Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2012 Aug;80(8):2578–2588. doi: 10.1128/IAI.00052-12

The Intermediate Region of Helicobacter pylori VacA Is a Determinant of Toxin Potency in a Jurkat T Cell Assay

Christian González-Rivera a, Holly M Scott Algood b, Jana N Radin b, Mark S McClain b, Timothy L Cover a,b,c,✉
Editor: B A McCormick
PMCID: PMC3434591  PMID: 22585965

Abstract

Colonization of the human stomach with Helicobacter pylori is a risk factor for peptic ulceration, noncardia gastric adenocarcinoma, and gastric lymphoma. The secreted VacA toxin is an important H. pylori virulence factor that causes multiple alterations in gastric epithelial cells and T cells. Several families of vacA alleles have been described, and H. pylori strains containing certain vacA types (s1, i1, and m1) are associated with an increased risk of gastric disease, compared to strains containing other vacA types (s2, i2, and m2). Thus far, there has been relatively little study of the role of the VacA intermediate region (i-region) in toxin activity. In this study, we compared the ability of i1 and i2 forms of VacA to cause functional alterations in Jurkat cells. To do this, we manipulated the chromosomal vacA gene in two H. pylori strains to introduce alterations in the region encoding the VacA i-region. We did not detect any differences in the capacity of i1 and i2 forms of VacA to cause vacuolation of RK13 cells. In comparison to i1 forms of VacA, i2 forms of VacA had a diminished capacity to inhibit the activation of nuclear factor of activated T cells (NFAT) and suppress interleukin-2 (IL-2) production. Correspondingly, i2 forms of VacA bound to Jurkat cells less avidly than did i1 forms of VacA. These results indicate that the VacA i-region is an important determinant of VacA effects on human T cell function.

INTRODUCTION

Helicobacter pylori is a Gram-negative microaerophilic bacterium that persistently colonizes the human stomach (3, 10). H. pylori infection elicits a gastric mucosal inflammatory response and is associated with an increased risk of peptic ulcer disease, gastric adenocarcinoma, and gastric lymphoma (2, 52, 63). One of the important virulence factors produced by H. pylori is a secreted pore-forming toxin known as VacA (9, 17, 23, 38).

The vacA gene encodes a 140-kDa protein, which undergoes proteolytic processing to yield an amino-terminal signal sequence, an 88-kDa secreted toxin, and a carboxyl-terminal β-barrel domain (15, 22, 55, 66). The 88-kDa toxin (passenger domain) is secreted by a type V or autotransporter mechanism (15, 16, 22, 55). Two domains of the 88-kDa secreted toxin have been identified and are designated p33 and p55 (50, 66, 68, 75). Amino acid sequences within both the p55 domain (51, 72) and the p33 domain (31, 68) contribute to the cell-binding capacity of VacA. The crystal structure of the p55 domain has been determined and predominantly consists of a right-handed parallel β-helix (27).

The secreted 88-kDa toxin can assemble into large water-soluble flower-shaped oligomeric complexes (12, 21, 42). Upon exposure to acid or alkaline pH, the oligomers dissociate into monomeric 88-kDa components (12, 48). In comparison to intact VacA oligomers, which have relatively little effect on human cells, oligomers exposed to acid or alkaline pH conditions are highly active on human cells (18, 47). A current model proposes that VacA monomers interact with the plasma membrane and subsequently oligomerize, which allows the formation of VacA pores in cell membranes (9). VacA causes a wide range of alterations in human gastric cells (9), including the formation of large cytoplasmic vacuoles (11, 40), permeabilization of the plasma membrane (65), reduction of mitochondrial transmembrane potential (19, 24, 26, 74), mitochondrial cytochrome c release (19, 24, 26, 74), mitochondrial fragmentation (35), activation of mitogen-activated protein kinases (49), induction of autophagy (67), and cell death (13, 26, 35, 53). Most of these effects (but not all) are dependent on membrane channel formation by VacA (30, 34, 46, 71).

VacA also has effects on cells of the immune system and has been classified as an immunomodulatory toxin (7, 29, 64). VacA interacts with β2 integrin on the surface of human T cells (57) and is then internalized through a clathrin-independent pathway (58). Once inside T cells, VacA inhibits the activation and nuclear translocation of nuclear factor of activated T cells (NFAT) (29, 58). As a consequence, VacA inhibits the expression and secretion of interleukin-2 (IL-2) (29). Effects of VacA on IL-2 production have been studied most extensively in Jurkat cells (29, 57). In addition to its effects on IL-2 production by Jurkat cells, VacA inhibits the activation-induced proliferation of primary human T cells and B cells (57, 58, 64, 69).

The vacA alleles of H. pylori strains from unrelated humans exhibit a high level of genetic diversity, and several vacA types have been recognized based on sequence diversity in specific regions (Fig. 1) (4, 5, 28). Until recently, most studies focused on diversity at the 5′ end (s-region) or within the middle region (m-region) of vacA (4). Two main families of s-region and m-region sequences have been recognized (designated types s1 and s2, m1 and m2) (4, 5, 28). H. pylori strains containing type s1 or m1 vacA alleles are associated with a higher incidence of gastric disease than are strains containing type s2 or m2 vacA alleles (4, 70). Type s1 VacA proteins cause numerous cellular alterations in vitro, whereas type s2 VacA proteins lack detectable activity in most in vitro assays (4, 25, 39, 43). In comparison to type m2 VacA proteins, type m1 VacA proteins cause vacuolation in a wider range of cells; this has been attributed to differences in the cell-binding properties of m1 and m2 VacA proteins (36, 51, 61, 73). Differences in the activities of type s1 and m1 forms of VacA compared to s2 and m2 forms of VacA have been detected not only in studies of epithelial cells but also in studies of T cells (1, 29, 57).

Fig 1.

Fig 1

Amino acid sequences of the VacA i-region in different H. pylori strains. The secreted p88 VacA protein (comprising 821 amino acids in H. pylori strain 60190) contains two domains, designated p33 and p55. Amino acid sequence variation in VacA proteins from different H. pylori strains is especially prominent in three regions, which are designated s-, i-, and m-regions. The i-region and a portion of the s-region are localized within the p33 domain, and the m-region is localized within the p55 domain. The lower portion of this figure shows the sequences of VacA i-regions from strain 60190 (GenBank no. U05676), Tx30a (GenBank no. U29401), and X47. The figure illustrates the sequence of the secreted VacA protein of H. pylori strain 60190 (amino acids G120 to L236) and corresponding regions of VacA in two other wild-type strains (Tx30a and X47). Clusters of amino acid polymorphisms defined as clusters A, B, and C are indicated. Asterisks (*) indicate amino acids that are identical in all three sequences. The sequence of VacA from strain 60190 is designated a prototype for the i1 region, and the sequence of VacA from strain Tx30a is designated a prototype for the i2 region. VacA from strain X47 contains a type i2 sequence in cluster C, and cluster B is chimeric.

A third polymorphic region, known as the intermediate region (i-region), was recently identified within the p33 domain of vacA (54). Similar to the s- and m-regions, two families of i-region sequences have been recognized, and these are designated type i1 and i2 (54). One study reported that type i1 VacA proteins caused vacuolation of HeLa and RK13 cells (derived from human cervix and rabbit kidney, respectively), whereas type i2 VacA proteins caused vacuolation of RK13 cells but not HeLa cells (54). Therefore, it was concluded that the i-region is a determinant of VacA cell-type specificity. Within the i-region, there are three main clusters of amino acid diversity, known as polymorphic clusters A, B, and C (Fig. 1). Sequence variation within clusters B and C was reported to be responsible for the observed variation in cell-type specificity (54). Importantly, H. pylori strains containing i1 vacA alleles have been associated with a higher incidence of gastric disease, in comparison to H. pylori strains containing i2 vacA alleles (6, 8, 20, 33, 37, 54, 60).

Although multiple studies reported that the vacA i-region type is a marker of disease outcome, thus far there have been very few studies comparing the activities of type i1 and type i2 VacA proteins. In the current study, we tested the hypothesis that type i1 and i2 VacA proteins differ in the capacity to cause functional alterations in human T cells. We report that, in comparison to type i1 VacA proteins, type i2 VacA proteins have a reduced capacity to inhibit the function of Jurkat cells. In addition, we demonstrate that the difference in activities of i1 and i2 VacA proteins is attributable, at least in part, to differences in the binding of these VacA proteins to T cells.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Bacterial strains and the plasmids used in this study are listed in Table 1. The wild-type (WT) H. pylori 60190 strain (ATCC 49503) and strain X47 (generously provided by Douglas Berg) were grown on Trypticase soy agar plates containing 5% sheep blood at 37°C in ambient air containing 5% CO2. H. pylori mutant strains were grown on brucella agar plates containing 10% fetal bovine serum, supplemented with metronidazole (3.75 μg/ml) or chloramphenicol (5 μg/ml) when indicated. H. pylori liquid cultures were grown in brucella broth supplemented with either activated charcoal or 5% fetal bovine serum (FBS) (11).

Table 1.

H. pylori strains and plasmids

Strain/plasmid Relevant characteristics Reference
Strains
    60190 Wild type (ATCC 49503); vacA s1/i1/m1 40
    60190 ΔrdxA Same as 60190 except HP0954 (rdxA) gene deleted; metronidazole resistant This study
    60190 vacA::cat rdxA Same as 60190 ΔrdxA except cat cassette and rdxA inserted in vacA; chloramphenicol resistant and metronidazole sensitive; expression of VacA is disrupted This study
    60190 i2B Same as 60190 ΔrdxA except vacA cluster B changed to i2 This study
    60190 i2C Same as 60190 ΔrdxA except vacA cluster C changed to i2 This study
    60190 i2BC Same as 60190 ΔrdxA except vacA clusters B and C changed to i2 This study
    60190 i1/i2C Same as 60190 ΔrdxA except vacA cluster C has 4 amino acids changed to i2 This study
    X47 Wild type; vacA s1/m2, chimeric i-region 32
    X47 ΔrdxA Same as X47 except HP0954 (rdxA) gene deleted; metronidazole resistant This study
    X47 vacA::cat rdxA Same as X47 ΔrdxA except cat cassette and rdxA inserted in vacA; chloramphenicol resistant and metronidazole sensitive; expression of VacA is disrupted This study
    X47 i1C Same as X47 ΔrdxA except vacA cluster C changed to i1 This study
Plasmids
    pMM672 Allows deletion of rdxA in H. pylori strains 41
    pCGR1 Contains cat-rdxA cassette in StuI site; derived from pA178 plasmid This study
    pCGR2 Contains cat-rdxA cassette in EcoRV site from X47 vacA This study
    pCGR3 60910 cluster B changed from i1 to i2 by inverse PCR using primers B1F and B1R This study
    pCGR4 60190 cluster C changed from i1 to i2 by inverse PCR using primers C1F and C1R This study
    pCGR5 60190 clusters B and C changed from i1 to i2 by inverse PCR using primers C1F and C1R and pCGR3 as the template This study
    pCGR6 A portion of 60190 cluster C changed from i1 to i2 by inverse PCR using primers C2F and C2R This study
    pCGR7 X47 cluster C changed from i2 to i1 by inverse PCR using primers C3F and C3R This study
    p55 Expresses VacA p55 27
    p33 Expresses VacA p33 31
    p33 i2 Expresses p33 i2 This study

Preparation of H. pylori broth culture supernatants and normalization of VacA concentrations.

For experiments using H. pylori broth culture supernatant (derived from bacteria cultured in brucella broth containing FBS), supernatants were concentrated 50-fold by ultrafiltration with a 30-kDa-cutoff membrane (Millipore). The relative concentrations of VacA in broth culture supernatant preparations from WT and mutant H. pylori strains were determined by Western blot analysis using anti-VacA antiserum no. 958 (prepared by immunization of a rabbit with VacA oligomers purified from H. pylori broth culture supernatant) (56). This anti-VacA antiserum reacted equally well with i1 and i2 VacA proteins in an antigen detection enzyme-linked immunosorbent assay (ELISA) (data not shown). When necessary, the concentrations of VacA in individual preparations were normalized by diluting samples with the appropriate volumes of concentrated brucella broth containing FBS.

Purification of VacA from H. pylori broth culture supernatants.

For experiments using purified VacA, VacA oligomers were purified from H. pylori culture supernatants as described previously (12). Prior to adding purified VacA to eukaryotic cells, the oligomeric VacA preparations were acid activated by the slow addition of 200 mM HCl until a pH of 3.0 was reached.

Mutagenesis of vacA.

To generate unmarked H. pylori mutant strains, we used a negative selection method (41, 59). As a first step, metronidazole-resistant forms of strains 60190 and X47, designated 60190 ΔrdxA and X47 ΔrdxA, were generated by deletion of the rdxA gene. PCR analysis confirmed that the rdxA locus was deleted from the mutant strains. As a next step, cloned vacA sequences were disrupted by insertion of a cat-rdxA cassette. This cassette confers resistance to chloramphenicol mediated by the chloramphenicol acetyltransferase (cat) gene from Campylobacter coli, and susceptibility to metronidazole is mediated by an intact rdxA gene (HP0954) from H. pylori 26695 (41). For mutagenesis of vacA in H. pylori strain 60190, the cat-rdxA cassette (described above) was ligated into an StuI site in plasmid pA178, which contains a vacA DNA fragment from H. pylori 60190 (43). The resulting plasmid (pCGR1), which is unable to replicate in H. pylori, was used to transform the H. pylori 60190 ΔrdxA strain, and single colonies resistant to chloramphenicol (5 μg/ml) but sensitive to metronidazole (3.75 μg/ml) were selected. For mutagenesis of vacA in H. pylori strain X47, a DNA fragment encoding VacA amino acids 4 to 727 was PCR amplified from this strain, and the PCR product was cloned into pGEMT-Easy (Promega). The resulting plasmid was digested with EcoRV, and the cat-rdxA cassette was ligated into this restriction site. The resulting plasmid (pCGR2) was transformed into the H. pylori X47 ΔrdxA strain, and single colonies resistant to chloramphenicol but sensitive to metronidazole were selected. Immunoblot analysis revealed the loss of VacA expression in these mutants, and insertion of the cat-rdxA cassette into the vacA gene was confirmed by PCR amplification and nucleotide sequence analysis of PCR products. To introduce alterations into the i-region of the chromosomal vacA gene in H. pylori strains, we constructed various plasmids using an inverse PCR approach with the 5′ phosphorylated primers listed in Table 2. The vacA sequence from each plasmid was sequenced to ensure that unintentional mutations were not introduced. These plasmids were used to transform H. pylori strains containing the cat-rdxA cassette, and transformants resistant to metronidazole were selected. The presence of the desired mutations was confirmed by PCR and nucleotide sequence analysis of PCR products.

Table 2.

PCR primers used for mutagenesis of the vacA i-region

Primer Sequence (5′→3′)
B1F ATTACAAGCCGTGAAAATGCTGAAATTTCTCTTTATG
B1R TTTTTCTGAACTTTTCAAAGTCAAAACCGTAGAGC
C1F TATATGGTAAGGTGTGGATGGGCCGTTTGC
C1R GATCAACGCTCTGATTTGAGCTTGAAACCAAATTGAGCGTAGCGCCATC
C2F AACCAAAGCGTTAAATTAAATGGCAATGTG
C2R GCTGTTTGACACCAAATTGAGCGTAGCGCCA
C3F TTAAATGGCAATGTGTGGATGGGCCGTTTGCAATA
C3R TTTAACGCTGTTTGAAGCCAAATTGAGCGTGGCGCCATCATA

Cell culture.

RK13 cells were obtained from the American Type Culture Collection (ATCC CCL-37) and were cultured in minimal essential medium supplemented with 10% FBS and 1 mM nonessential amino acids. Jurkat T lymphocytes (clone E6-1, ATCC TIB-152) were cultured in RPMI 1640 medium containing 2 mM l-glutamine, 1.5 g/liter sodium bicarbonate, 4.5 g/liter glucose, 10 mM HEPES, 1.0 mM sodium pyruvate, and 10% FBS. Jurkat lymphocytes containing stable luciferase reporters were cultured as described above, except that the medium was supplemented with 1 μM puromycin.

Neutral red uptake assay.

To quantify VacA-induced cell vacuolation, RK13 cells were seeded at a density of 2 × 104 cells/well into 96-well plates for 24 h prior to the experiment. Serial dilutions of concentrated H. pylori culture supernatants containing different forms of VacA were added to serum-free tissue culture medium (supplemented with 10 mM ammonium chloride) overlying cells and incubated overnight at 37°C. VacA-induced cell vacuolation was detected by inverted light microscopy and quantified by a neutral red uptake assay, a well-established method that is based on rapid uptake of neutral red into VacA-induced cell vacuoles (11, 14). Background levels of neutral red uptake by untreated cells were subtracted to yield net neutral red uptake values.

Analysis of IL-2 production by Jurkat cells.

Jurkat T cells were plated in 96-well plates at a density of 1 ×105 cells/well, and H. pylori broth culture supernatant preparations or purified VacA proteins were added to cells for 30 min at 37°C. The cells were then stimulated with phorbol myristate acetate (PMA) (50 ng/ml; Sigma) and ionomycin (500 ng/ml; Sigma) and maintained in RPMI 1640 medium containing 10% FBS for 24 h. Cells were pelleted, and levels of IL-2 in the supernatants were quantified by ELISA, according to the manufacturer's protocol (R&D Systems; human IL-2 immunoassay). To ensure that IL-2 production was not altered by T-cell apoptosis, we monitored the viability of Jurkat cells in each experiment by using trypan blue staining and did not detect any significant effect of VacA on viability of the cells (data not shown), a result that is consistent with previous publications (29, 64).

Expression and purification of recombinant VacA proteins.

Recombinant p33 and p55 proteins, derived from H. pylori strain 60190, were expressed in Escherichia coli and purified as described previously (27, 31). In addition, we modified the plasmid encoding the i1 p33 protein derived from H. pylori strain 60190, so that it expressed an i2 form of p33. To do this, we first changed the sequence in the vacA i-region polymorphic cluster B from type 1 to 2 by inverse PCR, using the WT p33 plasmid as a template and primers B1F and B1R (Table 2). The resulting plasmid, containing a type 2 cluster B and type 1 cluster C, was then used as a template to change the amino acid sequence of cluster C to type 2, using primers C1F and C1R (Table 2). The modifications in the i-region were confirmed by nucleotide sequence analysis. VacA p33 and p55 were expressed by culturing Escherichia coli BL21(DE3) in Terrific broth (Fisher) supplemented with 25 μg/ml kanamycin (TB-KAN) at 37°C overnight with shaking. Cultures were diluted 1:100 in TB-KAN and grown at 37°C until they reached an absorbance (A600) of 0.6. Cultures were induced with a final isopropyl β-d-thiogalactopyranoside (IPTG) concentration of 0.5 mM and incubated at 25°C for 16 to 18 h (p55 proteins) or at 37°C for 3 h (p33 proteins). VacA p55 was purified under native conditions by nickel affinity, ion exchange, and gel filtration chromatography (27). VacA p33 proteins were purified under denaturing conditions from inclusion bodies by using Ni-affinity resin (Novagen). The purified denatured VacA p33 proteins were then refolded by dialysis and were purified further by gel filtration chromatography (31).

Flow cytometric analysis of VacA binding to cells.

Purified p55 was labeled with Alexa 488 (Molecular Probes) according to the manufacturer's instructions (31). Jurkat cells (1 × 105 cells per condition) were treated with Alexa 488-labeled p55 alone (10 μg/ml) or with a mixture of Alexa 488-labeled p55 plus either purified refolded p33 i1 or p33 i2 proteins (each at 5 μg/ml) at 4°C for 1 h. Cells were then washed three times in cold phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and fixed in 2% paraformaldehyde. The cells were collected using a flow cytometer (LSR II system; BD, San Alta, CA) and analyzed using BD Diva (1). Immunofluorescent microscopy experiments indicated that the VacA proteins were not internalized at 4°C (data not shown).

Immunoblot analysis of VacA binding to cells.

Jurkat cells (1 × 106 cells per condition) were cultured in serum-free medium for 8 h and then incubated with preparations of H. pylori broth culture supernatants at 4°C for 1 h. Cells were washed three times with cold PBS, pelleted, and heated at 100°C for 5 min in sodium dodecyl sulfate loading buffer. Samples were electrophoresed on a 4 to 20% gradient precast acrylamide gel (Bio-Rad) and transferred onto nitrocellulose membranes. Membranes were immunoblotted with rabbit anti-VacA serum (serum number 958, diluted 1:10,000) or anti-GAPDH serum (abcam, diluted 1:1,000), followed by horseradish peroxidase-conjugated secondary antibodies (Promega, diluted 1:10,000). Immune complexes were revealed by using an enhanced chemiluminescence system (ECL Western Blotting Analysis System; GE Healthcare).

Generation of a Jurkat cell line with a stable NFAT luciferase reporter.

Jurkat lymphocytes were transduced with replication-deficient lentiviral particles encoding an NFAT reporter or a negative-control reporter (Cignal Lenti NFAT reporter assay and Cignal Lenti reporter negative control; Qiagen), according to the manufacturer's protocol. Briefly, Jurkat cells (1 × 104 cells per condition) were infected with lentiviral particles carrying the desired reporter at a multiplicity of infection (MOI) of 50 viral particles per cell. After 3 days, the cell culture medium was changed and supplemented with 1 μM puromycin. After 3 additional days, surviving clones were used for further experiments.

Luciferase assay.

Jurkat cells carrying a stable luciferase reporter (NFAT or negative control) were cultured (1 × 105 cells per condition) and treated with viable H. pylori strains (MOI of 50 bacterial cells per Jurkat cell) or H. pylori broth culture supernatant preparations for 1 h at 37°C. Cells were then stimulated with PMA (50 ng/ml) and ionomycin (500 ng/ml; Sigma) for 6 h. Luciferase activity was measured using the luciferase assay system with reporter lysis buffer (Promega) according to the manufacturer's protocol. Luciferase activity is expressed as relative values (luciferase activity of cells containing NFAT reporter divided by luciferase activity of cells containing the negative-control reporter), and the values for control cells (stimulated with PMA-ionomycin, without VacA treatment) are assigned a relative value of 1 (or 100%).

VacA binding to integrin.

VacA binding to β2 integrin was evaluated by ELISA. The wells of microtiter plates (Immunolon IB) were coated with 50 μl of recombinant αMβ2 integrin or αVβ3 integrin derived from human CHO cells (R&D system) at 4°C for 24 h. Unbound protein was then removed and the wells were blocked with PBS containing 5% BSA at 4°C for 48 h. After blocking, serial dilutions of H. pylori culture supernatants containing equivalent concentrations of different forms of VacA were added to the wells at 25°C for 1 h. Wells were then washed three times with PBS-0.05% Tween 20, and bound VacA was detected by incubating the wells with anti-VacA rabbit serum (diluted 1:1,000/serum no. 958), followed by incubating with horseradish peroxidase-conjugated secondary antibody (diluted 1:1,000; Promega), each at 25°C for 1 h. Rabbit serum and secondary antibody were diluted in PBS containing 3% BSA. ELISA was developed using Strep Ultra TMB-ELISA (Thermo Scientific).

RESULTS

Manipulation of the vacA i-region.

The VacA proteins secreted by different WT H. pylori strains vary markedly in amino acid sequences, and there are also differences among strains in the levels of VacA secretion (4, 25). To facilitate analysis of the VacA i-region, we used an approach in which we manipulated the chromosome of reference H. pylori strains (60190 and X47) in a manner so that we altered the region of vacA encoding the i-region and maintained all other regions of vacA without changes. For initial studies, we altered vacA in strain 60190 (which contains type s1/i1/m1 vacA) so that two clusters of polymorphisms in the i-region (cluster B and cluster C) were changed from an i1 form to an i2 form, as described in Materials and Methods. The modified strain was designated 60190 i2BC (Table 1 and Fig. 2A). Immunoblot analysis indicated that the modified H. pylori strain expressed and secreted VacA in a manner similar to the WT strain (data not shown). The WT strain and modified H. pylori strain were grown in broth cultures, and bacterial supernatants were concentrated and normalized so that they contained equivalent concentration of VacA, as described in Materials and Methods. To investigate whether there were any detectable differences in the ability of these proteins to cause alterations in gastric epithelial cells, serial dilutions of the supernatant preparations were added to RK13 cells. Consistent with results of a previous study (54), we did not detect any difference in the ability of the i1 and i2 forms of VacA to cause vacuolation of RK13 cells (Fig. 2B). This suggests that manipulation of the VacA i-region by this approach does not result in misfolding of the protein.

Fig 2.

Fig 2

VacA-induced vacuolation of RK13 cells. (A) Amino acid sequence of the VacA i-region in WT H. pylori strain 60190 (type i1) and a strain expressing a modified VacA protein in which clusters B and C were changed from type i1 to type i2 (60190 i2BC). (B) Broth culture supernatants derived from the WT strain (type i1) or strain 60190 i2BC were concentrated and normalized so that they contained equivalent VacA concentrations, as described in Materials and Methods. Serial dilutions of VacA-containing preparations were then added to RK13 cells. Vacuolating activity was measured by a neutral red uptake assay. Relative VacA concentrations are indicated. Results represent the means ± standard deviations (SD) from triplicate samples.

Effects of type i1 and i2 VacA on IL-2 production by Jurkat cells.

Previous studies have shown that type i1 forms of VacA can suppress IL-2 secretion from Jurkat cells (1, 29, 57). To determine whether type i1 and i2 forms of VacA differ in this activity, we compared the ability of the WT i1 form of VacA and the i2BC form described above to suppress IL-2 secretion by Jurkat cells. We also manipulated H. pylori strain 60190 so that individual polymorphic regions within the vacA i-region (cluster B or cluster C) were changed to type i2 (Fig. 3A). These modified strains are designated 60190 i2B and 60190 i2C. Cluster A was not manipulated, since sequence variation at this site has not been linked to disease outcome (54). Immunoblot analysis indicated that each of the modified H. pylori strains expressed and secreted VacA, similar to the WT strain (data not shown). The WT and modified H. pylori strains were grown in broth cultures, and supernatant preparations containing equivalent concentrations of VacA were prepared, as described in Materials and Methods. Jurkat cells were pretreated with broth culture supernatant preparations from the WT and modified strains and were then stimulated with PMA and ionomycin. IL-2 production by Jurkat cells was quantified by ELISA, as described in Materials and Methods. In comparison to supernatant from a vacA-null mutant strain, supernatant containing WT i1 VacA suppressed IL-2 secretion, as expected (Fig. 3B). Supernatants containing i2 forms of VacA (i2B, i2C, or i2BC) also suppressed IL-2 secretion, but in comparison to i1 VacA, the i2 forms of VacA had a significantly reduced capacity to suppress IL-2 secretion (Fig. 3B).

Fig 3.

Fig 3

Role of the VacA i-region in inhibition of IL-2 secretion by Jurkat cells. (A) Amino acid sequence of the VacA i-region in WT H. pylori strain 60190 (type i1) and modified strains. Modified strains were constructed so that 60190 i2B contains an i2 sequence in polymorphic cluster B and an i1 sequence in cluster C, 60190 i2C contains an i2 sequence in cluster C and an i1 sequence in cluster B, and 60190 i2BC contains i2 sequences in both clusters B and C. (B) H. pylori strains were cultured in broth, and preparations of culture supernatants were standardized so that they contained equivalent concentrations of VacA, as described in Materials and Methods. Jurkat cells were pretreated with 1:20 or 1:50 dilutions of culture supernatant preparations, each containing the indicated VacA protein, and then stimulated with PMA-ionomycin. After 24 h, the cells were pelleted and the IL-2 content of supernatants was analyzed by ELISA. (C) Amino acid sequence of the VacA i-region in WT strain X47 and a modified strain. WT strain X47 contains an i2 sequence in cluster C, and the X47 i1C strain contains an i1 sequence in cluster C. (D) Jurkat cells were pretreated with 1:20 or 1:50 dilutions of culture supernatant preparations, each containing the indicated VacA protein, and cells were then stimulated with PMA-ionomycin. After 24 h, the cells were pelleted, and the IL-2 content of supernatants was analyzed by ELISA. Results represent the means ± standard deviations of triplicate samples of a single experiment. Similar results were obtained in two additional experiments. *, P value of ≤0.05 compared to WT i1 VacA (A) or WT VacA from strain X47 (B) at a 1:20 dilution; ***, P value of ≤0.05 at a 1:50 dilution (analysis of variance [ANOVA] followed by Dunnett's post hoc test for panel B; Student t test for panel D). Levels of IL-2 secretion are expressed as relative values (levels of IL-2 secreted by cells treated with WT VacA or modified VacA proteins, divided by levels of IL-2 secreted by cells treated with supernatant from the VacA-null mutant strain). Values for cells treated with supernatant from the VacA-null mutant strain are assigned a relative value of 1 (or 100%).

We next investigated the role of the VacA i-region in the context of H. pylori strain X47, which contains an s1/m2 type of vacA. The vacA gene in this strain contains a type i2 sequence in cluster C of the i-region, and cluster B is chimeric (Fig. 1). A previous study (54) reported that polymorphisms in cluster C accounted for differences in the activity of i1 and i2 forms of VacA on epithelial cells. Therefore, we investigated whether changing cluster C of vacA in this strain from type i2 to type i1 would result in an increased capacity of VacA to suppress IL-2 secretion from Jurkat cells. To do this, we manipulated H. pylori strain X47 as described in Materials and Methods such that amino acids in cluster C of the vacA i-region were changed from an i2 to an i1 form, resulting in a strain designated X47 i1C (Fig. 3C). The WT and modified H. pylori strains were grown in broth cultures, and supernatant preparations containing equivalent concentrations of VacA were prepared, as described in Materials and Methods. Jurkat cells were pretreated with the H. pylori culture supernatant preparations and were then stimulated with PMA and ionomycin. In comparison to VacA produced by the H. pylori X47 WT strain (X47 i2), VacA containing an i1 form of cluster C (X47 i1C) had an increased inhibitory effect on IL-2 secretion by Jurkat cells (Fig. 3D).

Effects of purified VacA proteins on IL-2 production by Jurkat cells.

To further analyze the activities of type i1 and i2 VacA proteins, we purified i1 and i2 VacA proteins from broth culture supernatant of either WT H. pylori 60190 (expressing i1 VacA) or the 60190 i2BC strain (expressing an i2 form of VacA) (Table 1) and then tested the effects of these proteins on Jurkat cells. The purified VacA i1 protein suppressed IL-2 secretion from Jurkat cells, whereas the purified VacA i2 protein had relatively little effect (Fig. 4A). To corroborate the conclusion that i1 and i2 proteins differed in activity, we generated an additional modified form of VacA and analyzed the activity of this purified protein. Specifically, we mutated the 5′ end of vacA cluster C in H. pylori strain 60190 so that it contained amino acids corresponding to i2 sequences. Cluster C in this modified form of VacA, designated i1/i2C VacA, contained an A-to-V substitution and an SNQ insertion (VSNSNQSVKLNGN; for comparison, the type i1 sequence is ASNSVKLNGN and the type i2 sequence is VSSSNQSVDLYGK [Fig. 1]). We then purified the WT i1 protein and the VacA i1/i2C protein (containing i2 amino acids in the 5′ region of cluster C) from H. pylori supernatants and tested these proteins for their ability to inhibit IL-2 production by Jurkat cells. In comparison to the WT i1 VacA protein, the i1/i2C VacA protein was less potent in its ability to inhibit IL-2 production (Fig. 4B). We also attempted to purify WT and modified VacA proteins expressed by H. pylori strain X47, but this was not feasible due to a failure of this strain to grow in medium free of FBS (which is essential for purification of VacA).

Fig 4.

Fig 4

Effects of purified VacA proteins on IL-2 secretion by Jurkat cells. (A) Jurkat cells were pretreated with purified p88 VacA proteins secreted by either WT strain 60190 (expressing type i1 VacA) or a modified strain expressing i2BC VacA, which contains i2 sequences in polymorphic clusters B and C. (B) Jurkat cells were pretreated with purified H. pylori VacA proteins secreted by either WT strain 60190 (type i1) or a modified strain expressing an i1/i2C protein (as described in Results) at the indicated protein concentrations. Cells were then stimulated with PMA-ionomycin, and after 24 h the cells were pelleted and the IL-2 content of supernatants was analyzed by ELISA. (C) Recombinant purified p33 proteins containing either i1 or i2 (clusters BC) amino acid sequences were mixed with purified p55. The indicated protein concentrations for the VacA p33-p55 mixture (1:1 mass ratio) correspond to the total protein concentration. Jurkat cells were pretreated with the VacA preparations and were then stimulated with PMA-ionomycin. After 24 h, IL-2 production was quantified by ELISA. Results represent the means ± standard deviations of triplicate samples of a single experiment. Similar results were obtained in two additional experiments. *, P value of ≤0.05 as determined by Student's t test. Levels of IL-2 secretion are expressed as relative values (levels of IL-2 secreted by cells treated with WT VacA or modified VacA proteins, divided by levels of IL-2 secreted by cells treated with buffer alone). Values for cells treated with buffer are assigned a relative value of 1 (or 100%).

As another approach, we tested the activity of purified recombinant VacA i1 and i2 proteins. We have previously shown that a mixture of i1 p33 plus p55 VacA domains reconstitutes toxin activity in assays using HeLa cells (31, 68). Therefore, we expressed both i1 and i2 forms of p33 as described in Materials and Methods, mixed either purified VacA p33 i1 or p33 i2 proteins with purified p55 (1:1 mass ratio), and tested the effects of these preparations on Jurkat cells. In comparison to a mixture of p33 i1 plus purified p55, a mixture of p33 i2 plus purified p55 had a significantly reduced capacity to suppress IL-2 secretion from Jurkat cells (Fig. 4C). Taken together, these results indicate that the i-region is an important determinant of the capacity of VacA to inhibit IL-2 secretion.

Analysis of VacA effects on NFAT activation.

Previous studies have shown that the effect of VacA on IL-2 secretion by Jurkat cells is dependent on inhibition of NFAT (29). We therefore investigated whether the composition of the VacA i-region influences the ability of VacA to inhibit NFAT activation. We first transduced Jurkat cells with replication-deficient lentiviral particles that carry an NFAT luciferase reporter or a negative-control reporter and selected for puromycin-resistant cells that contain the reporters, as described in Materials and Methods. We then cocultured the cells with viable H. pylori (60190 WT strain, 60190 vacA-null mutant strain, or 60190 i2BC) (Fig. 5A). After 1 h of incubation, cells were stimulated with PMA-ionomycin for an additional 6 h, and luciferase was measured as described in Materials and Methods. In comparison to the WT H. pylori strain (expressing type i1 VacA), which inhibited NFAT activation, H. pylori expressing type i2 VacA (60190 i2BC) had an impaired ability to inhibit NFAT activation (Fig. 5A). Similar results were obtained when analyzing H. pylori broth culture supernatant preparations (Fig. 5B). As shown in Fig. 5B, supernatant from the vacA-null mutant strain caused some detectable inhibition of NFAT activation, which might be attributable to actions of other factors besides VacA on NFAT activation or nonspecific effects of the preparation on the luciferase assay. In summary, the results obtained in these studies of NFAT activation were concordant with results obtained in the IL-2 assays.

Fig 5.

Fig 5

Effects of VacA proteins on NFAT activation. Jurkat cells stably expressing an NFAT luciferase reporter or a negative-control luciferase reporter were treated with viable H. pylori strains (WT strain 60190 [expressing i1 VacA], vacA-null mutant strain, or 60190 i2BC [expressing i2BC VacA]) (A) or with H. pylori broth culture supernatant preparations derived from these strains (B) and then activated with PMA and ionomycin. Luciferase activity was quantified by luminometry, as described in Materials and Methods. NFAT activity is expressed as relative values (luciferase activity of cells containing NFAT reporter divided by luciferase activity of cells containing the negative-control reporter), and the values for control cells (stimulated with PMA-ionomycin, without VacA treatment) are assigned a relative value of 1 (or 100%). Results represent the means ± standard deviations of triplicate samples of a single experiment. Similar results were obtained in two additional experiments. *, P value of ≤0.05 as determined by using Student's t test, comparing WT strain 60190 and a strain expressing VacA i2BC (A) or culture supernatant preparations derived from these strains (B).

Analysis of VacA binding to Jurkat cells.

To investigate a possible mechanism for the observed differences in activities of i1 and i2 VacA proteins, we analyzed the binding properties of VacA proteins containing type i1 or type i2 i-regions. Broth culture supernatant preparations from H. pylori 60190 strains expressing either i1 VacA or i2 VacA (60190 i2BC) proteins, as well as a supernatant preparation from a vacA-null mutant strain, were incubated with Jurkat cells for 1 h at 4°C. Cells were then washed and immunoblotted with an anti-VacA antibody to detect VacA binding. As shown in Fig. 6A and B (top), immunoblot analysis of the supernatants in the absence of Jurkat cells indicated that the levels of VacA were similar in the normalized preparations from WT and modified strains. In comparison to i2 VacA, i1 VacA bound more avidly to the cells (Fig. 6A, bottom). Additionally, we tested the binding of VacA proteins produced by H. pylori strain X47 (X47 WT VacA [i2] and X47 i1C). Consistent with the results obtained when analyzing VacA proteins produced by strain 60190, the WT VacA i2 protein from strain X47 exhibited decreased avidity of binding compared to the i1C VacA protein (Fig. 6B, bottom).

Fig 6.

Fig 6

Binding of VacA proteins to Jurkat cells. H. pylori strains were cultured in broth, and culture supernatant preparations were standardized so that they contained equivalent concentrations of VacA. Jurkat cells were incubated with supernatant preparations from the indicated H. pylori strains for 1 h at 4°C. Cells were washed and lysed, and protein samples were then analyzed by immunoblotting using an anti-VacA antibody. (A) Analysis of WT H. pylori strain 60190 (expressing i1 VacA), 60190 vacA-null mutant strain, and 60190 i2BC (expressing i2BC VacA). (B) Analysis of WT H. pylori strain X47, X47 vacA-null mutant strain, and strain X47 i1C. Top panels (labeled “60190 supernatant” and “X47 supernatant”) depict immunoblot analysis of H. pylori supernatant preparations prior to the addition to Jurkat cells. Bottom panels (labeled “Bound VacA”) depict VacA binding to Jurkat cells. GAPDH was analyzed as a loading control. (C) Jurkat cells were treated with purified Alexa 488-labeled p55 (2.5 μg/ml) plus either purified p33 i1 or p33 i2 (2.5 μg/ml) for 1 h at 4°C. After treatment, cells were washed and analyzed by flow cytometry. Values indicate mean fluorescence intensity (MFI), based on three independent samples, and the percent positive cells (% pos. cells), defined as the proportion of cells exhibiting detectable fluorescence in comparison to control cells. Representative histograms depicting VacA binding are shown. (D) Graphical representation of VacA binding to Jurkat cells, based on flow cytometry analysis. These data are from an experiment performed on a separate day compared to the data in panel C. *, P value of ≤0.05 compared to p33 i2 and p55 Alexa 488, as determined by using Student's t test. Results represent the means ± standard deviations of triplicate samples from a single experiment.

As another approach for analyzing VacA binding, we quantified VacA binding to Jurkat cells using a flow cytometry-based assay. For these experiments, we used recombinantly expressed p33 and p55 VacA domains. We have previously shown that p33 can facilitate the binding of purified p55 to HeLa cells (31, 68). Therefore, in the current experiments, we labeled the recombinant VacA p55 protein with Alexa 488, as described previously (31), and mixed the labeled p55 protein with either unlabeled p33 i1 or unlabeled p33 i2 protein (1:1 mass ratio). These protein mixtures were incubated with Jurkat cells for 1 h at 4°C, and cells were then washed and analyzed by flow cytometry. When combined with unlabeled p33 i1, the labeled p55 protein bound more avidly to Jurkat cells than when the labeled p55 protein alone was added to Jurkat cells (Fig. 6C, D). The labeled p55 protein bound significantly less avidly when mixed with p33 i2 than when mixed with p33 i1 (Fig. 6C, D). Representative histograms are presented in Fig. 5C, and quantification of levels of VacA binding is shown in Fig. 5D. Collectively, these experiments indicate that, compared to type i2 forms of VacA, type i1 forms of VacA bind more avidly to Jurkat cells.

Binding of type i1 and i2 VacA to β2 integrin.

Previous studies have shown that β2 integrin is a receptor for VacA in T cells (57). We hypothesized that the observed difference in binding of i1 and i2 VacA proteins to Jurkat cells might be due to differences in the binding of these proteins to β2 integrin. To test this hypothesis, we performed an ELISA-based binding assay as described in Materials and Methods. Both VacA i1 and VacA i2 proteins bound to αMβ2 integrin in a dose-dependent manner, and no significant differences in binding avidity were detected (Fig. 7). As expected, both forms of VacA bound less avidly to a control protein (αVβ3 integrin) than to αMβ2 integrin. Taken together, these results suggest that the observed difference in binding of i1 and i2 VacA proteins to Jurkat cells is not attributable to differences in VacA binding to the β2 integrin receptor.

Fig 7.

Fig 7

Binding of type i1 and i2 VacA proteins to β2 integrin. Wells of microtiter plates were coated with αMβ2 integrin or αVβ3 integrin as described in Materials and Methods. Serial dilutions of culture supernatants from H. pylori 60190 strains, containing equivalent concentrations of either WT (i1) or i2BC forms of VacA, were then added and incubated for 1 h. Unbound protein was removed, wells were washed, and VacA binding was analyzed by ELISA, as described in Materials and Methods. The background absorbance (VacA binding to wells in the absence of integrin) was subtracted from all absorbance values. Results represent the means ± standard deviations of triplicate experiments and are representative of three independent experiments.

DISCUSSION

VacA is one of the most important virulence factors produced by H. pylori (9, 17, 23, 38). Numerous studies have shown that H. pylori strains containing specific vacA types (such as s1 or m1) are associated with a higher risk of gastric disease than are strains containing s2 or m2 vacA types (62). Correspondingly, type s1/m1 forms of VacA exhibit increased cytotoxic activity in vitro compared to type s2/m2 forms of VacA (4, 39, 43). Recently, it was reported that strains containing the type i1 forms of vacA are associated with a higher risk of gastric disease than are strains containing type i2 forms of vacA (6, 8, 20, 33, 37, 54, 60). One study reported that the i-region is a determinant of cell-type specificity (54), but thus far there has been very little study of the role of the i-region in VacA activity. In the current study, we tested the hypothesis that VacA i1 and i2 proteins differ in the ability to cause functional alterations in T cells, using Jurkat cells as a model cell line.

In accordance with a previous study (54), we found that both i1 and i2 forms of VacA caused vacuolation of RK13 cells. Both the i1 and i2 VacA proteins inhibited IL-2 secretion and NFAT activation in Jurkat cells, but the i2 VacA proteins had a reduced potency. Type i1 VacA proteins bound more avidly than type i2 VacA proteins to Jurkat cells, and this difference in binding probably accounts, at least in part, for the observed difference in activity. Previous studies have shown that binding of VacA to epithelial cells is mediated not only by the p55 domain but also by the p33 domain (31, 68). The results in the current study provide additional evidence that the VacA p33 domain contributes to VacA cell-binding properties.

The observed difference in the binding properties of i1 and i2 VacA suggest that these proteins might differ in binding to a specific receptor on the surface of Jurkat cells. As shown in Fig. 7, we did not detect any significant difference in the binding of type i1 and i2 VacA to β2 integrin, which is an important receptor for VacA on T cells (57). This result suggests that the i-region might be involved in VacA binding to alternate receptors which have not yet been characterized (57, 58). Various candidates for these alternate receptors include sphingomyelin, glycosylphosphatidylinositol (GPI)-anchored proteins, or glycolipids (57, 58). Further studies will be required to better understand the basis for the differential binding properties of i1 and i2 forms of VacA.

As shown in Fig. 1, type i1 and type i2 forms of VacA differ in amino acid sequences at a relatively small number of sites within polymorphic clusters A, B, and C, and these polymorphisms account for most of the sequence variation that is observed within the VacA p33 domain (28). Experiments in the current study indicate that polymorphisms in cluster C are important determinants of VacA activity in a Jurkat T cell assay. Prior to the current study, a random mutagenesis study revealed that mutations in two amino acids in close proximity to this region (T210A, S246L) altered the capacity of VacA to cause vacuolation in HeLa cells (44, 45). Taken together, these studies highlight the functional importance of this region of the p33 domain. At present, a crystal structure is available for the p55 domain of VacA (27), but no structural data are available for the p33 domain. In future studies, it will be important to determine the structure of the p33 domain and to investigate the structural basis for the observed differences in activity of type i1 and i2 forms of VacA. In addition, it will be important to determine whether the VacA i-region influences the potency of other VacA activities, including a spectrum of alterations produced by VacA in gastric epithelial cells and several types of immune cells (9).

It is striking that within three different regions of VacA (s-, i-, and m-regions), there is marked sequence variation among proteins expressed by different H. pylori strains, and analysis of each region indicates the existence of two main groups of VacA proteins categorized as type 1 (s1, i1, m1) and type 2 (s2, i2, m2) (4, 5, 28, 54). In each case, the sequence variations are associated with differences in VacA activity toward host cells (4, 25, 36, 39, 43, 51, 54, 61, 73). It may be presumed that selective forces had an important role in the origin of these variations, as well as in the maintenance of the different allelic variants (28). In future studies, it will be important to determine how these different forms of VacA each provide a selective advantage to H. pylori.

ACKNOWLEDGMENTS

We thank Borden Lacy for providing purified p55 protein, Beverly Hosse for assistance with VacA purification, and John Loh for assistance with preparation of figures.

This work was supported by the National Institutes of Health (AI039657 and AI068009), the Molecular Microbial Pathogenesis Training Program (T32 AI007281-21), the Vanderbilt University Digestive Diseases Research Center (DK058404), Vanderbilt Ingram Cancer Center, and the Department of Veterans Affairs.

Footnotes

Published ahead of print 14 May 2012

REFERENCES

  • 1. Algood HM, Torres VJ, Unutmaz D, Cover TL. 2007. Resistance of primary murine CD4+ T cells to Helicobacter pylori vacuolating cytotoxin. Infect. Immun. 75:334–341 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Amieva MR, El-Omar EM. 2008. Host-bacterial interactions in Helicobacter pylori infection. Gastroenterology 134:306–323 [DOI] [PubMed] [Google Scholar]
  • 3. Atherton JC, Blaser MJ. 2009. Coadaptation of Helicobacter pylori and humans: ancient history, modern implications. J. Clin. Invest. 119:2475–2487 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Atherton JC, et al. 1995. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem. 270:17771–17777 [DOI] [PubMed] [Google Scholar]
  • 5. Atherton JC, Peek RM, Jr, Tham KT, Cover TL, Blaser MJ. 1997. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 112:92–99 [DOI] [PubMed] [Google Scholar]
  • 6. Basso D, et al. 2008. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology 135:91–99 [DOI] [PubMed] [Google Scholar]
  • 7. Boncristiano M, et al. 2003. The Helicobacter pylori vacuolating toxin inhibits T cell activation by two independent mechanisms. J. Exp. Med. 198:1887–1897 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Chung C, et al. 2010. Diversity of VacA intermediate region among Helicobacter pylori strains from several regions of the world. J. Clin. Microbiol. 48:690–696 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Cover TL, Blanke SR. 2005. Helicobacter pylori VacA, a paradigm for toxin multifunctionality. Nat. Rev. Microbiol. 3:320–332 [DOI] [PubMed] [Google Scholar]
  • 10. Cover TL, Blaser MJ. 2009. Helicobacter pylori in health and disease. Gastroenterology 136:1863–1873 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Cover TL, Blaser MJ. 1992. Purification and characterization of the vacuolating toxin from Helicobacter pylori. J. Biol. Chem. 267:10570–10575 [PubMed] [Google Scholar]
  • 12. Cover TL, Hanson PI, Heuser JE. 1997. Acid-induced dissociation of VacA, the Helicobacter pylori vacuolating cytotoxin, reveals its pattern of assembly. J. Cell Biol. 138:759–769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Cover TL, Krishna US, Israel DA, Peek RM., Jr 2003. Induction of gastric epithelial cell apoptosis by Helicobacter pylori vacuolating cytotoxin. Cancer Res. 63:951–957 [PubMed] [Google Scholar]
  • 14. Cover TL, Puryear W, Perez-Perez GI, Blaser MJ. 1991. Effect of urease on HeLa cell vacuolation induced by Helicobacter pylori cytotoxin. Infect. Immun. 59:1264–1270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Cover TL, Tummuru MK, Cao P, Thompson SA, Blaser MJ. 1994. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J. Biol. Chem. 269:10566–10573 [PubMed] [Google Scholar]
  • 16. Dautin N, Bernstein HD. 2007. Protein secretion in Gram-negative bacteria via the autotransporter pathway. Annu. Rev. Microbiol. 61:89–112 [DOI] [PubMed] [Google Scholar]
  • 17. de Bernard M, Cappon A, Del Giudice G, Rappuoli R, Montecucco C. 2004. The multiple cellular activities of the VacA cytotoxin of Helicobacter pylori. Int. J. Med. Microbiol. 293:589–597 [DOI] [PubMed] [Google Scholar]
  • 18. de Bernard M, et al. 1995. Low pH activates the vacuolating toxin of Helicobacter pylori, which becomes acid and pepsin resistant. J. Biol. Chem. 270:23937–23940 [DOI] [PubMed] [Google Scholar]
  • 19. Domanska G, et al. 2010. Helicobacter pylori VacA toxin/subunit p34: targeting of an anion channel to the inner mitochondrial membrane. PLoS Pathog. 6:e1000878 doi:10.1371/journal.ppat.1000878 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Douraghi M, et al. 2009. Multiple gene status in Helicobacter pylori strains and risk of gastric cancer development. Digestion 80:200–207 [DOI] [PubMed] [Google Scholar]
  • 21. El-Bez C, Adrian M, Dubochet J, Cover TL. 2005. High resolution structural analysis of Helicobacter pylori VacA toxin oligomers by cryo-negative staining electron microscopy. J. Struct. Biol. 151:215–228 [DOI] [PubMed] [Google Scholar]
  • 22. Fischer W, Buhrdorf R, Gerland E, Haas R. 2001. Outer membrane targeting of passenger proteins by the vacuolating cytotoxin autotransporter of Helicobacter pylori. Infect. Immun. 69:6769–6775 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Fischer W, Prassl S, Haas R. 2009. Virulence mechanisms and persistence strategies of the human gastric pathogen Helicobacter pylori. Curr. Top. Microbiol. Immunol. 337:129–171 [DOI] [PubMed] [Google Scholar]
  • 24. Foo JH, et al. 2010. Both the p33 and p55 subunits of the Helicobacter pylori VacA toxin are targeted to mammalian mitochondria. J. Mol. Biol. 401:792–798 [DOI] [PubMed] [Google Scholar]
  • 25. Forsyth MH, Atherton JC, Blaser MJ, Cover TL. 1998. Heterogeneity in levels of vacuolating cytotoxin gene (vacA) transcription among Helicobacter pylori strains. Infect. Immun. 66:3088–3094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Galmiche A, et al. 2000. The N-terminal 34 kDa fragment of Helicobacter pylori vacuolating cytotoxin targets mitochondria and induces cytochrome c release. EMBO J. 19:6361–6370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Gangwer KA, et al. 2007. Crystal structure of the Helicobacter pylori vacuolating toxin p55 domain. Proc. Natl. Acad. Sci. U. S. A. 104:16293–16298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Gangwer KA, et al. 2010. Molecular evolution of the Helicobacter pylori vacuolating toxin gene vacA. J. Bacteriol. 192:6126–6135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Gebert B, Fischer W, Weiss E, Hoffmann R, Haas R. 2003. Helicobacter pylori vacuolating cytotoxin inhibits T lymphocyte activation. Science 301:1099–1102 [DOI] [PubMed] [Google Scholar]
  • 30. Genisset C, et al. 2006. A Helicobacter pylori vacuolating toxin mutant that fails to oligomerize has a dominant negative phenotype. Infect. Immun. 74:1786–1794 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Gonzalez-Rivera C, et al. 2010. Reconstitution of Helicobacter pylori VacA toxin from purified components. Biochemistry 49:5743–5752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Handt LK, et al. 1995. Characterization of feline Helicobacter pylori strains and associated gastritis in a colony of domestic cats. J. Clin. Microbiol. 33:2280–2289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Hussein NR, et al. 2008. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J. Clin. Microbiol. 46:1774–1779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ivie SE, et al. 2008. Helicobacter pylori VacA subdomain required for intracellular toxin activity and assembly of functional oligomeric complexes. Infect. Immun. 76:2843–2851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Jain P, Luo ZQ, Blanke SR. 2011. Helicobacter pylori vacuolating cytotoxin A (VacA) engages the mitochondrial fission machinery to induce host cell death. Proc. Natl. Acad. Sci. U. S. A. 108:16032–16037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Ji X, et al. 2000. Cell specificity of Helicobacter pylori cytotoxin is determined by a short region in the polymorphic midregion. Infect. Immun. 68:3754–3757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Jones KR, et al. 2011. Polymorphisms in the intermediate region of VacA impact Helicobacter pylori-induced disease development. J. Clin. Microbiol. 49:101–110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Jones KR, Whitmire JM, Merrell DS. 2010. A tale of two toxins: Helicobacter pylori CagA and VacA modulate host pathways that impact disease. Front. Microbiol. 1:115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Letley DP, Rhead JL, Twells RJ, Dove B, Atherton JC. 2003. Determinants of non-toxicity in the gastric pathogen Helicobacter pylori. J. Biol. Chem. 278:26734–26741 [DOI] [PubMed] [Google Scholar]
  • 40. Leunk RD, Johnson PT, David BC, Kraft WG, Morgan DR. 1988. Cytotoxic activity in broth-culture filtrates of Campylobacter pylori. J. Med. Microbiol. 26:93–99 [DOI] [PubMed] [Google Scholar]
  • 41. Loh JT, et al. 2011. Analysis of cagA in Helicobacter pylori strains from Colombian populations with contrasting gastric cancer risk reveals a biomarker for disease severity. Cancer Epidemiol. Biomarkers Prev. 20:2237–2249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Lupetti P, et al. 1996. Oligomeric and subunit structure of the Helicobacter pylori vacuolating cytotoxin. J. Cell Biol. 133:801–807 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. McClain MS, et al. 2001. A 12-amino-acid segment, present in type s2 but not type s1 Helicobacter pylori VacA proteins, abolishes cytotoxin activity and alters membrane channel formation. J. Bacteriol. 183:6499–6508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. McClain MS, Cover TL. 2003. Expression of Helicobacter pylori vacuolating toxin in Escherichia coli. Infect. Immun. 71:2266–2271 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. McClain MS, et al. 2006. Random mutagenesis of Helicobacter pylori vacA to identify amino acids essential for vacuolating cytotoxic activity. Infect. Immun. 74:6188–6195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. McClain MS, et al. 2003. Essential role of a GXXXG motif for membrane channel formation by Helicobacter pylori vacuolating toxin. J. Biol. Chem. 278:12101–12108 [DOI] [PubMed] [Google Scholar]
  • 47. McClain MS, Schraw W, Ricci V, Boquet P, Cover TL. 2000. Acid activation of Helicobacter pylori vacuolating cytotoxin (VacA) results in toxin internalization by eukaryotic cells. Mol. Microbiol. 37:433–442 [DOI] [PubMed] [Google Scholar]
  • 48. Molinari M, et al. 1998. The acid activation of Helicobacter pylori toxin VacA: structural and membrane binding studies. Biochem. Biophys. Res. Commun. 248:334–340 [DOI] [PubMed] [Google Scholar]
  • 49. Nakayama M, et al. 2004. Helicobacter pylori VacA activates the p38/activating transcription factor 2-mediated signal pathway in AZ-521 cells. J. Biol. Chem. 279:7024–7028 [DOI] [PubMed] [Google Scholar]
  • 50. Nguyen VQ, Caprioli RM, Cover TL. 2001. Carboxy-terminal proteolytic processing of Helicobacter pylori vacuolating toxin. Infect. Immun. 69:543–546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Pagliaccia C, et al. 1998. The m2 form of the Helicobacter pylori cytotoxin has cell type-specific vacuolating activity. Proc. Natl. Acad. Sci. U. S. A. 95:10212–10217 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Polk DB, Peek RM., Jr 2010. Helicobacter pylori: gastric cancer and beyond. Nat. Rev. Cancer 10:403–414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Radin JN, Gonzalez-Rivera C, Ivie SE, McClain MS, Cover TL. 2011. Helicobacter pylori VacA induces programmed necrosis in gastric epithelial cells. Infect. Immun. 79:2535–2543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Rhead JL, et al. 2007. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology 133:926–936 [DOI] [PubMed] [Google Scholar]
  • 55. Schmitt W, Haas R. 1994. Genetic analysis of the Helicobacter pylori vacuolating cytotoxin: structural similarities with the IgA protease type of exported protein. Mol. Microbiol. 12:307–319 [DOI] [PubMed] [Google Scholar]
  • 56. Schraw W, Li Y, McClain MS, van der Goot FG, Cover TL. 2002. Association of Helicobacter pylori vacuolating toxin (VacA) with lipid rafts. J. Biol. Chem. 277:34642–34650 [DOI] [PubMed] [Google Scholar]
  • 57. Sewald X, et al. 2008. Integrin subunit CD18 is the T-lymphocyte receptor for the Helicobacter pylori vacuolating cytotoxin. Cell Host Microbe 3:20–29 [DOI] [PubMed] [Google Scholar]
  • 58. Sewald X, Jimenez-Soto L, Haas R. 2011. PKC-dependent endocytosis of the Helicobacter pylori vacuolating cytotoxin in primary T lymphocytes. Cell Microbiol. 13:482–496 [DOI] [PubMed] [Google Scholar]
  • 59. Shaffer CL, et al. 2011. Helicobacter pylori exploits a unique repertoire of type IV secretion system components for pilus assembly at the bacteria-host cell interface. PLoS Pathog. 7:e1002237 doi:10.1371/journal.ppat.1002237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Sheu SM, Hung KH, Sheu BS, Yang HB, Wu JJ. 2009. Association of nonsynonymous substitutions in the intermediate region of the vacA gene of Helicobacter pylori with gastric diseases in Taiwan. J. Clin. Microbiol. 47:249–251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Skibinski DA, Genisset C, Barone S, Telford JL. 2006. The cell-specific phenotype of the polymorphic vacA midregion is independent of the appearance of the cell surface receptor protein tyrosine phosphatase beta. Infect. Immun. 74:49–55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Strobel S, et al. 1998. Identification and analysis of a new vacA genotype variant of Helicobacter pylori in different patient groups in Germany. J. Clin. Microbiol. 36:1285–1289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Suerbaum S, Michetti P. 2002. Helicobacter pylori infection. N. Engl. J. Med. 347:1175–1186 [DOI] [PubMed] [Google Scholar]
  • 64. Sundrud MS, Torres VJ, Unutmaz D, Cover TL. 2004. Inhibition of primary human T cell proliferation by Helicobacter pylori vacuolating toxin (VacA) is independent of VacA effects on IL-2 secretion. Proc. Natl. Acad. Sci. U. S. A. 101:7727–7732 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Szabo I, et al. 1999. Formation of anion-selective channels in the cell plasma membrane by the toxin VacA of Helicobacter pylori is required for its biological activity. EMBO J. 18:5517–5527 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Telford JL, et al. 1994. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J. Exp. Med. 179:1653–1658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Terebiznik MR, et al. 2009. Effect of Helicobacter pylori's vacuolating cytotoxin on the autophagy pathway in gastric epithelial cells. Autophagy 5:370–379 [DOI] [PubMed] [Google Scholar]
  • 68. Torres VJ, Ivie SE, McClain MS, Cover TL. 2005. Functional properties of the p33 and p55 domains of the Helicobacter pylori vacuolating cytotoxin. J. Biol. Chem. 280:21107–21114 [DOI] [PubMed] [Google Scholar]
  • 69. Torres VJ, VanCompernolle SE, Sundrud MS, Unutmaz D, Cover TL. 2007. Helicobacter pylori vacuolating cytotoxin inhibits activation-induced proliferation of human T and B lymphocyte subsets. J. Immunol. 179:5433–5440 [DOI] [PubMed] [Google Scholar]
  • 70. Van Doorn LJ, et al. 1999. Geographic distribution of vacA allelic types of Helicobacter pylori. Gastroenterology 116:823–830 [DOI] [PubMed] [Google Scholar]
  • 71. Vinion-Dubiel AD, et al. 1999. A dominant negative mutant of Helicobacter pylori vacuolating toxin (VacA) inhibits VacA-induced cell vacuolation. J. Biol. Chem. 274:37736–37742 [DOI] [PubMed] [Google Scholar]
  • 72. Wang HJ, Wang WC. 2000. Expression and binding analysis of GST-VacA fusions reveals that the C-terminal approximately 100-residue segment of exotoxin is crucial for binding in HeLa cells. Biochem. Biophys. Res. Commun. 278:449–454 [DOI] [PubMed] [Google Scholar]
  • 73. Wang WC, Wang HJ, Kuo CH. 2001. Two distinctive cell binding patterns by vacuolating toxin fused with glutathione S-transferase: one high-affinity m1-specific binding and the other lower-affinity binding for variant m forms. Biochemistry 40:11887–11896 [DOI] [PubMed] [Google Scholar]
  • 74. Willhite DC, Blanke SR. 2004. Helicobacter pylori vacuolating cytotoxin enters cells, localizes to the mitochondria, and induces mitochondrial membrane permeability changes correlated to toxin channel activity. Cell Microbiol. 6:143–154 [DOI] [PubMed] [Google Scholar]
  • 75. Ye D, Blanke SR. 2002. Functional complementation reveals the importance of intermolecular monomer interactions for Helicobacter pylori VacA vacuolating activity. Mol. Microbiol. 43:1243–1253 [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES