Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1988 Oct 25;16(20):9443–9456. doi: 10.1093/nar/16.20.9443

5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

S Iwai 1, E Ohtsuka 1
PMCID: PMC338755  PMID: 3186438

Abstract

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.

Full text

PDF
9452

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Epstein L. M., Gall J. G. Self-cleaving transcripts of satellite DNA from the newt. Cell. 1987 Feb 13;48(3):535–543. doi: 10.1016/0092-8674(87)90204-2. [DOI] [PubMed] [Google Scholar]
  2. Hirao I., Ishikawa M., Miura K. Solid-phase synthesis of oligoribonucleotides. Nucleic Acids Symp Ser. 1985;(16):173–176. [PubMed] [Google Scholar]
  3. Iwai S., Yamada E., Asaka M., Hayase Y., Inoue H., Ohtsuka E. A new solid-phase synthesis of oligoribonucleotides by the phosphoro-p-anisidate method using tetrahydrofuranyl protection of 2'-hydroxyl groups. Nucleic Acids Res. 1987 May 11;15(9):3761–3772. doi: 10.1093/nar/15.9.3761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Jay E., Bambara R., Padmanabhan R., Wu R. DNA sequence analysis: a general, simple and rapid method for sequencing large oligodeoxyribonucleotide fragments by mapping. Nucleic Acids Res. 1974 Mar;1(3):331–353. doi: 10.1093/nar/1.3.331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Koizumi M., Iwai S., Ohtsuka E. Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers. FEBS Lett. 1988 Feb 15;228(2):228–230. doi: 10.1016/0014-5793(88)80004-8. [DOI] [PubMed] [Google Scholar]
  6. Miyoshi K., Huang T., Itakura K. Solid-phase synthesis of polynucleotides. III. Synthesis of polynucleotides with defined sequences by the block coupling phosphotriester method. Nucleic Acids Res. 1980 Nov 25;8(22):5491–5505. doi: 10.1093/nar/8.22.5491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Reese C. B., Skone P. A. Action of acid on oligoribonucleotide phosphotriester intermediates. Effect of released vicinal hydroxy functions. Nucleic Acids Res. 1985 Jul 25;13(14):5215–5231. doi: 10.1093/nar/13.14.5215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Silberklang M., Prochiantz A., Haenni A. L., Rajbhandary U. L. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977 Feb;72(3):465–478. doi: 10.1111/j.1432-1033.1977.tb11270.x. [DOI] [PubMed] [Google Scholar]
  9. Sinha N. D., Biernat J., McManus J., Köster H. Polymer support oligonucleotide synthesis XVIII: use of beta-cyanoethyl-N,N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplifying deprotection and isolation of the final product. Nucleic Acids Res. 1984 Jun 11;12(11):4539–4557. doi: 10.1093/nar/12.11.4539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Tanaka T., Tamatsukuri S., Ikehara M. Solid phase synthesis of oligoribonucleotides using o-nitrobenzyl protection of 2'-hydroxyl via a phosphite triester approach. Nucleic Acids Res. 1986 Aug 11;14(15):6265–6279. doi: 10.1093/nar/14.15.6265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Tanaka T., Tamatsukuri S., Ikehara M. Solid phase synthesis of oligoribonucleotides using the o-nitrobenzyl group for 2'-hydroxyl protection and H-phosphonate chemistry. Nucleic Acids Res. 1987 Sep 25;15(18):7235–7248. doi: 10.1093/nar/15.18.7235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Warshaw M. M., Tinoco I., Jr Optical properties of sixteen dinucleoside phosphates. J Mol Biol. 1966 Sep;20(1):29–38. doi: 10.1016/0022-2836(66)90115-x. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES