Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2004 Feb;70(2):943–953. doi: 10.1128/AEM.70.2.943-953.2004

Development of Additional Selectable Markers for the Halophilic Archaeon Haloferax volcanii Based on the leuB and trpA Genes

Thorsten Allers 1,*, Hien-Ping Ngo 1, Moshe Mevarech 2, Robert G Lloyd 1
PMCID: PMC348920  PMID: 14766575

Abstract

Since most archaea are extremophilic and difficult to cultivate, our current knowledge of their biology is confined largely to comparative genomics and biochemistry. Haloferax volcanii offers great promise as a model organism for archaeal genetics, but until now there has been a lack of a wide variety of selectable markers for this organism. We describe here isolation of H. volcanii leuB and trpA genes encoding 3-isopropylmalate dehydrogenase and tryptophan synthase, respectively, and development of these genes as a positive selection system. ΔleuB and ΔtrpA mutants were constructed in a variety of genetic backgrounds and were shown to be auxotrophic for leucine and tryptophan, respectively. We constructed both integrative and replicative plasmids carrying the leuB or trpA gene under control of a constitutive promoter. The use of these selectable markers in deletion of the lhr gene of H. volcanii is described.


Less than 25 years ago, the archaea were virtually unknown. We now recognize that these organisms represent one of the fundamental domains of life (32) and constitute a significant fraction of the total biomass (9). Acceptance of the distinct status of the archaea has been largely due to genome sequencing projects (6). The data from the sequenced genomes have revealed that in spite of their prokaryotic morphology, the archaea have numerous similarities with eukaryotes (5), particularly in enzymes involved in core processes such as transcription (2), translation (10), and DNA replication (23). As the archaeal transcription and replication systems are considerably less complex than those found in eukaryotes, they are more amenable to analysis. Notwithstanding this sequence similarity, the archaea have a unique identity (12), which is best exemplified by novel enzymes such as the Holliday junction resolvase Hjc (19).

In order to realize the true potential of the archaea, both as stripped-down models to dissect more complex eukaryotic systems and as a source of novel enzymes, it is essential to harness the power of genetics to underpin advances in biochemistry and genomics. Haloferax volcanii is an obligate halophile (25) that is genetically stable and grows aerobically in both complex and minimal media (24). It has some of the best genetic tools among the archaea, including a transformation system (8), reporter genes (17), shuttle vectors with antibiotic resistance (14, 16, 22), auxotrophic markers (26), and a recently developed gene knockout system based on the pyrE2 gene (3) (Fig. 1A), which encodes orotate phosphoribosyl transferase and is involved in uracil biosynthesis.

FIG. 1.

FIG. 1.

Gene knockout system based on the pyrE2 gene. (A) A plasmid carrying the pyrE2 marker and flanking sequences of the gene to be deleted is used to transform a ΔpyrE2 H. volcanii strain to uracil prototrophy. Here, the crossover used to integrate the plasmid (pop-in) has occurred to the left of the deletion. Subsequent loss of the plasmid by intrachromosomal crossing over can occur on the left of the deletion, restoring the gene to wild type, or on the right of the deletion, resulting in the desired mutant. In either case the cell is rendered auxotrophic for uracil and is therefore resistant to 5-FOA by virtue of its inability to convert this compound to the toxic analog 5-fluorouracil. (B) The gene is replaced with the trpA marker, and the plasmid is used to transform a ΔpyrE2 ΔtrpA H. volcanii strain to prototrophy for uracil and tryptophan. Loss of the plasmid by crossing over on the right of the deletion, resulting in a trpA-marked mutant, can be selected in one step.

Since the number of selectable genetic markers in H. volcanii is still limited, we wished to supplement it with additional markers. We describe here the isolation of H. volcanii leuB and trpA genes encoding 3-isopropylmalate dehydrogenase and tryptophan synthase, respectively. Deletion of leuB, a homologue of the widely used Saccharomyces cerevisiae LEU2 gene (1), confers leucine auxotrophy in minimal medium. Deletion of the trpA gene (20) confers tryptophan auxotrophy in minimal or Casamino Acids medium. The trpA marker is of particular value when it is used with the pyrE2 gene knockout system, as it allows direct selection for deleterious mutations that are otherwise difficult to recover (Fig. 1B). Here we describe the use of this system for deletion of the H. volcanii homologue of the Escherichia coli lhr gene (28). The leuB and trpA markers were combined with a deletion of the hdrB gene (26), conferring thymidine auxotrophy in rich (yeast extract) medium, and both integrating and shuttle plasmid vectors in which pyrE2, leuB, trpA, and hdrB were used as selectable markers were generated.

MATERIALS AND METHODS

Unless stated otherwise, chemicals were obtained from Sigma and restriction endonucleases were obtained from New England Biolabs.

Strains and culture conditions.

The H. volcanii strains used are shown in Table 1 and were routinely grown in rich medium (Hv-YPC) containing (per liter) 144 g of NaCl, 21 g of MgSO4 · 7H2O, 18 g of MgCl2 · 6H2O, 4.2 g of KCl, and 12 mM Tris HCl (pH 7.5). For solid media, agar (Difco) was added at a concentration of 15 g per liter and was dissolved by heating the medium in a microwave oven. Yeast extract (0.5%, wt/vol; Difco), 0.1% (wt/vol) peptone (Oxoid), and 0.1% (wt/vol) Casamino Acids (Difco) were added, and the medium was autoclaved. After cooling, CaCl2 was added to a final concentration of 3 mM. When required, novobiocin was added to a concentration of 2 μg/ml, mevinolin was added to a concentration of 4 μg/ml, and thymidine was added to a concentration of 40 μg/ml. Casamino Acids medium (Hv-Ca) was made in a similar manner, except that yeast extract and peptone were omitted and Casamino Acids was added to a final concentration of 0.5% (wt/vol). When required, thymidine or hypoxanthine was added at a concentration of 40 μg/ml, and tryptophan or uracil was added at a concentration of 50 μg/ml; for pop-out selection medium, 5-fluoroorotic acid (5-FOA) was added to a concentration of 50 μg/ml and uracil was added to a concentration of 10 μg/ml. Minimal medium (Hv-Min) contained the same concentration of salts as Hv-YPC, except that Tris HCl (pH 7.5) was added to a concentration of 42 mM. After autoclaving and cooling, 4.25 ml of a sodium dl-lactate solution (60%, wt/vol), 3.83 g of disodium succinic acid · 6H2O, 0.25 ml of glycerol, 5 ml of a 1 M NH4Cl solution, 6 ml of a 0.5 M CaCl2 solution, 2 ml of 0.5 M potassium phosphate buffer (pH 7.5), 1 ml of a trace element solution (24), 0.8 mg of thiamine, and 0.1 mg of biotin were added per liter of Hv-Min. When required, thymidine or hypoxanthine was added to a concentration of 40 μg/ml, and leucine, tryptophan, uracil, methionine, glycine, or pantothenic acid was added to a concentration of 50 μg/ml.

TABLE 1.

H. volcanii strains used

Strain Background Derivation or referencea Genotype and/or phenotype
DS70 (DS70) 31
WR340 WFD11 3 His
WR480 WFD11 3 His ΔpyrE2
H18 DS70 DS70, pGB68 pop-in pyrE2+::[ΔpyrE2 NovR]
H23 DS70 DS70, pTA70 pop-in leuB+::[ΔleuB MevR]
H26 DS70 H18 pop-out ΔpyrE2
H30 WFD11 WR480, pTA73 pop-in His ΔpyrE2 leuB+::[ΔleuB pyrE2+]
H37 DS70 H23 pop-out ΔleuB
H40 WFD11 H30 pop-out His ΔpyrE2 ΔleuB
H42 WFD11 WR340, pTA93 pop-in HistrpA+::[ΔtrpA MevR]
H43 DS70 DS70, pTA93 pop-in trpA+::[ΔtrpA MevR]
H45 WFD11 WR480, pTA95 pop-in His ΔpyrE2 trpA+::[ΔtrpA pyrE2+]
H47 DS70 H26, pTA95 pop-in ΔpyrE2 trpA+::[ΔtrpA pyrE2+]
H52 WFD11 H45 pop-out His ΔpyrE2 ΔtrpA
H53 DS70 H47 pop-out ΔpyrE2 ΔtrpA
H60 DS70 H26, pTA73 pop-in ΔpyrE2 leuB+::[ΔleuB pyrE2+]
H66 DS70 H60 pop-out ΔpyrE2 ΔleuB
H76 WFD11 H42 pop-out His ΔtrpA
H77 DS70 H43 pop-out ΔtrpA
H90 DS70 H26, pTA155 pop-in ΔpyrE2 hdrB+::[ΔhdrB pyrE2+]
H91 DS70 H53, pTA155 pop-in ΔpyrE2 ΔtrpA hdrB+::[ΔhdrB pyrE2+]
H92 DS70 H66, pTA155 pop-in ΔpyrE2 ΔleuB hdrB+::[ΔhdrB pyrE2+]
H98 DS70 H90 pop-out ΔpyrE2 ΔhdrB
H99 DS70 H91 pop-out ΔpyrE2 ΔtrpA ΔhdrB
H100 DS70 H92 pop-out ΔpyrE2 ΔleuB ΔhdrB
H107 DS70 H26, pTA166 pop-in ΔpyrE2 lhr+::[Δlhr pyrE2+]
H108 DS70 H53, pTA166 pop-in ΔpyrE2 ΔtrpA lhr+::[Δlhr pyrE2+]
H109 DS70 H53, pTA172 ΔpyrE2 ΔtrpA lhr+::[Δlhr::trpA+pyrE2+]
H111 DS70 H53, pTA73 pop-in ΔpyrE2 ΔtrpA leuB+::[ΔleuB pyrE2+]
H119 DS70 H111 pop-out ΔpyrE2 ΔtrpA ΔleuB
H120 DS70 H107 pop-out ΔpyrE2 Δlhr
H121 DS70 H108 pop-out ΔpyrE2 ΔtrpA Δlhr
H122 DS70 H109 pop-out ΔpyrE2 ΔtrpA Δlhr::trpA+
H126 DS70 H119, pTA155 pop-in ΔpyrE2 ΔtrpA ΔleuB hdrB+::[ΔhdrB pyrE2+]
H133 DS70 H126 pop-out ΔpyrE2 ΔtrpA ΔleuB ΔhdrB
a

Unless indicated otherwise, the source of strains was this study.

E. coli strains XL1-Blue MRF′ (ΔmcrA183 ΔmcrCB-hsdSMR-mrr173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacIqZΔM15 Tn10]) and GM121 (F dam-3 dcm-6 ara-14 fhuA31 galK2 galT22 hdsR3 lacY1 leu-6 thi-1 thr-1 tsx-78) were grown in Luria-Bertani medium containing 100 μg of ampicillin per ml. The latter strain was used to prepare unmethylated plasmid DNA for efficient transformation of H. volcanii (18).

Transformation procedures.

Transformation of H. volcanii was carried out by using polyethylene glycol 600 as described previously (8). The media used for transformation were prepared as described above, except that sucrose was added to a concentration of 15% (wt/vol). E. coli was transformed by using a standard electroporation protocol (29).

Molecular genetic methods.

Restriction endonuclease digestion, agarose gel electrophoresis, Southern blot analysis, and molecular cloning techniques were performed by using standard procedures (29). Probes were generated by PCR by using the provisional H. volcanii genome sequence (University of Scranton, Scanton, Pa.) and the primers listed in Table 2.

TABLE 2.

Oligonucleotide primers used

Primer Sequence (5′-3′)a Relevant propertiesb
HvLeuF CGCCGGCGACCACGTCAAAGAAGA leuB probe, forward primer
HvLeuR AGCAGCATCGCCGCGGACAGAATC leuB probe, reverse primer
TrpAF2 CGCCGAGGGGCCGACCATCC trpA probe, forward primer
TrpAR CGTTGCGACGCGCCCGCTACC trpA probe, reverse primer
dLeu5F GCGTTCAGCACGAATTCCGCCGCCGGGATGACCT leuB deletion, upstream internal primer, EcoRI deletion site
dLeu5R CGCGGGATCCGTCAACCCCGACGAGACCACCTACGA leuB deletion, upstream external primer, BamHI cloning site
dLeu3F GCACGGATCCGCGGGCCGTTGTGATTGAGT leuB deletion, downstream external primer, BamHI cloning site
dLeu3R GGCGGAATTCGTTTCGAACGCGCCCGTTTTCGTTTCTGAT leuB deletion, downstream internal primer, EcoRI deletion site
dTrp5F GCTCTAGAACGCGCTCGGGCAGGTCTTACTGG trpA deletion, upstream external primer, XbaI cloning site
dTrp5R GGACGAATTCCGGGCCGTCGGAGAAGG trpA deletion, upstream internal primer, EcoRI deletion site
dTrp3F2 CGAACTCGAATTCGGTGCGGTAGCG trpA deletion, downstream internal primer, EcoRI deletion site
dTrp3R CCGGTGAGTCTCTAGACGTTTTCGTCCG trpA deletion, downstream external primer, XbaI cloning site
TrpPci GCCTGACATGTCGCTCGAAGACGCC trpA coding sequence, forward primer, PciI site
TrpXba GGGTTCTAGAGCAGTTATGTGCGTTCC trpA coding sequence, reverse primer, XbaI site
LeuBsp GCCCTACGTTCATGACTGAGGAAATCG leuB coding sequence, forward primer, BspHI site
LeuXba CGGGTCGCTCTAGATCAGAGTCGGTCG leuB coding sequence, reverse primer, XbaI site
LhrF2 GAAGCTGAAGGCGGGCGAGTTACG lhr probe, forward primer
LhrR2 ATGGCGGCGAGGTTCAGTTTGTCT lhr probe, reverse primer
dHdrBF2 CCCGATCTAGAGCCGGCTGGTCATC hdrB deletion, upstream external primer, XbaI cloning site
dHdrB5R CCCAGAAAGCTGCTAGCCGCTCATTCG hdrB deletion, upstream internal primer, NheI deletion site
dHdrB3F CTCGGGCTAGCGGGAGTACAAAATCGTC hdrB deletion, downstream internal primer, NheI deletion site
dHdrB3R GCCAAGCTCGAAATTAACCCTCAC hdrB deletion, downstream external primer (XbaI site used)
dLhr5F GAGCGCGCGTAATACGACTCACT lhr deletion, upstream external primer (XhoI site used)
dLhr5R GCGCGTCGCGGCCGCAATCAACGACG lhr deletion, upstream internal primer, NotI deletion site
dLhr3F GCGAGCGGCCGCGCCGGGTCATTACC lhr deletion, downstream internal primer, NotI deletion site
dLhr3R CGCGCAATTAACCCTCACTAAAGGG lhr deletion, downstream external primer (XhoI site used)
HdrBsp TGGCCTCATGAGCGGCGAGGAGC hdrB coding sequence, forward primer, BspHI site
HdrXba CTCCCACTCTCTAGAGTTACTCATCGG hdrB coding sequence, reverse primer, XbaI site
a

Restriction endonuclease sites used in cloning are underlined.

b

Deletion sites were used to ligate flanking sequences. Cloning sites were used to clone deletion constructs in plasmid vectors. Cloning sites in parentheses were located in the amplified sequence (not the primer).

Isolation of H. volcanii total genomic DNA.

One milliliter of a saturated culture (grown in Hv-YPC broth) was centrifuged at 3,300 × g for 8 min and resuspended in 200 μl of 1 M NaCl-20 mM Tris HCl (pH 7.5). Then 200 μl of 100 mM EDTA (pH 8.0)-0.2% (wt/vol) SDS was added to lyse the cells, followed by 1 ml of ethanol. The DNA was spooled out of solution onto a capillary, washed twice with ethanol, and resuspended in 500 μl of TE (10 mM Tris HCl, 1 mM EDTA; pH 7.5). The DNA was precipitated with isopropanol, washed thoroughly with 70% ethanol, and resuspended in 100 μl of TE containing 0.1 mg of RNase A per ml.

Plasmid construction.

The plasmids used are shown in Table 3. Apart from the plasmids shown in Fig. 5 (see below), plasmids were constructed as described in the Results. The PCR primers used for generation of deletion constructs are listed in Table 2. Sequence files are available on request.

TABLE 3.

Plasmids used

Plasmid Relevant properties Source or reference(s)
pBluescript II SK+ Standard cloning vector Stratagene
pD4 pBluescript KS with H. volcanii 3,566-bp MboI-HindIII fragment containing hdrB gene 26
pGB68 pBR322 with NovR and flanking sequences of pyrE2 3
pGB70 pUC19 with pyrE2 under ferredoxin promoter 3
pMDS99 Shuttle vector based on pOK12 with pHV2 replication origin and MevR from Haloarcula hispanica 31
pWL102 Shuttle vector based on pAT153 with pHV2 replication origin and MevR from H. volcanii 7, 22
pTA44 pBluescript II with H. volcanii 4,162-bp BssHII fragment containing leuB gene This study
pTA49 pBluescript II with H. volcanii 3,676-bp Sau3AI fragment containing trpA gene This study
pTA65 pBluescript II with BamHI PCR fragment containing flanking regions of leuB This study
pTA70 pTA65 with NotI fragment from pMDS99 containing MevR This study
pTA73 pGB70 with XbaI-HindIII ΔleuB fragment from pTA65 This study
pTA92 pBluescript II with XbaI PCR fragment containing flanking regions of trpA This study
pTA93 pTA92 with NotI fragment from pMDS99 containing MevR This study
pTA95 pGB70 with XbaI ΔtrpA fragment from pTA92 This study
pTA131 pBluescript II with BamHI-XbaI fragment from pGB70 containing pyrE2 under ferredoxin promoter This study
pTA132 pBluescript II with PCR fragment containing trpA under ferredoxin promoter This study
pTA133 pBluescript II with PCR fragment containing leuB under ferredoxin promoter This study
pTA150 pBluescript II with H. volcanii 3,974-bp XhoI-NruI fragment containing lhr gene This study
pTA155 pTA131 with HindIII-XbaI PCR fragment containing flanking regions of hdrB This study
pTA166 pTA131 with XhoI-SpeI PCR fragment containing flanking regions of lhr This study
pTA172 pTA166 with PCR fragment containing trpA under ferredoxin promoter, inserted at site of lhr deletion This study
pTA192 pBluescript II with PCR fragment containing hdrB under ferredoxin promoter This study
pTA230 pTA131 with NcoI-HindIII fragment from pWL102 containing pHV2 replication origin This study
pTA231 pTA132 with NcoI-HindIII fragment from pWL102 containing pHV2 replication origin This study
pTA232 pTA133 with NcoI-HindIII fragment from pWL102 containing pHV2 replication origin This study
pTA233 pTA192 with NcoI-HindIII fragment from pWL102 containing pHV2 replication origin This study

FIG. 5.

FIG. 5.

Plasmid vectors marked with pyrE2, leuB, trpA, and hdrB. (A) Gene knockout plasmids. The pyrE2, leuB, trpA, and hdrB genes were placed under control of the ferredoxin promoter and cloned in pBluescript II to generate pTA131, pTA132, pTA133, and pTA192, respectively. (B) Shuttle vectors. The pHV2 replication origin from pWL102 (7, 22) was cloned in pTA131, pTA132, pTA133, and pTA192 to generate pTA230, pTA231, pTA232, and pTA233, respectively. Some sites in the polylinker are not unique in the shuttle vectors; full plasmid maps are available on request.

(i) Integrative plasmids.

To generate pTA131, a BamHI-XbaI fragment from pGB70 (3) containing the pyrE2 gene under control of the constitutive ferredoxin promoter was inserted into the PsiI site of pBluescript II. The PsiI site lies outside the polylinker in the lacZ promoter; therefore, the blue-white screening capability is retained. To generate pTA133, pTA132, and pTA192, the coding regions of leuB, trpA, and hdrB were amplified from pTA44, pTA49, and pD4 (26), respectively. The primers used (Table 2) incorporated PciI or BspHI sites at the ATG start codon, which were compatible with the NcoI site at the 3′ end of the ferredoxin promoter. The ensuing fusion constructs were inserted into the PsiI site of pBluescript II.

(ii) Shuttle vectors.

An NcoI-HindIII fragment of pWL102 containing the pHV2 replication origin (7, 22) was inserted into the PciI sites of pTA131, pTA132, pTA133, and pTA192 to generate pTA230, pTA231, pTA232, and pTA233, respectively.

DNA sequence analysis.

DNA database searches of the H. volcanii genome were performed by using NCBI BLAST for Mac OS X (ftp://ftp.ncbi.nih.gov/blast/executables/), and sequence files were downloaded from the University of Scranton (http://wit-scranton.mbi.scranton.edu/Haloferax/). Genomic clones were sequenced by using an in-house service and were used to amend the University of Scranton data. Sequences of pyrE2 (3), hdrB (26), and the trpCBA operon (20) have been published previously.

Nucleotide sequence accession number.

The corrected nucleotide sequence of the H. volcanii leuCDB operon has been deposited in the EMBL nucleotide sequence database under accession number AJ571689.

RESULTS

Construction of H. volcanii DS70 ΔpyrE2 strain.

A ΔpyrE2 mutant was constructed previously in the H. volcanii WFD11 background (3). Since WFD11 strains (22) have been reported to suffer from growth reduction and plasmid instability (31), we implemented the pyrE2 gene knockout system in the improved H. volcanii strain DS70 (31) using the method described by Bitan-Banin et al. (3). DS70 cells were transformed to novobiocin resistance with pGB68, which contains the 850-bp upstream and 850-bp downstream flanking sequences of pyrE2 (3). Transformants (pop-in) were screened by Southern blot hybridization, and a clone (H18) was selected which had integrated at the pyrE2 locus and not gyrB; since novobiocin resistance is encoded by a mutant allele of the DNA gyrase gene gyrB (15), plasmids containing this marker can integrate at the chromosomal gyrB locus (which was the case in two of the five transformants examined). Excision of pGB68 (pop-out) was performed by propagating H18 for ∼30 generations in rich medium (Hv-YPC) in the absence of novobiocin and plating on Casamino Acids (Hv-Ca) agar containing either uracil alone or uracil and 5-FOA. Approximately 2% of the cells were 5-FOA resistant and were subsequently determined to be auxotrophic for uracil and sensitive to novobiocin. These clones were analyzed by Southern blot hybridization, and a strain in which pGB68 had been excised, resulting in deletion of pyrE2, was designated H26.

Cloning of leuB and flanking sequences.

An operon containing the leucine biosynthesis genes leuB, leuC, and leuD was identified in the H. volcanii genome sequence. The leuB gene, encoding 3-isopropylmalate dehydrogenase, was chosen for development as a genetic marker, since it is the terminal gene in the operon and a deletion would not have a polar effect on transcription of leuC and leuD. To clone the gene and its flanking sequences, a fragment of leuB was amplified by PCR and used to probe a Southern blot of H. volcanii chromosomal DNA digested with BssHII. A 4.2-kb DNA fragment was found to hybridize with the probe. A genomic DNA mini-library of 4.2-kb BssHII fragments was constructed in pBluescript II and screened by colony hybridization by using the leuB fragment probe. A clone (pTA44) was sequenced and found to contain the 972-bp leuB gene, as well as 1,604 bp of upstream flanking sequences and 1,584 bp of downstream flanking sequences (Fig. 2).

FIG. 2.

FIG. 2.

Construction of leuB deletion plasmids. The genomic leuB clone pTA44 contains a 4,162-bp genomic DNA BssHII fragment cloned in pBluescript II. Sequences flanking leuB were amplified from pTA44 and cloned in pBluescript II to generate the ΔleuB construct pTA65. The mevinolin resistance fragment from pMDS99 (31) was inserted into pTA65 to generate pTA70. Alternatively, the ΔleuB construct from pTA65 was cloned in the pyrE2-marked gene knockout plasmid pGB70 (3), generating pTA73. Only relevant sites are shown; full plasmid maps are available on request.

Deletion of leuB and phenotypic analysis.

To delete leuB, a 1,268-bp fragment upstream of leuB and a 1,395-bp downstream fragment were amplified by PCR by using pTA44 as a template. The internal primers contained EcoRI sites used to ligate the PCR products, and the external primers contained BamHI sites used to clone the ΔleuB fragment in pBluescript II SK+, generating pTA65 (Fig. 2). A NotI fragment from pMDS99 (31) containing the mevinolin resistance gene (MevR) was inserted at the NotI site of pTA65 to generate pTA70. Alternatively, an XbaI-HindIII fragment of pTA65 containing the ΔleuB construct was inserted at the XbaI and HindIII sites of the pyrE2-marked plasmid pGB70 (3), generating pTA73 (Fig. 2).

H. volcanii DS70 was transformed to mevinolin resistance with pTA70, and transformants were screened for integration at the leuB locus by Southern blot hybridization (Fig. 3); this was observed in all eight transformants analyzed. One clone was chosen (H23), and excision of pTA70 was performed by propagating H23 in the absence of mevinolin. Colonies were screened by replica plating on rich agar with and without mevinolin, as well as minimal agar (Hv-Min). Mevinolin-sensitive clones that failed to grow on minimal agar without added leucine were analyzed by Southern blot hybridization. A strain in which pTA70 had been excised, resulting in deletion of 942 bp, including leuB, was designated H37 (Fig. 3).

FIG. 3.

FIG. 3.

Deletion of leuB gene. (A) Plasmids pTA70 and pTA73 were constructed as described in the legend to Fig. 2. Integration of pTA70 into the chromosome of DS70 by homologous recombination upstream of leuB resulted in strain H23. Loss of the plasmid by intrachromosomal recombination (Fig. 1) resulted in the ΔleuB strain H37. Integration of pTA73 (in H26) by recombination downstream of leuB yielded strain H60, and loss of the plasmid resulted in the ΔleuB strain H66. Integration and deletion events were monitored by digestion with MluI (M), resulting in the fragments indicated. (B) Southern blot analysis of ΔleuB strain construction. Genomic DNA were prepared from the strains indicated, digested with MluI, and probed with the flanking regions of leuB.

To construct ΔpyrE2 ΔleuB strains, the H. volcanii DS70 ΔpyrE2 strain H26 was transformed to uracil prototrophy with pTA73, and transformants were screened for integration at the leuB locus (Fig. 3). One clone was chosen (H60), and excision of pTA73 was performed by propagating H60 in rich medium and plating the culture on Casamino Acids (Hv-Ca) agar containing either uracil alone or uracil and 5-FOA. Approximately 2% of the cells were 5-FOA resistant (Ura) and were screened by replica plating on minimal agar with and without added leucine. Five of 30 Ura clones tested were auxotrophic for leucine and were analyzed by Southern blotting (Fig. 3B). A strain in which pTA73 had been excised, resulting in deletion of leuB, was designated H66. A ΔpyrE2 ΔleuB strain was made in a similar manner in the WFD11 background by transforming WR480 (3) with pTA73. The pop-in strain was designated H30, and the ΔleuB pop-out strain was designated H40.

Cloning of trpA and flanking sequences.

To clone the operon containing the tryptophan biosynthesis genes trpC, trpB, and trpA and their flanking sequences (20), a fragment of trpA was amplified and used to probe a Southern blot of H. volcanii DNA digested with Sau3AI. As predicted (20), a 3.7-kb DNA fragment hybridized with the probe. A genomic DNA mini-library of 3.7-kb Sau3AI fragments was constructed in pBluescript II and screened by colony hybridization. A clone (pTA49) (Fig. 4A) was isolated that contained the 834-bp trpA gene, as well as 2,531 bp of upstream flanking sequences and 311 bp of downstream flanking sequences. The trpA gene, encoding the 277-amino-acid tryptophan synthase alpha subunit, was chosen for development as a genetic marker since it is the terminal gene in the operon.

FIG. 4.

FIG. 4.

Deletion of trpA gene. (A) Construction of trpA deletion plasmids. The genomic trpA clone pTA49 contains a 3,676-bp genomic DNA Sau3AI fragment cloned in pBluescript II. Sequences flanking trpA were amplified from pTA49 and cloned in pBluescript II to generate the ΔtrpA plasmid pTA92. The mevinolin resistance fragment from pMDS99 (31) was inserted into pTA92 to generate pTA93 (data not shown; similar to pTA70 in Fig. 2). Alternatively, the ΔtrpA construct from pTA92 was cloned in pGB70 (3), generating pTA95 (data not shown; similar to pTA73 in Fig. 2). Plasmid maps are available on request. (B) Deletion of the trpA gene in strains H77 and H53 was analyzed by MluI digestion and Southern blot hybridization by using flanking regions of trpA as a probe (similar to the leuB deletion in Fig. 3). Integration of pTA93 into the chromosome of DS70 by recombination upstream of trpA gave a novel 5.8-kb MluI fragment, producing strain H43. Loss of the plasmid, which deleted trpA (1.8-kb MluI fragment instead of 2.5-kb MluI fragment) resulted in ΔtrpA strain H77. Integration of pTA95 into H26 by recombination downstream of trpA gave a novel 5.5-kb MluI fragment, producing strain H47, and loss of the plasmid resulted in ΔtrpA strain H53.

Deletion of trpA and phenotypic analysis.

To delete trpA, a 1,048-bp fragment upstream of trpA and a 355-bp downstream fragment were amplified by PCR by using pTA49. The internal primers contained EcoRI sites used to ligate the PCR products, and the external primers contained XbaI sites used to clone the ΔtrpA fragment in pBluescript II, generating pTA92 (Fig. 4A). The NotI MevR fragment from pMDS99 (31) was inserted at the NotI site of pTA92 to generate pTA93 (data not shown; similar to pTA70 in Fig. 2). Alternatively, an XbaI fragment of pTA92 containing the ΔtrpA construct was inserted at the XbaI site of pGB70 (3), generating pTA95 (data not shown; similar to pTA73 in Fig. 2).

Plasmid pTA93 was used to transform H. volcanii DS70. Transformants were screened for integration at trpA by Southern blotting (Fig. 4B). One integrant was chosen (H43), and excision of pTA93 was performed as described above. Colonies were also screened by replica plating on Casamino Acids (Hv-Ca) agar, which contained no detectable tryptophan. Mevinolin-sensitive clones exhibiting tryptophan auxotrophy on Casamino Acids agar were analyzed by Southern blotting. A strain in which pTA93 had been excised to obtain a 744-bp deletion of trpA was designated H77 (Fig. 4). A ΔtrpA strain was made in a similar manner in the WFD11 background, by transforming WR340 (3) with pTA93. The pop-in strain was designated H42, and the ΔtrpA pop-out strain was designated H76.

To construct a ΔpyrE2 ΔtrpA strain, H. volcanii H26 was transformed with pTA95, and transformants were screened for integration at trpA. One integrant was chosen (H47) (Fig. 4B), and excision of pTA95 was performed as described above. 5-FOA-resistant (Ura) cells were screened for tryptophan auxotrophy by replica plating on Casamino Acids agar and were analyzed by Southern blot hybridization (Fig. 4B). A strain in which pTA95 had been excised to delete trpA was designated H53. A ΔpyrE2 ΔtrpA strain was made in a similar manner in the WFD11 background, by transforming WR480 (3) with pTA95. The pop-in strain was designated H45, and the ΔtrpA pop-out strain was designated H52.

We examined the potential of ΔtrpA strains in a counterselectable system similar to that based on pyrE2. In S. cerevisiae, 5-fluoroanthranilic acid has been used for counterselection of tryptophan biosynthesis genes (30). This compound is converted to toxic 5-fluorotryptophan in trp+ cells, which is analogous to the action on 5-FOA in uracil biosynthesis (4). We tested a number of anthranilic acid derivatives, including 4-, 5-, and 6-fluoroanthranilic acids and 5- and 6-methylanthranilic acids, as well as 5-fluoroindole, for the ability to select against trpA+ strains but not ΔtrpA strains. Strains H26 and H53 were tested by plating on Casamino Acids agar containing between 0.05 and 1 mg of the anthranilic acid derivatives per ml; tryptophan was added at a relative concentration of 10 to 40% to support growth of ΔtrpA cells. None of these compounds discriminated between H26 (trpA+) and H53 (ΔtrpA) cells; the anthranilic acid derivatives prevented growth of both strains at concentrations above 0.25 mg/ml, and 5-fluoroindole was toxic at all concentrations tested. This was most likely due to feedback inhibition of tryptophan biosynthesis, leading to insufficient conversion of anthranilic acid derivatives to toxic fluoro- or methyltryptophan, and a failure to discriminate between trpA+ and ΔtrpA strains. In addition, the anthranilic acid derivatives most probably exhibited nonspecific toxicity at higher concentrations, affecting both trpA+ and ΔtrpA cells.

Construction of strains with deletions in pyrE2, leuB, trpA, and hdrB.

The hdrB marker is a useful addition to the current genetic repertoire, as deletion of this gene confers thymidine auxotrophy in rich medium (Hv-YPC) (26). We therefore constructed a ΔhdrB mutant in the H. volcanii DS70 ΔpyrE2 strain H26. Sequences flanking hdrB (577 bp upstream and 292 bp downstream) were amplified by PCR by using the genomic clone pD4 as a template (26) and were cloned in the pyrE2-marked gene knockout plasmid pTA131 (see below) (Fig. 5A) to generate the ΔhdrB construct pTA155. H. volcanii H26 was transformed with pTA155, and transformants were screened for integration at hdrB (data not shown). One integrant was chosen (H90), and excision of pTA155 was performed as described above. 5-FOA-resistant (Ura) cells were screened for thymidine auxotrophy by replica plating on rich agar. A strain in which pTA155 had been excised to delete hdrB was designated H98.

We constructed strains with combinations of the deletions described above. A ΔpyrE2 ΔleuB ΔtrpA strain was made by transforming H53 with pTA73; the pop-in strain was designated H111, and the ΔleuB pop-out strain was designated H119. Derivatives of H53, H66, and H119 with an additional deletion of hdrB were constructed by transforming these strains with pTA155; the pop-in strains were designated H91, H92, and H126, respectively, and the ΔhdrB pop-out strains were designated H99, H100, and H133, respectively. All of the strains described here are listed in Table 1.

Construction of plasmid vectors by using pyrE2, leuB, trpA, and hdrB as selectable markers.

To construct an improved pyrE2-marked gene knockout plasmid, a fragment from pGB70 containing the pyrE2 gene under control of the constitutive ferredoxin promoter of Halobacterium salinarum (27) was inserted into pBluescript II. This plasmid (pTA131) (Fig. 5A) retained the blue-white screening facility of pBluescript. Similar plasmids were made by using leuB, trpA, and hdrB as selectable markers. The coding regions of these genes were amplified from pTA44, pTA49, and pD4, fused to the ferredoxin promoter, and inserted into pBluescript II to generate pTA133, pTA132, and pTA192, respectively (Fig. 5A).

Shuttle vectors were derived from these plasmids by inserting the replication origin of the H. volcanii episome pHV2 (Fig. 5B); both strain WFD11 and strain DS70 have been cured of this indigenous plasmid (7, 22, 31). The shuttle vectors were able to transform the corresponding H. volcanii deletion strains to prototrophy for the appropriate markers. The transformation efficiencies were ∼105 CFU/μg of DNA, as expected. Dual-resistance vectors based on pMDS20 (14), which also contained the novobiocin resistance gene, were also constructed (details are available on request).

Construction of a Δlhr strain by using the ΔpyrE2 ΔtrpA strain.

In the pop-in-pop-out gene knockout system, spontaneous excision of the integrated plasmid can occur in one of two ways, either restoring the gene to wild-type information or resulting in a deletion (Fig. 1A). Even if both outcomes are equally likely, the mutant rapidly becomes underrepresented (in the population of 5-FOA-resistant cells) if the gene deletion leads to a slow-growth phenotype. By replacing the gene to be deleted with the trpA marker and plating the culture on Casamino Acids medium with 5-FOA (but no added tryptophan), it is possible to select directly for pop-out events that lead to the mutation (Fig. 1B).

To demonstrate that the trpA pyrE2 system allows direct selection for gene knockouts that might otherwise be difficult to recover, we deleted the lhr gene, which was identified in the genome sequence on the basis of the homology of its product to the Lhr protein of E. coli. Lhr is a member of helicase superfamily II (28) and is well conserved among prokaryotes, although the C-terminal ∼650 amino acids of the E. coli protein are found only in bacteria. A 3,974-bp XhoI-NruI fragment of H. volcanii genomic DNA, containing the 2,757-bp lhr gene, 677 bp of upstream flanking sequences, and 540 bp of downstream flanking sequences, was cloned in pBluescript II to generate pTA150 (Fig. 6A). To delete lhr, a 653-bp upstream fragment and a 551-bp downstream fragment were amplified by PCR by using pTA150. The internal primers contained NcoI sites used to ligate the PCR products, and the external primers contained XhoI and SpeI sites used to clone the Δlhr fragment in pTA131, generating pTA166 (Fig. 6A). A 972-bp fragment containing the trpA gene under control of the ferredoxin promoter (see pTA132 in Fig. 5A) was inserted into the NcoI site at the lhr deletion to generate pTA172 (Fig. 6A).

FIG. 6.

FIG. 6.

Deletion of lhr gene. (A) Construction of lhr deletion plasmid. The genomic lhr clone pTA150 was used to amplify the flanking regions of lhr, which were inserted into pTA131 to generate the Δlhr construct pTA166. A fragment containing the trpA gene under control of the ferredoxin promoter (p.fdx) was inserted at the site of the lhr deletion (NcoI), generating the Δlhr::trpA plasmid pTA172. (B) Twelve 5-FOA-resistant (Ura) derivatives of pop-in strains H107 to H109 were grown on rich agar, transferred to a nylon filter, and probed with the lhr coding sequence. In the case of H109, the four Ura clones with lhr deleted had previously been shown to be prototrophic for tryptophan (Trp+), whereas the remaining eight clones in which lhr was not deleted were Trp. (C) Deletion of the lhr gene was analyzed by BspEI digestion and Southern blot hybridization by using the downstream flanking region of lhr as a probe. Integration of pTA166 into the chromosomes of H26 and H53 gave a novel 4.8-kb BspEI fragment, producing strains H107 and H108, respectively, and loss of pTA166, which deleted lhr (4.5-kb BspEI fragment instead of 7.3-kb BspEI fragment), resulted in Δlhr strains H120 and H121, respectively. Integration of pTA172 in the chromosome of H53 gave a novel 4.6-kb BspEI fragment, producing strain H109, and loss of pTA172, which deleted lhr (4.3-kb BspEI fragment), resulted in Δlhr::trpA strain H122.

H26 was transformed with pTA166, and H53 was transformed with pTA166 or pTA172. Integrants at lhr were verified (H107 to H109, respectively) (Fig. 6C), and excision of pTA166 and pTA172 was performed as usual. Cultures were plated on Casamino Acids agar containing uracil and 5-FOA with or without added tryptophan. Approximately 2% of the cells were 5-FOA resistant (Ura), and in the case of H109 (transformed with Δlhr::trpA plasmid pTA172), 4 of the 30 Ura clones tested were prototrophic for tryptophan. Ura clones were screened for deletion of lhr by colony hybridization by using the lhr coding sequence as a probe (Fig. 6B). All four of the Trp+ derivatives of H109 were Δlhr::trpA, while in the remaining Trp derivatives lhr was not deleted. Among derivatives of H107 and H108 (transformed with Δlhr plasmid pTA172) only 2 of 12 and 3 of 12 of the Ura clones, respectively, proved to be Δlhr (Fig. 6B). Deletions were confirmed by Southern blot hybridization (Fig. 6C), and Δlhr derivatives of H107 to H109 were designated H120 to H122, respectively. Δlhr mutants did not show any detectable growth deficiency in rich or minimal medium and were no more sensitive to UV or γ radiation than isogenic lhr+ strains were.

DISCUSSION

A cornerstone of genetic analysis is the ability to manipulate the genome. Traditionally, this has been done by chemical mutagenesis, followed by laborious screening for the appropriate phenotype. In the postgenomic era, when homologues are readily identifiable in model organisms, it is more expedient to perform targeted gene knockout and characterize the phenotype of the mutant. Selectable markers provide the means to accomplish this end.

The development of antibiotic resistance markers for the archaea has been hampered by the lack of drug targets. Bacterial antibiotics are safe for medical use as their targets are generally not found in eukaryotic cells. Due to the greater similarity of the archaea to eukaryotes, it is hardly surprising that most commonly used antibiotics are ineffective against archaea (13). The few antibiotics currently available for H. volcanii have shortcomings. For example, the mevinolin resistance marker is an up-promoter mutation of the chromosomal gene hmgA (21). Recombination between the chromosomal gene and the resistance marker can therefore lead to constitutive antibiotic resistance. This problem was recently alleviated by development of a mevinolin resistance marker from Haloarcula hispanica, which is stably maintained in H. volcanii (31). However, spontaneous resistance to mevinolin can still arise (at an inconveniently high frequency) by promoter point mutation or amplification of the hmg gene (T.A., unpublished observations). Stable auxotrophic mutants provide a solution to these problems.

We have developed leuB and trpA as selectable markers, in conjunction with existing systems based on pyrE2 and hdrB, since this suite of genes takes full advantage of the media available for H. volcanii (Table 4). In order to ensure that the mutants are stable, complete gene deletions were constructed. The coding sequence of the deleted gene can then be used as a selectable marker on a replicative (shuttle) vector without the risk of integration by homologous recombination. We have generated shuttle vectors and integrative plasmids for gene knockouts that complement these deletions (Fig. 5). Implementation of the leuB, trpA, and hdrB deletions in the ΔpyrE2 background provides the widest variety of genetic markers available in any archaeal species.

TABLE 4.

Growth characteristics of selected H. volcanii mutants

Strain Genotype Growth on:
Hv-YPC Hv-Ca Hv-Min
H26 ΔpyrE2 + Ura Ura
H37 ΔleuB + + Leu
H77 ΔtrpA + Trp Trp
H66 ΔpyrE2 ΔleuB + Ura Ura Leu
H53 ΔpyrE2 ΔtrpA + Ura Trp Ura Trp
H98a ΔpyrE2 ΔhdrB Thy Ura Thy Ura Thy
a

In addition to thymidine, ΔhdrB strain cultures should be supplemented with hypoxanthine in Hv- Ca and with hypoxanthine, methionine, glycine, and pantothenic acid in Hv-Min (26).

The genetic tools described here, particularly the trpA pyrE2 system, should be useful for isolation of mutants that are deleterious and therefore difficult to recover. By using a construct in which the gene of interest is replaced with the trpA marker, it is possible to select directly for deletion events (Fig. 1B). We demonstrated the utility of this system with a deletion of the lhr gene of H. volcanii (Fig. 6). Complete failure to recover 5-FOA-resistant Trp+ cells from such a pop-in strain would be a strong indication that the gene deletion is lethal. This facility should in turn permit development of more sophisticated genetic tools, such as synthetic lethal screening methods (11).

Acknowledgments

We thank Steven Marsden for help with the leuB and trpA deletions, Gili Bitan-Banin for valuable advice, and Ed Bolt for critical reading of the manuscript.

This work was supported by a Wellcome Trust project grant to T.A. and R.G.L. and by a Royal Society University Research Fellowship to T.A.

REFERENCES

  • 1.Beggs, J. D. 1978. Transformation of yeast by a replicating hybrid plasmid. Nature 275:104-109. [DOI] [PubMed] [Google Scholar]
  • 2.Bell, S. D., and S. P. Jackson. 2001. Mechanism and regulation of transcription in archaea. Curr. Opin. Microbiol. 4:208-213. [DOI] [PubMed] [Google Scholar]
  • 3.Bitan-Banin, G., R. Ortenberg, and M. Mevarech. 2003. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J. Bacteriol. 185:772-778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Boeke, J. D., F. LaCroute, and G. R. Fink. 1984. A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346. [DOI] [PubMed] [Google Scholar]
  • 5.Brown, J. R., and W. F. Doolittle. 1997. Archaea and the prokaryote-to-eukaryote transition. Microbiol. Mol. Biol. Rev. 61:456-502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073. [DOI] [PubMed] [Google Scholar]
  • 7.Charlebois, R. L., W. L. Lam, S. W. Cline, and W. F. Doolittle. 1987. Characterization of pHV2 from Halobacterium volcanii and its use in demonstrating transformation of an archaebacterium. Proc. Natl. Acad. Sci. 84:8530-8534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cline, S. W., W. L. Lam, R. L. Charlebois, L. C. Schalkwyk, and W. F. Doolittle. 1989. Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35:148-152. [DOI] [PubMed] [Google Scholar]
  • 9.DeLong, E. F., L. T. Taylor, T. L. Marsh, and C. M. Preston. 1999. Visualization and enumeration of marine planktonic archaea and bacteria by using polyribonucleotide probes and fluorescent in situ hybridization. Appl. Environ. Microbiol. 65:5554-5563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dennis, P. P. 1997. Ancient ciphers: translation in Archaea. Cell 89:1007-1010. [DOI] [PubMed] [Google Scholar]
  • 11.Forsburg, S. L. 2001. The art and design of genetic screens: yeast. Nat. Rev. Genet. 2:659-668. [DOI] [PubMed] [Google Scholar]
  • 12.Graham, D. E., R. Overbeek, G. J. Olsen, and C. R. Woese. 2000. An archaeal genomic signature. Proc. Natl. Acad. Sci. 97:3304-3308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hilpert, R., J. Winter, W. Hammes, and O. Kandler. 1981. The sensitivity of archaebacteria to antibiotics. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 Orig. Reihe C 2:11-20. [Google Scholar]
  • 14.Holmes, M., F. Pfeifer, and M. Dyall-Smith. 1994. Improved shuttle vectors for Haloferax volcanii including a dual-resistance plasmid. Gene 146:117-121. [DOI] [PubMed] [Google Scholar]
  • 15.Holmes, M. L., and M. L. Dyall-Smith. 1991. Mutations in DNA gyrase result in novobiocin resistance in halophilic archaebacteria. J. Bacteriol. 173:642-648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Holmes, M. L., and M. L. Dyall-Smith. 1990. A plasmid vector with a selectable marker for halophilic archaebacteria. J. Bacteriol. 172:756-761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Holmes, M. L., and M. L. Dyall-Smith. 2000. Sequence and expression of a halobacterial beta-galactosidase gene. Mol. Microbiol. 36:114-122. [DOI] [PubMed] [Google Scholar]
  • 18.Holmes, M. L., S. D. Nuttall, and M. L. Dyall-Smith. 1991. Construction and use of halobacterial shuttle vectors and further studies on Haloferax DNA gyrase. J. Bacteriol. 173:3807-3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Komori, K., S. Sakae, H. Shinagawa, K. Morikawa, and Y. Ishino. 1999. A Holliday junction resolvase from Pyrococcus furiosus: functional similarity to Escherichia coli RuvC provides evidence for conserved mechanism of homologous recombination in Bacteria, Eukarya, and Archaea. Proc. Natl. Acad. Sci. 96:8873-8878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lam, W. L., A. Cohen, D. Tsouluhas, and W. F. Doolittle. 1990. Genes for tryptophan biosynthesis in the archaebacterium Haloferax volcanii. Proc. Natl. Acad. Sci. 87:6614-6618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lam, W. L., and W. F. Doolittle. 1992. Mevinolin-resistant mutations identify a promoter and the gene for a eukaryote-like 3-hydroxy-3-methylglutaryl-coenzyme A reductase in the archaebacterium Haloferax volcanii. J. Biol. Chem. 267:5829-5834. [PubMed] [Google Scholar]
  • 22.Lam, W. L., and W. F. Doolittle. 1989. Shuttle vectors for the archaebacterium Halobacterium volcanii. Proc. Natl. Acad. Sci. 86:5478-5482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.MacNeill, S. A. 2001. Understanding the enzymology of archaeal DNA replication: progress in form and function. Mol. Microbiol. 40:520-529. [DOI] [PubMed] [Google Scholar]
  • 24.Mevarech, M., and R. Werczberger. 1985. Genetic transfer in Halobacterium volcanii. J. Bacteriol. 162:461-462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mullakhanbhai, M. F., and H. Larsen. 1975. Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Arch. Microbiol. 104:207-214. [DOI] [PubMed] [Google Scholar]
  • 26.Ortenberg, R., O. Rozenblatt-Rosen, and M. Mevarech. 2000. The extremely halophilic archaeon Haloferax volcanii has two very different dihydrofolate reductases. Mol. Microbiol. 35:1493-1505. [DOI] [PubMed] [Google Scholar]
  • 27.Pfeifer, F., J. Griffig, and D. Oesterhelt. 1993. The fdx gene encoding the [2Fe-2S] ferredoxin of Halobacterium salinarium (H. halobium). Mol. Gen. Genet. 239:66-71. [DOI] [PubMed] [Google Scholar]
  • 28.Reuven, N. B., E. V. Koonin, K. E. Rudd, and M. P. Deutscher. 1995. The gene for the longest known Escherichia coli protein is a member of helicase superfamily II. J. Bacteriol. 177:5393-5400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 30.Toyn, J. H., P. L. Gunyuzlu, W. H. White, L. A. Thompson, and G. F. Hollis. 2000. A counterselection for the tryptophan pathway in yeast: 5-fluoroanthranilic acid resistance. Yeast 16:553-560. [DOI] [PubMed] [Google Scholar]
  • 31.Wendoloski, D., C. Ferrer, and M. L. Dyall-Smith. 2001. A new simvastatin (mevinolin)-resistance marker from Haloarcula hispanica and a new Haloferax volcanii strain cured of plasmid pHV2. Microbiology 147:959-964. [DOI] [PubMed] [Google Scholar]
  • 32.Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. 87:4576-4579. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES