Skip to main content
Microbiology and Molecular Biology Reviews: MMBR logoLink to Microbiology and Molecular Biology Reviews: MMBR
. 2012 Sep;76(3):530–564. doi: 10.1128/MMBR.05020-11

DNA Repair and Genome Maintenance in Bacillus subtilis

Justin S Lenhart 1, Jeremy W Schroeder 1, Brian W Walsh 1, Lyle A Simmons 1,
PMCID: PMC3429619  PMID: 22933559

Abstract

Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis.

INTRODUCTION

All cells must accurately copy and maintain their DNA to ensure faithful transmission of their genetic material to the next generation. Organisms ranging from bacteria to humans contain a series of DNA repair pathways dedicated to the specific recognition and repair of the myriad of DNA damage or base-pairing errors that can occur throughout the lifetime of a cell. In mammals, it has been estimated that every cell is subject to >15,000 lesions per 24-h period (128, 212). Most of these lesions are hypothesized to arise from endogenous sources, such as reactive by-products of normal cellular metabolism (128). In higher eukaryotic systems, failures in DNA repair are often attributed to numerous disease states and/or cell death (e.g., see reference 128). In bacterial cells, DNA damage and mutation accumulation can reduce cell fitness and potentially affect viability (128, 131). Conversely, mutagenesis also provides the material for evolution, as base pair substitutions may confer a selective advantage to bacterial cells vulnerable to a changing environment (e.g., see reference 481). Therefore, transient increases in mutagenesis must be balanced carefully with high-fidelity repair to ensure genome preservation while providing the opportunity for genetic diversity (for reviews, see references 434 to 438). The conservation of DNA repair pathways from bacteria to humans is often very impressive; such conservation has allowed for experimentally tractable bacteria to provide important mechanistic insights into processes critical for genome maintenance in more complex systems (for a review, see reference 128). To date, the DNA repair and mutagenesis pathways in Escherichia coli are the best understood for a bacterial system, and this information has led to the identification of several founding members of DNA repair and damage tolerance superfamilies that show exquisite conservation across biology (e.g., see references 8, 78, 118, 119, 128, 231, and 296).

Efforts in genome sequencing and evolution have estimated that Gram-positive and Gram-negative bacteria diverged over a billion years ago (e.g., see references 67, 298, and 303). Such a long separation has allowed for many DNA repair processes in Gram-negative and Gram-positive bacteria to diverge, evolving substantial differences in both their molecular mechanisms and modes of regulation. Over the last decade, it has become increasingly clear that the DNA repair pathways of many Gram-positive bacteria can be different from those described for E. coli. In some cases, entire pathways exist in Gram-positive bacteria that are completely absent from the prototypical Gram-negative bacterium E. coli. Below, we review and discuss several pathways that are critical for genome maintenance in the Gram-positive bacterium Bacillus subtilis. We discuss many DNA repair, DNA damage tolerance, and DNA damage checkpoints that maintain genome integrity during vegetative growth and during the developmental program of sporulation. We also review the similarities of DNA repair and DNA replication pathways in several other bacteria, and we relate these findings to what is known for better-characterized bacterial systems.

THE SOS RESPONSE

The SOS response is a transcriptional circuit that is activated upon DNA damage, replication fork stress, and many other stresses that affect genome integrity (for a review, see references 128 and 385) (Fig. 1). The SOS response of E. coli has been very well characterized (for a review, see reference 385). RecA bound to single-stranded DNA (ssDNA) activates the response, whereas LexA, a transcriptional repressor, negatively regulates SOS induction. Following DNA damage from endogenous or exogenous sources, ssDNA is formed during repair or replication of damaged DNA templates. RecA binds ssDNA and polymerizes, forming a nucleoprotein filament which activates LexA for self-cleavage, inactivating LexA from binding to and repressing the transcription of genes under its control. In E. coli, ∼56 genes are repressed by LexA, and these genes comprise the SOS regulon (for a review, see reference 385) (Table 1).

Fig 1.

Fig 1

Model for activation of the SOS response in B. subtilis. (A) In this model, UV damage has created a cyclobutane pyrimidine dimer (CPD) in the leading strand template, creating a daughter strand gap after repriming and continued replication beyond the lesion. (B) SSB binds to the daughter strand gap, preserving the integrity of the DNA. (C) Recombinase mediator proteins RecF, RecO, and RecR, and possibly other accessory factors, stimulate RecA loading at the gap region as SSB is displaced from the site. (D) RecA forms a nucleoprotein filament on ssDNA. (E) The RecA-ssDNA nucleoprotein filament then interacts with LexA, activating its latent protease activity and resulting in autocleavage of LexA. Following autocleavage and inactivation of LexA, SOS gene transcription is activated, and a global transcriptional response is induced. (F) SOS-dependent changes in gene expression help B. subtilis to survive DNA damage by upregulating DNA repair proteins, preventing the bacterium from undergoing cell division, and finally increasing the regulatory products RecA and LexA to reset the system after repair is completed. (Adapted from reference 385.)

Table 1.

LexA-regulated genes in B. subtilis and E. colia

B. subtilis gene Function or description (reference) E. coli gene Function or description (reference)
aprX Alkaline serine protease, activity identified in culture medium (184) polB DNA polymerase involved in repair (325)
ybaK Predicted protein of 147 amino acids; conserved domain of unknown function (DUF2521) found in Bacillus hokE Killing protein showing similarity to plasmid toxins (305)
cwlD Germination, N-acetylmuramoyl-l-alanine amidase (cell wall hydrolase) (365) dinG DNA helicase with 5′-to-3′ polarity (431)
dinB Nuclease inhibitor of 172 amino acids; metal binding and conserved with mycothiol maleylpyruvate isomerase N-terminal domain ftsK Chromosome segregation after septation (104)
dltA d-Alanyl-d-alanine carrier protein ligase used for incorporation of alanine into lipoteichoic acid (162) dinI Functions to stabilize RecA-ssDNA filaments (432)
dltB Involved in lipoteichoic acid biosynthesis (162) yebG Putative 96-amino-acid protein of the YebG superfamily, described as DNA damage-inducible small proteins of unknown function
dltD Involved in lipoteichoic acid biosynthesis; possible carrier protein for d-alanine (162) sbmC Inhibitor of DNA gyrase (56)
dnaE DNA polymerase III (alpha subunit); essential protein involved in primer maturation on the lagging strand (99, 352) recN SMC-like protein involved in recombination (255)
lexA Transcriptional repressor of the SOS regulon (264) lexA Transcriptional repressor of SOS regulon (217)
pcrA Essential ATP-dependent DNA helicase, shows similarity to E. coli Rep and UvrD (307, 308) uvrD DNA helicase II, involved in NER and MMR (293)
ligA DNA ligase (183) molR Involved in molybdate transport (198)
yerH Predicted protein of 396 amino acids, similar to putative lipoproteins dinF Putative 459-amino-acid protein predicted to be a multidrug efflux transporter
recA Required for homologous recombination and SOS induction (230) recA Required for homologous recombination and SOS induction (83)
parE ATP-binding subunit of DNA topoisomerase IV (16) dinQ Predicted 228-amino-acid protein of the SpoU methylase superfamily involved in rRNA methylation
parC DNA binding and cleavage subunit of DNA topoisomerase IV (16) ysdAB Toxic protein with expression induced under stress conditions
ruvA DNA binding activity of the Holliday junction helicase RuvAB ruvA DNA binding activity of the Holliday junction helicase RuvAB (417, 418)
ruvB ATP binding protein, ATPase, and helicase motor for Holliday junction helicase RuvAB ruvB ATP binding protein, ATPase, and helicase motor for Holliday junction helicase RuvAB (417, 418)
queA S-Adenosylmethionine tRNA ribosyltransferase-isomerase (142) ydjM Predicted to be an inner membrane protein of unknown function
tgt Queuine tRNA-ribosyltransferase; also known as tRNA-guanine transglycosylase (326) dinS Similar to transposase; contains a helix-turn-helix motif and integrase core domain
tagC Putative polyglycerol phosphate involved in teichoic acid biosynthesis RmuC (yigN) Contains domains conserved with RmuC superfamily of DNA recombination proteins, and the N-terminal domain is conserved with SMC proteins; this protein is predicted to function as a nuclease
uvrA Excinuclease ABC (subunit A) uvrA Excinuclease ABC (subunit A)
uvrB Excinuclease ABC (subunit B) uvrB Excinuclease ABC (subunit B)
uvrC Excinuclease ABC (subunit C) ydjQ UvrC ortholog (272)
yolD SPβ prophage protein of unknown function; 110 amino acids ydfE Predicted 306-amino-acid protein of unknown function showing similarity to phage-encoded exonucleases
uvrX SPβ protein that shares similarity to UmuC and the Y family DNA polymerases (193) yjiW Predicted 132-amino-acid protein showing similarity to SymE toxin superfamily of endoribonucleases
xkdA PBSX prophage, shows similarity to yqaB from the skin element; contains H-E-X-X-H motif suggesting Zn2+-dependent peptidase activity borD Similar to prophage protein expressed during lysogeny
ydiO Putative DNA methyltransferase, cytosine-specific ybiN Adenine-N6-methyltransferase (366)
ydiP Putative DNA methyltransferase subunit, cytosine specific grxA Glutoredoxin; functions as a hydrogen donor for ribonucleotide reductase (316)
yhaN (sbcE) AAA+ SMC-like protein involved in recombination (189) yccF Predicted 148-amino-acid protein of unknown function showing similarity to domain of unknown function 307 (DUF307) for small putative membrane proteins
yhaM 3′-5′ exoribonuclease; contains a C-terminal ND domain found in metal-dependent phosphohydrolases (189) ymfD Predicted 221-amino-acid protein showing similarity to SAM-dependent methyltransferases
yhaZ Very similar to DNA alkylation repair COG4335 superfamily of proteins ymfE Predicted 234-amino-acid protein showing similarity to inner membrane proteins
yhjD Predicted 120-amino-acid protein of unknown function with no conserved domains identified lit Protease for EF-Tu (133)
yhjC Predicted 66-amino-acid protein similar to short bacterial proteins of unknown function intE Shows similarity to a prophage integrase
yjhB Similar to sodium, proline symporter; member of the sodium solute symporter superfamily ymfG Putative 78-amino-acid protein predicated to be an e14 prophage excisionase (328)
yneA DNA damage-dependent inhibitor of cell division (177, 268) sulA Inhibitor of cell division, blocks FtsZ polymerization (132)
yneB Putative serine recombinase superfamily member, shows similarity to transposases and resolvases ymfH Putative 103-amino-acid e14 prophage protein predicted to be membrane associated (328)
ynzC Predicted 77-amino-acid protein of unknown function; structure prediction suggests a nucleic acid binding domain; conserved among Firmicutes ymfI Putative 128-amino-acid protein of unknown function from e14 prophage
yokE Predicted 160-amino-acid protein of unknown function with no conserved domains identified ymfL Predicted 189-amino-acid protein hypothesized to be a transcriptional regulator for e14 prophage (328)
yokF Similar to staphylococcal nucleases ycgH Predicted 882-amino-acid protein showing similarity to a type V secretory outer membrane protein
yopT Member of the YopT superfamily of conserved hypothetical proteins expressed in B. subtilis ydeO Transcriptional activator important for acid resistance (44)
yopU Predicted 65-amino-acid protein of unknown function with no conserved domains ydeS Putative 176-amino-acid protein of the fimbrial superfamily
yopV Predicted 64-amino-acid protein of unknown function with no conserved domains ydeT Putative 382-amino-acid protein with domains conserved with chaperone usher of type VII secretion system and a PapC C-terminal domain involved in pilus assembly
yopW Predicted 111-amino-acid protein of unknown function with no conserved domains ydeR Putative 167-amino-acid protein predicted to function in fimbrial adhesion
yopX Member of the YopX superfamily, a group of conserved largely α-helical proteins of unknown function; predicted to form a 12-chain α-helical structure arpB Putative 632-amino-acid protein of the toxin 15 superfamily of enterotoxins
yopY Predicted 92-amino-acid protein of unknown function with no conserved domains identified yoaB Putative protein of 114 amino acids sharing similarity to endoribonucleases involved in the inhibition of translation
yopZ Predicted 67-amino-acid protein of unknown function with no conserved domains identified ogrK P2 phage transcriptional regulator
yoqA Predicted 116-amino-acid protein of unknown function with no conserved domains identified yqgC Predicted 71-amino-acid protein of unknown function with no conserved domains identified
yoqB Predicted 112-amino-acid protein of unknown function with no conserved domains identified yqgD Predicted 83-amino-acid protein with the domain of unknown function DUF2683
yoqC Predicted 135-amino-acid protein of unknown function with no conserved domains identified yhiJ Predicted 540-amino-acid protein with the domain of unknown function DUF4049
yoqH Predicted 150-amino-acid protein of unknown function with no conserved domains identified yhiL Predicted 412-amino-acid protein with the domain of unknown function DUF4049
yoqI Predicted 64-amino-acid protein of unknown function with no conserved domains identified glvB Phosphotransferase system arbutin-like IIB protein (459)
yoqJ Putative 171-amino-acid protein in DUF1273 superfamily of conserved bacterial proteins of unknown function with approximately 180 residues ibpB Heat-inducible chaperone (247)
yoqK Predicted 67-amino-acid protein of unknown function with no conserved domains identified ibpA Heat-inducible chaperone (247)
yoqL SPβ phage protein conserved with the α subunit of DNA polymerase III (DnaE) yifL Putative 228-amino-acid protein showing similarity to SpoU rRNA methyltransferases
yorB SPβ 98-amino-acid protein of unknown function with no conserved domains identified
yorC SPβ 126-amino-acid protein of unknown function with no conserved domains identified
yorD SPβ 104-amino-acid protein of unknown function with no conserved domains identified
yorE SPβ 123-amino-acid protein of unknown function with no conserved domains identified
yorF SPβ 304-amino-acid protein of unknown function with no conserved domains identified
yorH SPβ 156-amino-acid protein of unknown function with no conserved domains identified
yorI SPβ protein similar to replicative DNA helicase of the DnaB family
yozL Predicted 97-amino-acid protein of the YolD superfamily of unknown proteins, functionally predicted to be UmuD of E. coli DNA polymerase V
yozK Conserved with Y family DNA polymerases, in particular with UmuC and Pol Kappa
yqjH PolY2, similar to E. coliDinB (403) dinB Y family DNA polymerase (37, 45, 254)
yqjW PolY1, similar to E. coliUmuC (403) umuCD Y family DNA polymerase (327, 409)
yqjX 112-amino-acid protein of the YolD superfamily of unknown proteins, functionally predicted to be UmuD of E. coli DNA polymerase V
yqjY Similar to N-acetyltransferases, contains a coenzyme A binding pocket
yqjZ Member of the ABM superfamily, consisting of uncharacterized proteins involved in production of extracellular polysaccharides
a

The table was generated based on data from references 10, 138, and 385). For genes of unknown function, we performed a BLAST search through NCBI to identify and report conserved domains and possible functions found based on homology (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Genes that are shown in bold denote shared homologs or functional analogs between E. coli and B. subtilis.

A responsive gene expression system in B. subtilis was suggested when it was found that lysogenic strains had reduced DNA transformation when grown to the competent state for DNA transformation (469). It was proposed that prophage expression was induced in competent cells by a process analogous to the E. coli SOS response (464, 465). It should be noted that prophages and several other genetic elements are often induced by DNA damage, because RecA-ssDNA will often inactivate a transcriptional repressor or, in some cases, LexA can directly repress expression of some prophage genes (41, 116, 117, 218, 320, 321). Some of the first direct evidence showing that a DNA damage-inducible system was present in B. subtilis came from experiments using random promoterless lacZ insertions into the B. subtilis chromosome to determine if DNA damage resulted in increased expression of damage-inducible (din) genes (134, 224, 226, 227, 468). Fifteen genes were identified as din genes, demonstrating that DNA damage caused by UV, mitomycin C, and ethyl methanesulfonate (EMS) resulted in an increase in gene expression (224). These observations showed the presence of an SOS-like system in B. subtilis. It should be noted that the SOS system of B. subtilis was first defined as SOB, for SOS-like system of B. subtilis, because it differed from the SOS response in E. coli (for a review, see reference 466).

The major differences between the SOS-like system of B. subtilis and the SOS system of E. coli are in the phenotypes that result from W reactivation. W reactivation is a phenomenon where phages treated with DNA damage show increased survival when the host also experiences DNA damage (464). It was noticed that W reactivation in B. subtilis was specific for repair of pyrimidine dimers, W reactivation can function for an extended number of generations, and the rate of mutagenesis is low. It was also noticed that a DNA methylase encoded by the prophage SPβ was induced (291, 467). These four factors differ from the E. coli system, and primarily for these reasons, the SOS system of B. subtilis has been referred to as SOB (for a review, see reference 466). For simplicity, we refer to the response as the SOS response, because the regulation of SOS in B. subtilis is basically the same as that in E. coli and many other recA- and lexA-containing bacteria. The major differences between bacterial systems are in the gene products that are under LexA control, which show substantial variation from organism to organism (Table 1).

In B. subtilis, the highly conserved RecA and LexA (also known as DinR) proteins are central to regulation of the SOS transcriptional response (65, 399, 451, 452, 468) (Fig. 1). RecA (also known as RecE) is a multifunctional protein required for homologous recombination, and RecA positively regulates the SOS response as it does in E. coli (10, 139, 178, 227, 230, 242). RecA in complex with ssDNA forms a nucleoprotein filament required to stimulate self-cleavage of LexA, the transcriptional repressor of the SOS regulon (143, 228). LexA represses the expression of 63 genes in 26 operons by binding to their promoters and preventing their transcription (10, 139) (Table 1). The LexA consensus binding sequence has been determined for B. subtilis and several other bacteria (Table 2). Many of the LexA-regulated genes function in some aspect of DNA repair, DNA replication, or the inhibition of cell division (10, 139) (Table 1). LexA also directly represses genes in two prophages, i.e., SPβ and PBSX (139) (Table 1). It should be noted that approximately 25% of the RecA-regulated genes in B. subtilis are of unknown function (10, 139). Strikingly, in our estimation, only 10 of the genes induced in B. subtilis are homologous or analogous to LexA-regulated genes in E. coli (10, 139) (Table 1). Thus, although the regulatory mechanism controlling the SOS pathway is conserved between B. subtilis and E. coli, ∼85% of the genes comprising the SOS regulon in B. subtilis appear distinct from those in the E. coli SOS regulon (10, 139) (Table 1). In addition to its participation in the SOS response, RecA is also responsible for the DNA damage-dependent alteration in gene expression of nearly 600 other genes in B. subtilis (139). Virtually all of these genes are encoded by phages or integrative conjugative elements that are directly or indirectly regulated by RecA bound to ssDNA. The reason that these genes are not considered part of the SOS regulon is that although their expression is regulated by RecA, these genes are not known to be repressed directly by LexA (32, 139).

Table 2.

SOS boxes of Gram-positive bacteria compared with that of E. coli

Organism SOS box consensus sequencea Reference
Escherichia coli CTGT-(AT)4-ACAG 205
Bacillus subtilis CGAAC-RNRY-GTTYC 451
Staphylococcus aureus CGAAC-AAAT-GTTCG 69
Listeria monocytogenes AATAAGAACATATGTTCGTTT 425
Cornyebacterium glutamicum TCGAA(A/C)ANNTGTTCGA 169
a

These and other Gram-positive SOS boxes can be found in reference 451. R, purine; Y, pyrimidine.

It is known that SOS induction is important for E. coli cells to survive exogenous DNA damage (e.g., see references 354 and 453). A comparison of the percentage of cells induced to respond through the SOS system following challenge with ionizing radiation between E. coli and B. subtilis showed that E. coli has a much lower DNA damage threshold to elicit SOS induction (386). In addition, the study showed that a site-specific double-strand break (DSB) in B. subtilis, generated by the homing endonuclease I-SceI, elicited SOS induction in fewer than 5% of cells (386). Moreover, in the absence of SOS induction, B. subtilis is capable of surviving a higher dose of ionizing radiation than that tolerated by E. coli, suggesting that DNA repair in the absence of SOS induction may be more efficient than that in E. coli (386). An alternate approach used tetO arrays to block replication fork progression in B. subtilis in order to induce and subsequently measure the response to replication fork arrest (23). That study found that the SOS response in B. subtilis was not readily induced by a protein block to replication fork progression (23). Taking both of these studies into consideration, it seems that B. subtilis can efficiently repair DNA damage or tolerate perturbations to replication forks in a way that does not readily induce the SOS transcriptional response. In support of this idea, cells incapable of SOS induction due to integration of a noncleavable lexA variant were shown to survive a considerable amount of DNA damage, suggesting efficient repair in the absence of triggering the SOS response (386).

SOS Responses in other Gram-Positive Bacteria

The SOS response has been investigated in several pathogenic and nonpathogenic Gram-positive organisms. The opportunistic human pathogen Staphylococcus aureus contains the lexA and recA genes (18, 27, 163). As expected, antibiotics that damage DNA, such as fluoroquinolones (inhibitors of DNA gyrase), induced the SOS response when administered at subinhibitory concentrations (259). The genome-wide SOS response of S. aureus to ciprofloxacin, a fluoroquinolone which induces DSBs and stalls replication forks, was determined using microarrays (69). In that study, the responses of wild-type and noncleavable lexA-bearing S. aureus strains to ciprofloxacin were compared (69). Sixteen genes were identified as under LexA control (69). This number is small relative to the number of genes under SOS control in B. subtilis (10, 139). The genes that were identified as upregulated included recA and lexA, genes involved in nucleotide excision repair (NER) (uvrA and uvrB), topoisomerase IV genes (parE and parC), and nuclease genes (sbcC and sbcD) (69). The binding of S. aureus LexA to the promoter of recA has been demonstrated (27), and this result is consistent with the mode of recA regulation in other systems (for a review, see reference 385). Interestingly, fibronectin binding proteins produced by S. aureus to aid in its attachment to the extracellular matrix and the plasma membrane are induced by fluoroquinolones (27), and the promoter for the fibronectin binding protein B gene (fnbB) is bound by LexA. This suggests that DNA damage may affect the ability of S. aureus to form clumps or attach to surfaces, a feature important during infection (27).

Listeria monocytogenes also contains the lexA and recA genes (113, 425). Challenge of Listeria with the DNA damaging agent mitomycin C resulted in the identification of 29 genes induced from 16 operons (425). Of these genes, most are involved in DNA repair, regulation of cytokinesis, and translesion synthesis (425). In addition to these studies, the SOS regulon has also been investigated in other Gram-positive bacteria. The SOS responses in many other Gram-positive bacteria are also regulated by RecA and LexA, as expected (169, 288). Overall, the number of genes and functions of genes controlled by this response differ considerably from organism to organism. With that stated, the recA gene, the lexA gene, and a gene product important for inhibiting cell division are consistently found to be under LexA control.

HOMOLOGOUS RECOMBINATION

Homologous recombination is central to DNA repair and the integration of DNA following genetic transformation (for a review, see references 108, 109, and 394). The homologous recombination pathway in B. subtilis has been reviewed in greater detail elsewhere (e.g., see references 11, 347, and 348). Here we focus on an overview of the pathway, with an emphasis on the cell biology of homologous recombination. We also highlight the similarities and differences in the homologous recombination pathways of B. subtilis and the better-understood Gram-negative model E. coli. In general terms, the steps of homologous recombination are conserved throughout biology. The conserved steps during DSB repair are (i) recognition and processing of a double-stranded end; (ii) loading of a recombinase such as RecA or Rad51 onto ssDNA; (iii) pairing of ssDNA with an intact homologous DNA segment, forming a crossover junction; (iv) DNA synthesis using the 3′-OH of the invading strand; and (v) endonucleolytic resolution of the crossover junction, resulting in the formation of two intact daughter chromosomes (for a review, see reference 128) (Fig. 2). These general steps in B. subtilis are the same as the steps in other organisms; it is the protein assemblies required to perform each step that differ between organisms.

Fig 2.

Fig 2

Model for repair of a single double-strand break by homologous recombination in B. subtilis. (A) Active replication fork with a single-strand nick in the leading strand template. (B) Upon the fork encountering the lesion, a DSB is produced and the replication fork collapses. (C) The double-stranded end is processed by the AddAB helicase-nuclease complex, or perhaps by RecQ or RecS helicase in combination with RecJ. In this case, AddAB degrades both the 5′ and 3′ ends until it reaches a Chi site, stimulating formation of a 3′-ssDNA tail. (D) The recombinase mediator complex RecFOR is recruited to load the recombinase RecA onto the ssDNA region. This reaction produces a ssDNA-RecA nucleoprotein filament. (E) The RecA-ssDNA filament forms a D loop, where one strand of the template DNA is displaced by the RecA-ssDNA nucleoprotein filament. (F) The 3′ end of the filament is then extended by DNA polymerase by use of the homologous strand as a template for DNA synthesis. The RecG protein or the RuvAB complex can facilitate migration of the D loop. (G) After the damaged strand is sufficiently extended, the Holliday junction is cleaved by RecU or possibly RecV (the dashed line indicates strand nicking). (H) PriA-facilitated replication restart reconstitutes replication of the lagging strand. (Adapted from reference 154 with permission from Elsevier.)

Cross-Link Repair

Mitomycin C is a reagent that is commonly used to damage DNA and view the organization of repair proteins fused to fluorescent proteins into foci (e.g., see references 180, 245, and 387). Before we discuss the localization of recombination proteins in this section, we discuss mitomycin C as a DNA damaging agent and the mechanism of cross-link repair, based on repair of psoralen adducts. Mitomycin C forms a mono-adduct preferentially at the N2 or N7 position of guanine, as well as interstrand cross-links (for a review, see reference 107). The mono-adduct comprises ∼87 to 88% of the lesions, whereas the cross-link represents the minor lesion that forms when mitomycin C is assayed in chick embryos (442). Interstrand cross-link repair in E. coli is best understood by experiments examining repair of psoralen adducts. Repair of a psoralen interstrand cross-link requires NER to generate a nick in a single strand both 5′and 3′ of the cross-link. NER action generates an intermediate in which the dually nicked strand remains cross-linked to the other strand (389). DNA polymerase I (Pol I) in E. coli generates a gap in the nicked strand, providing a substrate for homologous recombination to pair the gapped region with a homologous DNA sequence, generating a three-stranded intermediate (389). Following endonucleolytic resolution of the resulting Holliday junction, the other strand is subject to NER, releasing a cross-linked double-stranded DNA (dsDNA) fragment (389; for a review, see reference 107). The major requirement for RecA and other recombination proteins is in formation and resolution of the three-stranded intermediate. In E. coli, a DSB can form following mitomycin C challenge, most likely by a mechanism where the replication fork encounters a gap in the DNA following processing of the lesion by NER and Pol I. When DSBs form in E. coli, this type of lesion represents a minor outcome of mitomycin C challenge relative to the mono-adduct (for a review, see reference 107).

RecN

A single, unrepaired DSB is lethal (e.g., see references 127 and 215), and thus efficient identification and repair are critical for ensuring genome preservation. RecN is hypothesized to respond early following DSB formation in B. subtilis (180, 350).

RecN is a conserved bacterial recombination protein that is a member of the SMC family of proteins (structural maintenance of chromosomes) (for a review, see reference 141). SMC-like proteins are best known for their role in chromosome partitioning and DNA compaction in organisms ranging from bacteria to humans (e.g., see references 36, 144, and 400; for a review, see reference 285). The eukaryotic protein Rad50 is a member of the SMC family and is part of the MRE11-Rad50-NBS1 (MRN) repair complex in humans, which associates with and stabilizes DNA ends at a DSB (68, 266).

Following treatment of cells with the DNA damaging agent mitomycin C, a functional fusion of RecN to green fluorescent protein (GFP) localizes and forms foci within the first 20 min after mitomycin C challenge (180). RecN-yellow fluorescent protein (RecN-YFP) focus formation is independent of RecA or DNA replication, further suggesting that RecN operates early following mitomycin C challenge and adduct formation (189). In support of a role for RecN in DSB repair, fully functional RecN-GFP was shown to form foci in response to an HO endonuclease-generated DSB (179). Consistent with an early role for RecN in repair is the observation that the recN gene in B. subtilis is not regulated by the SOS response, suggesting that this protein may be present at sufficient levels to efficiently respond to cross-linked adducts or DSBs that form in vivo (10). Interestingly, when X-ray challenge was used as a source to generate base damage sites, single-strand breaks, and DSBs, RecN-YFP focus formation was independent of the DNA damage dose, meaning that typically one RecN-YFP focus was observed per cell, regardless of the number of DSBs hypothesized to exist following X-ray treatment (180). This result suggests that RecN establishes a “repair center” where multiple DSBs might undergo repair in one large complex (180). Such a complex would be analogous to the DSB repair complexes in eukaryotic systems, where it has been shown that multiple breaks converge to form a single repair center (e.g., see references 9 and 215). Consistent with the cytological results indicating that RecN functions as a repair platform, biochemical characterization showed that RecN can form large oligomeric complexes in the presence or absence of DNA (345, 346). Considering the in vitro and in vivo results together, the current model is that B. subtilis RecN is capable of gathering multiple breaks into a complex prior to the arrival of other proteins involved in repair. In evaluating the “DNA repair center” model, it has yet to be demonstrated that multiple DNA ends originating from numerous DSBs are indeed present in a single RecN focus. Additionally, the signaling mechanism that directs RecN in response to a DSB has not been identified, and it will be interesting to uncover the mechanism that recruits RecN to a DSB(s) and to mitomycin C-generated lesions in vivo. Although RecN is important for DNA repair, cells can survive a site-specific I-SceI endonuclease-generated DSB in the absence of RecN, showing that RecN is not obligatory for DSB repair in B. subtilis (189).

In addition to a role for RecN in DSB repair, cells disrupted in recN are sensitive to several alkylating agents. The study of recN-disrupted strains has shown increased sensitivity to DNA damaging agents, including the alkylating agent methyl methansulfonate (MMS) and 4-nitroquinoline-1-oxide (4NQO), as well as a reduction in the transformation of chromosomal DNA (3, 180). Thus, the absence of recN has an effect on DNA repair and the integration of DNA during genetic transformation. However, recN-deficient strains are not nearly as sensitive to a DSB as recA-deficient strains, and furthermore, RecA-GFP foci are capable of forming in the absence of recN, as determined following mitomycin C challenge (3, 179). These results show that RecA function is not dependent on the presence of recN (3, 179). Taken together, the data show that RecN contributes to homologous recombination and appears to function early in the pathway of DSB repair in B. subtilis.

End Processing by AddAB

After a DSB is identified, the ends are processed, marking them for repair. In bacterial systems, the two enzyme classes responsible for this task are the helicase-nuclease complexes RecBCD and AddAB (for a review, see reference 471). During repair of a double-stranded end, the DNA is unwound and simultaneously digested by a nuclease, eventually generating a 3′-ssDNA overhang, which once loaded with RecA forms a nucleoprotein filament capable of undergoing strand exchange in the next step of homologous recombination (for a review, see reference 81) (Fig. 2). In E. coli, the major complex required for double-stranded end processing is the RecBCD helicase-nuclease complex (for a review, see reference 100). Briefly, RecBCD contains two helicase motors, RecB and RecD, with opposite polarities (29, 101, 410). The unwound ssDNA segments are then cleaved by the single RecB nuclease (388, 474, 475). The RecB nuclease is required for cleavage of both strands (388). Cleavage of the 3′ strand is more processive because the 3′ strand is channeled closer to the active site of RecB. Cleavage of the 5′ strand is less frequent, as movement of the 5′ strand is further away from the active site, making cleavage of the 5′ strand less efficient (388). The RecC protein contains a “pin” functioning to efficiently separate the duplex DNA (388). Cleavage of the 3′ strand is attenuated when the Chi sequence (crossover hot spot instigator) (5′-GCTGGTGG-3′) is encountered and bound by RecC, while cleavage of the 5′ strand continues. This overall mechanism allows for degradation of both strands until a Chi sequence is encountered, generating a 3′ overhang, a substrate appropriate for RecA binding.

B. subtilis lacks RecBCD, so the analogous functioning complex is AddAB, which performs the same overall reaction, although the mechanisms and organization of the protein complex are different (for a review, see reference 471). The AddAB complex engages in DSB end processing and is highly conserved among the Firmicutes (84, 148151, 185, 257). Deletion or inactivation of the addA or addB gene causes substantial defects in DSB repair and increases the sensitivity of B. subtilis to a wide spectrum of DNA damaging agents (3).

AddA is both a helicase and an endonuclease. The N terminus of AddA is an SF1A family helicase, and the C-terminal domain is a RecB-type nuclease, which cuts the 3′-5′ strand (319, 338, 470). AddB does not have helicase activity; the C terminus of AddB forms a RecB-like nuclease domain which cleaves the 5′-3′ strand (319, 470). An Fe-S cluster is present in AddB, and this region has been shown to bind DNA in the crystal structure and to stabilize the protein structure (338). AddAB initiates end processing by binding to a double-stranded end, followed by processive unwinding and cleavage of both DNA strands (58; for a review, see reference 471). Degradation of both strands continues until a Chi site is encountered (5861). Chi sites in B. subtilis have the short sequence 5′-AGCGG-3′ and are enriched in the chromosome (61). Chi sites are also found to generally coorient with the leading strand of replication (61). When AddAB encounters Chi, much like E. coli RecBCD, its nuclease activity is altered, allowing for continued unwinding and degradation of the 5′ strand downstream of Chi while interrupting the degradation of the 3′ strand downstream of Chi (59). The attenuation in nuclease activity on the 3′ strand produces a 3′-ssDNA segment that is appropriate for RecA binding (45, 46). As mentioned above, AddB is a nuclease, and the N-terminal portion of the protein shows similarity to DNA helicases, although AddB lacks the motifs required for helicase activity (338). Recent structural work has shown that the Chi sequence binds to the Chi recognition site in AddB. This binding event prevents degradation of the 3′ strand by AddAB as it is channeled through the AddAB complex (338).

Stoichiometric analysis of the AddAB complex shows that AddAB is active in vitro as a 1:1 heterodimer (472). The heterodimer has numerous activities, including the ability to bind a dsDNA end and to catalyze unwinding of duplex DNA (471). AddAB also has two genetically separable nuclease activities (470). As mentioned above, the AddAB helicase activity is conferred by the AddA subunit and has 3′-to-5′ polarity (472, 473). Inactivation of the ATP binding site (Walker A motif) in AddB has very little effect on the helicase activity of the AddAB complex, further demonstrating that AddA powers the helicase activity of AddAB (149151). Unlike RecBCD, which contains two helicase activities and a single nuclease, AddAB has two nucleases that reside separately in its individual subunits, as well as a single helicase (for a review, see reference 471). In B. subtilis and many Gram-positive bacteria, the AddAB complex is responsible primarily for end processing during DSB repair.

RecQ, RecS, and RecJ

DNA helicases of the RecQ family are well conserved and present throughout biology (for a review, see reference 455). Humans have five RecQ helicases, and deficiencies in three have been linked to syndromes featuring a predisposition to cancer (for a review, see reference 331). Individuals with a deficiency in WRN, encoding a RecQ helicase, are predisposed to developing Werner's syndrome, which is characterized by a premature aging phenotype and increased incidence of mesenchymal tumor formation (for a review, see references 175 and 455). Interestingly, E. coli and yeast (Saccharomyces cerevisiae and Schizosaccharomyces pombe) both contain a single RecQ helicase homolog, as opposed to the multiple RecQ helicases found in higher eukaryotic organisms. In contrast, B. subtilis encodes two recently discovered RecQ helicase homologs, known as RecQ and RecS (350). Gene annotations for RecQ and RecS are different depending on the source of information. RecQ is encoded by an open reading frame named either recQ or yocI, whereas RecS is encoded by an open reading frame named either recQ or ypbC, again depending on the source used (77, 350). B. subtilis RecQ shares the closest sequence homology to human WRN and E. coli RecQ, as it contains the highly conserved helicase domain, the RecQ helicase conserved region (RecQ-Ct), and the helicase and RNase D C-terminal domains (HRDC) (Fig. 3). However, WRN contains an RNase D 3′-to-5′ exonuclease domain (281) which is absent from B. subtilis RecQ and RecS, E. coli RecQ, and S. cerevisiae Sgs1 (281, 284).

Fig 3.

Fig 3

Schematic representation of the domain structure of B. subtilis DNA helicases RecQ and RecS in comparison with human WRN. The N-terminal region contains the helicase motifs (light blue); the RecQ helicase conserved region (RecQ-Ct) (dark blue/purple) and the helicase and RNase D C-terminal domains (HRDC) (red) are also shown. The human protein contains the RNase D domain N-terminal region, which contains a 3′-to-5′ exonuclease domain. (Adapted from references 24 with permission of Oxford University Press, 281 with permission from Elsevier, and 284 with permission from Macmillan Publishers Ltd.)

Recent evidence suggests that RecQ and possibly RecS can function in combination with the exonuclease RecJ in repair (350). Cells deficient in recQ or recS show almost no sensitivity to DNA damaging agents (350), but cells deficient in addAB in combination with recJ show a synergistic loss of survival, and the sensitivity of the resulting strain to alkylating agents (MMS and 4NQO) and the damaging agent mitomycin C is similar to that of a recA null mutant (350). Thus, in the absence of both addAB and recJ, the phenotype is the same as that of a strain lacking recA. Analysis of RecN-YFP localization in the absence of addAB and recJ showed that RecN-YFP foci still form in response to DNA damage, yet RecN-YFP is impaired in forming a single large focus and instead forms multiple small foci (350). These results have been used to conclude that end processing is required for the establishment of a single large RecN-YFP complex, with the caveat that alkylating agents were used and a DSB was not directly tested (350). Together, these data also support the model that RecN complexes form in vivo prior to action by AddAB or RecQ-RecS-RecJ, further supporting a role for RecN early in DNA repair.

Recent work showed that the SSB protein targets several proteins, including RecQ, RecS, and RecJ, to the replication fork (77). Proteomic analysis of the interactome of SSB revealed numerous DNA repair proteins that bind SSB in vivo, including but not limited to RecQ, RecS, and RecJ (77) (see Table 3 for a complete list). When YFP-RecQ was expressed ectopically with the native recQ gene intact, YFP-RecQ was shown to form foci that colocalized with the replisome (DnaX-cyan fluorescent protein [DnaX-CFP]) in untreated cells (197). This suggests that RecQ is constitutively associated with the DNA replication machinery and that replisome association is mediated by interaction with SSB. Strikingly, a C-terminal truncation of ssb (ssbΔ35) which reduces RecQ binding in vitro blocks GFP-RecQ focus formation in vivo, indicating that the C terminus of SSB may recruit RecQ to replication forks in B. subtilis (197). This observation is supported by results showing that the SSB-RecQ interaction is conserved in E. coli and that the SSB C terminus is required for their interaction (374).

Table 3.

Summary of SSB-interacting partners in E. coli and B. subtilisa

E. coli protein B. subtilis protein Function
Chi (holC) (+) Absent Pol III subunit
Pol II (polB) (+) Absent Repair DNA polymerase
Pol V (umuC) (+) PolY1/YqjW (*) Translesion DNA polymerase
Exo I (sbcB) (+) Absent 3′-to-5′ exonuclease involved in MMR
Exo IX (xni) (+) Absent 3′-to-5′ exonuclease and 3′ phosphodiesterase (372)
Primase (DnaG) (+) DnaG (*) Primase
PriA (+) PriA (+) Primosome assembly and DNA helicase
PriB (+) Absent Involved in primosome assembly
RecG (+) RecG (+) Repair helicase
RecJ (+) RecJ (+) 5′-to-3′ exonuclease
RecO (+) RecO (+) RecA loading
RecQ (recQ) (+) RecQ (yocI) (+) 3′-to-5′ DNA helicase
Topo III (topB) (+) Topo III (topB) (*) Type 1A topoisomerase
Ung (+) Ung (+) Uracil DNA glycosylase
DnaE (*) DnaE (+) Primer maturation in B. subtilis, catalytic replicative DNA polymerase in E. coli
Absent YrrC (+) Similar to E. coli RecD, the alpha subunit of exonuclease V; has a role in mismatch repair in Bacillus anthracis (462)
XseA (*) XseA (+) Large subunit of exonuclease VII
Absent YpbB/RecS (recQ) (+) RecS is a RecQ family DNA helicase, and YpbB is unknown and shows homology to RecQ-like ATP-dependent helicases
SbcC (*) SbcC (yirY) (+) RecN-like protein involved in recombination and DNA repair
RarA (mgsA) (*) RarA (mgsA) (+) RecA loading and chromosome partitioning
a

This table was assembled using data from references 77, 374, and 375. (*), the protein is present in both E. coli and B. subtilis but has not been shown to interact with SSB; (+), an interaction between the indicated protein and SSB has been measured.

Ectopic expression of GFP-RecJ with the native recJ locus intact also showed that GFP-RecJ formed foci in vivo (77). Focus formation by GFP-RecJ under these conditions occurred in the absence of exogenous DNA damage, suggesting that like RecQ, RecJ may also routinely be positioned at active replication forks in B. subtilis. GFP-RecJ formed one or two foci per nucleoid, at a subcellular position similar to where the replisome would be expected to localize (77). It is worth noting that when visualized in vivo, functional AddA-GFP and AddB-YFP localized diffusely throughout B. subtilis cells and failed to organize into discrete foci in cells that were exposed to DNA damaging agents (245). Together, these results suggest that RecQ-GFP and RecJ-GFP could be positioned at the replisome, whereas AddAB does not appear to be located at the replisome as judged by fluorescence microscopy. These results suggest that the RecQ/RecJ functions could be localized to the site of DNA replication in B. subtilis through interaction with SSB (77).

RecS was also shown to bind B. subtilis SSB in vitro, and SSB bearing a tandem affinity purification (TAP) tag was purified from extracts with RecS associated (77). In the reciprocal experiment, TAP tag purification of RecS showed interaction with SSB but also with an unannotated protein, YpbB (77). Interestingly, RecS is cotranslated with YpbB, as the two genes slightly overlap (77). When gfp-ypbB-recS was expressed ectopically, the complex formed foci, but only if the SSB C terminus was intact (77). When GFP-YpbB or GFP-RecS was imaged, foci were not observed, suggesting that RecS and YpbB function together. Thus, the C terminus of SSB in B. subtilis is critical for DNA repair and recruitment of RecQ, RecS, and RecJ to the replication fork in vivo. SSB is gaining considerable attention as a protein that facilitates trafficking of replication and repair proteins to the replication fork and other ssDNA substrates in B. subtilis and E. coli (77, 197, 374, 375). The proteins that bind SSB in B. subtilis and E. coli show some overlap. However, many SSB binding partners are not shared between the two organisms (Table 2).

RecA Recruitment, Loading, and Coupling to DNA Synthesis

Processing of DNA ends, predominantly by AddAB and perhaps by RecQ-RecJ or RecS-RecJ, will result in a 3′-ssDNA suitable for RecA binding (Fig. 2 and 4). As mentioned above, B. subtilis also contains SSB (also termed SsbA), which is essential for DNA replication and critical for repair processes during exponential-phase growth (183). Unlike E. coli, B. subtilis contains a second SSB paralog, designated SsbB, encoded by the ywpH gene (213). YwpH is upregulated during the development of genetic competence and is critical for DNA transformation (213). SSB-coated ssDNA inhibits RecA filament formation (31, 187, 195, 423). At the same time, SSB can promote RecA binding by removing secondary structure from the DNA, ultimately providing a more suitable substrate for RecA filament formation (187). Even so, RecA must replace SSB on ssDNA in order to form the RecA-ssDNA nucleoprotein filament that mediates strand exchange (422). The mechanisms for RecA loading are well established for E. coli yet poorly understood for many other bacteria. In E. coli, RecBCD and the RecFOR pathways can each function in RecA loading (153, 201, 412, 422, 423). Once E. coli RecBCD produces a 3′-ssDNA end, RecBCD actively begins to load RecA onto ssDNA in the 5′-3′ direction, while displacing SSB (83). The RecFOR pathway functions primarily in the repair of daughter strand gaps, as well as in protection of the nascent strand following replication fork arrest in response to UV damage (66).

Fig 4.

Fig 4

Model for double Holliday junction formation during homologous recombination and repair of DSBs in B. subtilis. (A) Ionizing radiation or an I-SceI endonuclease creates a DSB in the B. subtilis chromosome. (B) The ends of the DSB are processed by the AddAB helicase-nuclease complex, or perhaps by RecQ or RecS in combination with RecJ. AddAB degrades both the 5′ and 3′ ends until it encounters a Chi site (5′-AGCGG-3′), where 3′-5′ degradation is attenuated, whereas degradation of the 5′-3′ strand continues. This produces a 3′-ssDNA strand on both sides of the DSB, which is bound by SSB. (C) The recombinase mediator complex RecFOR is recruited and functions to load RecA, generating a 3′-ssDNA–RecA nucleoprotein filament. (D) One of the filaments undergoes a homology search and pairs with a template. This produces a displacement loop (D loop) where one strand of the template DNA is displaced by the RecA filament during pairing. One advantage of D loop formation is that the displaced strand can anneal to the other processed DNA, providing a template for its replication. (E) The 3′ ends of both invading strands are then extended by DNA polymerase, using the homologous strand as a template for DNA synthesis. The RecG protein or the RuvAB complex facilitates migration of the D loop, extending the degree of strand exchange. (G) Endonuclease resolution of the double Holliday junctions is facilitated by RecU or RecV, and depending on the location of the cut site, different exchanges between the two strands will be generated. (H) If the Holliday junctions are cleaved at the black dashed line, a gene conversion results in which the flanking sequences are the same as before. (I) If the Holliday junctions are cleaved at the blue dashed line, the downstream sequence flanking the site of damage is exchanged between the two strands. (Adapted from reference 154 with permission from Elsevier.)

In B. subtilis, AddAB is not known to load RecA, whereas the RecFOR complex, specifically RecO, does have a RecA loading function (for a review, see references 11, 347, and 348). Mutations in recF, recO, or recR strongly sensitize B. subtilis to DNA damaging agents (MMS, EMS, and 4NQO), which primarily form daughter strand gaps (3, 4, 121). Mutations in recF, recO, and recR also decrease the transformation of B. subtilis with chromosomal DNA, providing more direct evidence that these proteins function in recombination of ssDNA entering the cell (3, 4, 121). It is not entirely clear if B. subtilis RecFOR functions in repair of a double-stranded end (DSE), which would be formed by ionizing radiation or through an I-SceI-induced break in the chromosome. If it does, one possibility is that RecFOR may help to load RecA onto the 3′-ssDNA tail generated following end processing by AddAB.

A critical actor in the RecFOR complex is the RecO protein. The domain organization and structure of the E. coli and Deinococcus radiodurans RecO proteins are very similar (201, 232, 337). Based on homology, B. subtilis RecO has a similar overall domain organization, particularly to that of D. radiodurans RecO (201, 232, 337). The N-terminal domain is an oligonucleotide/oligosaccharide binding fold (OB fold) characteristic of proteins that bind ssDNA and/or dsDNA. RecO contains a C-terminal domain composed of six alpha helices forming the core and a zinc binding domain (201, 232). For D. radiodurans, zinc binding is coordinated by four conserved cysteine residues, which are conserved in the B. subtilis protein (201, 232). The E. coli protein has one of the four cysteine residues, and the crystal structure of E. coli RecO lacks zinc (337). The overall fold of the “zinc binding domain” in E. coli RecO is very similar to that of the D. radiodurans protein. Thus, although sequence conservation between the E. coli and D. radiodurans RecO proteins is low (∼21% identical), the overall structures are very similar (201, 232).

In addition to a role in RecA loading, RecO generally contains two conserved biochemical activities: it can anneal complementary single strands, and it helps to load and facilitate strand exchange by RecA (236, 237). For the B. subtilis proteins, it has been shown in vitro that RecO will help to load RecA onto SSB-bound ssDNA, although the mechanism of action is not clear (236, 237). A major difference in RecO function between B. subtilis and E. coli is that B. subtilis RecO alone is sufficient to nucleate RecA filament formation on SSB-coated ssDNA in vitro, while in E. coli, RecO and RecR are necessary, because RecO will not overcome SSB inhibition alone (422, 423).

A possible mechanism is that RecO physically binds and loads RecA onto ssDNA or that the strand annealing activity of RecO indirectly helps to stimulate RecA loading. Experiments have been performed to test for a direct interaction between B. subtilis RecA and RecO, but so far an interaction between these proteins has not been shown (236). However, in E. coli, a very weak interaction was detected between RecO and RecA by surface plasmon resonance (423). Thus, there is some evidence suggesting that RecO binds directly to RecA, although the binding appears to be very weak (423). It is also not clear whether RecF and RecR function in the loading of RecA onto ssDNA in B. subtilis (179). In total, the RecA loading mechanism in B. subtilis is unclear and will require further study in order to understand the concerted steps that result in RecA-ssDNA filaments in vitro and in vivo.

One of the requirements for homologous recombination is the presence of two chromosome copies in order to provide an identical template for repair of a DSB. By coupling homologous recombination with DNA replication status, a cell may ensure that this requirement is met. A study using a partially functional recA-gfp fusion allele integrated at the native recA locus as the only source of RecA activity in the cell showed that ongoing DNA replication was necessary for RecA-GFP to form foci in response to single-strand gaps or an I-SceI-induced DSB in vivo (387). In this study, a DSB was generated and RecA-GFP failed to organize into a focus when DNA replication initiation was blocked (387). It is also worth noting that DNA replication has previously been shown to be necessary for SOS induction in E. coli (357). In that work, the LexA cleavage and degradation following UV irradiation were shown to be dependent on active DNA replication (357). The dependence on DNA replication may be due to the production of a significant amount of ssDNA at collapsed replication forks or perhaps to the presence of recombination proteins at the replisome. As discussed above, the SSB C-terminal tail is able to recruit proteins that might stimulate RecA loading at stalled or collapsed replication forks in B. subtilis, providing a possible platform for coupling between DNA replication and recombination (77). For example, the RecA loading protein RecO fused to GFP does not localize in cells deleted for the C-terminal 35 amino acids of SSB (77). Furthermore, RecO colocalizes predominantly with the replisome, suggesting that RecO is staged at the replication forks through SSB (77, 197). Thus, RecA-GFP focus formation is dependent on ongoing DNA synthesis. Interestingly, this feature is conserved in S. cerevisiae. Rad52, the S. cerevisiae analog of bacterial RecO, was found to form foci only during S phase (216). These data show a distinct coupling of Rad52 to DNA replication status in eukaryotes (216).

RecA-Catalyzed Strand Exchange

After RecA has been recruited into a complex with ssDNA, it must then search for an intact homologous sequence and catalyze strand exchange. In vitro, it has been shown that B. subtilis RecA bound to ssDNA is sufficient to catalyze strand exchange, forming recombinational intermediates (49, 54, 230, 397). The RecA/Rad51/DCM1/RadA superfamily is comprised of RecA-like recombinases that bind ATP and contain the conserved GXXXXGKT ATP binding motif (e.g., see reference 457). RecA binds to and hydrolyzes ATP and dATP (54, 230). Once the RecA-ssDNA nucleoprotein filament is formed, RecA-dATP hydrolysis in the presence of SSB stimulates strand exchange (54). RecA complexed with ATP can still catalyze strand exchange, but the level of RecA-ATP required to achieve this reaction is 10-fold higher than the necessary level of RecA-dATP (54). It has been proposed that the formation of the RecA nucleoprotein filament is regulated by dATP and through interaction with SSB (54). In Gram-negative bacteria, many proteins have been identified to modulate RecA activity, and most of these proteins are not present in B. subtilis (for a review, see reference 82). However, in B. subtilis, the Holliday junction endonuclease RecU modulates RecA activity (12, 46, 47, 50). RecU shows some stimulation of RecA binding to ssDNA, yet it inhibits its ssDNA-dependent dATPase activity (49). In support of this idea, RecU mutants have been isolated that are no longer capable of modulating RecA activities yet remain capable of Holliday junction cleavage (46, 47, 50). Cells with a recU deletion are sensitive to DNA damage and have a substantially reduced capability for transformation with plasmid and chromosomal DNAs (51, 52). In vitro cross-linking results show a weak but direct interaction between RecA and RecU in the absence of DNA (46). These results suggest that RecA and RecU interact in a step preceding Holliday junction cleavage. Taken together, the data show that RecA and RecU bind in a defined system and that RecU has the ability to regulate the role of RecA in homologous recombination.

Branch Migration and Holliday Junction Resolution

In E. coli, the RuvABC complex is involved in branch migration and Holliday junction cleavage (for a review, see reference 446). RuvA binds Holliday junctions and recruits the helicase RuvB to undertake branch migration (for a review, see reference 446). RuvC is an endonuclease that ultimately cleaves the Holliday junction. B. subtilis contains homologs of RuvA and RuvB but not RuvC. It is hypothesized that RecU provides the function of E. coli RuvC in B. subtilis and many other Gram-positive bacteria, as RecU appears to be absent from most or all Gram-negative bacteria (250). As mentioned above, RecU can cleave four-way junctions, and recU-deficient cells are sensitive to DNA damaging agents and have a reduced capability for transformation of B. subtilis with chromosomal DNA (122, 250) (Fig. 4). The crystal structure of RecU shows that RecU is similar to type II restriction endonucleases and a Holliday junction endonuclease (Hjc) from the archaeal organism Sulfolobus solfataricus (30, 250, 289). The overall RecU fold has been described as a “mushroom” with a cap and a stalk (250). The cap contains the catalytic residues important for Holliday junction cleavage (250) (Fig. 5). The stalk region is important for Holliday junction binding and for inhibiting the dATPase activity of RecA (47). Cytological experiments with a functional RecU-GFP fusion showed that RecU forms discrete foci, though in a small percentage of damaged cells and very late in the process of repair (351). Cells deficient for ruvAB do not support RecU-GFP focus formation, suggesting that RuvAB may recruit RecU in vivo (351).

Fig 5.

Fig 5

Crystal structure of Holliday junction resolvase RecU of B. subtilis. (Adapted from reference 250 with permission from Elsevier.) RecU has been described as a “mushroom”-like protein with a “stalk” and “cap” as indicated in the figure. The catalytic residues critical for Holliday junction cleavage are located in the cap, whereas the stalk interacts with RecA and modulates RecA activity. The Protein Data Bank accession number for the RecU structure is 1ZP7. This image was generated using Pymol (www.pymol.org/).

For B. subtilis, RecV has also been proposed to cleave Holliday junctions (349). The RecV protein is largely uncharacterized; however, it contains motifs that are similar to those of known Holliday junction endonucleases (349), and the recV41 allele results in a similar level of sensitivity to DNA damage to that for a strain deleted for recU (349). Because deletion of ruvAB does not completely disable homologous recombination, it is possible that RecG catalyzes branch migration along with RecU or RecV to cleave and thus resolve recombinational intermediates. The current data argue against RecV working together with RecG, as a double mutant combining the recV41 and ΔrecG alleles is much more sensitive to DNA damage caused by alkylating agents than the corresponding single mutants (349). Very little is known about RecV, and more experiments are necessary to understand the physiological and biochemical roles of this protein in homologous recombination in Gram-positive bacteria.

Primosome Assembly

The primosome has been well characterized for E. coli, and we direct readers to recent reviews on this subject (e.g., see references 238 to 240). The E. coli primosome is composed of PriA, PriB, PriC, DnaT, DnaB, DnaC, and DnaG (for a review, see reference 241). Briefly, PriA is an SF2 helicase with 3′-to-5′ polarity (199). During replication fork restart, PriA recognizes D loops and can reestablish replication forks at a D loop or free 3′-OH, where it can facilitate the loading and reassembly of the replisome (e.g., see references 219, 220, 249, and 292). In E. coli, PriA, PriB, and DnaT are dedicated to the primosome and assist with replication restart, yet they do not function in replication initiation from oriC. In B. subtilis, the primosome has the same overall function as in E. coli with respect to replication fork restart, but the composition of the primosome is different. B. subtilis contains the highly conserved PriA protein but lacks orthologs for PriB, PriC, and DnaT (193). Instead, B. subtilis uses components that normally function in replication initiation from oriC to fulfill the role of PriB, PriC, and DnaT in primosome assembly and replication fork restart (38, 243, 315). DnaD, DnaB (helicase loader in B. subtilis), and DnaI function in the loading of the B. subtilis replicative helicase DnaC at recombinational intermediates and oriC (38, 243, 315, 393). In B. subtilis, priA-deficient strains have very slow growth and are extremely sensitive to DNA damage, and their cells filament and show aberrant nucleoid morphology, demonstrating a critical need for PriA during vegetative growth (38). Mutations in the helicase loading protein of B. subtilis (DnaB) rapidly accumulate to suppress the growth phenotype resulting from deprivation of priA (38). This observation is very similar to the case for E. coli, as a priA deficiency is suppressed by mutations in the helicase loader encoded by dnaC (353).

Analysis of DnaD and DnaB has shown that these two proteins are related even though their sequence similarity is low (244). Both proteins contain a conserved YXXXIXXXW motif critical for DNA binding (244), and both proteins are capable of binding ssDNA and dsDNA. DnaD is a scaffold protein that remodels DNA, resulting in untwisting of a plasmid substrate. In contrast, DnaB remodels DNA by compaction, and thus the two proteins have opposing effects (48, 361, 477). For DnaD, the N-terminal domain forms oligomers, and structural analysis has shown a winged helix domain important for dimer and tetramer formation (361). The N-terminal domain of DnaD forms oligomers in the absence of DNA, while the C-terminal domain harbors DNA binding activity and a DNA-dependent oligomerization activity (48). Atomic force microscopy shows that DnaB forms a tetramer with a central hole (476). DnaB binds and condenses DNA, suggesting a more global role in DNA organization in vivo.

Ectopically expressed GFP-PriA shows constitutive association with the replisome, suggesting that it is poised to aid in reestablishment of replication forks that collapse during vegetative growth (197). Consistent with this hypothesis, PriA interacts with the C terminus of SSB. Thus, SSB probably functions to help recruit PriA to sites of replication fork arrest (197). Experiments in vivo show that the primosome proteins DnaD and DnaB associate with genomic regions experiencing high transcriptional activity, causing conflicts with DNA replication (258). To minimize such conflicts, transcription and DNA replication are cooriented in B. subtilis in vivo, but conflicts arise nevertheless (396). In particular, DnaD and DnaB associate with rRNA genes or the promoter of an integrative conjugative element, causing codirectional or head-on collisions with DNA replication, respectively (258). Association of DnaD and DnaB with rRNA genes requires priA and is independent of the replication initiation protein DnaA (258). Taken together, the data show that the composition of the primosome in B. subtilis is different from that in E. coli. It is not clear how the primosome functions at the biochemical level; however, it is known that it functions to reestablish collapsed replication forks and that the pathway is critical for B. subtilis during vegetative growth.

Potential Roles for Other SMC-Like Proteins in DSB Repair

In eukaryotic organisms, the SMC family of proteins has many functions in genome maintenance: Smc1 and Smc3 function in sister chromatid cohesion, while Smc5 and Smc6 are involved in replication fork stabilization, the DNA damage checkpoint response, and homologous recombination (6, 76, 97, 155, 156, 398). In addition, Smc2 and Smc4 are involved in X chromosome gene dosage compensation and mitotic chromosome condensation (e.g., see references 85 to 87). Chromosome organization and segregation in B. subtilis are accomplished by the SMC complex, which includes SMC, ScpA (kleisin), and ScpB (35, 36, 144, 214, 246, 395, 400). In addition to SMC, B. subtilis contains three other SMC-like proteins (RecN, SbcC, and YhaN [now known as SbcE]) (for a review, see reference 141). A yeast two-hybrid analysis showed that ScpA interacts with AddB, a nuclease subunit of the end processing helicase-nuclease AddAB complex and a critical component of DSB repair in Gram-positive bacteria (discussed above) (98). In support of a role for ScpA in homologous recombination, point mutations in ScpA were identified that rendered cells sensitive to mitomycin C challenge (98). Overexpression of addBA within these mutant backgrounds suppressed this phenotype, suggesting that ScpA interacts with AddB during some step of the repair process (74). Deletion of scpAB or smc also rendered cells sensitive to mitomycin C, although the sensitivity was not suppressed by increased expression of addBA, showing that suppression of scpA was specific (98). The sensitivity of scpA- and smc-deleted cells to mitomycin C does not implicate the corresponding proteins in a direct role for DSB repair in vivo; however, the observations that ScpA binds AddB and that addBA overexpression suppresses the sensitivity of mutant alleles of scpA to DNA damage do suggest a role for at least ScpA in DSB repair. It has yet to be determined if the role of ScpA in DNA repair takes place while ScpA is in complex with SMC and ScpB or if ScpA has a role in repair on its own. Because eukaryotic Smc5 and Smc6 have established roles in DSB repair (6, 76, 97, 130, 200), it is tempting to speculate that the SMC complex in B. subtilis may also have a role in DSB repair. One possibility is that ScpA in complex with SMC and ScpB functions to direct the end processing reaction of AddAB to break sites in vivo.

In S. cerevisiae, Rad50 is an SMC-like protein that forms a complex with Mre11 and Xrs2, forming the MRX complex (for a review, see reference 265). MRX with Sae2 functions to catalyze the first step in end processing of DSBs by catalyzing DNA end resection, a step that facilitates repair by homologous recombination while inhibiting nonhomologous end joining (NHEJ) (266, 480). In bacterial systems, the closest orthologs of Rad50 and Mre11 are the SMC-like protein SbcC and the endonuclease SbcD (373). In E. coli, SbcCD proteins are able to cleave certain DNA structures, such as hairpins (75). In B. subtilis, cells disrupted for sbcC show only a slight decrease in survival to DNA damage by ionizing radiation and mitomycin C challenge, yet a fully functional SbcC-YFP fusion forms faint foci in vivo during exponential-phase growth, an effect exacerbated following challenge with mitomycin C (245). Colocalization experiments showed that SbcC-YFP foci were coincident with the replisome, as detected with the DnaX-CFP fusion protein (245). Consistent with this finding, SbcC was shown to interact with SSB in B. subtilis as part of the SSB interactome (77). Furthermore, SbcC and the SbcD homolog YhaO were shown to interact with the B. subtilis primase (DnaG) in a yeast two-hybrid analysis (245). Based on these results, it seems that the SbcCD complex may act at the site of DNA synthesis, perhaps through coupling to primase. This could aid in vivo in the repair of DNA damage such as interstrand cross-links at replication forks, as already suggested. However, the overall roles of these proteins in repair and genome maintenance are still unclear (387).

SbcE (YhaN) was recently identified as an SMC family protein in B. subtilis which has a role in DNA repair (189). Cells disrupted for sbcE show ∼30% survival following introduction of an I-SceI-induced DSB (189). The gene downstream of sbcE shows homology to sbcD and has been named sbcF (yhaO) (189). SbcF and SbcE have been shown to interact by yeast two-hybrid analysis (290). Fully functional SbcE-YFP forms foci during vegetative growth, with slightly more foci in cells exposed to DNA damage (189). Like the case for RecN, SbcE-YFP foci form in cells experiencing DNA damage induced by mitomycin C in the absence of DNA replication. SbcE has also been shown to function during competence. Cells deficient for sbcE have a reduced capability for transformation, maintaining a transformation efficiency of only ∼5% relative to the wild-type level (189). Epistasis analysis places SbcE in a pathway parallel to that of RecN, because sbcE and recN double mutants are more sensitive than the single mutants (189, 290). Taken together, the data indicate that SbcE is an SMC-like protein that contributes to DSB repair and transformation of B. subtilis cells.

NONHOMOLOGOUS END JOINING

NHEJ is a low-fidelity DSB repair pathway that catalyzes end joining of two broken DNA ends, using minimal or no sequence homology (for a review, see references 34, 89, 206, 207, and 380). Although it is mutagenic, NHEJ can repair DSBs when a homologous chromosome is not available. NHEJ was identified and studied in eukaryotic systems based on studies of viral integration (450). It was later found that NHEJ is important for the repair of DSBs (for a review, see references 34, 89, 206, 207, and 380). NHEJ is commonly used in mammals to repair DSBs, while the pathway is much more restricted in S. cerevisiae (174). In eukaryotes, the Ku70/80 heterodimer is responsible for binding broken DNA ends (439), followed by recruitment of other proteins responsible for repair (e.g., see reference 188). In 2001, it became apparent that some prokaryotes contain Ku-like proteins and several ATP-dependent ligases that are necessary to perform NHEJ (7, 102, 444, 447). Currently, our understanding of the bacterial NHEJ pathway is based largely on biochemical analysis of the proteins from Mycobacterium tuberculosis (for a review, see references 34 and 380).

Unlike eukaryotic NHEJ, bacterial NHEJ is a two-component DNA repair pathway consisting of a Ku homolog and an ATP-dependent ligase (96, 137, 445). Bacterial Ku functions as a homodimer that preferentially binds double-stranded DNA ends, both protecting them from nuclease attack and facilitating repair (445). Ku recruits the ATP-dependent ligase to the DSB, where it facilitates end processing, polymerization, and ligation in order to repair the broken segment (137, 445). Using Mycobacterium smegmatis as a genetic system, it was shown that ATP-dependent LigD is required to ligate a blunt-ended or 5′-cohesive-ended plasmid in vivo (137). Sequencing of the repair junctions showed that NHEJ is error prone, demonstrating that repair of the DNA ends is accompanied by nucleotide insertions or deletions (137). In the absence of ligD, NHEJ is dependent on the ligase LigC (137). LigD is a multidomain protein harboring an N-terminal polymerase domain, a central domain with 3′-5′ exonuclease activity, and a C-terminal domain with ATP-dependent ligase activity (313). The Pol domain belongs to the X family of DNA polymerases, whose members include Pol μ and Pol λ, which function during NHEJ in mammalian cells (34). In all, LigD has consolidated three processing activities into one protein, allowing for NHEJ to repair a wide range of DNA breaks without the need for other proteins.

B. subtilis also utilizes an NHEJ pathway that has been characterized almost exclusively in vivo. The B. subtilis Ku and LigD-like gene products are encoded in an operon, by the ykoV and ykoU genes, respectively (103). Deletion of ykoV or ykoU sensitizes B. subtilis strains to ionizing radiation in stationary phase (445) and sensitizes spores to X-ray and high-energy charged particle challenge (270). These results are consistent with a role of Ku and LigD in DSB repair. The B. subtilis proteins have not been examined biochemically, because both YkoV and YkoU have been reported to be insoluble (445).

What is the function of such a specialized DSB repair pathway in B. subtilis? Results defining the forespore-specific σG regulon of B. subtilis have provided a clue (440). The sigma factor σG directs transcription of genes in the forespore during development (401). This observation is striking because asymmetric septation during sporulation would physically separate each chromosome from its homolog by a membrane barrier, preventing homologous recombination (for a review, see reference 335). The physical compartmentalization and separation of the two chromosomes during this growth phase would be ideal for NHEJ to repair DSBs that might occur once a chromosome has been partitioned into the developing forespore. In addition, NHEJ has been associated with prokaryotes that undergo extended periods with one genome copy as part of their life-style, whether during sporulation or during extended periods in stationary phase, in the case of M. tuberculosis (34, 96, 137, 444, 445). These observations support the idea that NHEJ in B. subtilis contributes to genome maintenance during stationary phase and during germination of B. subtilis spores, when B. subtilis has predominantly 1C chromosomal DNA content per cell (270, 440, 445).

NUCLEOTIDE EXCISION REPAIR

NER is an important DNA repair pathway that allows for the high-fidelity repair of a variety of drug- and UV-induced lesions (for a review, see reference 128). The NER pathway is conserved from prokaryotes to eukaryotes, and defects in NER in humans are associated with many diseases, including xeroderma pigmentosum, which contributes to a high risk for developing skin cancer (71, 72). The highly conserved UvrABC excinuclease complex is required for recognition and excision of the damaged base (for a review, see reference 128). B. subtilis contains homologs of the Uvr system, including UvrA, UvrB, and UvrC (193). The uvrBA genes are in the same operon, and their expression is regulated by the SOS response (10, 65). Disruption of uvrA renders cells highly sensitive to a variety of DNA damaging agents, including UV, 4NQO, and mitomycin C (129). The uvrC gene is located in a different position on the chromosome from uvrBA and shows very low levels of SOS induction (10, 193). In E. coli, the UvrA2B complex is responsible for identifying the damaged base (159, 248; for a review, see references 342 to 344). UvrA dissociates, leaving UvrB to recruit UvrC to the site of damage (300302). UvrC in cooperation with UvrB removes approximately 10 to 15 nucleotides surrounding and encompassing the noncoding base (208, 209, 301). The dually nicked strand containing the noncoding base is then removed by DNA helicase II (UvrD), followed by gap filling with DNA polymerase I for the E. coli pathway (128). The resulting nick is then sealed by DNA ligase to finish the repair process (342, 381). Most of the biochemical experiments on NER have been performed with the E. coli proteins. It has been shown that B. subtilis uvrC will complement an E. coli uvrC deletion and that purified UvrC protein from B. subtilis will replace E. coli UvrC in a repair reaction reconstituted with purified components (210). Localization experiments using a functional UvrA-GFP fusion showed that UvrA-GFP was coincident with the nucleoid and that UvrA-GFP fluorescence was enriched on the nucleoid following UV damage (390). It has been proposed that UvrA may scan the chromosome to identify damaged bases, and the subcellular localization of UvrA-GFP is consistent with this hypothesis (390).

Transcription-Coupled Repair

The mutation frequency decline (Mfd) protein, also known as transcription repair coupling factor (TRCF), is a 133-kDa protein that dislodges stalled RNA polymerase from the transcribed strand when a lesion is encountered, targeting repair to the transcribed strand (123, 124). Deletion of mfd causes an increase in mutagenesis during vegetative growth, and interestingly, an mfd deficiency substantially reduces “adaptive” or “stationary-phase” mutagenesis in B. subtilis (330). Stationary-phase mutagenesis refers to the formation of mutations under nonlethal selection when cells are not growing, including conditions of nutrient limitation (402, 403). The effect of Mfd on DNA damage-inducible mutation frequency requires the presence of a functional excision repair pathway (124). B. subtilis Mfd has been purified and shown to displace RNA polymerase stalled at a cross-linked lesion (13). In addition, Mfd-deficient strains have a reduced capacity for supporting homologous recombination as measured by plasmid and chromosomal DNA transformation (13). These data show that an mfd deficiency results in 2- and 2.6-fold reductions in transformation with plasmid and chromosomal DNAs, respectively (13). When an mfd deficiency is combined with other gene defects in homologous recombination, transformation is further reduced (13). A synergistic decrease in plasmid and chromosomal DNA transformation was measured when an mfd disruption was combined with deficiencies in recH, recP, recB, and recG with respect to chromosomal DNA transformation (13). The mechanism underlying this observation is unknown. Because the functions of recH and recP are not clear and deficiencies in these genes cause the most striking effects with loss of mfd, elucidating the role of mfd in homologous recombination has been difficult (13). It has been suggested that Mfd may bind a recombination protein such as RecG, recruiting it to sites of homologous recombination (13). Mfd has not been studied in great detail in Gram-positive systems, and thus more work is necessary to understand the mechanism and possible role of Mfd in transcription-coupled repair and homologous recombination.

BASE EXCISION REPAIR

Base excision repair (BER) is a pathway that specializes in the repair of nonbulky lesions in DNA. This is in contrast to NER, which functions on the nucleotide/oligonucleotide level to repair bulky lesions (for a review, see reference 90). Nonbulky lesions are caused by numerous chemical assaults, including alkylation, oxidation, depurination/depyrimidination, deamination, and dUTP incorporation during DNA replication (for a review, see references 90 and 128). With many sources of potential damage, BER is considered the most frequently used DNA repair pathway in vivo (for a review, see references 28 and 191). The general process begins with detection of the lesion by a glycosylase, which hydrolyzes the N-glycosidic bond, removing the damaged base. This produces an apurinic/apyrimidinic or abasic site (referred to as an AP site henceforth). These sites are highly mutagenic and have the potential to cause single-stranded DNA breaks (for a review, see references 17, 90, and 128). AP endonucleases and AP lyases nick sites 5′ and 3′ of the AP site, respectively, which allows subsequent processing of the AP site by an exonuclease or a deoxyribophosphodiesterase (dRpase). The small gap is then closed by a repair polymerase, such as Pol I, and ligated, restoring the site to its undamaged form (for a review, see references 17, 90, and 128).

The “GO” System

The “GO” system is part of the BER pathway dedicated to the repair of oxidized guanines, such as 7,8-dihydro-8-oxoguanine (8-oxo-G), as well as opened guanine imidazole rings, referred to as formamidopyrimidines (FaPy-G) (176, 411). 8-oxo-G is the result of the oxidation of guanine at carbon 8, while FaPy-G is caused by ionizing radiation, methylation of N7, or oxidative damage (128). DNA damage caused by oxidation can originate from exogenous sources; however, most damage is due to endogenous reactive oxygen species (ROS) originating from cellular metabolism (176). 8-oxo-G is the most prevalent form of oxidative damage in DNA, and if left unrepaired, it can be mutagenic because replicative polymerases can pair dATP opposite the damaged base during DNA synthesis (160, 233, 377). This produces an 8-oxo-G–A mismatch. Failure to repair this mismatch before the next replication cycle will create a GC → TA transversion (128, 260263). In E. coli, the glycosylases MutM (fpg) and MutY reduce the mutagenic potential of 8-oxo-G in DNA by removing 8-oxo-G (MutM) or the mismatched adenine (MutY) from the 8-oxo-G–A mispair. Specifically, MutM selectively removes 8-oxo-G, in addition to producing a nick 3′ of the AP site with its AP lyase activity (e.g., see references 317 and 318). This occurs before an 8-oxo-G–A mismatch is produced during the next replication cycle. To provide an additional layer of protection from G → T transversions, MutY recognizes the 8-oxo-G–A mismatches and selectively removes the adenine base. MutY also has 3′ AP lyase activity, allowing for MutY to nick the DNA 3′ of the AP site, followed by repair synthesis with Pol I (415, 416). MutY therefore provides the cell with another replication cycle for MutM to remove 8-oxo-G before a mutation can occur (190, 448, 449).

Detection and excision of 8-oxo-G lesions and mismatches in B. subtilis are performed by homologs of E. coli MutM and MutY. In B. subtilis, a mutM-deficient strain has a slight increase in spontaneous mutagenesis (∼5-fold), whereas mutY knockout confers a much larger increase in frequency of mutant occurrence (∼100-fold). Characteristic of the GO pathway, a double knockout (mutM mutY) which prevents removal of both 8-oxo-G lesions and 8-oxo-G–A mismatches is synergistic, with a mutation frequency of ∼1,000-fold (355).

Another target of oxidation is the nucleotide pool. For example (d)GTP can be oxidized to form 8-oxo-(d)GTP (26, 80). Oxidized nucleotides remain competent for incorporation into DNA during replication, with a high mutagenic potential (233). When 8-oxo-dGTP is incorporated into DNA, it can pair with adenine, producing an AT → CG transversion (233). Thus, the GO system has a third component responsible for cleansing nucleotide pools and preventing 8-oxo-dGTP incorporation into DNA. In E. coli, MutT provides this function (e.g., see references 26 and 80). Cells deficient for mutT confer a large increase in spontaneous mutation frequency (up to 10,000-fold) (79), with a mutation spectrum strongly biased toward AT → CG transversions (358). MutT is a nucleoside triphosphatase that sanitizes the nucleotide pools by selectively hydrolyzing 8-oxo-dGTP to 8-oxo-dGMP, with release of pyrophosphate, producing a nucleotide that cannot be incorporated into DNA during replication (26).

A clear functional analog for MutT in B. subtilis has not been identified. Analysis of the sequenced B. subtilis genome revealed a putative mutT gene (with 27.4% amino acid sequence homology) as well as two other possible orthologs (yvcI and yjhB) (193). These three genes, along with two more (ytkD and nudF), carry a conserved array of amino acids called the Nudix box (nucleoside diphosphates linked to some other moiety X), to which MutT's ability to hydrolyze 8-oxo-(d)GTP is attributed (25). Cells deficient for mutT, yvcI, or yjhB showed virtually no change in mutation frequency relative to a wild-type strain; a similar result occurred when all three genes were disrupted (355, 356). There is evidence suggesting that the ytkD gene may encode an activity that is similar to that of E. coli MutT (55, 324, 428). It was shown that YtkD can specifically hydrolyze 8-oxo-(d)GTP, as well as complement a mutT deficiency in E. coli. It was also shown that cells deficient for ytkD are more susceptible to oxidative DNA damage (55, 324, 428). However, others have presented evidence that YtkD fails to hydrolyze 8-oxo-dGTP selectively over dGTP (458). These results, in addition to the low frequency of occurrence of mutants observed with a ytkD knockout (∼4-fold higher than that of the wild type), suggest that YtkD does not provide a role analogous to that of E. coli MutT but may function as a general nucleotide hydrolase turning over the nucleotide pool, indirectly reducing the amount of oxidized nucleotides within the pool. Another possibility is that with the lack of a clear B. subtilis ortholog of E. coli mutT, removal of oxidized nucleotides from the deoxynucleoside triphosphate (dNTP) pools is due to ribo- and deoxyribonucleoside tri- and diphosphatases that remain unidentified.

Uracil Glycosylases

Base excision repair is also responsible for reducing mutagenic potential from the introduction of UMP into the chromosome (111). Uracil is integrated into dsDNA through incorporation of dUMP opposite dAMP by the replicative DNA polymerase (419). dUMP incorporation can lead to GC → AT transition mutations (407, 408, 420). dUMP incorporation is rare because the dUTP pool is relatively small compared to that of dTTP; however, the kinetics of incorporation are similar to those in E. coli, and any increase in the dUTP/dTTP ratio will increase the likelihood of dUMP incorporation into DNA (379, 421). Another mechanism for dUMP incorporation into chromosomal DNA is through deamination of dCMP to dUMP. This process can occur spontaneously but may also be exacerbated by the presence of hydroxyl radicals or other DNA damaging agents (128). To counteract dUMP incorporation, B. subtilis possesses a uracil-DNA glycosylase (UDG; encoded by ung) which specifically removes uracil from DNA (74).

Interestingly, the PBS1 and PBS2 phages of B. subtilis have dUMP substituted for dTMP in their genomes (406). These phages contain Ung or UDG inhibitors (Ugi) that prevent Ung from removing dUMP from their DNA (20). Overexpression of Ugi causes an increase in mutagenesis in E. coli, demonstrating the effect of this protein as a Ung/UDG inhibitor in vitro and in vivo (441).

Processing of Apurinic/Apyrimidinic Sites

After removal of the damaged nitrogenous base by the appropriate glycosylase, a noncoding 2-deoxyribose-phosphate or AP site remains present within the DNA (211). AP sites also arise spontaneously following breakage of the N-glycosidic bond under physiological conditions (90). AP sites can damage DNA through mutagenesis or stalling of DNA replication and transcription complexes and can lead to chromosomal breakage (145, 191). In addition, when RNA polymerase encounters either ssDNA breaks or AP sites during transcription, it may incorporate ATP by default as a mechanism to ensure continued transcription, potentially producing base substitutions in the RNA transcript (70, 479). Therefore, it is important for the cell to process and correctly repair AP sites in order to prevent phenotypic consequences (211).

Both glycosylase and spontaneously produced AP sites are processed by AP endonucleases, which yield a 3′-OH group (128). B. subtilis contains three AP endonuclease genes: yqfS, exoA, and yshC (14, 193). All three AP endonucleases nick the phosphate sugar backbone 5′ of the AP site, in a metal-dependent manner, producing a replication-competent 3′-OH and a 5′ deoxyribose phosphate terminus (5′-dRp) (339, 378). Differences arise between the three AP endonucleases in terms of their spatial localization, temporal expression, and enzymatic activities. YqfS is a member of the Nfo family (endonuclease IV) of related AP endonucleases (339). Members of this family possess both AP endonuclease and 3′-phosphatase activities yet lack 3′-5′ exonuclease function and 5′-phosphatase activities (90). Importantly, when expressed from a plasmid, B. subtilis yqfS can complement an E. coli strain lacking its 2 major AP endonuclease genes (nfo and xthA) (339). In B. subtilis, yqfS expression is under the control of the σG transcription factor and is therefore expressed late during sporulation (339). This provides the forespore with its own AP endonuclease to repair AP sites formed in the forespore chromosome during development. In addition, His6-YqfS protein is detected in mature spores, suggesting that this protein could repair AP sites during spore germination (339). In contrast to E. coli nfo, yqfS is not induced by the presence of superoxide radicals, which are generated following challenge of cells with paraquat and hydrogen peroxide (424). B. subtilis also has an AP endonuclease gene of the exonuclease III class, called exoA, which is conserved throughout biology, with members including E. coli xthA and human APEX1 and APEX2. Northern blot analysis indicates that exoA is expressed during vegetative growth in B. subtilis (378). ExoA, much like E. coli XthA, possesses AP endonuclease, 3′-5′ exonuclease, and 3′-phospho-monoesterase activities (378). Surprisingly, an exoA yqfS double mutant fails to display a reduction in tolerance to AP sites, and its mutation frequency does not increase, suggesting that another AP endonuclease may be present in B. subtilis (424).

B. subtilis contains a homolog of E. coli Nth (endonuclease III) (73). Interestingly, the nth gene is located directly downstream of the dnaD gene. As discussed above, DnaD is involved in loading of the replicative DNA helicase at oriC and at sites of replication fork restart (73). In addition, it has been proposed that DnaD provides a general role in nucleoid organization, as it untwists DNA and has DNA remodeling activities (48). Nth has received very little attention in B. subtilis; however, it has been shown to nick substrates with AP sites (73). DnaD, YonN, and HBsu showed stimulation of Nth nicking of AP site-containing substrates in vitro. A direct physical interaction between DnaD and Nth has not been shown, suggesting that DnaD, YonN, and HBsu are capable of remodeling DNA in a way that allows for efficient access of Nth to AP sites (73). Activation of the nth gene in B. subtilis confers sensitivity to hydrogen peroxide, consistent with the idea that Nth recognizes oxidized derivatives, including thymine glycol (443).

A newly discovered AP endonuclease activity was found for the B. subtilis DNA polymerase X (yshC) (14). PolX is a DNA polymerase that possesses low processivity and slow polymerization. PolX also acts preferentially on gaps of one to a few nucleotides in length (14). Polymerase activity is increased by the presence of a phosphate group on the 5′ terminus 1 to 5 nucleotides downstream of a 3′-OH (14). In addition, it was shown that PolX is able to nick a DNA substrate containing a nucleotide analog that mimics an AP site (15). The combination of AP endonuclease activity and the preference of its polymerase activity for small gapped substrates strongly suggests that PolX may be the primary polymerase that repairs small lesions, such as those produced by BER. Furthermore, PolX possesses a 3′-5′ exonuclease activity which was shown to process AP sites that were cleaved on the 3′ side by an AP lyase (15). Lyase cleavage produces a 3′-phospho-α,β-unsaturated aldehyde (3′-PUA), a group that blocks replication unless it is processed further (15). Therefore, PolX 3′-5′ exonuclease activity will process 3′-PUA by hydrolyzing the phosphodiester bond, leaving a 3′-OH from which PolX can extend (15). Interestingly, the exonuclease and AP endonuclease activities could not be separated by mutational analysis, and the presence of an AP site appears to inhibit the exonuclease activity of PolX, thereby favoring the AP endonuclease activity when an AP site is present (15).

PolX has been well characterized in vitro; however, the in vivo effects of deleting PolX are unknown. Because an exoA deficiency in vivo has very little effect on the repair of AP sites, it is hypothesized that PolX, jointly with ExoA, may provide an overlapping strategy for B. subtilis to repair AP sites during vegetative growth (15).

ALKYLATION DAMAGE

Bacteria occupy a variety of niches, from aqueous environments to mammalian and plant hosts. DNA damage by alkylating and methylating agents is common, and therefore the repair of alkylation and methylation damage is critical for survival of many bacterial species. Soil bacteria, including B. subtilis, are frequently exposed to environmental alkylating agents, including methyl chloride and methyl bromide as well as many naturally produced antibiotics (for a review, see reference 364). Alkylating agents react with many sites on DNA bases, causing numerous forms of DNA damage. Some DNA modifications are benign, whereas others can be toxic (for a review, see reference 90). These agents are divided into two categories based on their modes of substitution: SN1 and SN2 (for a review, see references 105 and 363). The SN2 class of alkylating agents, such as the methyl halides, react selectively with nitrogen within the base ring not bound to hydrogen (for a review, see references 105 and 363). The main targets (and products) of SN2 alkylation are the 7th nitrogen of both the guanine (7-meG) and adenine (7-meA) rings as well as the 3rd nitrogen of adenine (3-meA) (for a review, see references 105 and 363). SN1-type alkylating agents, such as the lab reagent N-methyl-N′-nitro-N-nitrosoguanidine (MNNG), react with the same nitrogen moieties as SN2 alkylating agents, while also reacting with the exocyclic oxygen sites primarily of guanine and thymine, yielding O6-meG and O4-meT (for a review, see references 105 and 363). 3-meA and 3-meG lesions can block the cellular replicase, leading to a loss of viability. O6-meG and O4-meT lesions have the capacity to cause mispairing and the formation of GC → AT transitions in vivo (for a review, see references 105 and 363).

Methyl and Alkyl Glycosylases

Bacteria such as those from the genus Bacillus have developed both constitutive and inducible pathways for repair of lesions resulting from DNA alkylation (146, 274276, 278280). The AdaA pathway is inducible and relies on a combination of methyltransferases and 3-methyl glycosylases to repair alkylation damage to DNA. Part of the constitutive pathway relies on the presence of numerous methyl and alkyl glycosylases encoded within the Bacillus genome (193). We focus most of our attention on the inducible Ada response. The AdaA response includes induction of a 3-methyl glycosylase called AlkA, encoded by the alkA gene (for a review, see reference 90). AlkA functions predominantly in the removal of lesions formed by alkylating agents that target nitrogen moieties, specifically 3-meA, 3-meG, and 7-meG (277). In addition to AlkA, the B. subtilis genome encodes at least four other glycosylases, which have redundant substrate repair activities as well as the ability to recognize other alkylation-based lesions (274280). B. subtilis Aag (yxlJ) is a member of the mammalian AAG family, which is composed of 3-methyladenine DNA glycosylases (1). B. subtilis Aag is able to excise 3-meA and 3-meG but lacks the ability to excise 7-meG in vitro (1). In addition, B. subtilis contains two putative alkyl glycosylases (encoded by yfjP and yhaZ), although their functions and substrate recognition are unknown (193).

The bacterium Bacillus cereus also possesses three known 3-meA DNA glycosylases: AlkC, AlkD, and AlkE (5). The alkE gene is predicted to produce a protein that shares 26% sequence identity with E. coli AlkA, and it has been shown to complement an E. coli strain deficient in both alkA and tag, encoding the two glycosylases able to remove 3-meA (5). Therefore, AlkE is probably the AlkA ortholog in B. cereus. Conversely, AlkC and AlkD of B. cereus may represent a novel protein superfamily of 3-meA glycosylases (5). Both AlkC and AlkD have been shown to remove SN2 lesions, whereas AlkD has also been shown to remove bulky lesions in vitro (5, 334). Recently, it was shown that AlkD bends alkylated dsDNA without intercalating between the bases. Strikingly, AlkD causes hydrolysis of the N-glycosidic bond without direct chemical attack from the enzyme itself, thus distinguishing its mechanism of action from the base-flipping mechanism used by most other glycosylases (334).

Alkyltransferases and the Ada Response

Upon alkylation of DNA, enzymes called alkyltransferases catalyze the transfer of the alkyl group from the DNA onto a cysteine residue (for a review, see reference 128). This process repairs the DNA by accepting the alkyl group while consuming its enzymatic activity in the reaction (128). The expensive activity of removing alkylation damage via a suicidal action is a highly conserved process, and unlike glycosylases, this process does not produce mutagenic AP sites (for a review, see reference 306). The B. subtilis genome carries at least five separate alkyltransferase genes: adaA, adaB, dat, ydiO, and ydiP (193).

The Ada response is a semiconserved response to alkylation agents designed to increase defenses against further alkylation (167, 168, 359). For a complete and comprehensive review of the E. coli Ada response, we direct readers to previously published reviews (128, 376, 430). The Ada response occurs in many Gram-negative bacteria as well as some Gram-positive bacteria, including but not limited to B. subtilis, Bacillus thuringiensis, M. tuberculosis, and Micrococcus luteus (340, 341, 463). The Ada response is a transcriptional response that was originally referred to as “the adaptive response to alkylation damage,” because pretreatment of E. coli cells with small doses of alkylating agents guarded cells against the effects of higher doses (128, 167, 168, 359, 376, 430). Nonadapted (i.e., nonpretreated) B. subtilis cells displayed higher mutation frequencies and lower viability upon exposure to alkylating agents (274280). The B. subtilis adaAB operon encodes two separate alkyltransferases with different substrate specificities. The AdaA protein catalyzes the selective removal of the S stereoisomer of methylphosphotriesters from the sugar-phosphate backbone of DNA (274). This irreversible transfer of the methyl group from the methylphosphotriester to AdaA elicits a conformational change which activates a latent transcriptional activator activity inducing the Ada response (274280). Thus, repair of methylphosphotriesters is used to upregulate AdaA target genes, including the adaAB operon and alkA. The second gene in the operon, adaB, is hypothesized to encode a protein catalyzing the removal of O6-methylguanine (274280). In doing so, AdaB protects the chromosome from the deleterious effects of alkylation agents.

MISMATCH REPAIR

Mismatch repair (MMR) is a process used to correct replication errors introduced during DNA synthesis (for a review, see references 192 and 362). In E. coli, MutS binds a mismatch, followed by recruitment of MutL (for a review, see references 192 and 362). MutL recruits and activates the MutH endonuclease, causing MutH to nick the unmethylated and thus nascent strand bearing the mismatch (for a review, see references 192 and 362). The helicase UvrD is then loaded at the site of the nick, where it unwinds the DNA strand containing the error (for a review, see references 192 and 362). The error-containing strand is then degraded by one of many exonucleases, depending on the polarity of the excised strand (429). The resulting gap is synthesized by Pol III, and the nick is sealed by DNA ligase (for a review, see references 192 and 362). The MMR pathway in E. coli requires MutS, MutL, MutH, UvrD, and Dam methylase to methylate adenine in the d(GATC) sequence, allowing for identification of the newly replicated, mismatch-bearing strand (Table 4).

Table 4.

Comparison of mismatch repair proteins between E. coli and B. subtilis

E. coliprotein(s) Function B. subtilis protein
MutS Mismatch recognition MutS
MutL Protein “matchmaker” MutL (endonuclease activity)
MutH Methylation-directed endonuclease Absent
Dam Methylates adenine in d(GATC) sequences Absent
Exonucleases I, X, and VII, RecJ Exonucleases for degradation of the mismatch-bearing strand Yet to be established in mismatch repaira
UvrD DNA helicase YrrCb
a

Exonucleases I and X are not present in B. subtilis; Exo VII and RecJ are present in B. subtilis, but it is not known if these proteins function in mismatch repair.

b

YrrC may function as a mismatch repair helicase in Gram-positive systems. YrrC is a RecD2 ortholog with 5′-to-3′ DNA helicase polarity, based on studies of the D. radiodurans RecD2 protein (462).

B. subtilis contains the highly conserved MutS and MutL proteins (135); however, it lacks MutH, Dam, and a clear UvrD ortholog known to function in mismatch repair (88, 118, 119). MutS is the “sensor” that recognizes the mismatch (384), whereas MutL is the “linker,” which functions to link the remaining proteins in the pathway together to allow for efficient repair of replication errors in B. subtilis (for a review, see references 192 and 362). Because neither dam nor mutH is present within the B. subtilis genome, it has been hypothesized that B. subtilis uses a methylation-independent mismatch repair pathway, unlike the mismatch repair pathway characterized for E. coli. Consistent with this idea, d(GATC) sequences in B. subtilis and S. aureus are not methylated, suggesting that a functional analog of Dam is not present in these organisms (106). It is also important that the methylation-directed mismatch repair pathway characterized for E. coli is absent from most bacteria, and it is hypothesized that most bacteria utilize a methylation-independent mismatch repair system (310), just as in eukaryotic systems it is hypothesized that identifying the newly replicated strand in B. subtilis and other organisms that lack a methylation-directed signal relies on strand discontinuities located at or near DNA replication forks in vivo (for a review, see reference 194).

B. subtilis MutL is a Latent Endonuclease

One of the major differences between E. coli and B. subtilis is that B. subtilis MutL is an endonuclease and E. coli MutL is not (171, 310). In the E. coli methylation-directed mismatch repair system, MutH endonuclease activity is required for mismatch correction (2, 152). The endonuclease active site in B. subtilis MutL is identical to the active site in human and S. cerevisiae MutLα, suggesting a strong conservation in mechanism between B. subtilis and eukaryotic organisms (171). Recently, the crystal structure of the endonuclease domain of B. subtilis MutL was solved (310). Two critical observations came from this work. First, MutL contains a zinc-binding loop, and mutations that abolish zinc binding inactivate mismatch repair in vivo (310). The zinc-binding loop is hypothesized to play a structural role in allowing for the proper positioning of DNA into the active site for subsequent cleavage (310). Second, a β clamp-binding site with the sequence 487QEMIVP492 was identified in the C-terminal domain of MutL (310), and this site was shown to indeed bind the β clamp (311). One favored mode of action is that the β clamp binds to the C terminus of MutL, opening the active site and allowing for DNA cleavage during repair (311). Interaction between MutL and the β clamp may function to both position and activate MutL for cleavage of the mismatch-containing strand. In support of this idea, mutation of the β clamp-binding motif blocks β clamp binding in vitro and prevents mismatch repair in vivo (310, 311). In contrast, mutations to the homologous site in E. coli MutL have a less pronounced effect on mismatch repair in vivo (311). Thus, it is attractive to consider that the β clamp may help to orient MutL to the nascent strand by directing MutL endonuclease activity. Once the newly synthesized strand is nicked, the nick site could then serve as an entry point for other repair proteins involved in mismatch correction in B. subtilis. Although this is an attractive model, these steps have yet to be shown experimentally. We provide a current model for mismatch repair in B. subtilis in Fig. 6.

Fig 6.

Fig 6

Model for mismatch repair in B. subtilis. (A and B) The β clamp directs MutS to the DNA to aid in identification of a mismatch. (C) MutS recruits MutL to the site of the mismatch. (D to F) We speculate that the complex slides along the DNA until the latent endonuclease activity of MutL is stimulated, possibly through interaction with the β clamp, causing MutL to nick the nascent strand. (F) The error-containing strand is then unwound, perhaps by RecD2 helicase, and degraded by an exonuclease. New homoduplex DNA is synthesized in the gap, and the new strand is ligated to complete mismatch correction. (Adapted from reference 310 with permission.)

Mismatch Repair Proteins Are Coupled to DNA Synthesis

Several lines of evidence show that mismatch repair proteins assemble into complexes at the site of DNA synthesis (181, 384, 391). Many replication proteins localize in cells as discrete foci marking the site of DNA synthesis (21, 22, 99, 203, 256). Some of the first evidence suggesting that mismatch repair is coupled to DNA synthesis came from visualizing the formation of mismatch repair foci in human cell culture and in live B. subtilis cells (181, 384, 391). In B. subtilis, MutS-GFP and MutL-GFP fusion alleles expressed from their native promoter were shown to form foci in a small proportion of cells (∼5 to 10% of cells) during exponential-phase growth, and this proportion was increased when cells were challenged with the mismatch-forming agent 2-aminopurine (2-AP) (384, 391). It should be noted that the mutS-gfp allele is functional and the mutL-gfp allele is nonfunctional with respect to mutant occurrence; however, the MutL-GFP fusion protein does form foci in response to mismatches, suggesting active recruitment in response to replication errors (391). The focus formation response by MutS-GFP and MutL-GFP requires ongoing DNA replication in B. subtilis (391). When MutS-GFP and MutL-GFP form foci, they preferentially localize to the midcell area, the site in the cell where DNA synthesis occurs (391). Moreover, MutS-YFP foci colocalize with the replisome (DnaX-CFP) in ∼48% of live cells (391). These data suggest that mismatch repair proteins are coupled to or function near the site of DNA replication in B. subtilis.

In support of a mechanism that couples mismatch repair to DNA synthesis in B. subtilis, it was recently shown that MutS alters the subcellular localization of the essential DNA polymerase DnaE in response to replication errors (182). In this work, ectopically expressed DnaE-GFP foci decreased in cells challenged with 2-AP or in cells that bore a proofreading-deficient polC allele (mut-1) (182). The decrease in DnaE-GFP foci required MutS, suggesting that the effect takes place at the step of mismatch recognition. Protein far-Western blot experiments demonstrated that both mismatch repair proteins MutS and MutL directly bind DnaE, suggesting that a strong interaction between these proteins may exist in vivo (182). Thus, MutS detection of mismatches affects the subcellular localization of an essential DNA polymerase in B. subtilis, suggesting that MutS is able to signal to or perturb the replication complex following mismatch identification in live cells (182). One candidate protein for recruiting MutS to active replication forks is the processivity β clamp, discussed below.

Recent work in S. cerevisiae made use of a functional fusion of the MutS homolog MSH6 to an S-phase-specific cyclin to restrict MSH6 protein expression to S phase. In this experiment, the MSH6–S-phase cyclin fusion protein conferred wild-type levels of mismatch repair (158). In contrast, when MSH6 expression was limited to G2/M by fusion to a G2/M-specific cyclin, mismatch repair was nonfunctional (158). In addition, live-cell imaging using fully functional fluorescent fusions to MSH6 showed colocalization with the replication machinery in live S. cerevisiae cells (157). Colocalization of MSH6 to replication forks corresponded to ∼15% of MMR in S. cerevisiae, and interestingly, it was required for functional mismatch repair in the absence of ExoI (157). This work shows that mismatch repair is coupled to DNA replication in S. cerevisiae, demonstrating that the coupling of mismatch repair to DNA replication is conserved in higher organisms and is not unique to Bacillus (157, 158).

Involvement of β Clamp in Mismatch Repair

The DNA replication processivity factor β clamp is important for linking mismatch repair foci to the DNA replication status (112, 384). B. subtilis MutS contains a five-amino-acid motif originally identified through bioinformatics analysis as a putative β clamp-binding site (91). Residues 810QLSFF814 provide a mostly hydrophobic plug that fits into a hydrophobic cleft on the β clamp (42, 91). Replacement of this motif with five alanine residues caused an ∼40-fold increase in measurements of mutant frequency, and a mutant form of MutS fused to GFP and bearing a replacement of QLSFF with five alanine residues was reduced ∼3-fold for focus formation in response to 2-AP challenge (384). Biochemical analysis shows that the β clamp binds to peptides bearing the QLSFF residues (384). Therefore, the MutS QLSFF motif is critical for interaction between MutS and the β clamp for efficient mismatch repair in B. subtilis (384).

Although mutation of the β clamp-binding motif in MutS increased the frequency of mutants of live cells, deletion of the 58-residue unstructured C-terminal region bearing this motif (resulting in the MutS800 protein) nearly abolished the interaction between B. subtilis MutS and the β clamp in vitro (384). Importantly, purified MutS800 protein bound to a mismatch at the same level as wild-type MutS in vitro, suggesting that removal of the C-terminal 58 amino acids does not diminish mismatch binding (384). Although it was expressed at wild-type levels, the mutS800 allele conferred a spontaneous mutant frequency close to that for a strain disrupted in the mutS gene. MutS800 fused with GFP failed to localize as a focus in response to 2-AP, and YFP fused to only the C-terminal 58 amino acids of MutS bearing the β clamp-binding motif was sufficient to target YFP for localization when the fusion was overexpressed (384). These data support the hypothesis that the β clamp aids in the formation of MutS-GFP foci in response to mismatches in vivo (384). This work also found that a conditional allele of dnaN (coding for the β clamp) which caused a partial defect in mismatch repair had a reduced capacity for supporting MutS-GFP focus formation in vivo (384). In addition, intragenic suppressors of the temperature-sensitive phenotype caused by this β clamp allele (dnaN5) maintained defects in mismatch repair while rescuing the DNA replication defect conferred by this allele. These data further support a role for the β clamp in mismatch repair in B. subtilis (112).

An important role for the β clamp (DnaN) in mismatch repair is strongly supported by studies of Bacillus anthracis. Interestingly, B. anthracis contains two dnaN genes: dnaN1 and dnaN2 (460). Both dnaN-encoded clamps support growth in vivo, yet deletion of dnaN1 confers a rate of spontaneous mutagenesis that is identical to that of B. anthracis cells disrupted for mismatch repair (460). These results show that both dnaN genes allow for proper DNA synthesis; however, only dnaN1 is capable of functioning in mismatch repair (460). These data further establish a role for the β clamp in correction of DNA replication errors in the genus Bacillus (460). The data from B. subtilis and B. anthracis show that MutS interaction with the β clamp is crucial for mismatch repair in some Gram-positive organisms, and it may be found to be important in other organisms that lack a dam-directed repair pathway, although this remains to be established. The involvement of the β clamp in mismatch repair in dam-directed systems such as that of E. coli is unclear and requires further study (221223, 314).

RecD2 Is a Possible Mismatch Repair Helicase in Bacillus

UvrD (DNA helicase II) is a 3′-5′ DNA helicase that functions during methylation-directed mismatch repair in E. coli (for a review, see references 192 and 362). B. subtilis contains two proteins showing homology to UvrD, namely, PcrA and YjcD (53, 307). PcrA is an essential helicase in B. subtilis, and the pcrA gene is able to complement the UV sensitivity conferred on E. coli lacking uvrD (307). It has been reported that a strain deficient in yjcD confers a wild-type level of mutagenesis (307). Thus, it is possible that PcrA functions in mismatch repair. Another possibility is that B. subtilis does not have a helicase that participates in mismatch repair and that mismatch correction is more similar to the process in eukaryotes, where an exonuclease (Exo I) is likely to function in the absence of a DNA helicase (for a review, see references 192 and 362). Recently, a screen for transposon insertions in B. anthracis that result in colony papillation revealed several genes that increase the rate of mutagenesis (461). Of these, a recD2 ortholog was identified, and this work showed that a recD2 deficiency in B. anthracis conferred a spontaneous mutation frequency and a mutation spectrum similar to those seen with a mismatch repair defect (461). Epistasis analysis of the recD2-deficient allele in combination with a mutS-defective allele showed a spontaneous mutation frequency that was similar to that of a strain bearing only a mutS deficiency, suggesting a role for RecD2 in mismatch repair in B. anthracis (462). RecD2 is similar to RecD1, a component of the RecBCD complex involved in end processing during DSB repair (e.g., see reference 462). RecD2 homologs are conserved in the Firmicutes and in Gram-positive bacteria that lack the RecBCD recombination complex (462). Based on these data, it is tempting to conclude that RecD2 helicases function in mismatch repair in many Gram-positive bacteria.

YshD, a MutS Paralog

In rare fashion, B. subtilis encodes MutS and a paralog, MutS2 (yshD). The mutS2 gene is transcribed during normal growth, and transcription continues until cells reach stationary phase (332). Disruption of mutS causes the substantial increase in mutagenesis expected for a gene product involved in mismatch repair (112, 135, 384). Disruption of mutS2 (yshD) has no observable effect on mutant frequency (332); however, analysis of the mutation spectrum in the rpoB genes of mutS2-deficient cells showed an unusual increase in transversion mutations (332). It has been suggested that such an increase could be attributed to inefficient repair of oxidative DNA damage; however, it is not known if mutS2-deficient strains are sensitive to oxidative damage (14). Analysis of the MutS2 protein in the Gram-negative organism Helicobacter pylori showed that MutS2 is an endonuclease involved in homologous recombination (312). Although the role for MutS2 in B. subtilis is unknown, based on conservation and analogy with other systems, B. subtilis MutS2 is probably an endonuclease involved in some unknown aspect of genome maintenance.

DNA DAMAGE TOLERANCE AND TRANSLESION SYNTHESIS

Translesion DNA polymerases are so named because they are capable of replicative bypass over noncoding bases that would normally block progression of a replicative DNA polymerase (for a review, see references 404 and 405). B. subtilis and many other Gram-positive bacteria contain two Y family DNA polymerases, termed PolY1 (YqjW) and PolY2 (YqjH) (403). PolY1 shows the highest sequence identity to E. coli UmuC, and PolY2 most closely resembles E. coli DinB (Pol IV) (403). In E. coli, UmuC cooperates with a posttranslationally modified version of UmuD called UmuD′ (for a review, see reference 297). This protein lacks the N-terminal 24 amino acids of UmuD, and two UmuD′ monomers dimerize and associate with UmuC to form DNA polymerase V (UmuD′2C) (327, 409). UmuD is not well conserved outside bacteria closely related to E. coli (119). Thus, a protein analogous to E. coli UmuD has not been identified in B. subtilis, though not without attempts (110). Therefore, we hypothesize that PolY1 of B. subtilis acts in the absence of an accessory factor analogous to E. coli UmuD. Both PolY1 and PolY2 in B. subtilis were originally identified through sequence comparisons to the E. coli Y family DNA polymerases and later in a genome-wide yeast two-hybrid assay aimed at identifying B. subtilis proteins that interact with the replication processivity β clamp (DnaN) (290, 403). Like the case with their E. coli counterparts, expression of PolY1 or PolY2 from an ectopic locus induces mutation frequency on undamaged DNA, but not to the same extent (110, 403).

It should be noted that E. coli cells deficient in dinB were originally identified as causing a minor decrease in untargeted UV mutagenesis of λ phage and later shown to have a more striking role in adaptive mutagenesis (37, 45, 254). B. subtilis PolY2 also has a role in adaptive or stationary-phase mutagenesis, as polY2 (yqjH)-deficient cells show a significant decease in stationary-phase his+ reversion (403). Thus, both E. coli DinB and B. subtilis PolY2 have roles in adaptive mutagenesis.

DnaE-Induced Mutagenesis

Translesion synthesis is not limited to DNA polymerases of the Y family, because C family DNA polymerases can also have roles in lesion bypass and mutagenesis in several Gram-positive bacteria. DnaE is the replicative polymerase in E. coli and other Gram-negative organisms (for a review, see references 170, 251, and 253). B. subtilis and many low-G+C Gram-positive bacteria contain two C family DNA polymerases, i.e., PolC and DnaE (186, 478). The composition of the replicative DNA polymerase in low-G+C Gram-positive bacteria is different from that of the Pol III characterized for E. coli. For readers interested in these differences, we suggest a series of reviews and research articles that have recently been published (40, 98, 186, 196, 251253, 352, 392, 427, 478). In the case of B. subtilis, Streptomyces coelicolor, Streptococcus pyogenes, S. aureus, and Enterococcus faecalis, the dnaE gene is essential (99, 125, 126, 164). The essential role of DnaE in B. subtilis is due to the requirement for utilization of RNA primers on the lagging strand during replication (352). DnaE can efficiently extend from an RNA primer, and PolC cannot (352). DnaE in Gram-negative organisms has an associated proofreading ε subunit (DnaQ) which provides the 3′-5′ exonuclease activity, allowing for proofreading and thus high-fidelity DNA replication (115, 360). Searches of B. subtilis coding sequences have failed to identify an ε subunit that would be available to associate with DnaE (data not shown). Extensive biochemical characterization of S. pyogenes DnaE showed that this protein is error prone, can easily bypass abasic sites, and can efficiently extend from a mismatched primer terminus (39). All of this evidence points to DnaE of S. pyogenes providing a role in mutagenesis and translesion synthesis (39).

As mentioned above, the dnaE gene product in B. subtilis is essential and required for maturation of the lagging strand in vitro (352). DnaE protein levels in B. subtilis have been shown to increase following DNA damage, and DnaE protein levels are elevated in cells deficient for lexA (196). In addition, the dnaE gene has a LexA binding site located upstream, and dnaE transcripts are induced ∼11-fold in response to DNA damage (10). These data support the hypothesis that DnaE could have a role in DNA repair or lesion bypass, in addition to its essential role in chromosomal DNA replication. Consistent with a role for DnaE in lesion bypass, B. subtilis DnaE has been shown to bypass N2-acetylaminofluorene guanine and AP sites with low efficiency, although DnaE was unable to bypass benzo-(a)-pyrene adducts or 6-4 TT photoproducts (196). It was also recently shown that the percentage of cells with DnaE-GFP foci was elevated in cells challenged with the DNA damaging agent mitomycin C, further suggesting a role for DnaE in repair or translesion synthesis across from mitomycin C adducts (182). Together, the data indicate that dnaE encodes an SOS-inducible DNA polymerase capable of lesion bypass in vitro and that DnaE is essential for chromosomal replication in vivo.

In some Gram-positive bacteria, typified by M. tuberculosis, PolC is absent, and M. tuberculosis instead contains two dnaE genes (dnaE1 and dnaE2) (33). The dnaE1 gene is essential, and deletion of dnaE2 abolishes induced mutagenesis (33). It seems that bacteria containing two DnaE-type DNA polymerases use the dnaE2 gene product for lesion bypass in vivo.

DNA INTEGRITY REGULATES BACTERIAL CELL DIVISION

When bacterial cells experience DNA damage or replication fork stress during vegetative growth, a response is activated to prevent cell division (57, 161, 177, 269, 294). A block to cell division, either transient or prolonged, allows for repair of damaged DNA, ensuring that a broken or otherwise damaged chromosome is not segregated into a new cell. Cells experiencing a sustained block to cell division show filamentation, meaning that cells continue to grow in length without a cell division event. For example, in E. coli, inhibition of the cell cycle is accomplished through the SOS-induced expression of SulA (sfiA or sulA). SulA prevents cell division by inhibiting polymerization of FtsZ, the tubulin ortholog responsible for cytokinesis (for a review, see references 147 and 283). After the SOS response is turned off, SulA is rapidly degraded by Lon protease, allowing for cell division to resume, and cell cycle progression continues (267). In B. subtilis, the yneA gene is SOS regulated, and expression of yneA inhibits cell division. We discuss YneA in greater detail below.

RecA-Dependent Regulation of Cell Division

When B. subtilis is challenged with DNA damage, cells filament in a recA-dependent manner (177, 225). The yneA gene is transcribed divergently from the lexA gene, and the yneA promoter region contains three LexA binding sites (10, 177). Inactivation of the yneA gene prevents DNA damage-inducible cell filamentation (177). YneA is a small protein secreted by the Sec pathway (232). It has a single transmembrane segment and a C-terminal peptidoglycan-binding LysM domain separated by a predicted protease cleavage site (268). YneA shares no sequence similarity to E. coli SulA (177). If yneA is under the control of an inducible promoter, expression of yneA is sufficient to prevent cell division, with cells growing to a mean length of about 5.5 μm (177). Upon subsequent depletion of inducer and repression of yneA expression, filamenting cells rapidly engage in cell division, and the average cell length returns to ∼3 μm in as little as 20 min (268). These data show that cell division resumes efficiently after yneA expression is blocked, indicating that the YneA protein is rapidly cleared (268). Mutational analysis indicates that full-length YneA is necessary to inhibit cell division. Upon signal peptide cleavage, the LysM domain of YneA is released into the culture medium, inactivating YneA, which is followed by rapid degradation by extracellular proteases (268). It should be noted that overexpression of yneA also appears to impair separation of daughter cells following cell division, suggesting an additional role of YneA in cell wall remodeling (268). Furthermore, yneA is upregulated by the competence transcription factor ComK, suggesting a potential in vivo role in daughter cell separation following entry into stationary phase (295).

Currently, the mechanism that YneA uses to inhibit cell division in B. subtilis is unknown. Ectopic expression of yneA or expression of yneA through disruption of lexA caused a reduction or slight loss of FtsZ ring formation (177, 268). Yeast two-hybrid analysis failed to detect an interaction between YneA and FtsZ (177). It has been proposed that YneA may interact with a component of the cell division apparatus, probably through its transmembrane domain (268). Consistent with this idea, mutations in the transmembrane domain of YneA inactivate its ability to block cytokinesis (268). Furthermore, these mutations cluster to a single face of the transmembrane helix, adding evidence that the transmembrane domain may facilitate checkpoint activation through interaction with another protein, or perhaps through direct contact and inhibition of the cell division apparatus (268). Transmembrane domains have previously been shown to facilitate formation of hetero- and homo-oligomers during complex formation (202, 414). Interestingly, the newly discovered Caulobacter crescentus SOS-induced inhibitor of cell division A (SidA) was shown to prevent cell division by blocking the final stages of cytokinesis through inhibiting formation of the FtsWIN subcomplex (269). The interaction between SidA and FtsW occurs partly through the transmembrane domain, and mutations localized to the transmembrane domain abolish SidA-dependent blocks to cell division (269).

Blocking of cytokinesis is widely conserved among bacterial checkpoint proteins, as exemplified by YneA gene orthologs present in other Gram-positive bacteria, including L. monocytogenes (yneA), M. tuberculosis (Rv2719c), and Corynebacterium glutamicum (divS) (57, 294). Like B. subtilis yneA, these genes all maintain LexA-dependent repression, have a conserved genomic position adjacent to lexA, and are sufficient to prevent cell division when expressed (57, 294). Challenge of M. tuberculosis with cell wall antibiotics or the DNA damaging agent mitomycin C induces expression of Rv2719c and results in a block to cell division resulting in cell filamentation (57). Deletion of Rv2719c renders cells highly sensitive to DNA damaging agents, indicative of a checkpoint-like function (57). The DivS protein of C. glutamicum does not show sequence similarity to YneA or M. tuberculosis Rv2719c, but this protein does appear to have a single-pass transmembrane domain (294). It also appears that peptidoglycan synthesis at midcell and, to some extent, FtsZ ring assembly are altered upon divS induction following mitomycin C challenge (294). It is not known whether DivS, YneA, and Rv2719c directly inhibit Z ring assembly, like SulA, or whether they do so indirectly, regulating a late stage in cell division, like Caulobacter SidA. It should be noted that all known functional analogs of B. subtilis YneA aside from E. coli SulA, which is cytoplasmic, possess a single transmembrane domain. YneA may therefore represent a more widely conserved mode of inhibiting cell division than the SulA-type mechanism present in E. coli (57, 268, 269, 294).

RecA-Independent and DnaA-Dependent Regulation of Cell Division

B. subtilis regulates DNA replication initiation through regulating the activity of the initiation protein DnaA at the origin, oriC (for a review, see reference 273). The formation of a nucleoprotein complex between DnaA and oriC marks the start of replication initiation, a process that ultimately facilitates local chromosome unwinding and the assembly of the replication apparatus at the origin (e.g., see references 172, 173, and 282). DnaA is essential and is required for replication initiation in virtually all free-living bacteria (for a review, see reference 172). Although the essential function of DnaA is in DNA replication initiation, we focus on other roles for DnaA here and refer readers to several comprehensive reviews of DnaA and its role in chromosomal DNA replication initiation (e.g., see references 172, 173, and 282).

In addition to the well-defined roles for DnaA in replication initiation, DnaA has also been shown to function as a transcription factor that activates or represses transcription of a variety of genes, including its own (138). Results from gene profiling studies performed with B. subtilis show that DnaA controls a regulon comprising 56 genes in 20 operons (138). Among these DnaA-regulated genes, putative DnaA binding sites were identified upstream of 19 of the 20 operons (138). Furthermore, DnaA has been shown to bind a number of these sites in vivo, as determined by chromatin immunoprecipitation (138).

A striking finding was that DnaA is capable of sensing DNA replication fork perturbations, resulting in alterations to the expression of DnaA-regulated genes (138). Upon closer analysis of the DnaA regulon, two genes of particular interest were found: sda and ftsL (Fig. 7). Suppressor of dnaA (Sda) is a sporulation checkpoint protein and is described in detail below; however, we focus here on ftsL and the regulation of cell division. In contrast to the case for yneA, which is SOS regulated, ftsL regulation of cell division is recA independent (138). Upon encountering DNA replication stress, DnaA binds to the promoter region of the yllB-ylxA-ftsL-pbpB operon, downregulating transcription 2- to 4-fold and ultimately preventing additional rounds of cell division (138).

Fig 7.

Fig 7

Schematic diagram of the genome maintenance checkpoints in B. subtilis. (A) The interplay between DNA replication and entry into the sporulation program is carefully regulated. The cell cycle regulator protein Sda prevents sporulation when DNA replication is ongoing. In contrast, SirA is activated upon entry into sporulation to prevent new rounds of DNA replication. In addition, entry into sporulation is regulated by at least two separate pathways in response to DNA damage. Sda is upregulated by the SOS response, and DisA senses DNA repair intermediates. Both Sda and DisA inhibit Spo0A phosphorylation, delaying progression of sporulation. (B) B. subtilis has mechanisms that prevent cell division when damaged chromosomes are detected. DnaA regulates cell division by decreasing levels of FtsL, and YneA is an SOS-regulated gene which blocks cell division through an unknown mechanism. These cell cycle checkpoints prevent septum formation and provide cells with a transient period to repair their DNA prior to cytokinesis. Green arrows represent activation events, red line segments represent repression or inactivation, and the black arrow indicates that DNA damage has occurred. (Adapted from reference 433 with permission of the publisher.)

The penicillin-binding protein 2B gene (pbpB) and ftsL are essential genes required for cell division (183). FtsL has an unknown function but is known to form an oligomeric complex with DivIB and DivIC preceding cell division, and this recruitment is dependent on FtsZ ring formation (94, 382, 383). PbpB synthesizes peptidoglycan that eventually constitutes the new poles of daughter cells (120, 136). PbpB is a stable septal protein, whereas FtsL has been shown to be unstable, making ftsL an ideal target for regulating a cell division checkpoint (92, 138). Depletion of FtsL independent of pbpB results in substantial cell filamentation, as cell division is arrested at a step preceding septum formation and membrane invagination (93). Following a perturbation to the DNA replication fork, DnaA binds to and represses expression of the operon containing ftsL (138). Due to the instability of FtsL, the steady-state level drops, causing a block to cell division. The FtsL cell division checkpoint may prevent cytokinesis over unsegregated chromosomes arrested for DNA synthesis. Interestingly, it appears that the regulation of ftsL by DnaA is broadly conserved (138). The mechanism used by DnaA to sense a perturbation to DNA replication is unknown.

GENOME INTEGRITY AND CHECKPOINT CONTROL DURING DEVELOPMENT

The developmental program of sporulation ensues when nutrients become limiting (for a review, see references 95, 114, 304, and 309). Nutrient limitation triggers the histidine kinases KinA, KinB, and KinC to produce a phosphorylation cascade that phosphorylates the master regulator of sporulation, the transcription factor Spo0A (making Spo0A∼P). Spo0A∼P regulates the transcription of genes whose products initiate the developmental program (271). As the program progresses, an asymmetric septum forms and separates two distinct compartments: the mother cell and the developing forespore. At the beginning of sporulation, cells contain 2 copies (2C) of the chromosome; one remains in the mother cell, while the other is translocated into the developing forespore (456).

Coupling Development to DNA Replication

B. subtilis has mechanisms to ensure a 2C chromosome copy number as it enters sporulation. If the cell enters sporulation with fewer than 2 chromosomal copies, the cell risks producing an anucleate endospore. In contrast, if the cell enters the sporulation program with more than 2 chromosomal copies, it may produce spores with multiple chromosomes or with twin spores, with one spore located at each cell pole (426). To avoid these outcomes, B. subtilis couples the process of sporulation to DNA replication (234, 235). Such coupling provides a brief window during the cell cycle in which sporulation can be initiated. If at any point during the cell cycle DNA damage or replicative stress occurs, the sporulation program will be inhibited to allow for repair or continued DNA replication. By inhibiting DNA replication elongation with the PolC-specific drug HPURa [6-(p-hydroxyphenylazo)uracil], it was shown that inhibition of sporulation was recA dependent (166). Experiments using alleles that are temperature sensitive for replication initiation (dnaA1, dnaB19, and dnaD23) showed that sporulation was inhibited when replication initiation was inhibited (165, 204). This pathway used a recA-independent mechanism to delay sporulation. In both the recA-dependent and recA-independent pathways, sporulation is halted by inhibiting formation of Spo0A∼P. An allele of spo0A (rvtA11) that permits its activation directly by KinC bypassed the replication inhibition defect (165, 166, 204). These data indicate that the DNA replication status during sporulation is sensed and that this information is used to regulate formation of Spo0A∼P.

Sda

The source of coupling between the B. subtilis replication cycle and its entry into sporulation is sda. Mutations in the sda locus allowed B. subtilis to sporulate in a dnaA1 temperature-sensitive mutant at the restrictive temperature in the absence of DNA replication initiation (43). Sda inhibits KinA and KinB, such that phosphorylation of Spo0A no longer efficiently occurs when levels of Sda are elevated upon inhibition of DNA replication (34). In this way, Sda inhibits sporulation by limiting Spo0A∼P levels (34). In vitro studies have confirmed that Sda inhibits KinA by binding its autokinase domain, preventing autophosphorylation and subsequent activation (333).

Sda protein levels are correlated directly with stages of the cell cycle and rely on cell cycle-dependent gene transcription, as well as the instability of Sda, to transiently prevent entry into sporulation (426). The sda promoter contains 5 dnaA boxes that allow regulation of sda transcription at the beginning of each cell cycle through binding of DnaA (43, 138, 426). Reductions in Sda levels correlate with the end of DNA replication, ensuring that a 2C DNA content is present before sporulation to help ensure viable spores. However, to enter into the sporulation program, the cell must reduce the amount of Sda in the cell to allow for Spo0A activation at the appropriate time. This process is performed by ClpXP-mediated proteolysis. In vivo, Sda maintains a half-life on the order of minutes (336, 426) due to residues at its C terminus that target Sda for degradation (V-S-S-COOH) (140, 336).

In addition to dnaA-dependent regulation of the sda locus, the SOS response can also mediate an increase in Sda levels in response to DNA damage or stalled replication forks (10, 336). The sda promoter contains a putative LexA binding site that has been shown to be responsive to UV damage and HPURa treatments (10, 166, 336). DNA damage-dependent upregulation of sda prevents entry into sporulation when chromosomal DNA is damaged.

SirA

As an additional measure to maintain the proper chromosome number during sporulation, B. subtilis can inhibit DNA replication initiation through the action of the checkpoint protein SirA (sporulation inhibitor of replication A) (yneE) (322, 323, 433). Using this checkpoint, the cell ensures that the 2C DNA content is maintained (322, 323, 433). The sirA gene was identified in the Spo0A regulon and found to inhibit DNA replication initiation (322, 323, 433). In addition, it was shown that artificial expression of sirA during vegetative growth caused a block in DNA replication initiation (322, 433). Conversely, sporulating cells deficient in sirA overreplicate, as assayed by observing genome equivalents or the origin copy number during sporulation (322, 433).

SirA prevents DNA replication initiation by binding DnaA and sequestering it from oriC (322, 433). In addition, cells that lack oriC and initiate replication through an ectopically integrated origin (oriN) that does not require DnaA for replication initiation are refractory to the inhibitory action of SirA (433). Depletion of DnaA blocks GFP-SirA focus formation, and expression of SirA causes DnaA-GFP foci to disperse (433). It was further shown that SirA binds to a group of amino acids (N44, F46, and V47) residing in domain 1 of DnaA, presumably preventing DnaA from establishing an active initiation complex at oriC (323). Mutation of these DnaA residues causes the cell to be unaffected by the inhibitory action of SirA (323).

Together, Sda and SirA maintain the 2C DNA content as cells enter sporulation. Sda prevents sporulation from occurring too early in the replication cycle, guarding against 1C bacteria undergoing development. Conversely, SirA expression is activated by Spo0A∼P upon entrance of B. subtilis into sporulation, thus preventing overreplication during development and preventing an increase in chromosomal copy number, which can reduce spore viability (426) (Fig. 7).

DisA

In addition to the importance of entering sporulation with two copies of the chromosome, B. subtilis must also ensure that genome integrity is maintained. One approach is recA-dependent transcription of sda as discussed above, and the other involves disA (19). DisA (DNA integrity scanning protein A) is a checkpoint protein that mediates a delay in sporulation following detection of DNA damage (19). In the absence of disA, the checkpoint fails and cells with damaged chromosomes progress into sporulation, producing nonviable spores (19). The disA-dependent checkpoint appears to attenuate phosphorylation of the master regulator Spo0A, preventing cells from entering sporulation following the detection of DNA damage (19).

How does DisA monitor genome integrity? DisA moves throughout the cell, scanning the chromosome for intermediates of DNA repair. DisA fused to GFP forms a dynamic complex that actively moves throughout the cell and pauses at sites of DNA damage (19). DisA movement requires that the cell make ATP and is independent of the cytoskeletal proteins MreB and Mbl (19). DisA-GFP also forms a mobile complex in the absence of DNA, suggesting that its movement is DNA independent (19).

Structural determination of a DisA homolog from Thermotoga maritima found that DisA has diadenylate cyclase activity (454). Specifically, this activity allows DisA to synthesize the second messenger c-di-AMP [bis-(3′,5′)-cyclic dimeric AMP] (454), and diadenylate cyclase activity is important for DisA-GFP focus movement in vivo (299). Interestingly, DisA diadenylate cyclase activity is regulated by different DNA substrates (454). DisA is unaffected by a ssDNA oligonucleotide or a blunt dsDNA substrate (454). However, branched DNA substrates that mimic intermediates of recombination, including 5′- and 3′-flapped structures or three- and four-way junctions, modulate diadenylate cyclase activity of DisA (454). These substrates reduce the rate of c-di-AMP production, which suggests that DisA does not scan for DNA damage per se but instead identifies intermediates of DNA repair, such as Holliday junctions. This model was also supported in vivo by monitoring a disA-dependent increase in endogenous levels of c-di-AMP (299). Following challenge of cells with DNA damaging agents, c-di-AMP levels dropped, supporting the idea that DisA signals that genome integrity is compromised through a decrease in c-di-AMP production (299). To further support this model, the B. subtilis protein YybT was shown to ensure a constant turnover of c-di-AMP in vivo by degrading the signaling molecule and allowing for a quick and efficient decrease following the DNA damage-dependent attenuation of c-di-AMP production by DisA (299).

The current model invokes a mechanism where DisA scans the B. subtilis chromosome for intermediates of DNA repair. Upon identifying a Holliday junction or other DNA repair intermediate, DisA diadenylate cyclase activity is attenuated. The reduction in c-di-AMP may act as a signal to pause entry into sporulation by preventing an increase in Spo0A∼P levels in vivo (Fig. 7).

CONCLUDING REMARKS

DNA replication, repair, and mutagenesis have been studied in B. subtilis and other Gram-positive bacteria for over 40 years. During this time, we have begun to appreciate that the mechanisms allowing for genome replication and repair are often different from the pathways described for the bacterial prototype, E. coli. During the last 10 years, researchers in the field have discovered new proteins and pathways with intricate mechanisms of regulation, and we have witnessed a spectacular increase in our understanding of genome maintenance in B. subtilis and other Gram-positive bacteria. This has allowed for a greater appreciation of the differences in the pathways of different bacteria and has provided a platform for understanding the molecular details of genome maintenance. We look forward to learning the mechanistic details of these pathways in years to come.

There are several other areas under active investigation that have contributed significantly to our knowledge of genome stability in B. subtilis and other Gram-positive bacteria. These include but are not limited to stationary-phase mutagenesis, natural genetic transformation, and the mechanisms that allow for spores to be resistant to genotoxic stress. We chose not to discuss these topics because several excellent review articles have been published on these subjects, and we direct readers interested in these subjects to those comprehensive reviews (6264, 108, 109, 286, 287, 304, 329, 367371, 413).

ACKNOWLEDGMENTS

We thank the many labs that founded the fields of DNA replication, repair, and genome maintenance in Gram-positive bacteria. We regret not being able to cite all of the work that has shaped these fields over the last several decades. We thank members of the Simmons lab, Eileen Brandes, Nick Bolz, and Gabriella Szewczyk for comments and discussions on the manuscript. We also thank three anonymous referees for their helpful comments, which improved the manuscript.

This work was supported by grant MCB1050948 from the National Science Foundation, by a grant from the Wendy Will Case Cancer Fund, and by start-up funds from the University of Michigan and the Department of Molecular, Cellular, and Developmental Biology to L.A.S. The NIH Genetics Training Grant at the University of Michigan supported J.W.S. during this work (T32 GM007544).

Biographies

Justin S. Lenhart is a graduate student in the Department of Molecular, Cellular, and Developmental Biology at the University of Michigan. His doctoral studies are on mismatch repair in the Simmons lab. Justin received his B.S. in Cellular and Molecular Biology from the University of Michigan in 2007.

Jeremy W. Schroeder is a graduate student at the University of Michigan in the Department of Molecular, Cellular, and Developmental Biology. He is a member of the Simmons lab, where he studies mismatch repair. Jeremy received his B.S. in Biology from Ohio Northern University.

Brian W. Walsh is a graduate student at the University of Michigan in the Department of Molecular, Cellular, and Developmental Biology. He is a member of the Simmons lab and is studying helicases. He received his B.S. in Microbiology and Molecular Genetics from Michigan State University in 2006.

Lyle A. Simmons is an Assistant Professor in the Department of Molecular, Cellular, and Developmental Biology at the University of Michigan in Ann Arbor. He received his B.S. in Biology from Alma College and his Ph.D. in Biochemistry and Molecular Biology from Michigan State University, where he studied the initiation of DNA replication in E. coli. Dr. Simmons was a postdoctoral fellow in the Department of Biology at the Massachusetts Institute of Technology, where he studied DNA repair and genome maintenance in B. subtilis. Since establishing his lab at the University of Michigan, Dr. Simmons has continued to study DNA mismatch repair, and he teaches introductory microbiology and an advanced undergraduate course covering genome stability.

REFERENCES

  • 1. Aamodt RM, Falnes PO, Johansen RF, Seeberg E, Bjoras M. 2004. The Bacillus subtilis counterpart of the mammalian 3-methyladenine DNA glycosylase has hypoxanthine and 1,N6-ethenoadenine as preferred substrates. J. Biol. Chem. 279:13601–13606 [DOI] [PubMed] [Google Scholar]
  • 2. Ahrends R, et al. 2006. Identifying an interaction site between MutH and the C-terminal domain of MutL by crosslinking, affinity purification, chemical coding and mass spectrometry. Nucleic Acids Res. 34:3169–3180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Alonso JC, Stiege AC, Luder G. 1993. Genetic recombination in Bacillus subtilis 168: effect of recN, recF, recH and addAB mutations on DNA repair and recombination. Mol. Gen. Genet. 239:129–136 [DOI] [PubMed] [Google Scholar]
  • 4. Alonso JC, Tailor RH, Luder G. 1988. Characterization of recombination-deficient mutants of Bacillus subtilis. J. Bacteriol. 170:3001–3007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Alseth I, et al. 2006. A new protein superfamily includes two novel 3-methyladenine DNA glycosylases from Bacillus cereus, AlkC and AlkD. Mol. Microbiol. 59:1602–1609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ampatzidou E, Irmisch A, O'Connell MJ, Murray JM. 2006. Smc5/6 is required for repair at collapsed replication forks. Mol. Cell. Biol. 26:9387–9401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Aravind L, Koonin EV. 2001. Prokaryotic homologs of the eukaryotic DNA-end-binding protein Ku, novel domains in the Ku protein and prediction of a prokaryotic double-strand break repair system. Genome Res. 11:1365–1374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Aravind L, Walker DR, Koonin EV. 1999. Conserved domains in DNA repair proteins and evolution of repair systems. Nucleic Acids Res. 27:1223–1242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Aten JA, et al. 2004. Dynamics of DNA double-strand breaks revealed by clustering of damaged chromosome domains. Science 303:92–95 [DOI] [PubMed] [Google Scholar]
  • 10. Au N, et al. 2005. Genetic composition of the Bacillus subtilis SOS system. J. Bacteriol. 187:7655–7666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Ayora S, et al. 2011. Double-strand break repair in bacteria: a view from Bacillus subtilis. FEMS Microbiol. Rev. 35:1055–1081 [DOI] [PubMed] [Google Scholar]
  • 12. Ayora S, Carrasco B, Doncel-Perez E, Lurz R, Alonso JC. 2004. Bacillus subtilis RecU protein cleaves Holliday junctions and anneals single-stranded DNA. Proc. Natl. Acad. Sci. U. S. A. 101:452–457 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ayora S, Rojo F, Ogasawara N, Nakai S, Alonso JC. 1996. The Mfd protein of Bacillus subtilis 168 is involved in both transcription-coupled DNA repair and DNA recombination. J. Mol. Biol. 256:301–318 [DOI] [PubMed] [Google Scholar]
  • 14. Banos B, Lazaro JM, Villar L, Salas M, de Vega M. 2008. Characterization of a Bacillus subtilis 64-kDa DNA polymerase X potentially involved in DNA repair. J. Mol. Biol. 384:1019–1028 [DOI] [PubMed] [Google Scholar]
  • 15. Banos B, Villar L, Salas M, de Vega M. 2010. Intrinsic apurinic/apyrimidinic (AP) endonuclease activity enables Bacillus subtilis DNA polymerase X to recognize, incise, and further repair abasic sites. Proc. Natl. Acad. Sci. U. S. A. 107:19219–19224 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Barnes MH, LaMarr WA, Foster KA. 2003. DNA gyrase and DNA topoisomerase of Bacillus subtilis: expression and characterization of recombinant enzymes encoded by the gyrA, gyrB and parC, parE genes. Protein Expr. Purif. 29:259–264 [DOI] [PubMed] [Google Scholar]
  • 17. Baute J, Depicker A. 2008. Base excision repair and its role in maintaining genome stability. Crit. Rev. Biochem. Mol. Biol. 43:239–276 [DOI] [PubMed] [Google Scholar]
  • 18. Bayles KW, et al. 1994. A genetic and molecular characterization of the recA gene from Staphylococcus aureus. Gene 147:13–20 [DOI] [PubMed] [Google Scholar]
  • 19. Bejerano-Sagie M, et al. 2006. A checkpoint protein that scans the chromosome for damage at the start of sporulation in Bacillus subtilis. Cell 125:679–690 [DOI] [PubMed] [Google Scholar]
  • 20. Bennett SE, Mosbaugh DW. 1992. Characterization of the Escherichia coli uracil-DNA glycosylase.inhibitor protein complex. J. Biol. Chem. 267:22512–22521 [PubMed] [Google Scholar]
  • 21. Berkmen MB, Grossman AD. 2006. Spatial and temporal organization of the Bacillus subtilis replication cycle. Mol. Microbiol. 62:57–71 [DOI] [PubMed] [Google Scholar]
  • 22. Berkmen MB, Grossman AD. 2007. Subcellular positioning of the origin region of the Bacillus subtilis chromosome is independent of sequences within oriC, the site of replication initiation, and the replication initiator DnaA. Mol. Microbiol. 63:150–165 [DOI] [PubMed] [Google Scholar]
  • 23. Bernard R, Marquis KA, Rudner DZ. 2010. Nucleoid occlusion prevents cell division during replication fork arrest in Bacillus subtilis. Mol. Microbiol. 78:866–882 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Bernstein DA, Keck JL. 2003. Domain mapping of Escherichia coli RecQ defines the roles of conserved N- and C-terminal regions in the RecQ family. Nucleic Acids Res. 31:2778–2785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Bessman MJ, Frick DN, O'Handley SF. 1996. The MutT proteins or “Nudix” hydrolases, a family of versatile, widely distributed, “housecleaning” enzymes. J. Biol. Chem. 271:25059–25062 [DOI] [PubMed] [Google Scholar]
  • 26. Bhatnagar SK, Bessman MJ. 1988. Studies on the mutator gene, mutT of Escherichia coli. Molecular cloning of the gene, purification of the gene product, and identification of a novel nucleoside triphosphatase. J. Biol. Chem. 263:8953–8957 [PubMed] [Google Scholar]
  • 27. Bisognano C, et al. 2004. A recA-lexA-dependent pathway mediates ciprofloxacin-induced fibronectin binding in Staphylococcus aureus. J. Biol. Chem. 279:9064–9071 [DOI] [PubMed] [Google Scholar]
  • 28. Bjelland S, Seeberg E. 2003. Mutagenicity, toxicity and repair of DNA base damage induced by oxidation. Mutat. Res. 531:37–80 [DOI] [PubMed] [Google Scholar]
  • 29. Boehmer PE, Emmerson PT. 1992. The RecB subunit of the Escherichia coli RecBCD enzyme couples ATP hydrolysis to DNA unwinding. J. Biol. Chem. 267:4981–4987 [PubMed] [Google Scholar]
  • 30. Bond CS, Kvaratskhelia M, Richard D, White MF, Hunter WN. 2001. Structure of Hjc, a Holliday junction resolvase, from Sulfolobus solfataricus. Proc. Natl. Acad. Sci. U. S. A. 98:5509–5514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Bork JM, Cox MM, Inman RB. 2001. The RecOR proteins modulate RecA protein function at 5′ ends of single-stranded DNA. EMBO J. 20:7313–7322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Bose B, Auchtung JM, Lee CA, Grossman AD. 2008. A conserved anti-repressor controls horizontal gene transfer by proteolysis. Mol. Microbiol. 70:570–582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Boshoff HI, Reed MB, Barry CE, 3rd, Mizrahi V. 2003. DnaE2 polymerase contributes to in vivo survival and the emergence of drug resistance in Mycobacterium tuberculosis. Cell 113:183–193 [DOI] [PubMed] [Google Scholar]
  • 34. Bowater R, Doherty AJ. 2006. Making ends meet: repairing breaks in bacterial DNA by non-homologous end-joining. PLoS Genet. 2:e8 doi:10.1371/journal.pgen.0020008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Britton RA, Grossman AD. 1999. Synthetic lethal phenotypes caused by mutations affecting chromosome partitioning in Bacillus subtilis. J. Bacteriol. 181:5860–5864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Britton RA, Lin DC, Grossman AD. 1998. Characterization of a prokaryotic SMC protein involved in chromosome partitioning. Genes Dev. 12:1254–1259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Brotcorne-Lannoye A, Maenhaut-Michel G. 1986. Role of RecA protein in untargeted UV mutagenesis of bacteriophage lambda: evidence for the requirement for the dinB gene. Proc. Natl. Acad. Sci. U. S. A. 83:3904–3908 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Bruand C, Farache M, McGovern S, Ehrlich SD, Polard P. 2001. DnaB, DnaD and DnaI proteins are components of the Bacillus subtilis replication restart primosome. Mol. Microbiol. 42:245–255 [DOI] [PubMed] [Google Scholar]
  • 39. Bruck I, Goodman MF, O'Donnell M. 2003. The essential C family DnaE polymerase is error-prone and efficient at lesion bypass. J. Biol. Chem. 278:44361–44368 [DOI] [PubMed] [Google Scholar]
  • 40. Bruck I, O'Donnell M. 2000. The DNA replication machine of a gram-positive organism. J. Biol. Chem. 275:28971–28983 [DOI] [PubMed] [Google Scholar]
  • 41. Bunny K, Liu J, Roth J. 2002. Phenotypes of lexA mutations in Salmonella enterica: evidence for a lethal lexA null phenotype due to the Fels-2 prophage. J. Bacteriol. 184:6235–6249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Bunting KA, Roe SM, Pearl LH. 2003. Structural basis for recruitment of translesion DNA polymerase Pol IV/DinB to the beta-clamp. EMBO J. 22:5883–5892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Burkholder WF, Kurtser I, Grossman AD. 2001. Replication initiation proteins regulate a developmental checkpoint in Bacillus subtilis. Cell 104:269–279 [DOI] [PubMed] [Google Scholar]
  • 44. Burton NA, Johnson MD, Antczak P, Robinson A, Lund PA. 2010. Novel aspects of the acid response network of E. coli K-12 are revealed by a study of transcriptional dynamics. J. Mol. Biol. 401:726–742 [DOI] [PubMed] [Google Scholar]
  • 45. Cairns J, Foster PL. 1991. Adaptive reversion of a frameshift mutation in Escherichia coli. Genetics 128:695–701 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Canas C, Carrasco B, Ayora S, Alonso JC. 2008. The RecU Holliday junction resolvase acts at early stages of homologous recombination. Nucleic Acids Res. 36:5242–5249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Canas C, et al. 2011. The stalk region of the RecU resolvase is essential for Holliday junction recognition and distortion. J. Mol. Biol. 410:39–49 [DOI] [PubMed] [Google Scholar]
  • 48. Carneiro MJ, et al. 2006. The DNA-remodelling activity of DnaD is the sum of oligomerization and DNA-binding activities on separate domains. Mol. Microbiol. 60:917–924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Carrasco B, Ayora S, Lurz R, Alonso JC. 2005. Bacillus subtilis RecU Holliday-junction resolvase modulates RecA activities. Nucleic Acids Res. 33:3942–3952 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Carrasco B, Canas C, Sharples GJ, Alonso JC, Ayora S. 2009. The N-terminal region of the RecU holliday junction resolvase is essential for homologous recombination. J. Mol. Biol. 390:1–9 [DOI] [PubMed] [Google Scholar]
  • 51. Carrasco B, Cozar MC, Lurz R, Alonso JC, Ayora S. 2004. Genetic recombination in Bacillus subtilis 168: contribution of Holliday junction processing functions in chromosome segregation. J. Bacteriol. 186:5557–5566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Carrasco B, Fernandez S, Asai K, Ogasawara N, Alonso JC. 2002. Effect of the recU suppressors sms and subA on DNA repair and homologous recombination in Bacillus subtilis. Mol. Genet. Genomics 266:899–906 [DOI] [PubMed] [Google Scholar]
  • 53. Carrasco B, Fernandez S, Petit MA, Alonso JC. 2001. Genetic recombination in Bacillus subtilis 168: effect of DeltahelD on DNA repair and homologous recombination. J. Bacteriol. 183:5772–5777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Carrasco B, Manfredi C, Ayora S, Alonso JC. 2008. Bacillus subtilis SsbA and dATP regulate RecA nucleation onto single-stranded DNA. DNA Repair (Amsterdam) 7:990–996 [DOI] [PubMed] [Google Scholar]
  • 55. Castellanos-Juarez FX, et al. 2006. YtkD and MutT protect vegetative cells but not spores of Bacillus subtilis from oxidative stress. J. Bacteriol. 188:2285–2289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Chatterji M, Sengupta S, Nagaraja V. 2003. Chromosomally encoded gyrase inhibitor GyrI protects Escherichia coli against DNA-damaging agents. Arch. Microbiol. 180:339–346 [DOI] [PubMed] [Google Scholar]
  • 57. Chauhan A, et al. 2006. Interference of Mycobacterium tuberculosis cell division by Rv2719c, a cell wall hydrolase. Mol. Microbiol. 62:132–147 [DOI] [PubMed] [Google Scholar]
  • 58. Chedin F, Ehrlich SD, Kowalczykowski SC. 2000. The Bacillus subtilis AddAB helicase/nuclease is regulated by its cognate Chi sequence in vitro. J. Mol. Biol. 298:7–20 [DOI] [PubMed] [Google Scholar]
  • 59. Chedin F, Handa N, Dillingham MS, Kowalczykowski SC. 2006. The AddAB helicase/nuclease forms a stable complex with its cognate Chi sequence during translocation. J. Biol. Chem. 281:18610–18617 [DOI] [PubMed] [Google Scholar]
  • 60. Chedin F, Kowalczykowski SC. 2002. A novel family of regulated helicases/nucleases from Gram-positive bacteria: insights into the initiation of DNA recombination. Mol. Microbiol. 43:823–834 [DOI] [PubMed] [Google Scholar]
  • 61. Chedin F, Noirot P, Biaudet V, Ehrlich SD. 1998. A five-nucleotide sequence protects DNA from exonucleolytic degradation by AddAB, the RecBCD analogue of Bacillus subtilis. Mol. Microbiol. 29:1369–1377 [DOI] [PubMed] [Google Scholar]
  • 62. Chen I, Christie PJ, Dubnau D. 2005. The ins and outs of DNA transfer in bacteria. Science 310:1456–1460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Chen I, Dubnau D. 2003. DNA transport during transformation. Front. Biosci. 8:s544–s556 [DOI] [PubMed] [Google Scholar]
  • 64. Chen I, Dubnau D. 2004. DNA uptake during bacterial transformation. Nat. Rev. Microbiol. 2:241–249 [DOI] [PubMed] [Google Scholar]
  • 65. Cheo D, Bayles K, Yasbin R. 1991. Cloning and characterization of DNA damage-inducible promoter regions from Bacillus subtilis. J. Bacteriol. 173:1696–1703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Chow KH, Courcelle J. 2004. RecO acts with RecF and RecR to protect and maintain replication forks blocked by UV-induced DNA damage in Escherichia coli. J. Biol. Chem. 279:3492–3496 [DOI] [PubMed] [Google Scholar]
  • 67. Ciccarelli FD, et al. 2006. Toward automatic reconstruction of a highly resolved tree of life. Science 311:1283–1287 [DOI] [PubMed] [Google Scholar]
  • 68. Ciccia A, Elledge SJ. 2010. The DNA damage response: making it safe to play with knives. Mol. Cell 40:179–204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Cirz RT, et al. 2007. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J. Bacteriol. 189:531–539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Clauson CL, Saxowsky TT, Doetsch PW. 2010. Dynamic flexibility of DNA repair pathways in growth arrested Escherichia coli. DNA Repair (Amsterdam) 9:842–847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Cleaver JE. 1968. Defective repair replication of DNA in xeroderma pigmentosum. Nature 218:652–656 [DOI] [PubMed] [Google Scholar]
  • 72. Cleaver JE. 1969. Xeroderma pigmentosum: a human disease in which an initial stage of DNA repair is defective. Proc. Natl. Acad. Sci. U. S. A. 63:428–435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Collier C, Machon C, Briggs GS, Smits WK, Soultanas P. 2012. Untwisting of the DNA helix stimulates the endonuclease activity of Bacillus subtilis Nth at AP sites. Nucleic Acids Res. 40:739–750 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Cone R, Duncan J, Hamilton L, Friedberg EC. 1977. Partial purification and characterization of a uracil DNA N-glycosidase from Bacillus subtilis. Biochemistry 16:3194–3201 [DOI] [PubMed] [Google Scholar]
  • 75. Connelly JC, de Leau ES, Leach DR. 1999. DNA cleavage and degradation by the SbcCD protein complex from Escherichia coli. Nucleic Acids Res. 27:1039–1046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Cost GJ, Cozzarelli NR. 2006. Smc5p promotes faithful chromosome transmission and DNA repair in Saccharomyces cerevisiae. Genetics 172:2185–2200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Costes A, Lecointe F, McGovern S, Quevillon-Cheruel S, Polard P. 2010. The C-terminal domain of the bacterial SSB protein acts as a DNA maintenance hub at active chromosome replication forks. PLoS Genet. 6:e1001238 doi:10.1371/journal.pgen.1001238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Cox EC, Degnen GE, Scheppe ML. 1972. Mutator gene studies in Escherichia coli: the mutS gene. Genetics 72:551–567 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Cox EC, Yanofsky C. 1967. Altered base ratios in the DNA of an Escherichia coli mutator strain. Proc. Natl. Acad. Sci. U. S. A. 58:1895–1902 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Cox EC, Yanofsky C. 1969. Mutator gene studies in Escherichia coli. J. Bacteriol. 100:390–397 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Cox MM. 1999. Recombinational DNA repair in bacteria and the RecA protein. Prog. Nucleic Acid Res. Mol. Biol. 63:311–366 [DOI] [PubMed] [Google Scholar]
  • 82. Cox MM. 2007. Regulation of bacterial RecA protein function. Crit. Rev. Biochem. Mol. Biol. 42:41–63 [DOI] [PubMed] [Google Scholar]
  • 83. Cox MM, Lehman IR. 1982. recA protein-promoted DNA strand exchange. Stable complexes of RecA protein and single-stranded DNA formed in the presence of ATP and single-stranded DNA binding protein. J. Biol. Chem. 257:8523–8532 [PubMed] [Google Scholar]
  • 84. Cromie GA. 2009. Phylogenetic ubiquity and shuffling of the bacterial RecBCD and AddAB recombination complexes. J. Bacteriol. 191:5076–5084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Csankovszki G. 2009. Condensin function in dosage compensation. Epigenetics 4:212–215 [DOI] [PubMed] [Google Scholar]
  • 86. Csankovszki G, McDonel P, Meyer BJ. 2004. Recruitment and spreading of the C. elegans dosage compensation complex along X chromosomes. Science 303:1182–1185 [DOI] [PubMed] [Google Scholar]
  • 87. Csankovszki G, Petty EL, Collette KS. 2009. The worm solution: a chromosome-full of condensin helps gene expression go down. Chromosome Res. 17:621–635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Culligan KM, Meyer-Gauen G, Lyons-Weiler J, Hays JB. 2000. Evolutionary origin, diversification and specialization of eukaryotic MutS homolog mismatch repair proteins. Nucleic Acids Res. 28:463–471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89. Daley JM, Palmbos PL, Wu D, Wilson TE. 2005. Nonhomologous end joining in yeast. Annu. Rev. Genet. 39:431–451 [DOI] [PubMed] [Google Scholar]
  • 90. Dalhus B, Laerdahl JK, Backe PH, Bjoras M. 2009. DNA base repair—recognition and initiation of catalysis. FEMS Microbiol. Rev. 33:1044–1078 [DOI] [PubMed] [Google Scholar]
  • 91. Dalrymple BP, Kongsuwan K, Wijffels G, Dixon NE, Jennings PA. 2001. A universal protein-protein interaction motif in the eubacterial DNA replication and repair systems. Proc. Natl. Acad. Sci. U. S. A. 98:11627–11632 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92. Daniel RA, Errington J. 2000. Intrinsic instability of the essential cell division protein FtsL of Bacillus subtilis and a role for DivIB protein in FtsL turnover. Mol. Microbiol. 36:278–289 [DOI] [PubMed] [Google Scholar]
  • 93. Daniel RA, Harry EJ, Katis VL, Wake RG, Errington J. 1998. Characterization of the essential cell division gene ftsL(yIID) of Bacillus subtilis and its role in the assembly of the division apparatus. Mol. Microbiol. 29:593–604 [DOI] [PubMed] [Google Scholar]
  • 94. Daniel RA, Noirot-Gros MF, Noirot P, Errington J. 2006. Multiple interactions between the transmembrane division proteins of Bacillus subtilis and the role of FtsL instability in divisome assembly. J. Bacteriol. 188:7396–7404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. de Hoon MJ, Eichenberger P, Vitkup D. 2010. Hierarchical evolution of the bacterial sporulation network. Curr. Biol. 20:R735–R745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96. Della M, et al. 2004. Mycobacterial Ku and ligase proteins constitute a two-component NHEJ repair machine. Science 306:683–685 [DOI] [PubMed] [Google Scholar]
  • 97. De Piccoli G, et al. 2006. Smc5-Smc6 mediate DNA double-strand-break repair by promoting sister-chromatid recombination. Nat. Cell Biol. 8:1032–1034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Dervyn E, et al. 2004. The bacterial condensin/cohesin-like protein complex acts in DNA repair and regulation of gene expression. Mol. Microbiol. 51:1629–1640 [DOI] [PubMed] [Google Scholar]
  • 99. Dervyn E, et al. 2001. Two essential DNA polymerases at the bacterial replication fork. Science 294:1716–1719 [DOI] [PubMed] [Google Scholar]
  • 100. Dillingham MS, Kowalczykowski SC. 2008. RecBCD enzyme and the repair of double-stranded DNA breaks. Microbiol. Mol. Biol. Rev. 72:642–671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101. Dillingham MS, Spies M, Kowalczykowski SC. 2003. RecBCD enzyme is a bipolar DNA helicase. Nature 423:893–897 [DOI] [PubMed] [Google Scholar]
  • 102. Doherty AJ, Jackson SP. 2001. DNA repair: how Ku makes ends meet. Curr. Biol. 11:R920–R924 [DOI] [PubMed] [Google Scholar]
  • 103. Doherty AJ, Jackson SP, Weller GR. 2001. Identification of bacterial homologues of the Ku DNA repair proteins. FEBS Lett. 500:186–188 [DOI] [PubMed] [Google Scholar]
  • 104. Dorazi R, Dewar SJ. 2000. The SOS promoter dinH is essential for ftsK transcription during cell division. Microbiology 146:2891–2899 [DOI] [PubMed] [Google Scholar]
  • 105. Drablos F, et al. 2004. Alkylation damage in DNA and RNA—repair mechanisms and medical significance. DNA Repair (Amsterdam) 3:1389–1407 [DOI] [PubMed] [Google Scholar]
  • 106. Dreiseikelmann B, Wackernagel W. 1981. Absence in Bacillus subtilis and Staphylococcus aureus of the sequence-specific deoxyribonucleic acid methylation that is conferred in Escherichia coli K-12 by the Dam and Dcm enzymes. J. Bacteriol. 147:259–261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107. Dronkert ML, Kanaar R. 2001. Repair of DNA interstrand cross-links. Mutat. Res. 486:217–247 [DOI] [PubMed] [Google Scholar]
  • 108. Dubnau D. 1999. DNA uptake in bacteria. Annu. Rev. Microbiol. 53:217–244 [DOI] [PubMed] [Google Scholar]
  • 109. Dubnau D. 1991. Genetic competence in Bacillus subtilis. Microbiol. Rev. 55:395–424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110. Duigou S, Ehrlich SD, Noirot P, Noirot-Gros MF. 2004. Distinctive genetic features exhibited by the Y-family DNA polymerases in Bacillus subtilis. Mol. Microbiol. 54:439–451 [DOI] [PubMed] [Google Scholar]
  • 111. Duncan BK, Rockstroh PA, Warner HR. 1978. Escherichia coli K-12 mutants deficient in uracil-DNA glycosylase. J. Bacteriol. 134:1039–1045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112. Dupes NM, et al. 2010. Mutations in the Bacillus subtilis beta clamp that separate its roles in DNA replication from mismatch repair. J. Bacteriol. 192:3452–3463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113. Duwat P, Ehrlich SD, Gruss A. 1992. A general method for cloning recA genes of gram-positive bacteria by polymerase chain reaction. J. Bacteriol. 174:5171–5175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114. Dworkin J, Losick R. 2001. Linking nutritional status to gene activation and development. Genes Dev. 15:1051–1054 [DOI] [PubMed] [Google Scholar]
  • 115. Echols H, Lu C, Burgers PM. 1983. Mutator strains of Escherichia coli, mutD and dnaQ, with defective exonucleolytic editing by DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. U. S. A. 80:2189–2192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116. Eguchi Y, Ogawa T, Ogawa H. 1988. Cleavage of bacteriophage f80 cI repressor by RecA protein. J. Mol. Biol. 202:565–573 [DOI] [PubMed] [Google Scholar]
  • 117. Eguchi Y, Ogawa T, Ogawa H. 1988. Stimulation of RecA-mediated cleavage of phage f80 cI repressor by deoxydinucleotides. J. Mol. Biol. 204:69–77 [DOI] [PubMed] [Google Scholar]
  • 118. Eisen JA. 1998. A phylogenomic study of the MutS family of proteins. Nucleic Acids Res. 26:4291–4300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119. Eisen JA, Hanawalt PC. 1999. A phylogenomic study of DNA repair genes, proteins, and processes. Mutat. Res. 435:171–213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120. Errington J, Daniel RA, Scheffers DJ. 2003. Cytokinesis in bacteria. Microbiol. Mol. Biol. Rev. 67:52–65 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 121. Fernandez S, Kobayashi Y, Ogasawara N, Alonso JC. 1999. Analysis of the Bacillus subtilis recO gene: RecO forms part of the RecFLOR function. Mol. Gen. Genet. 261:567–573 [DOI] [PubMed] [Google Scholar]
  • 122. Fernandez S, Sorokin A, Alonso JC. 1998. Genetic recombination in Bacillus subtilis 168: effects of recU and recS mutations on DNA repair and homologous recombination. J. Bacteriol. 180:3405–3409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123. Filippov VD, El-Halfawy KA. 1981. UV-induced mutation fixation in Bacillus subtilis. Mutat. Res. 82:251–261 [DOI] [PubMed] [Google Scholar]
  • 124. Filippov VD, Zagoruiko EE. 1978. Study of MFD in Bacillus subtilis. Mutat. Res. 52:49–56 [DOI] [PubMed] [Google Scholar]
  • 125. Flett F, et al. 1999. A ‘gram-negative-type' DNA polymerase III is essential for replication of the linear chromosome of Streptomyces coelicolor A3(2). Mol. Microbiol. 31:949–958 [DOI] [PubMed] [Google Scholar]
  • 126. Foster KA, et al. 2003. DNA polymerase III of Enterococcus faecalis: expression and characterization of recombinant enzymes encoded by the polC and dnaE genes. Protein Expr. Purif. 27:90–97 [DOI] [PubMed] [Google Scholar]
  • 127. Frankenber-Schwager M, Frankenberg D, Harbich R. 1985. Potentially lethal damage, sublethal damage and DNA double strand breaks. Radiat. Prot. Dosimetry 13:171–174 [Google Scholar]
  • 128. Friedberg EC, et al. 2006. DNA repair and mutagenesis, 2nd ed. American Society for Microbiology, Washington, DC [Google Scholar]
  • 129. Friedman BM, Yasbin RE. 1983. The genetics and specificity of the constitutive excision repair system of Bacillus subtilis. Mol. Gen. Genet. 190:481–486 [DOI] [PubMed] [Google Scholar]
  • 130. Fujioka Y, Kimata Y, Nomaguchi K, Watanabe K, Kohno K. 2002. Identification of a novel non-structural maintenance of chromosomes (SMC) component of the SMC5-SMC6 complex involved in DNA repair. J. Biol. Chem. 277:21585–21591 [DOI] [PubMed] [Google Scholar]
  • 131. Funchain P, et al. 2000. The consequences of growth of a mutator strain of Escherichia coli as measured by loss of function among multiple gene targets and loss of fitness. Genetics 154:959–970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 132. George J, Castellazzi M, Buttin G. 1975. Prophage induction and cell division in E. coli. III. Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif. Mol. Gen. Genet. 140:309–332 [PubMed] [Google Scholar]
  • 133. Georgiou T, et al. 1998. Specific peptide-activated proteolytic cleavage of Escherichia coli elongation factor Tu. Proc. Natl. Acad. Sci. U. S. A. 95:2891–2895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134. Gillespie K, Yasbin RE. 1987. Chromosomal locations of three Bacillus subtilis din genes. J. Bacteriol. 169:3372–3374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135. Ginetti F, Perego M, Albertini AM, Galizzi A. 1996. Bacillus subtilis mutS mutL operon: identification, nucleotide sequence and mutagenesis. Microbiology 142:2021–2029 [DOI] [PubMed] [Google Scholar]
  • 136. Goffin C, Ghuysen JM. 1998. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62:1079–1093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 137. Gong C, et al. 2005. Mechanism of nonhomologous end-joining in mycobacteria: a low-fidelity repair system driven by Ku, ligase D and ligase C. Nat. Struct. Mol. Biol. 12:304–312 [DOI] [PubMed] [Google Scholar]
  • 138. Goranov AI, Katz L, Breier AM, Burge CB, Grossman AD. 2005. A transcriptional response to replication status mediated by the conserved bacterial replication protein DnaA. Proc. Natl. Acad. Sci. U. S. A. 102:12932–12937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139. Goranov AI, Kuester-Schoeck E, Wang JD, Grossman AD. 2006. Characterization of the global transcriptional responses to different types of DNA damage and disruption of replication in Bacillus subtilis. J. Bacteriol. 188:5595–5605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140. Gottesman S. 2003. Proteolysis in bacterial regulatory circuits. Annu. Rev. Cell Dev. Biol. 19:565–587 [DOI] [PubMed] [Google Scholar]
  • 141. Graumann PL, Knust T. 2009. Dynamics of the bacterial SMC complex and SMC-like proteins involved in DNA repair. Chromosome Res. 17:265–275 [DOI] [PubMed] [Google Scholar]
  • 142. Grimm C, et al. 2006. Crystal structure of Bacillus subtilis S-adenosylmethionine:tRNA ribosyltransferase-isomerase. Biochem. Biophys. Res. Commun. 351:695–701 [DOI] [PubMed] [Google Scholar]
  • 143. Groban ES, et al. 2005. Binding of the Bacillus subtilis LexA protein to the SOS operator. Nucleic Acids Res. 33:6287–6295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144. Gruber S, Errington J. 2009. Recruitment of condensin to replication origin regions by ParB/SpoOJ promotes chromosome segregation in B. subtilis. Cell 137:685–696 [DOI] [PubMed] [Google Scholar]
  • 145. Guillet M, Boiteux S. 2003. Origin of endogenous DNA abasic sites in Saccharomyces cerevisiae. Mol. Cell. Biol. 23:8386–8394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146. Hadden CT, Foote RS, Mitra S. 1983. Adaptive response of Bacillus subtilis to N-methyl-N′-nitro-N-nitrosoguanidine. J. Bacteriol. 153:756–762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 147. Haeusser DP, Levin PA. 2008. The great divide: coordinating cell cycle events during bacterial growth and division. Curr. Opin. Microbiol. 11:94–99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 148. Haijema BJ, Hamoen LW, Kooistra J, Venema G, van Sinderen D. 1995. Expression of the ATP-dependent deoxyribonuclease of Bacillus subtilis is under competence-mediated control. Mol. Microbiol. 15:203–211 [DOI] [PubMed] [Google Scholar]
  • 149. Haijema BJ, Meima R, Kooistra J, Venema G. 1996. Effects of lysine-to-glycine mutations in the ATP-binding consensus sequences in the AddA and AddB subunits on the Bacillus subtilis AddAB enzyme activities. J. Bacteriol. 178:5130–5137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150. Haijema BJ, et al. 1996. Replacement of the lysine residue in the consensus ATP-binding sequence of the AddA subunit of AddAB drastically affects chromosomal recombination in transformation and transduction of Bacillus subtilis. Mol. Microbiol. 21:989–999 [DOI] [PubMed] [Google Scholar]
  • 151. Haijema BJ, Venema G, Kooistra J. 1996. The C terminus of the AddA subunit of the Bacillus subtilis ATP-dependent DNase is required for the ATP-dependent exonuclease activity but not for the helicase activity. J. Bacteriol. 178:5086–5091 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152. Hall MC, Matson SW. 1999. The Escherichia coli MutL protein physically interacts with MutH and stimulates the MutH-associated endonuclease activity. J. Biol. Chem. 274:1306–1312 [DOI] [PubMed] [Google Scholar]
  • 153. Hegde SP, et al. 1996. Interactions of RecF protein with RecO, RecR, and single-stranded DNA binding proteins reveal roles for the RecF-RecO-RecR complex in DNA repair and recombination. Proc. Natl. Acad. Sci. U. S. A. 93:14468–14473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 154. Helleday T, Lo J, van Gent DC, Engelward BP. 2007. DNA double-strand break repair: from mechanistic understanding to cancer treatment. DNA Repair (Amsterdam) 6:923–935 [DOI] [PubMed] [Google Scholar]
  • 155. Hirano M, Hirano T. 1998. ATP-dependent aggregation of single-stranded DNA by a bacterial SMC homodimer. EMBO J. 17:7139–7148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 156. Hirano T. 2006. At the heart of the chromosome: SMC proteins in action. Nat. Rev. Mol. Cell. Biol. 7:311–322 [DOI] [PubMed] [Google Scholar]
  • 157. Hombauer H, Campbell CS, Smith CE, Desai A, Kolodner RD. 2011. Visualization of eukaryotic DNA mismatch repair reveals distinct recognition and repair intermediates. Cell 147:1040–1053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 158. Hombauer H, Srivatsan A, Putnam CD, Kolodner RD. 2011. Mismatch repair, but not heteroduplex rejection, is temporally coupled to DNA replication. Science 334:1713–1716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 159. Hsu DS, Kim ST, Sun Q, Sancar A. 1995. Structure and function of the UvrB protein. J. Biol. Chem. 270:8319–8327 [DOI] [PubMed] [Google Scholar]
  • 160. Hsu GW, Ober M, Carell T, Beese LS. 2004. Error-prone replication of oxidatively damaged DNA by a high-fidelity DNA polymerase. Nature 431:217–221 [DOI] [PubMed] [Google Scholar]
  • 161. Huisman GW, Siegele D, Almiron M, Tormo A, Kolter R. 1996. Morphological and physiological changes during stationary phase, p 1672–1682. In Neidhardt F, et al. (ed), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, DC [Google Scholar]
  • 162. Hyyrylainen HL, et al. 2000. d-Alanine substitution of teichoic acids as a modulator of protein folding and stability at the cytoplasmic membrane/cell wall interface of Bacillus subtilis. J. Biol. Chem. 275:26696–26703 [DOI] [PubMed] [Google Scholar]
  • 163. Inoue M, Oshima H, Okubo T, Mitsuhashi S. 1972. Isolation of the rec mutants in Staphylococcus aureus. J. Bacteriol. 112:1169–1176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 164. Inoue R, et al. 2001. Genetic identification of two distinct DNA polymerases, DnaE and PolC, that are essential for chromosomal DNA replication in Staphylococcus aureus. Mol. Genet. Genomics 266:564–571 [DOI] [PubMed] [Google Scholar]
  • 165. Ireton K, Grossman AD. 1994. A developmental checkpoint couples the initiation of sporulation to DNA replication in Bacillus subtilis. EMBO J. 13:1566–1573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 166. Ireton K, Grossman AD. 1992. Coupling between gene expression and DNA synthesis early during development in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 89:8808–8812 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 167. Jeggo P. 1979. Isolation and characterization of Escherichia coli K-12 mutants unable to induce the adaptive response to simple alkylating agents. J. Bacteriol. 139:783–791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 168. Jeggo P, Defais M, Samson L, Schendel P. 1978. The adaptive response of E. coli to low levels of alkylating agent: the role of polA in killing adaptation. Mol. Gen. Genet. 162:299–305 [DOI] [PubMed] [Google Scholar]
  • 169. Jochmann N, et al. 2009. Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays. Microbiology 155:1459–1477 [DOI] [PubMed] [Google Scholar]
  • 170. Johnson A, O'Donnell M. 2005. Cellular DNA replicases: components and dynamics at the replication fork. Annu. Rev. Biochem. 74:283–315 [DOI] [PubMed] [Google Scholar]
  • 171. Kadyrov FA, Dzantiev L, Constantin N, Modrich P. 2006. Endonucleolytic function of MutLalpha in human mismatch repair. Cell 126:297–308 [DOI] [PubMed] [Google Scholar]
  • 172. Kaguni JM. 2006. DnaA: controlling the initiation of bacterial DNA replication and more. Annu. Rev. Microbiol. 60:351–375 [DOI] [PubMed] [Google Scholar]
  • 173. Kaguni JM. 2011. Replication initiation at the Escherichia coli chromosomal origin. Curr. Opin. Chem. Biol. 15:606–613 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 174. Karathanasis E, Wilson TE. 2002. Enhancement of Saccharomyces cerevisiae end-joining efficiency by cell growth stage but not by impairment of recombination. Genetics 161:1015–1027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 175. Karow JK, Wu L, Hickson ID. 2000. RecQ family helicases: roles in cancer and aging. Curr. Opin. Genet. Dev. 10:32–38 [DOI] [PubMed] [Google Scholar]
  • 176. Kasai H, et al. 1991. 8-Hydroxyguanine, a DNA adduct formed by oxygen radicals: its implication on oxygen radical-involved mutagenesis/carcinogenesis. J. Toxicol. Sci. 16(Suppl 1):95–105 [DOI] [PubMed] [Google Scholar]
  • 177. Kawai Y, Moriya S, Ogasawara N. 2003. Identification of a protein, YneA, responsible for cell division suppression during the SOS response in Bacillus subtilis. Mol. Microbiol. 47:1113–1122 [DOI] [PubMed] [Google Scholar]
  • 178. Keggins KM, Duvall EJ, Lovett PS. 1978. Recombination between compatible plasmids containing homologous segments requires the Bacillus subtilis recE gene product. J. Bacteriol. 134:514–520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 179. Kidane D, Graumann PL. 2005. Dynamic formation of RecA filaments at DNA double strand break repair centers in live cells. J. Cell Biol. 170:357–366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 180. Kidane D, Sanchez H, Alonso JC, Graumann PL. 2004. Visualization of DNA double-strand break repair in live bacteria reveals dynamic recruitment of Bacillus subtilis RecF, RecO and RecN proteins to distinct sites on the nucleoids. Mol. Microbiol. 52:1627–1639 [DOI] [PubMed] [Google Scholar]
  • 181. Kleczkowska HE, Marra G, Lettieri T, Jiricny J. 2001. hMSH3 and hMSH6 interact with PCNA and colocalize with it to replication foci. Genes Dev. 15:724–736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 182. Klocko AD, et al. 2011. Mismatch repair causes the dynamic release of an essential DNA polymerase from the replication fork. Mol. Microbiol. 82:648–663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 183. Kobayashi K, et al. 2003. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U. S. A. 100:4678–4683 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 184. Kodama T, et al. 2007. Bacillus subtilis AprX involved in degradation of a heterologous protein during the late stationary growth phase. J. Biosci. Bioeng. 104:135–143 [DOI] [PubMed] [Google Scholar]
  • 185. Kooistra J, Haijema BJ, Hesseling-Meinders A, Venema G. 1997. A conserved helicase motif of the AddA subunit of the Bacillus subtilis ATP-dependent nuclease (AddAB) is essential for DNA repair and recombination. Mol. Microbiol. 23:137–149 [DOI] [PubMed] [Google Scholar]
  • 186. Koonin EV, Bork P. 1996. Ancient duplication of DNA polymerase inferred from analysis of complete bacterial genomes. Trends Biochem. Sci. 21:128–129 [PubMed] [Google Scholar]
  • 187. Kowalczykowski SC, Krupp RA. 1987. Effects of Escherichia coli SSB protein on the single-stranded DNA-dependent ATPase activity of Escherichia coli RecA protein. Evidence that SSB protein facilitates the binding of RecA protein to regions of secondary structure within single-stranded DNA. J. Mol. Biol. 193:97–113 [DOI] [PubMed] [Google Scholar]
  • 188. Krejci L, Chen L, Van Komen S, Sung P, Tomkinson A. 2003. Mending the break: two DNA double-strand break repair machines in eukaryotes. Prog. Nucleic Acid Res. Mol. Biol. 74:159–201 [DOI] [PubMed] [Google Scholar]
  • 189. Krishnamurthy M, Tadesse S, Rothmaier K, Graumann PL. 2010. A novel SMC-like protein, SbcE (YhaN), is involved in DNA double-strand break repair and competence in Bacillus subtilis. Nucleic Acids Res. 38:455–466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 190. Krokan HE, Standal R, Slupphaug G. 1997. DNA glycosylases in the base excision repair of DNA. Biochem. J. 325:1–16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191. Krwawicz J, Arczewska KD, Speina E, Maciejewska A, Grzesiuk E. 2007. Bacterial DNA repair genes and their eukaryotic homologues. 1. Mutations in genes involved in base excision repair (BER) and DNA-end processors and their implication in mutagenesis and human disease. Acta Biochim. Pol. 54:413–434 [PubMed] [Google Scholar]
  • 192. Kunkel TA, Erie DA. 2005. DNA mismatch repair. Annu. Rev. Biochem. 74:681–710 [DOI] [PubMed] [Google Scholar]
  • 193. Kunst F, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249–256 [DOI] [PubMed] [Google Scholar]
  • 194. Larrea AA, Lujan SA, Kunkel TA. 2010. SnapShot: DNA mismatch repair. Cell 141:730.e1 doi:10.1016/j.cell.2010.05.002. [DOI] [PubMed] [Google Scholar]
  • 195. Lavery PE, Kowalczykowski SC. 1990. Properties of recA441 protein-catalyzed DNA strand exchange can be attributed to an enhanced ability to compete with SSB protein. J. Biol. Chem. 265:4004–4010 [PubMed] [Google Scholar]
  • 196. Le Chatelier E, et al. 2004. Involvement of DnaE, the second replicative DNA polymerase from Bacillus subtilis, in DNA mutagenesis. J. Biol. Chem. 279:1757–1767 [DOI] [PubMed] [Google Scholar]
  • 197. Lecointe F, et al. 2007. Anticipating chromosomal replication fork arrest: SSB targets repair DNA helicases to active forks. EMBO J. 26:4239–4251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 198. Lee JH, Wendt JC, Shanmugam KT. 1990. Identification of a new gene, molR, essential for utilization of molybdate by Escherichia coli. J. Bacteriol. 172:2079–2087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 199. Lee MS, Marians KJ. 1987. Escherichia coli replication factor Y, a component of the primosome, can act as a DNA helicase. Proc. Natl. Acad. Sci. U. S. A. 84:8345–8349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 200. Lehmann AR, et al. 1995. The rad18 gene of Schizosaccharomyces pombe defines a new subgroup of the SMC superfamily involved in DNA repair. Mol. Cell. Biol. 15:7067–7080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 201. Leiros I, Timmins J, Hall DR, McSweeney S. 2005. Crystal structure and DNA-binding analysis of RecO from Deinococcus radiodurans. EMBO J. 24:906–918 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 202. Lemmon MA, Engelman DM. 1994. Specificity and promiscuity in membrane helix interactions. FEBS Lett. 346:17–20 [DOI] [PubMed] [Google Scholar]
  • 203. Lemon KP, Grossman AD. 2000. Movement of replicating DNA through a stationary replisome. Mol. Cell 6:1321–1330 [DOI] [PubMed] [Google Scholar]
  • 204. Lemon KP, Kurtser I, Wu J, Grossman AD. 2000. Control of initiation of sporulation by replication initiation genes in Bacillus subtilis. J. Bacteriol. 182:2989–2991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 205. Lewis LK, Harlow GR, Gregg-Jolly LA, Mount DW. 1994. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 241:507–523 [DOI] [PubMed] [Google Scholar]
  • 206. Lieber MR, Gu J, Lu H, Shimazaki N, Tsai AG. 2010. Nonhomologous DNA end joining (NHEJ) and chromosomal translocations in humans. Subcell. Biochem. 50:279–296 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 207. Lieber MR, Wilson TE. 2010. SnapShot: nonhomologous DNA end joining (NHEJ). Cell 142:496.e1 doi:10.1016/j.cell.2010.07.035. [DOI] [PubMed] [Google Scholar]
  • 208. Lin JJ, Phillips AM, Hearst JE, Sancar A. 1992. Active site of (A)BC excinuclease. II. Binding, bending, and catalysis mutants of UvrB reveal a direct role in 3′ and an indirect role in 5′ incision. J. Biol. Chem. 267:17693–17700 [PubMed] [Google Scholar]
  • 209. Lin JJ, Sancar A. 1992. Active site of (A)BC excinuclease. I. Evidence for 5′ incision by UvrC through a catalytic site involving Asp399, Asp438, Asp466, and His538 residues. J. Biol. Chem. 267:17688–17692 [PubMed] [Google Scholar]
  • 210. Lin JJ, Sancar A. 1990. Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis. J. Biol. Chem. 265:21337–21341 [PubMed] [Google Scholar]
  • 211. Lindahl T. 1993. Instability and decay of the primary structure of DNA. Nature 362:709–715 [DOI] [PubMed] [Google Scholar]
  • 212. Lindahl T, Barnes DE. 2000. Repair of endogenous DNA damage. Cold Spring Harb. Symp. Quant. Biol. 65:127–133 [DOI] [PubMed] [Google Scholar]
  • 213. Lindner C, et al. 2004. Differential expression of two paralogous genes of Bacillus subtilis encoding single-stranded DNA binding protein. J. Bacteriol. 186:1097–1105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 214. Lindow JC, Britton RA, Grossman AD. 2002. Structural maintenance of chromosomes protein of Bacillus subtilis affects supercoiling in vivo. J. Bacteriol. 184:5317–5322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 215. Lisby M, Mortensen UH, Rothstein R. 2003. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre. Nat. Cell Biol. 5:572–577 [DOI] [PubMed] [Google Scholar]
  • 216. Lisby M, Rothstein R, Mortensen UH. 2001. Rad52 forms DNA repair and recombination centers during S phase. Proc. Natl. Acad. Sci. U. S. A. 98:8276–8282 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 217. Little J. 1991. Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie 73:411–422 [DOI] [PubMed] [Google Scholar]
  • 218. Little JW. 1993. LexA cleavage and other self-processing reactions. J. Bacteriol. 175:4943–4950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 219. Liu J, Marians KJ. 1999. PriA-directed assembly of a primosome on D loop DNA. J. Biol. Chem. 274:25033–25041 [DOI] [PubMed] [Google Scholar]
  • 220. Liu J, Xu L, Sandler SJ, Marians KJ. 1999. Replication fork assembly at recombination intermediates is required for bacterial growth. Proc. Natl. Acad. Sci. U. S. A. 96:3552–3555 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 221. Lopez de Saro FJ, Georgescu RE, O'Donnell M. 2003. A peptide switch regulates DNA polymerase processivity. Proc. Natl. Acad. Sci. U. S. A. 100:14689–14694 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 222. Lopez de Saro FJ, Marinus MG, Modrich P, O'Donnell M. 2006. The beta sliding clamp binds to multiple sites within MutL and MutS. J. Biol. Chem. 281:14340–14349 [DOI] [PubMed] [Google Scholar]
  • 223. Lopez de Saro FJ, O'Donnell M. 2001. Interaction of the beta sliding clamp with MutS, ligase, and DNA polymerase I. Proc. Natl. Acad. Sci. U. S. A. 98:8376–8380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 224. Love PE, Lyle MJ, Yasbin RE. 1985. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 82:6201–6205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 225. Love PE, Yasbin RE. 1984. Genetic characterization of the inducible SOS-like system of Bacillus subtilis. J. Bacteriol. 160:910–920 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 226. Love PE, Yasbin RE. 1986. Induction of the Bacillus subtilis SOS-like response by Escherichia coli RecA protein. Proc. Natl. Acad. Sci. U. S. A. 83:5204–5208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 227. Lovett CM, Jr, Love PE, Yasbin RE, Roberts JW. 1988. SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains. J. Bacteriol. 170:1467–1474 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 228. Lovett CM, Jr, Cho KC, O'Gara TM. 1993. Purification of an SOS repressor from Bacillus subtilis. J. Bacteriol. 175:6842–6849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 229. Reference deleted.
  • 230. Lovett CM, Jr, Roberts JW. 1985. Purification of a RecA analogue from Bacillus subtilis. J. Biol. Chem. 260:3305–3313 [PubMed] [Google Scholar]
  • 231. Lusetti SL, Cox MM. 2002. The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu. Rev. Biochem. 71:71–100 [DOI] [PubMed] [Google Scholar]
  • 232. Makharashvili N, Koroleva O, Bera S, Grandgenett DP, Korolev S. 2004. A novel structure of DNA repair protein RecO from Deinococcus radiodurans. Structure 12:1881–1889 [DOI] [PubMed] [Google Scholar]
  • 233. Maki H, Sekiguchi M. 1992. MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis. Nature 355:273–275 [DOI] [PubMed] [Google Scholar]
  • 234. Mandelstam J, Higgs SA. 1974. Induction of sporulation during synchronized chromosome replication in Bacillus subtilis. J. Bacteriol. 120:38–42 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 235. Mandelstam J, Sterlini JM, Kay D. 1971. Sporulation in Bacillus subtilis. Effect of medium on the form of chromosome replication and on initiation to sporulation in Bacillus subtilis. Biochem. J. 125:635–641 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 236. Manfredi C, Carrasco B, Ayora S, Alonso JC. 2008. Bacillus subtilis RecO nucleates RecA onto SsbA-coated single-stranded DNA. J. Biol. Chem. 283:24837–24847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 237. Manfredi C, Suzuki Y, Yadav T, Takeyasu K, Alonso JC. 2010. RecO-mediated DNA homology search and annealing is facilitated by SsbA. Nucleic Acids Res. 38:6920–6929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 238. Marians KJ. 2004. Mechanisms of replication fork restart in Escherichia coli. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359:71–77 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 239. Marians KJ. 2000. PriA-directed replication fork restart in Escherichia coli. Trends Biochem. Sci. 25:185–189 [DOI] [PubMed] [Google Scholar]
  • 240. Marians KJ. 1999. PriA: at the crossroads of DNA replication and recombination. Prog. Nucleic Acid Res. Mol. Biol. 63:39–67 [DOI] [PubMed] [Google Scholar]
  • 241. Marians KJ. 1992. Prokaryotic DNA replication. Annu. Rev. Biochem. 61:673–719 [DOI] [PubMed] [Google Scholar]
  • 242. Marrero R, Yasbin RE. 1988. Cloning of the Bacillus subtilis recE+ gene and functional expression of recE+ in B. subtilis. J. Bacteriol. 170:335–344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 243. Marsin S, McGovern S, Ehrlich SD, Bruand C, Polard P. 2001. Early steps of Bacillus subtilis primosome assembly. J. Biol. Chem. 276:45818–45825 [DOI] [PubMed] [Google Scholar]
  • 244. Marston FY, et al. 2010. When simple sequence comparison fails: the cryptic case of the shared domains of the bacterial replication initiation proteins DnaB and DnaD. Nucleic Acids Res. 38:6930–6942 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 245. Mascarenhas J, et al. 2006. Bacillus subtilis SbcC protein plays an important role in DNA inter-strand cross-link repair. BMC Mol. Biol. 7:20 doi:10.1186/1471-2199-7-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 246. Mascarenhas J, Soppa J, Strunnikov AV, Graumann PL. 2002. Cell cycle-dependent localization of two novel prokaryotic chromosome segregation and condensation proteins in Bacillus subtilis that interact with SMC protein. EMBO J. 21:3108–3118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 247. Matuszewska M, Kuczynska-Wisnik D, Laskowska E, Liberek K. 2005. The small heat shock protein IbpA of Escherichia coli cooperates with IbpB in stabilization of thermally aggregated proteins in a disaggregation competent state. J. Biol. Chem. 280:12292–12298 [DOI] [PubMed] [Google Scholar]
  • 248. Mazur SJ, Grossman L. 1991. Dimerization of Escherichia coli UvrA and its binding to undamaged and ultraviolet light damaged DNA. Biochemistry 30:4432–4443 [DOI] [PubMed] [Google Scholar]
  • 249. McGlynn P, Al-Deib AA, Liu J, Marians KJ, Lloyd RG. 1997. The DNA replication protein PriA and the recombination protein RecG bind D-loops. J. Mol. Biol. 270:212–221 [DOI] [PubMed] [Google Scholar]
  • 250. McGregor N, et al. 2005. The structure of Bacillus subtilis RecU Holliday junction resolvase and its role in substrate selection and sequence-specific cleavage. Structure 13:1341–1351 [DOI] [PubMed] [Google Scholar]
  • 251. McHenry CS. 2011. Breaking the rules: bacteria that use several DNA polymerase IIIs. EMBO Rep. 12:408–414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 252. McHenry CS. 2003. Chromosomal replicases as asymmetric dimers: studies of subunit arrangement and functional consequences. Mol. Microbiol. 49:1157–1165 [DOI] [PubMed] [Google Scholar]
  • 253. McHenry CS. 2011. DNA replicases from a bacterial perspective. Annu. Rev. Biochem. 80:403–436 [DOI] [PubMed] [Google Scholar]
  • 254. McKenzie GJ, Lee PL, Lombardo MJ, Hastings PJ, Rosenberg SM. 2001. SOS mutator DNA polymerase IV functions in adaptive mutation and not adaptive amplification. Mol. Cell 7:571–579 [DOI] [PubMed] [Google Scholar]
  • 255. Meddows TR, Savory AP, Grove JI, Moore T, Lloyd RG. 2005. RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand breaks. Mol. Microbiol. 57:97–110 [DOI] [PubMed] [Google Scholar]
  • 256. Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P. 2006. Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics 6:2135–2146 [DOI] [PubMed] [Google Scholar]
  • 257. Meima R, Haijema BJ, Venema G, Bron S. 1995. Overproduction of the ATP-dependent nuclease AddAB improves the structural stability of a model plasmid system in Bacillus subtilis. Mol. Gen. Genet. 248:391–398 [DOI] [PubMed] [Google Scholar]
  • 258. Merrikh H, Machon C, Grainger WH, Grossman AD, Soultanas P. 2011. Co-directional replication-transcription conflicts lead to replication restart. Nature 470:554–557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 259. Mesak LR, Miao V, Davies J. 2008. Effects of subinhibitory concentrations of antibiotics on SOS and DNA repair gene expression in Staphylococcus aureus. Antimicrob. Agents Chemother. 52:3394–3397 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 260. Michaels ML, Cruz C, Grollman AP, Miller JH. 1992. Evidence that MutY and MutM combine to prevent mutations by an oxidatively damaged form of guanine in DNA. Proc. Natl. Acad. Sci. U. S. A. 89:7022–7025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 261. Michaels ML, Pham L, Cruz C, Miller JH. 1991. MutM, a protein that prevents GC → TA transversions, is formamidopyrimidine-DNA glycosylase. Nucleic Acids Res. 19:3629–3632 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 262. Michaels ML, Pham L, Nghiem Y, Cruz C, Miller JH. 1990. MutY, an adenine glycosylase active on G-A mispairs, has homology to endonuclease III. Nucleic Acids Res. 18:3841–3845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 263. Michaels ML, Tchou J, Grollman AP, Miller JH. 1992. A repair system for 8-oxo-7,8-dihydrodeoxyguanine. Biochemistry 31:10964–10968 [DOI] [PubMed] [Google Scholar]
  • 264. Miller MC, Resnick JB, Smith BT, Lovett CM., Jr 1996. The Bacillus subtilis dinR gene codes for the analogue of Escherichia coli LexA. Purification and characterization of the DinR protein. J. Biol. Chem. 271:33502–33508 [PubMed] [Google Scholar]
  • 265. Mimitou EP, Symington LS. 2011. DNA end resection—unraveling the tail. DNA Repair (Amsterdam) 10:344–348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 266. Mimitou EP, Symington LS. 2008. Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing. Nature 455:770–774 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 267. Mizusawa S, Gottesman S. 1983. Protein degradation in Escherichia coli: the lon gene controls the stability of sulA protein. Proc. Natl. Acad. Sci. U. S. A. 80:358–362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 268. Mo AH, Burkholder WF. 2010. YneA, an SOS-induced inhibitor of cell division in Bacillus subtilis, is regulated posttranslationally and requires the transmembrane region for activity. J. Bacteriol. 192:3159–3173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 269. Modell JW, Hopkins AC, Laub MT. 2011. A DNA damage checkpoint in Caulobacter crescentus inhibits cell division through a direct interaction with FtsW. Genes Dev. 25:1328–1343 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 270. Moeller R, et al. 2008. Roles of the major, small, acid-soluble spore proteins and spore-specific and universal DNA repair mechanisms in resistance of Bacillus subtilis spores to ionizing radiation from X rays and high-energy charged-particle bombardment. J. Bacteriol. 190:1134–1140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 271. Molle V, et al. 2003. The Spo0A regulon of Bacillus subtilis. Mol. Microbiol. 50:1683–1701 [DOI] [PubMed] [Google Scholar]
  • 272. Moolenaar GF, van Rossum-Fikkert S, van Kesteren M, Goosen N. 2002. Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair. Proc. Natl. Acad. Sci. U. S. A. 99:1467–1472 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 273. Moriya S, Imai Y, Hassan AK, Ogasawara N. 1999. Regulation of initiation of Bacillus subtilis chromosome replication. Plasmid 41:17–29 [DOI] [PubMed] [Google Scholar]
  • 274. Morohoshi F, Hayashi K, Munakata N. 1990. Bacillus subtilis ada operon encodes two DNA alkyltransferases. Nucleic Acids Res. 18:5473–5480 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 275. Morohoshi F, Hayashi K, Munakata N. 1989. Bacillus subtilis gene coding for constitutive O6-methylguanine-DNA alkyltransferase. Nucleic Acids Res. 17:6531–6543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 276. Morohoshi F, Hayashi K, Munakata N. 1991. Molecular analysis of Bacillus subtilis ada mutants deficient in the adaptive response to simple alkylating agents. J. Bacteriol. 173:7834–7840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 277. Morohoshi F, Hayashi K, Munkata N. 1993. Bacillus subtilis alkA gene encoding inducible 3-methyladenine DNA glycosylase is adjacent to the ada operon. J. Bacteriol. 175:6010–6017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 278. Morohoshi F, Munakata N. 1990. Isolation of a Bacillus subtilis mutant defective in constitutive O6-alkylguanine-DNA alkyltransferase. Mutat. Res. 235:15–23 [DOI] [PubMed] [Google Scholar]
  • 279. Morohoshi F, Munakata N. 1987. Multiple species of Bacillus subtilis DNA alkyltransferase involved in the adaptive response to simple alkylating agents. J. Bacteriol. 169:587–592 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 280. Morohoshi F, Munakata N. 1986. Two classes of Bacillus subtilis mutants deficient in the adaptive response to simple alkylating agents. Mol. Gen. Genet. 202:200–206 [DOI] [PubMed] [Google Scholar]
  • 281. Morozov V, Mushegian AR, Koonin EV, Bork P. 1997. A putative nucleic acid-binding domain in Bloom's and Werner's syndrome helicases. Trends Biochem. Sci. 22:417–418 [DOI] [PubMed] [Google Scholar]
  • 282. Mott ML, Berger JM. 2007. DNA replication initiation: mechanisms and regulation in bacteria. Nat. Rev. Microbiol. 5:343–354 [DOI] [PubMed] [Google Scholar]
  • 283. Mukherjee A, Cao C, Lutkenhaus J. 1998. Inhibition of FtsZ polymerization by SulA, an inhibitor of septation in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 95:2885–2890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 284. Nakayama H. 2002. RecQ family helicases: roles as tumor suppressor proteins. Oncogene 21:9008–9021 [DOI] [PubMed] [Google Scholar]
  • 285. Nasmyth K, Haering CH. 2005. The structure and function of SMC and kleisin complexes. Annu. Rev. Biochem. 74:595–648 [DOI] [PubMed] [Google Scholar]
  • 286. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol. Mol. Biol. Rev. 64:548–572 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 287. Nicholson WL, Schuerger AC, Setlow P. 2005. The solar UV environment and bacterial spore UV resistance: considerations for Earth-to-Mars transport by natural processes and human spaceflight. Mutat. Res. 571:249–264 [DOI] [PubMed] [Google Scholar]
  • 288. Nishimura T, Teramoto H, Inui M, Yukawa H. 2011. Gene expression profiling of Corynebacterium glutamicum during anaerobic nitrate respiration: induction of the SOS response for cell survival. J. Bacteriol. 193:1327–1333 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 289. Nishino T, Komori K, Tsuchiya D, Ishino Y, Morikawa K. 2001. Crystal structure of the archaeal Holliday junction resolvase Hjc and implications for DNA recognition. Structure 9:197–204 [DOI] [PubMed] [Google Scholar]
  • 290. Noirot-Gros MF, et al. 2002. An expanded view of bacterial DNA replication. Proc. Natl. Acad. Sci. U. S. A. 99:8342–8347 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 291. Noyer-Weidner M, Jentsch S, Pawlek B, Gunthert U, Trautner TA. 1983. Restriction and modification in Bacillus subtilis: DNA methylation potential of the related bacteriophages Z, SPR, SP beta, phi 3T, and rho 11. J. Virol. 46:446–453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 292. Nurse P, Liu J, Marians KJ. 1999. Two modes of PriA binding to DNA. J. Biol. Chem. 274:25026–25032 [DOI] [PubMed] [Google Scholar]
  • 293. Oeda K, Horiuchi T, Sekiguchi M. 1982. The uvrD gene of E. coli encodes a DNA-dependent ATPase. Nature 298:98–100 [DOI] [PubMed] [Google Scholar]
  • 294. Ogino H, Teramoto H, Inui M, Yukawa H. 2008. DivS, a novel SOS-inducible cell-division suppressor in Corynebacterium glutamicum. Mol. Microbiol. 67:597–608 [DOI] [PubMed] [Google Scholar]
  • 295. Ogura M, et al. 2002. Whole-genome analysis of genes regulated by the Bacillus subtilis competence transcription factor ComK. J. Bacteriol. 184:2344–2351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 296. Ohmori H, et al. 2001. The Y-family of DNA polymerases. Mol. Cell 8:7–8 [DOI] [PubMed] [Google Scholar]
  • 297. Ollivierre JN, Fang J, Beuning PJ. 2010. The roles of UmuD in regulating mutagenesis. J. Nucleic Acids 2010:947680 doi:10.4061/2010/947680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 298. Olsen GJ, Woese CR, Overbeek R. 1994. The winds of (evolutionary) change: breathing new life into microbiology. J. Bacteriol. 176:1–6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 299. Oppenheimer-Shaanan Y, Wexselblatt E, Katzhendler J, Yavin E, Ben-Yehuda S. 2011. c-di-AMP reports DNA integrity during sporulation in Bacillus subtilis. EMBO Rep. 12:594–601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 300. Orren DK, Sancar A. 1990. Formation and enzymatic properties of the UvrB.DNA complex. J. Biol. Chem. 265:15796–15803 [PubMed] [Google Scholar]
  • 301. Orren DK, Sancar A. 1989. The (A)BC excinuclease of Escherichia coli has only the UvrB and UvrC subunits in the incision complex. Proc. Natl. Acad. Sci. U. S. A. 86:5237–5241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 302. Orren DK, Selby CP, Hearst JE, Sancar A. 1992. Post-incision steps of nucleotide excision repair in Escherichia coli. Disassembly of the UvrBC-DNA complex by helicase II and DNA polymerase I. J. Biol. Chem. 267:780–788 [PubMed] [Google Scholar]
  • 303. Pace NR, Olsen GJ, Woese CR. 1986. Ribosomal RNA phylogeny and the primary lines of evolutionary descent. Cell 45:325–326 [DOI] [PubMed] [Google Scholar]
  • 304. Paredes-Sabja D, Setlow P, Sarker MR. 2011. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends Microbiol. 19:85–94 [DOI] [PubMed] [Google Scholar]
  • 305. Pedersen K, Gerdes K. 1999. Multiple hok genes on the chromosome of Escherichia coli. Mol. Microbiol. 32:1090–1102 [DOI] [PubMed] [Google Scholar]
  • 306. Pegg AE, Byers TL. 1992. Repair of DNA containing O6-alkylguanine. FASEB J. 6:2302–2310 [DOI] [PubMed] [Google Scholar]
  • 307. Petit MA, et al. 1998. PcrA is an essential DNA helicase of Bacillus subtilis fulfilling functions both in repair and rolling-circle replication. Mol. Microbiol. 29:261–273 [DOI] [PubMed] [Google Scholar]
  • 308. Petit MA, Ehrlich D. 2002. Essential bacterial helicases that counteract the toxicity of recombination proteins. EMBO J. 21:3137–3147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 309. Piggot PJ, Hilbert DW. 2004. Sporulation of Bacillus subtilis. Curr. Opin. Microbiol. 7:579–586 [DOI] [PubMed] [Google Scholar]
  • 310. Pillon MC, et al. 2010. Structure of the endonuclease domain of MutL: unlicensed to cut. Mol. Cell 39:145–151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 311. Pillon MC, Miller JH, Guarne A. 2011. The endonuclease domain of MutL interacts with the beta sliding clamp. DNA Repair (Amsterdam) 10:87–93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 312. Pinto AV, et al. 2005. Suppression of homologous and homeologous recombination by the bacterial MutS2 protein. Mol. Cell 17:113–120 [DOI] [PubMed] [Google Scholar]
  • 313. Pitcher RS, Tonkin LM, Green AJ, Doherty AJ. 2005. Domain structure of a NHEJ DNA repair ligase from Mycobacterium tuberculosis. J. Mol. Biol. 351:531–544 [DOI] [PubMed] [Google Scholar]
  • 314. Pluciennik A, Burdett V, Lukianova O, O'Donnell M, Modrich P. 2009. Involvement of the beta clamp in methyl-directed mismatch repair in vitro. J. Biol. Chem. 284:32782–32791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 315. Polard P, et al. 2002. Restart of DNA replication in Gram-positive bacteria: functional characterisation of the Bacillus subtilis PriA initiator. Nucleic Acids Res. 30:1593–1605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 316. Prieto-Alamo MJ, et al. 2000. Transcriptional regulation of glutaredoxin and thioredoxin pathways and related enzymes in response to oxidative stress. J. Biol. Chem. 275:13398–13405 [DOI] [PubMed] [Google Scholar]
  • 317. Qi Y, et al. 2009. Encounter and extrusion of an intrahelical lesion by a DNA repair enzyme. Nature 462:762–766 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 318. Qi Y, Spong MC, Nam K, Karplus M, Verdine GL. 2010. Entrapment and structure of an extrahelical guanine attempting to enter the active site of a bacterial DNA glycosylase, MutM. J. Biol. Chem. 285:1468–1478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 319. Quiberoni A, et al. 2001. In vivo evidence for two active nuclease motifs in the double-strand break repair enzyme RexAB of Lactococcus lactis. J. Bacteriol. 183:4071–4078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 320. Quinones M, Kimsey HH, Ross W, Gourse RL, Waldor MK. 2006. LexA represses CTXphi transcription by blocking access of the alpha C-terminal domain of RNA polymerase to promoter DNA. J. Biol. Chem. 281:39407–39412 [DOI] [PubMed] [Google Scholar]
  • 321. Quinones M, Kimsey HH, Waldor MK. 2005. LexA cleavage is required for CTX prophage induction. Mol. Cell 17:291–300 [DOI] [PubMed] [Google Scholar]
  • 322. Rahn-Lee L, Gorbatyuk B, Skovgaard O, Losick R. 2009. The conserved sporulation protein YneE inhibits DNA replication in Bacillus subtilis. J. Bacteriol. 191:3736–3739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 323. Rahn-Lee L, Merrikh H, Grossman AD, Losick R. 2011. The sporulation protein SirA inhibits the binding of DnaA to the origin of replication by contacting a patch of clustered amino acids. J. Bacteriol. 193:1302–1307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 324. Ramirez MI, Castellanos-Juarez FX, Yasbin RE, Pedraza-Reyes M. 2004. The ytkD (mutTA) gene of Bacillus subtilis encodes a functional antimutator 8-oxo-(dGTP/GTP)ase and is under dual control of sigma A and sigma F RNA polymerases. J. Bacteriol. 186:1050–1059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 325. Rangarajan S, Woodgate R, Goodman MF. 1999. A phenotype for enigmatic DNA polymerase II: a pivotal role for pol II in replication restart in UV-irradiated Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 96:9224–9229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 326. Reader JS, Metzgar D, Schimmel P, de Crecy-Lagard V. 2004. Identification of four genes necessary for biosynthesis of the modified nucleoside queuosine. J. Biol. Chem. 279:6280–6285 [DOI] [PubMed] [Google Scholar]
  • 327. Reuven NB, Arad G, Maor-Shoshani A, Livneh Z. 1999. The mutagenesis protein UmuC is a DNA polymerase activated by UmuD′, RecA, and SSB and specialized for translesion synthesis. J. Biol. Chem. 274:31763–31766 [DOI] [PubMed] [Google Scholar]
  • 328. Riley M, et al. 2006. Escherichia coli K-12: a cooperatively developed annotation snapshot—2005. Nucleic Acids Res. 34:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 329. Robleto EA, Yasbin R, Ross C, Pedraza-Reyes M. 2007. Stationary phase mutagenesis in B. subtilis: a paradigm to study genetic diversity programs in cells under stress. Crit. Rev. Biochem. Mol. Biol. 42:327–339 [DOI] [PubMed] [Google Scholar]
  • 330. Ross C, et al. 2006. Novel role of mfd: effects on stationary-phase mutagenesis in Bacillus subtilis. J. Bacteriol. 188:7512–7520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 331. Rossi ML, Ghosh AK, Bohr VA. 2010. Roles of Werner syndrome protein in protection of genome integrity. DNA Repair (Amsterdam) 9:796–804 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 332. Rossolillo P, Albertini AM. 2001. Functional analysis of the Bacillus subtilis yshD gene, a mutS paralogue. Mol. Gen. Genet. 264:809–818 [DOI] [PubMed] [Google Scholar]
  • 333. Rowland SL, et al. 2004. Structure and mechanism of action of Sda, an inhibitor of the histidine kinases that regulate initiation of sporulation in Bacillus subtilis. Mol. Cell 13:689–701 [DOI] [PubMed] [Google Scholar]
  • 334. Rubinson EH, Gowda AS, Spratt TE, Gold B, Eichman BF. 2010. An unprecedented nucleic acid capture mechanism for excision of DNA damage. Nature 468:406–411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 335. Rudner DZ, Losick R. 2001. Morphological coupling in development: lessons from prokaryotes. Dev. Cell 1:733–742 [DOI] [PubMed] [Google Scholar]
  • 336. Ruvolo MV, Mach KE, Burkholder WF. 2006. Proteolysis of the replication checkpoint protein Sda is necessary for the efficient initiation of sporulation after transient replication stress in Bacillus subtilis. Mol. Microbiol. 60:1490–1508 [DOI] [PubMed] [Google Scholar]
  • 337. Ryzhikov M, Koroleva O, Postnov D, Tran A, Korolev S. 2011. Mechanism of RecO recruitment to DNA by single-stranded DNA binding protein. Nucleic Acids Res. 39:6305–6314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 338. Saikrishnan K, et al. 2012. Insights into Chi recognition from the structure of an AddAB-type helicase-nuclease complex. EMBO J. 31:1568–1578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 339. Salas-Pacheco JM, Urtiz-Estrada N, Martinez-Cadena G, Yasbin RE, Pedraza-Reyes M. 2003. YqfS from Bacillus subtilis is a spore protein and a new functional member of the type IV apurinic/apyrimidinic-endonuclease family. J. Bacteriol. 185:5380–5390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 340. Samson L. 1992. The suicidal DNA repair methyltransferases of microbes. Mol. Microbiol. 6:825–831 [DOI] [PubMed] [Google Scholar]
  • 341. Samson LD. 1992. The repair of DNA alkylation damage by methyltransferases and glycosylases. Essays Biochem. 27:69–78 [PubMed] [Google Scholar]
  • 342. Sancar A. 1996. DNA excision repair. Annu. Rev. Biochem. 65:43–81 [DOI] [PubMed] [Google Scholar]
  • 343. Sancar A. 1994. Mechanisms of DNA excision repair. Science 266:1954–1956 [DOI] [PubMed] [Google Scholar]
  • 344. Sancar A, Sancar GB. 1988. DNA repair enzymes. Annu. Rev. Biochem. 57:29–67 [DOI] [PubMed] [Google Scholar]
  • 345. Sanchez H, Alonso JC. 2005. Bacillus subtilis RecN binds and protects 3′-single-stranded DNA extensions in the presence of ATP. Nucleic Acids Res. 33:2343–2350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 346. Sanchez H, Cardenas PP, Yoshimura SH, Takeyasu K, Alonso JC. 2008. Dynamic structures of Bacillus subtilis RecN-DNA complexes. Nucleic Acids Res. 36:110–120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 347. Sanchez H, Carrasco B, Ayora S, Alonso JC. 2007. Dynamics of DNA double-strand break repair in Bacillus subtilis. Caister Academic Press, Norfolk, United Kingdom [Google Scholar]
  • 348. Sanchez H, Carrasco B, Ayora S, Alonso JC. 2006. Homologous recombination in low dC+dG Gram-positive bacteria. Springer, Berlin, Germany [Google Scholar]
  • 349. Sanchez H, Carrasco B, Cozar MC, Alonso JC. 2007. Bacillus subtilis RecG branch migration translocase is required for DNA repair and chromosomal segregation. Mol. Microbiol. 65:920–935 [DOI] [PubMed] [Google Scholar]
  • 350. Sanchez H, Kidane D, Castillo Cozar M, Graumann PL, Alonso JC. 2006. Recruitment of Bacillus subtilis RecN to DNA double-strand breaks in the absence of DNA end processing. J. Bacteriol. 188:353–360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 351. Sanchez H, et al. 2005. The RuvAB branch migration translocase and RecU Holliday junction resolvase are required for double-stranded DNA break repair in Bacillus subtilis. Genetics 171:873–883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 352. Sanders GM, Dallmann HG, McHenry CS. 2010. Reconstitution of the B. subtilis replisome with 13 proteins including two distinct replicases. Mol. Cell 37:273–281 [DOI] [PubMed] [Google Scholar]
  • 353. Sandler SJ, Samra HS, Clark AJ. 1996. Differential suppression of priA2::kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC. Genetics 143:5–13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 354. Sargentini NJ, Smith KC. 1986. Quantitation of the involvement of the recA, recB, recC, recF, recJ, recN, lexA, radA, radB, uvrD, and umuC genes in the repair of X-ray-induced DNA double-strand breaks in Escherichia coli. Radiat. Res. 107:58–72 [PubMed] [Google Scholar]
  • 355. Sasaki M, Kurusu Y. 2004. Analysis of spontaneous base substitutions generated in mutator strains of Bacillus subtilis. FEMS Microbiol. Lett. 234:37–42 [DOI] [PubMed] [Google Scholar]
  • 356. Sasaki M, Yonemura Y, Kurusu Y. 2000. Genetic analysis of Bacillus subtilis mutator genes. J. Gen. Appl. Microbiol. 46:183–187 [DOI] [PubMed] [Google Scholar]
  • 357. Sassanfar M, Roberts JW. 1990. Nature of the SOS-inducing signal in Escherichia coli: the involvement of DNA replication. J. Mol. Biol. 212:79–96 [DOI] [PubMed] [Google Scholar]
  • 358. Schaaper RM, Bond BI, Fowler RG. 1989. AT → CG transversions and their prevention by the Escherichia coli mutT and mutHLS pathways. Mol. Gen. Genet. 219:256–262 [DOI] [PubMed] [Google Scholar]
  • 359. Schendel PF, Defais M, Jeggo P, Samson L, Cairns J. 1978. Pathways of mutagenesis and repair in Escherichia coli exposed to low levels of simple alkylating agents. J. Bacteriol. 135:466–475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 360. Scheuermann RH, Echols H. 1984. A separate editing exonuclease for DNA replication: the epsilon subunit of Escherichia coli DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. U. S. A. 81:7747–7751 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 361. Schneider S, Zhang W, Soultanas P, Paoli M. 2008. Structure of the N-terminal oligomerization domain of DnaD reveals a unique tetramerization motif and provides insights into scaffold formation. J. Mol. Biol. 376:1237–1250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 362. Schofield MJ, Hsieh P. 2003. DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 57:579–608 [DOI] [PubMed] [Google Scholar]
  • 363. Sedgwick B. 2004. Repairing DNA-methylation damage. Nat. Rev. Mol. Cell. Biol. 5:148–157 [DOI] [PubMed] [Google Scholar]
  • 364. Sedgwick B, Lindahl T. 2002. Recent progress on the Ada response for inducible repair of DNA alkylation damage. Oncogene 21:8886–8894 [DOI] [PubMed] [Google Scholar]
  • 365. Sekiguchi J, et al. 1995. Nucleotide sequence and regulation of a new putative cell wall hydrolase gene, cwlD, which affects germination in Bacillus subtilis. J. Bacteriol. 177:5582–5589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 366. Sergiev PV, Serebryakova MV, Bogdanov AA, Dontsova OA. 2008. The ybiN gene of Escherichia coli encodes adenine-N6 methyltransferase specific for modification of A1618 of 23S ribosomal RNA, a methylated residue located close to the ribosomal exit tunnel. J. Mol. Biol. 375:291–300 [DOI] [PubMed] [Google Scholar]
  • 367. Setlow P. 2007. I will survive: DNA protection in bacterial spores. Trends Microbiol. 15:172–180 [DOI] [PubMed] [Google Scholar]
  • 368. Setlow P. 1992. I will survive: protecting and repairing spore DNA. J. Bacteriol. 174:2737–2741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 369. Setlow P. 1995. Mechanisms for the prevention of damage to DNA in spores of Bacillus species. Annu. Rev. Microbiol. 49:29–54 [DOI] [PubMed] [Google Scholar]
  • 370. Setlow P. 1994. Mechanisms which contribute to the long-term survival of spores of Bacillus species. Soc. Appl. Bacteriol. Symp. Ser. 23:49S–60S [DOI] [PubMed] [Google Scholar]
  • 371. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J. Appl. Microbiol. 101:514–525 [DOI] [PubMed] [Google Scholar]
  • 372. Shafritz KM, Sandigursky M, Franklin WA. 1998. Exonuclease IX of Escherichia coli. Nucleic Acids Res. 26:2593–2597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 373. Sharples GJ, Leach DR. 1995. Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast. Mol. Microbiol. 17:1215–1217 [DOI] [PubMed] [Google Scholar]
  • 374. Shereda RD, Bernstein DA, Keck JL. 2007. A central role for SSB in Escherichia coli RecQ DNA helicase function. J. Biol. Chem. 282:19247–19258 [DOI] [PubMed] [Google Scholar]
  • 375. Shereda RD, Kozlov AG, Lohman TM, Cox MM, Keck JL. 2008. SSB as an organizer/mobilizer of genome maintenance complexes. Crit. Rev. Biochem. Mol. Biol. 43:289–318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 376. Shevell DE, Friedman BM, Walker GC. 1990. Resistance to alkylation damage in Escherichia coli: role of the Ada protein in induction of the adaptive response. Mutat. Res. 233:53–72 [DOI] [PubMed] [Google Scholar]
  • 377. Shibutani S, Takeshita M, Grollman AP. 1991. Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature 349:431–434 [DOI] [PubMed] [Google Scholar]
  • 378. Shida T, Kaneda K, Ogawa T, Sekiguchi J. 1999. Abasic site recognition mechanism by the Escherichia coli exonuclease III. Nucleic Acids Symp. Ser. 1999:195–196 [DOI] [PubMed] [Google Scholar]
  • 379. Shlomai J, Kornberg A. 1978. Deoxyuridine triphosphatase of Escherichia coli. Purification, properties, and use as a reagent to reduce uracil incorporation into DNA. J. Biol. Chem. 253:3305–3312 [PubMed] [Google Scholar]
  • 380. Shuman S, Glickman MS. 2007. Bacterial DNA repair by non-homologous end joining. Nat. Rev. Microbiol. 5:852–861 [DOI] [PubMed] [Google Scholar]
  • 381. Sibghat-Ullah, Sancar A, Hearst JE. 1990. The repair patch of E. coli (A)BC excinuclease. Nucleic Acids Res. 18:5051–5053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 382. Sievers J, Errington J. 2000. Analysis of the essential cell division gene ftsL of Bacillus subtilis by mutagenesis and heterologous complementation. J. Bacteriol. 182:5572–5579 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 383. Sievers J, Errington J. 2000. The Bacillus subtilis cell division protein FtsL localizes to sites of septation and interacts with DivIC. Mol. Microbiol. 36:846–855 [DOI] [PubMed] [Google Scholar]
  • 384. Simmons LA, Davies BW, Grossman AD, Walker GC. 2008. Beta clamp directs localization of mismatch repair in Bacillus subtilis. Mol. Cell 29:291–301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 385. Simmons LA, Foti JJ, Cohen SE, Walker GC. 25 July 2008, posting date. Chapter 5.4.3, The SOS regulatory network. In Böck A, et al. (ed), EcoSal—Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, DC: doi:10.1128/ecosal.4.7.4. [Google Scholar]
  • 386. Simmons LA, et al. 2009. Comparison of responses to double-strand breaks between Escherichia coli and Bacillus subtilis reveals different requirements for SOS induction. J. Bacteriol. 191:1152–1161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 387. Simmons LA, Grossman AD, Walker GC. 2007. Replication is required for the RecA localization response to DNA damage in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 104:1360–1365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 388. Singleton MR, Dillingham MS, Gaudier M, Kowalczykowski SC, Wigley DB. 2004. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature 432:187–193 [DOI] [PubMed] [Google Scholar]
  • 389. Sladek FM, Munn MM, Rupp WD, Howard-Flanders P. 1989. In vitro repair of psoralen-DNA cross-links by RecA, UvrABC, and the 5′-exonuclease of DNA polymerase I. J. Biol. Chem. 264:6755–6765 [PubMed] [Google Scholar]
  • 390. Smith BT, Grossman AD, Walker GC. 2002. Localization of UvrA and effect of DNA damage on the chromosome of Bacillus subtilis. J. Bacteriol. 184:488–493 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 391. Smith BT, Grossman AD, Walker GC. 2001. Visualization of mismatch repair in bacterial cells. Mol. Cell 8:1197–1206 [DOI] [PubMed] [Google Scholar]
  • 392. Smits WK, Goranov AI, Grossman AD. 2010. Ordered association of helicase loader proteins with the Bacillus subtilis origin of replication in vivo. Mol. Microbiol. 75:452–461 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 393. Smits WK, Merrikh H, Bonilla CY, Grossman AD. 2011. Primosomal proteins DnaD and DnaB are recruited to chromosomal regions bound by DnaA in Bacillus subtilis. J. Bacteriol. 193:640–648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 394. Sonenshein AL, Hoch JA, Losick R. 1993. Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington DC [Google Scholar]
  • 395. Soppa J, et al. 2002. Discovery of two novel families of proteins that are proposed to interact with prokaryotic SMC proteins, and characterization of the Bacillus subtilis family members ScpA and ScpB. Mol. Microbiol. 45:59–71 [DOI] [PubMed] [Google Scholar]
  • 396. Srivatsan A, Tehranchi A, MacAlpine DM, Wang JD. 2010. Co-orientation of replication and transcription preserves genome integrity. PLoS Genet. 6:e1000810 doi:10.1371/journal.pgen.1000810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 397. Steffen SE, Bryant FR. 1999. Reevaluation of the nucleotide cofactor specificity of the RecA protein from Bacillus subtilis. J. Biol. Chem. 274:25990–25994 [DOI] [PubMed] [Google Scholar]
  • 398. Stephan AK, Kliszczak M, Dodson H, Cooley C, Morrison CG. 2011. Roles of vertebrate Smc5 in sister chromatid cohesion and homologous recombinational repair. Mol. Cell. Biol. 31:1369–1381 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 399. Stranathan MC, Bayles KW, Yasbin RE. 1990. The nucleotide sequence of the recE+ gene of Bacillus subtilis. Nucleic Acids Res. 18:4249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 400. Sullivan NL, Marquis KA, Rudner DZ. 2009. Recruitment of SMC by ParB-parS organizes the origin region and promotes efficient chromosome segregation. Cell 137:697–707 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 401. Sun DX, Stragier P, Setlow P. 1989. Identification of a new sigma-factor involved in compartmentalized gene expression during sporulation of Bacillus subtilis. Genes Dev. 3:141–149 [DOI] [PubMed] [Google Scholar]
  • 402. Sung HM, Yasbin RE. 2002. Adaptive, or stationary-phase, mutagenesis, a component of bacterial differentiation in Bacillus subtilis. J. Bacteriol. 184:5641–5653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 403. Sung HM, Yeamans G, Ross CA, Yasbin RE. 2003. Roles of YqjH and YqjW, homologs of the Escherichia coli UmuC/DinB or Y superfamily of DNA polymerases, in stationary-phase mutagenesis and UV-induced mutagenesis of Bacillus subtilis. J. Bacteriol. 185:2153–2160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 404. Sutton MD. 2010. Coordinating DNA polymerase traffic during high and low fidelity synthesis. Biochim. Biophys. Acta 1804:1167–1179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 405. Sutton MD, Walker GC. 2001. Managing DNA polymerases: coordinating DNA replication, DNA repair, and DNA recombination. Proc. Natl. Acad. Sci. U. S. A. 98:8342–8349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 406. Takahashi I, Marmur J. 1963. Replacement of thymidylic acid by deoxyuridylic acid in the deoxyribonucleic acid of a transducing phage for Bacillus subtilis. Nature 197:794–795 [DOI] [PubMed] [Google Scholar]
  • 407. Tamanoi F, Machida Y, Okazaki T. 1979. Uracil incorporation into nascent DNA of Bacillus subtilis and Escherichia coli. Cold Spring Harb. Symp. Quant. Biol. 43:239–242 [DOI] [PubMed] [Google Scholar]
  • 408. Tamanoi F, Okazaki T. 1978. Uracil incorporation into nascent DNA of thymine-requiring mutant of Bacillus subtilis 168. Proc. Natl. Acad. Sci. U. S. A. 75:2195–2199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 409. Tang M, et al. 1999. UmuD′2C is an error-prone DNA polymerase, Escherichia coli pol V. Proc. Natl. Acad. Sci. U. S. A. 96:8919–8924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 410. Taylor AF, Smith GR. 2003. RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity. Nature 423:889–893 [DOI] [PubMed] [Google Scholar]
  • 411. Tchou J, et al. 1991. 8-Oxoguanine (8-hydroxyguanine) DNA glycosylase and its substrate specificity. Proc. Natl. Acad. Sci. U. S. A. 88:4690–4694 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 412. Timmins J, Leiros I, McSweeney S. 2007. Crystal structure and mutational study of RecOR provide insight into its mode of DNA binding. EMBO J. 26:3260–3271 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 413. Tortosa P, Dubnau D. 1999. Competence for transformation: a matter of taste. Curr. Opin. Microbiol. 2:588–592 [DOI] [PubMed] [Google Scholar]
  • 414. Toutain CM, et al. 2003. The transmembrane domain of the DnaJ-like protein DjlA is a dimerisation domain. Mol. Genet. Genomics 268:761–770 [DOI] [PubMed] [Google Scholar]
  • 415. Tsai-Wu JJ, Liu HF, Lu AL. 1992. Escherichia coli MutY protein has both N-glycosylase and apurinic/apyrimidinic endonuclease activities on A.C and A.G mispairs. Proc. Natl. Acad. Sci. U. S. A. 89:8779–8783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 416. Tsai-Wu JJ, Lu AL. 1994. Escherichia coli mutY-dependent mismatch repair involves DNA polymerase I and a short repair tract. Mol. Gen. Genet. 244:444–450 [DOI] [PubMed] [Google Scholar]
  • 417. Tsaneva IR, Illing G, Lloyd RG, West SC. 1992. Purification and properties of the RuvA and RuvB proteins of Escherichia coli. Mol. Gen. Genet. 235:1–10 [DOI] [PubMed] [Google Scholar]
  • 418. Tsaneva IR, Muller B, West SC. 1992. ATP-dependent branch migration of Holliday junctions promoted by the RuvA and RuvB proteins of E. coli. Cell 69:1171–1180 [DOI] [PubMed] [Google Scholar]
  • 419. Tye BK, Chien J, Lehman IR, Duncan BK, Warner HR. 1978. Uracil incorporation: a source of pulse-labeled DNA fragments in the replication of the Escherichia coli chromosome. Proc. Natl. Acad. Sci. U. S. A. 75:233–237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 420. Tye BK, Lehman IR. 1977. Excision repair of uracil incorporated in DNA as a result of a defect in dUTPase. J. Mol. Biol. 117:293–306 [DOI] [PubMed] [Google Scholar]
  • 421. Tye BK, Nyman PO, Lehman IR. 1978. Excision repair of uracil during replication of phiX174 DNA in vitro. Biochem. Biophys. Res. Commun. 82:434–441 [DOI] [PubMed] [Google Scholar]
  • 422. Umezu K, Chi N-W, Kolodner RD. 1993. Biochemical interactions of the Escherichia coli RecF, RecO, and RecR proteins with RecA protein and single-stranded binding protein. Proc. Natl. Acad. Sci. U. S. A. 90:3875–3879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 423. Umezu K, Kolodner RD. 1994. Protein interactions in genetic recombination in Escherichia coli. Interactions involving RecO and RecR overcome the inhibition of RecA by single-stranded DNA-binding protein. J. Biol. Chem. 269:30005–30013 [PubMed] [Google Scholar]
  • 424. Urtiz-Estrada N, Salas-Pacheco JM, Yasbin RE, Pedraza-Reyes M. 2003. Forespore-specific expression of Bacillus subtilis yqfS, which encodes type IV apurinic/apyrimidinic endonuclease, a component of the base excision repair pathway. J. Bacteriol. 185:340–348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 425. van der Veen S, et al. 2010. The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis. Microbiology 156:374–384 [DOI] [PubMed] [Google Scholar]
  • 426. Veening JW, Murray H, Errington J. 2009. A mechanism for cell cycle regulation of sporulation initiation in Bacillus subtilis. Genes Dev. 23:1959–1970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 427. Velten M, et al. 2003. A two-protein strategy for the functional loading of a cellular replicative DNA helicase. Mol. Cell 11:1009–1020 [DOI] [PubMed] [Google Scholar]
  • 428. Vidales LE, Cardenas LC, Robleto E, Yasbin RE, Pedraza-Reyes M. 2009. Defects in the error prevention oxidized guanine system potentiate stationary-phase mutagenesis in Bacillus subtilis. J. Bacteriol. 191:506–513 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 429. Viswanathan M, Burdett V, Baitinger C, Modrich P, Lovett ST. 2001. Redundant exonuclease involvement in Escherichia coli methyl-directed mismatch repair. J. Biol. Chem. 276:31053–31058 [DOI] [PubMed] [Google Scholar]
  • 430. Volkert MR. 1988. Adaptive response of Escherichia coli to alkylation damage. Environ. Mol. Mutagen. 11:241–255 [DOI] [PubMed] [Google Scholar]
  • 431. Voloshin ON, Camerini-Otero RD. 2007. The DinG protein from Escherichia coli is a structure-specific helicase. J. Biol. Chem. 282:18437–18447 [DOI] [PubMed] [Google Scholar]
  • 432. Voloshin ON, Ramirez BE, Bax A, Camerini-Otero RD. 2001. A model for the abrogation of the SOS response by an SOS protein: a negatively charged helix in DinI mimics DNA in its interaction with RecA. Genes Dev. 15:415–427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 433. Wagner JK, Marquis KA, Rudner DZ. 2009. SirA enforces diploidy by inhibiting the replication initiator DnaA during spore formation in Bacillus subtilis. Mol. Microbiol. 73:963–974 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 434. Walker GC. 1984. Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli. Microbiol. Rev. 48:60–93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 435. Walker GC. 1995. SOS-regulated proteins in translesion synthesis and mutagenesis. Trends Biochem. Sci. 10:416–420 [DOI] [PubMed] [Google Scholar]
  • 436. Walker GC. 1987. The SOS response of Escherichia coli, p 1346–1357. In Neidhardt F, et al. (ed), Escherichia coli and Salmonella: cellular and molecular biology. American Society for Microbiology, Washington, DC [Google Scholar]
  • 437. Walker GC, Kenyon CJ, Bagg A, Langer PJ, Shanabruch WG. 1982. Mutagenesis and cellular responses to DNA damage. J. Natl. Cancer Inst. Monogr. 60:257–267 [PubMed] [Google Scholar]
  • 438. Walker GC, Smith BT, Sutton MD. 2000. The SOS response to DNA damage, p 131–144. In Storz G, Hengge-Aronis R. (ed), Bacterial stress responses. The American Society for Microbiology, Washington DC [Google Scholar]
  • 439. Walker JR, Corpina RA, Goldberg J. 2001. Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412:607–614 [DOI] [PubMed] [Google Scholar]
  • 440. Wang ST, et al. 2006. The forespore line of gene expression in Bacillus subtilis. J. Mol. Biol. 358:16–37 [DOI] [PubMed] [Google Scholar]
  • 441. Wang ZG, Smith DG, Mosbaugh DW. 1991. Overproduction and characterization of the uracil-DNA glycosylase inhibitor of bacteriophage PBS2. Gene 99:31–37 [DOI] [PubMed] [Google Scholar]
  • 442. Warren AJ, Maccubbin AE, Hamilton JW. 1998. Detection of mitomycin C-DNA adducts in vivo by 32P-postlabeling: time course for formation and removal of adducts and biochemical modulation. Cancer Res. 58:453–461 [PubMed] [Google Scholar]
  • 443. Weiss B, Cunningham RP. 1985. Genetic mapping of nth, a gene affecting endonuclease III (thymine glycol-DNA glycosylase) in Escherichia coli K-12. J. Bacteriol. 162:607–610 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 444. Weller GR, Doherty AJ. 2001. A family of DNA repair ligases in bacteria? FEBS Lett. 505:340–342 [DOI] [PubMed] [Google Scholar]
  • 445. Weller GR, et al. 2002. Identification of a DNA nonhomologous end-joining complex in bacteria. Science 297:1686–1689 [DOI] [PubMed] [Google Scholar]
  • 446. West SC. 1997. Processing of recombination intermediates by the RuvABC proteins. Annu. Rev. Genet. 31:213–244 [DOI] [PubMed] [Google Scholar]
  • 447. Wilkinson A, Day J, Bowater R. 2001. Bacterial DNA ligases. Mol. Microbiol. 40:1241–1248 [DOI] [PubMed] [Google Scholar]
  • 448. Williams SD, David SS. 2000. A single engineered point mutation in the adenine glycosylase MutY confers bifunctional glycosylase/AP lyase activity. Biochemistry 39:10098–10109 [DOI] [PubMed] [Google Scholar]
  • 449. Williams SD, David SS. 1999. Formation of a Schiff base intermediate is not required for the adenine glycosylase activity of Escherichia coli MutY. Biochemistry 38:15417–15424 [DOI] [PubMed] [Google Scholar]
  • 450. Wilson JH, Berget PB, Pipas JM. 1982. Somatic cells efficiently join unrelated DNA segments end-to-end. Mol. Cell. Biol. 2:1258–1269 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 451. Winterling KW, et al. 1998. The Bacillus subtilis DinR binding site: redefinition of the consensus sequence. J. Bacteriol. 180:2201–2211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 452. Winterling KW, Levine AS, Yasbin RE, Woodgate R. 1997. Characterization of DinR, the Bacillus subtilis SOS repressor. J. Bacteriol. 179:1698–1703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 453. Witkin EM, Roegner-Maniscalco V, Sweasy JB, McCall JO. 1987. Recovery from ultraviolet light-induced inhibition of DNA synthesis requires umuDC gene products in recA718 mutant strains but not in recA+ strains of Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 84:6805–6809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 454. Witte G, Hartung S, Buttner K, Hopfner KP. 2008. Structural biochemistry of a bacterial checkpoint protein reveals diadenylate cyclase activity regulated by DNA recombination intermediates. Mol. Cell 30:167–178 [DOI] [PubMed] [Google Scholar]
  • 455. Wu L, Hickson ID. 2006. DNA helicases required for homologous recombination and repair of damaged replication forks. Annu. Rev. Genet. 40:279–306 [DOI] [PubMed] [Google Scholar]
  • 456. Wu LJ, Errington J. 1994. Bacillus subtilis spoIIIE protein required for DNA segregation during asymmetric cell division. Science 264:572–575 [DOI] [PubMed] [Google Scholar]
  • 457. Wu Y, He Y, Moya IA, Qian X, Luo Y. 2004. Crystal structure of archaeal recombinase RADA: a snapshot of its extended conformation. Mol. Cell 15:423–435 [DOI] [PubMed] [Google Scholar]
  • 458. Xu W, Jones CR, Dunn CA, Bessman MJ. 2004. Gene ytkD of Bacillus subtilis encodes an atypical nucleoside triphosphatase member of the Nudix hydrolase superfamily. J. Bacteriol. 186:8380–8384 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 459. Yamamoto H, Uchiyama S, Fajar AN, Ogasawara N, Sekiguchi J. 1996. Determination of a 12 kb nucleotide sequence around the 76 degrees region of the Bacillus subtilis chromosome. Microbiology 142:1417–1421 [DOI] [PubMed] [Google Scholar]
  • 460. Yang H, Miller JH. 2008. Deletion of dnaN1 generates a mutator phenotype in Bacillus anthracis. DNA Repair (Amsterdam) 7:507–514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 461. Yang H, et al. 2011. Papillation in Bacillus anthracis colonies: a tool for finding new mutators. Mol. Microbiol. 79:1276–1293 [DOI] [PubMed] [Google Scholar]
  • 462. Yang H, Yung M, Sikavi C, Miller JH. 2011. The role of Bacillus anthracis RecD2 helicase in DNA mismatch repair. DNA Repair (Amsterdam) 10:1121–1130 [DOI] [PubMed] [Google Scholar]
  • 463. Yang M, et al. 2011. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage. DNA Repair (Amsterdam) 10:595–602 [DOI] [PubMed] [Google Scholar]
  • 464. Yasbin RE. 1977. DNA repair in Bacillus subtilis. I. The presence of an inducible system. Mol. Gen. Genet. 153:211–218 [PubMed] [Google Scholar]
  • 465. Yasbin RE. 1977. DNA repair in Bacillus subtilis. II. Activation of the inducible system in competent bacteria. Mol. Gen. Genet. 153:219–225 [PubMed] [Google Scholar]
  • 466. Yasbin RE, Cheo D, Bayles KW. 1991. The SOB system of Bacillus subtilis: a global regulon involved in DNA repair and differentiation. Res. Microbiol. 142:885–892 [DOI] [PubMed] [Google Scholar]
  • 467. Yasbin RE, Fields PI, Andersen BJ. 1980. Properties of Bacillus subtilis 168 derivatives freed of their natural prophages. Gene 12:155–159 [DOI] [PubMed] [Google Scholar]
  • 468. Yasbin RE, Stranathan M, Bayles KW. 1991. The recE(A)+ gene of B. subtilis and its gene product: further characterization of this universal protein. Biochimie 73:245–250 [DOI] [PubMed] [Google Scholar]
  • 469. Yasbin RE, Wilson GA, Young FE. 1975. Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol. 121:296–304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 470. Yeeles JT, Dillingham MS. 2007. A dual-nuclease mechanism for DNA break processing by AddAB-type helicase-nucleases. J. Mol. Biol. 371:66–78 [DOI] [PubMed] [Google Scholar]
  • 471. Yeeles JT, Dillingham MS. 2010. The processing of double-stranded DNA breaks for recombinational repair by helicase-nuclease complexes. DNA Repair (Amsterdam) 9:276–285 [DOI] [PubMed] [Google Scholar]
  • 472. Yeeles JT, Gwynn EJ, Webb MR, Dillingham MS. 2011. The AddAB helicase-nuclease catalyses rapid and processive DNA unwinding using a single superfamily 1A motor domain. Nucleic Acids Res. 39:2271–2285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 473. Yeeles JT, van Aelst K, Dillingham MS, Moreno-Herrero F. 2011. Recombination hotspots and single-stranded DNA binding proteins couple DNA translocation to DNA unwinding by the AddAB helicase-nuclease. Mol. Cell 42:806–816 [DOI] [PubMed] [Google Scholar]
  • 474. Yu M, Souaya J, Julin DA. 1998. Identification of the nuclease active site in the multifunctional RecBCD enzyme by creation of a chimeric enzyme. J. Mol. Biol. 283:797–808 [DOI] [PubMed] [Google Scholar]
  • 475. Yu M, Souaya J, Julin DA. 1998. The 30-kDa C-terminal domain of the RecB protein is critical for the nuclease activity, but not the helicase activity, of the RecBCD enzyme from Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 95:981–986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 476. Zhang W, et al. 2005. The Bacillus subtilis DnaD and DnaB proteins exhibit different DNA remodelling activities. J. Mol. Biol. 351:66–75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 477. Zhang W, et al. 2008. Single-molecule atomic force spectroscopy reveals that DnaD forms scaffolds and enhances duplex melting. J. Mol. Biol. 377:706–714 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 478. Zhao XQ, Hu JF, Yu J. 2006. Comparative analysis of eubacterial DNA polymerase III alpha subunits. Genomics Proteomics Bioinformatics 4:203–211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 479. Zhou W, Doetsch PW. 1993. Effects of abasic sites and DNA single-strand breaks on prokaryotic RNA polymerases. Proc. Natl. Acad. Sci. U. S. A. 90:6601–6605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 480. Zhu Z, Chung WH, Shim EY, Lee SE, Ira G. 2008. Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double-strand break ends. Cell 134:981–994 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 481. Zinser ER, Kolter R. 1999. Mutations enhancing amino acid catabolism confer a growth advantage in stationary phase. J. Bacteriol. 181:5800–5807 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Microbiology and Molecular Biology Reviews : MMBR are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES