Skip to main content
PLOS One logoLink to PLOS One
. 2013 Feb 28;8(2):e57586. doi: 10.1371/journal.pone.0057586

Cellobiose-Mediated Gene Expression in Streptococcus pneumoniae: A Repressor Function of the Novel GntR-Type Regulator BguR

Sulman Shafeeq 1, Oscar P Kuipers 1,*, Tomas G Kloosterman 1
Editor: Luciana C C Leite2
PMCID: PMC3585215  PMID: 23469031

Abstract

The human pathogen Streptococcus pneumoniae has the ability to use the carbon- and energy source cellobiose due to the presence of a cellobiose-utilizing gene cluster (cel locus) in its genome. This system is regulated by the cellobiose-dependent transcriptional activator CelR, which has been previously shown to contribute to pneumococcal virulence. To get a broader understanding of the response of S. pneumoniae to cellobiose, we compared the pneumococcal transcriptome during growth on glucose as the main carbon source to that with cellobiose as the main carbon source. The expression of various carbon metabolic genes was altered, including a PTS operon (which we here denote as the bgu operon) that has high similarity with the cel locus. In contrast to the cel locus, the bgu operon is conserved in all sequenced strains of S. pneumoniae, indicating an important physiological function in the lifestyle of pneumococci. We next characterized the transcriptional regulation of the bgu operon in more detail. Its expression was increased in the presence of cellobiose, and decreased in the presence of glucose. A novel GntR-type transcriptional regulator (which we here denote as BguR) was shown to act as a transcriptional repressor of the bgu operon and its repressive effect was relieved in the presence of cellobiose. BguR-dependent repression was demonstrated to be mediated by a 20-bp DNA operator site (5′-AAAAATGTCTAGACAAATTT-3′) present in PbguA, as verified by promoter truncation experiments. In conclusion, we have identified a new cellobiose-responsive PTS operon, together with its transcriptional regulator in S. pneumoniae.

Introduction

Streptococcus pneumoniae is a Gram-positive bacterial pathogen in humans that has the ability to colonize the nasopharyngeal cavity of the nose [1]. In favorable environmental conditions it may spread to different parts of the human body to cause serious infections like pneumonia, otitis media, septicemia or meningitis [2], [3] leading to millions of deaths each year, especially in children and the elderly [4]. In order to survive in the different niches in the human host, S. pneumoniae must have the ability to adapt to fluctuating levels of nutrients [5], [6], such as the available carbohydrate- and energy sources.

Previous studies have shown that S. pneumoniae is able to use an exceptionally broad spectrum of different carbon sources like cellobiose, raffinose, sucrose, galactose, maltose and others [7][18]. Cellobiose is a β-glucoside carbohydrate that can also be utilized by S. pneumoniae as an energy source alternative to a preferred sugar like glucose [7], [18], although it is not clear whether it encounters this presumed plant-derived carbohydrate in its natural environment. However, the extracellular matrix of mammalian tissues is rich in glycosaminoglycans that contain repeating units of β-linked disaccharides [19]. The degradation of glycosaminoglycans from these mammalian extracellular tissues may release structural analogues of cellobiose [19], [20]. Therefore, a system previously described to function in cellobiose utilization in S. pneumoniae, i.e. the Cel system [7], [8], may be involved in the acquisition and metabolism of β-glucosides related to cellobiose, which are derived by degradation of the extracellular matrix or other biopolymers in the host [19], [20].

The Cel system (encoded by the cel locus) [7] has been shown to be required for S. pneumoniae strain R6 to grow on cellobiose as the sole energy source. The cel loci of strains R6/D39 consist of seven genes and they are transcribed into two transcriptional units [7], [8]. The genes in the cel locus encode a phospho-β-glucosidase (celA), a DNA-binding transcriptional activator (celR), cellobiose-specific PTS IIBAC components (celB, celC and celD) and two proteins with unknown functions. CelR was found to be responsible for activation of the cel locus in Streptococcus mutans in the presence of cellobiose [21]. Recently, CelR also has been demonstrated to function as a transcriptional activator of the cel locus in S. pneumoniae [8]. However, the cel locus is not conserved in all pneumococcal strains, as it is absent in 50% of the sequenced S. pneumoniae genomes available on the KEGG website, including major multi-drug resistant pneumococcal strains like 19F and 23F. Based on this observation, we hypothesized that S. pneumoniae might possess alternative systems that it employs to use β-glucosides like cellobiose.

To get a broader understanding of the response of S. pneumoniae to cellobiose, we examined in this study cellobiose-dependent regulation on a transcriptome-wide level and found another operon, homologous to the cel locus, which is highly expressed in the presence of cellobiose. This operon encodes a PTS system that was recently shown to contribute to growth on the β-glucosides amygdalin and cellobiose [17]. In subsequent experiments, this operon was found to be regulated by a GntR-type transcriptional repressor (BguR, encoded by the divergently orientated upstream gene) in response to cellobiose and glucose. A conserved operator sequence was found that is necessary for the regulation to take place. The novel PTS operon, which we tentatively name bguDBC, did not contribute to growth in medium with cellobiose as the sole carbon source, whereas the cel locus did. Therefore, the cel locus seems to be the primary transport system for cellobiose in S. pneumoniae D39, but the exact function of bgu operon, although likely to lie in transport of β-glucosides [17], is still not entirely clear.

Materials and Methods

DNA Manipulation, Bacterial Strains and Growth Conditions

Chromosomal DNA of S. pneumoniae D39 wild-type [10] was used for PCR amplification. Primers were based on the sequence of the D39 genome [10] and are listed in Table 1.

Table 1. List of primers used in this study. Restriction sites are underlined.

Name Nucleotide Sequence (5′3′) Restriction site
PbguA-Fr CGGGATCCCCGCTAGAAGCTGCTCCCCACC EcoRI
PbguA-Rv CGGAATTCCTTTTCACGAATCTCATTGT BamHI
PmalQ-Fr CGGGAATTCTATGGACGTTTGTGCTTTG EcoRI
PmalQ-Rv CGGGATCCGAGATGTGCATCAACACAC BamHI
PmalP-Fr CGGGAATTCCCTCTTTAGACAGATTC EcoRI
PmalP-Rv CGGGATCCAAGCACCGCAGTGCTC BamHI
SPD1830-KO-1 GTAAATTCATCACAAGATCC
SPD1830-KO-2 TCCTCCTCACTATTTTGATTAGTTTTGTACTCATTTAATCTGG
SPD1830-KO-3 CGTTTTAGCGTTTATTTCGTTTAGTCATTACGACATTCCTCCTAGG
SPD1830-KO-4 CTGTTTTCATACTCTTTCCC
SPD1832-4-KO-1 CTGGATGCCAGACCAATAC
SPD1832-4-KO-2 GAGATCTAATCGATGCATGCCAGCAAAGGTGGCAAATTGG
SPD1832-4-KO-3 AGTTATCGGCATAATCGTTAGAATTCATCGATCTCTATC
SPD1832-4-KO-4 TTCCTGATAGAGTTGTTCAC
Spec-R ACTAAACGAAATAAACGC
Spec-F CTAATCAAAATAGTGAGGAGG
Ery-R TAACGATTATGCCGATAACT
Ery-F GCATGCATCGATTAGATCTC
Forward primers used with PbguA-Rv (reverse primer) for 5′ subcloning of P bguA
PbguA-5.3 GCATGAATTCTAGACAAATTTTAAAATTATG EcoRI
PbguA-5.4 GCATGAATTCGTCTAGACAAATTTTAAAATTATGC EcoRI
PbguA-5.5 GCATGAATTCGTATCAACAATTTTTAAAAATG EcoRI

Bacterial strains and plasmids used in this study are listed in Table 2. All bacterial strains were stored in 10% (v/v) glycerol at −80°C. M17 broth [22], [23] supplemented with 0.5% (w/v) glucose was used for growing S. pneumoniae D39 wild-type [10] on blood agar plates supplemented with 1% (v/v) defibrinated sheep blood in micro-aerophilic conditions at 37°C. For selection, media were supplemented with the following concentrations of antibiotics: erythromycin: 0.25 µg ml−1, spectinomycin: 150 µg ml−1, tetracycline: 2.5 µg ml−1 for S. pneumoniae; and ampicillin: 100 µg ml−1 for E. coli.

Table 2. List of strains and plasmids used in this study.

Strain/plasmid Description Source
S. pneumoniae
D39 Serotype 2 strain. cps 2 Laboratory of P. Hermans.
ΔccpA D39 ΔccpA; SpecR [13]
ΔcelR D39 ΔcelR; SpecR [8]
ΔbguDBC D39 ΔbguDBC; EryR This study
SS300 D39 ΔbguR; SpecR This study
SS301 D39 ΔbgaA::PbguA-lacZ; TetR This study
SS302 SS300 ΔbgaA:: PbguA-lacZ; TetR This study
SS303 ΔccpA ΔbgaA::PbguA-lacZ; TetR This study
SS304 ΔbguDBC ΔbgaA::PbguA-lacZ; TetR This study
SS305 D39 ΔbgaA::PbguA-5.3-lacZ; TetR This study
SS306 D39 ΔbgaA::PbguA-5.4-lacZ; TetR This study
SS307 D39 ΔbgaA::PbguA-5.5-lacZ; TetR This study
E. coli
EC1000 KmR; MC1000 derivative carrying a single copy of the pWV1 repA gene in glgB Laboratory collection
Plasmids
pPP2 AmpR TetR; promoter-less lacZ. For replacement of bgaA with promoter lacZ-fusion. Derivative of pTP1. [25]
pSS301 pPP2 PbguA-lacZ This study
pSS302 pPP2 PbguA-5.3-lacZ This study
pSS303 pPP2 PbguA-5.4-lacZ This study
pSS304 pPP2 PbguA-5.5-lacZ This study

Construction of Deletion Mutants of bguR and bguDBC

bguR and bguDBC deletion mutants were made by allelic replacement with a spectinomycin- and erythromycin-resistance gene, respectively, following the procedure as described before [24]. Briefly, primer pairs SPD1830-KO-1/SPD1830-KO-2, SPD1830-KO-3/SPD1830-KO-4, 1832-4-KO-1/1832-4-KO-2 and 1832-4-KO-3/1832-4-KO-4 were used to generate PCR fragments of the left- and right flanking regions of bguR and bguDBC, respectively. The spectinomycin-resistance marker was amplified by a PCR on pORI38 with primers Spec-F/Spec-R. The erythromycin-resistance marker was amplified by a PCR on pORI28 with primers Ery-F/Ery-R. Then, the left- and right flanking regions of bguR and bguDBC were fused to the spectinomycin- and erythromycin-resistance markers, respectively, by means of overlap-extension PCR. The resulting PCR products were transformed to S. pneumoniae D39 wild-type and selection of the mutant strains was done with the appropriate antibiotic. Spectinomycin- and erythromycin-resistant clones were further examined for the presence of the bguR and bguDBC deletion, respectively, by PCR.

Construction of lacZ-fusions and bguA Promoter Subclones in pPP2

The pPP2 [25] plasmid was used to construct a vector for an ectopic chromosomal transcriptional lacZ-fusion to the promoter of bguA in S. pneumoniae D39 using the primer pair mentioned in Table 1. The resulting plasmid pSS301 was introduced into D39 wild-type and the bguR mutant and integrated in the genome via double crossover in the bgaA gene, resulting in strains SS301 and SS302. The PbguA-lacZ was also introduced into the ΔccpA strain that was published before [13] and in the ΔbguDBC, resulting in strain SS303 and SS304, respectively.

The following promoter subclones of PbguA were made in pPP2 (primer pairs are mentioned in Table 1): PbguA-5.3 (truncated 15 bases upstream of the proposed BguR operator site), PbguA-5.4 (first 6 bases of the BguR operator site deleted) and PbguA-5.5 (half of the BguR operator site deleted, but keeping the -35 site intact). This resulted in plasmids pSS302-04. These constructs were introduced into D39 wild-type as described above, resulting in strains SS305-07. All plasmid constructs were checked by sequencing.

Enzyme Assays

Specific β-galactosidase assays were performed as described before [26]. Cells were grown in M17 in the presence of the appropriate carbon source (exact concentrations are mentioned in the Results section) and harvested in the mid-exponential phase of growth.

DNA Microarray Analyses

For transcriptome analyses of S. pneumoniae, the D39 wild-type strain was grown in 3 biological replicates in CM17 (0.5% Cellobiose+M17) and compared to the strain grown in GM17 (0.5% Glucose+M17) medium. Cells were harvested for RNA isolation at two time points in CM17 (CT-1 and CT2) and GM17 (GT-1 and GT-2) medium (see Fig. 1). To analyze the effect of bguR deletion on the transcriptome, S. pneumoniae D39 wild-type and its isogenic bguR mutant (SS300) were grown in 3 biological replicates in GM17 (0.5% Glucose+M17) medium. These cultures were harvested at the mid-exponential phase of growth at an OD600 of 0.25. All other procedures regarding the DNA microarray experiments (cell disruption, RNA isolation, RNA quality testing, cDNA synthesis, labeling with dyes (Cy3 and Cy5), hybridization and scanning) were performed as described before [27], [28].

Figure 1. Growth of S. pneumoniae D39 in the presence of 0.5% cellobiose (grey line ▪) and 0.5% glucose (black line ♦) in M17 medium.

Figure 1

Black circles show the time points at which cultures were harvested for transcriptome analysis. Where C = cellobiose, G = Glucose, T1 = time point 1 and T2 = Time point 2.

DNA Microarray Data Analysis

DNA microarray data were analyzed as described before [27][29]. For identification of differentially expressed genes a Bayesian p-value <0.001 and fold change cut-off of 3 was applied. Microarray data have been submitted to GEO under accession number GSE43345.

In silico Analyses

The NCBI web site (www.ncbi.nlm.nih.gov/BLAST/) was used for blasting genes among different genomes, while the Kyoto Encyclopedia of Genes and Genomes (www.genome.jp/kegg/) database was used to analyze different genomes of S. pneumoniae (D39, Tigr4, R6, GSSP14, G54-19F, ATCC700669, Hungary-19A, JJA, P1031, Taiwan-19F-14, TCH8431-19A, 630-6B, 70585 and AP200) for the presence of the cel gene cluster and bgu operon. The in-house developed software Genome 2D (http://server.molgenrug.nl/) was used to analyze the whole genome of S. pneumoniae D39 for the presence of BguR operator sites, allowing 4 mismatches.

Results

Growth and Transcriptome Analysis of S. pneumoniae in Medium with Cellobiose as the Sole Carbon Source

To study the growth behavior of S. pneumoniae D39 in cellobiose, growth experiments were performed in the complex M17 medium supplemented with 0.5% cellobiose, which was compared to the growth in M17+0.5% glucose. As expected, normal exponential growth of D39 was observed in the presence of glucose. However, on cellobiose cells grew in a diauxic growth pattern with two distinct growth phases. This is similar to the growth behavior of S. pneumoniae on β-glucosides like cellobiose as seen in a recent study [18]. As the first exponential growth phase is similar to the growth in M17 without added carbon source (Fig. 1), it is most likely that cellobiose is only metabolized in the second growth phase. Because of these two growth phases on cellobiose, we decided to perform a transcriptome comparison with the growth on glucose in both phases (T1 and T2, Fig. 1) and in this way identify cellobiose-responsive genes. Therefore, D39 wild-type was grown in CM17 (0.5% Cellobiose+M17) and in GM17 (0.5% Glucose+M17) and cells were harvested at two different time points (T1 and T2) as indicated in Fig. 1. Table 3 summarizes the number of genes that were affected in these transcriptome profiling experiments, grouped into COG (Clusters of Orthologous Groups) functional categories on the basis of the putative functions of the corresponding proteins (see table S1 for expression ratios of all genes that were significantly differentially expressed at time points T1 and T2). At T1 ∼10 times more genes were affected in the presence of cellobiose than at T2, comprising many genes of COG functional category J (translation, ribosomal structure and biogenesis). This probably reflects the fact that in the presence of cellobiose, cells have to adapt in the first phase and are therefore not growing optimally, whereas in the second phase the cellobiose is likely to be actively metabolized. At both time points (T1 and T2), most of the affected genes belong to COG functional category G (carbohydrate transport and metabolism). Almost all the affected genes belonging to category G (49 out of 51 at T1 and 16 out of 20 at T2) were upregulated in the presence of cellobiose. These effects may be either due to release of carbon catabolite repression [13] of these genes as an effect of the absence of glucose, or due to a direct inductive effect of cellobiose. Other COG functional categories with a high number of differentially expressed genes are S (function unknown) and R (general functions prediction only).

Table 3. Number of genes significantly* affected in the presence of cellobiose at time point T1 and T2.

Functional Categories T1 T2
Total Down Up Total Down Up
C: Energy production and conversion 7 1 6 1 0 1
D: Cell cycle control, cell division, chromosome partitioning 5 4 1 0 0 0
E: Amino acid transport and metabolism 18 16 2 0 0 0
F: Nucleotide transport and metabolism 14 12 2 0 0 0
G: Carbohydrate transport and metabolism 52 2 50 9 0 9
H: Coenzyme transport and metabolism 9 4 5 0 0 0
I: Lipid transport and metabolism 3 2 1 0 0 0
J: Translation, ribosomal structure and biogenesis 49 46 3 0 0 0
K: Transcription 12 7 5 1 0 1
L: Replication, recombination and repair 13 10 3 0 0 0
M: Cell wall/membrane/envelope biogenesis 15 9 6 0 0 0
O: Posttranslational modification, protein turnover, chaperones 6 4 2 3 0 3
P: Inorganic ion transport and metabolism 8 6 2 0 0 0
Q: Secondary metabolites biosynthesis, transport and catabolism 1 0 1 0 0 0
R: General function prediction only 27 13 14 2 0 2
S: Function unknown 51 22 29 10 2 8
T: Signal transduction mechanisms 3 1 2 0 0 0
U: Intracellular trafficking, secretion, and vesicular transport 2 1 1 0 0 0
V: Defense mechanisms 12 3 9 0 0 0
Total number of genes 307 163 144 26 2 24
*

Representing the genes with at least 3-fold increase or 3-fold decrease in expression levels in CM17 compared to GM17, and with a Bayesian p-value below 0.001 (Cyber-T test).

The effects of cellobiose on the transcriptome of S. pneumoniae D39 that were observed at both time points are summarized in Table 4. The expression of various genes and operons of diverse function was altered in the presence of cellobiose instead of glucose as the added carbon source, among which sugar metabolic genes. Notably, genes involved in cellobiose and maltose metabolism were highly upregulated. In addition, an ABC transporter cluster (msmEFG) that encodes a putative multiple sugar transport system was highly upregulated as well. Cellobiose metabolism has previously been shown to be carried out by a cellobiose-specific gene cluster (cel locus) in streptococci, including S. pneumoniae [7], [8], [21]. In a previous study, we showed that CelR is involved in the activation of the cel locus, specifically in the presence of cellobiose [8]. As expected, the cel locus was also among the highly upregulated genes at both time points. This suggests that the conditions applied for the transcriptome analyses are indeed appropriate to find cellobiose-responsive genes. The expression of an operon (SPD1830–1833, which will be denoted here tentatively as the bgu operon) encoding a glycosyl hydrolase protein and the PTS system IICBA components was also highly upregulated at both time points of growth. Interestingly, blast searches showed that this operon has high similarity with the cel locus that was previously identified to be involved in cellobiose metabolism [7], [8]. In addition, this operon was recently shown to play a role in the metabolism of the β-glucosides cellobiose and amygdalin [17]. Our transcriptome data support a role of this bgu operon in the metabolism/utilization of cellobiose or similar carbon sources. Therefore, we decided to further investigate the regulation of this operon in the presence of cellobiose.

Table 4. List of genes that are differentially expressed in the transcriptome comparison of S. pneumoniae D39 strain grown in CM17 and GM17 at time points T1 and T2.

D39 locus taga Function (TIGR Annotation)b Ratioc
T1 T2
SPD0265 Alcohol dehydrogenase, zinc-containing 26.0 2.1
SPD0277 6-Phospho-beta-glucosidase, CelA 71.9 88.4
SPD0278 Hypothetical protein 2.1 3.5
SPD0279 Cellobiose phosphotransferase system IIB component, CelB 13.9 23.4
SPD0280 DNA binding transcriptional regulator, CelR 10.3 10.5
SPD0281 Cellobiose phosphotransferase system IIA component, CelC 11.7 6.9
SPD0282 Hypothetical protein 12.8 4.3
SPD0283 Cellobiose phosphotransferase system IIC component, CelD 8.8 3.7
SPD0344 DNA-binding response regulator 3.5 2.8
SPD0466 BlpT protein fusion 4.3 4.0
SPD0473 Immunity protein BlpY 11.8 5.6
SPD0502 PTS system, beta-glucosides-specific IIABC components 10.1 1.3
SPD0503 6-phospho-beta-glucosidase 14.6 1.1
SPD0661 PTS system IIABC components 2.0 2.1
SPD0850 Lactoylglutathione lyase, GloA −20.6 2.5
SPD0851 Dihydroorotate dehydrogenase, PyrK −150.3 2.8
SPD0852 Dihydroorotate dehydrogenase 1B, PyrDb −65.8 2.3
SPD0886 Thioredoxin family protein 12.6 3.6
SPD1495 Sugar ABC transporter, sugar-binding protein 8.5 7.1
SPD1496 PTS system. IIBC components 2.7 2.7
SPD1590 General stress protein 24. putative 5.5 5.1
SPD1675 Sugar ABC transporter, MsmG 8.2 13
SPD1676 Sugar ABC transporter, MsmF 11.9 1.7
SPD1677 Sugar ABC transporter, MsmE 10.7 2.1
SPD1726 Pneumolysin, PlY −2.0 −2.0
SPD1727 Hypothetical protein −2.7 −2.5
SPD1728 Hypothetical protein −3.5 −3.6
SPD1729 Hypothetical protein −8.64 −3.4
SPD1830 Glycosyl hydrolase family 1, BguA 57.1 2.3
SPD1831 PTS system. IIC component, BguD 62.9 3.4
SPD1832 PTS system. IIB component, BguB 53.4 4.2
SPD1833 PTS system. IIA component, BguC 55.9 3.3
SPD1865 Alcohol dehydrogenase. Zinc-containing 12.6 2.5
SPD1866 N-Acetylglucosamine-6-phosphate deacetylase, NagA 4.2 2.5
SPD1933 Glycogen phosphorylase family protein 1.3 1.7
SPD1934 4-Alpha-glucanotransferase, MalQ 2.1 3.4
SPD1935 Maltose/maltodextrin ABC transporter, MalX 1.3 2.1
SPD1936 Maltodextrin ABC transporter, MalC 1.6 1.8
a

Gene numbers refer to D39 locus tags.

b

D39/TIGR4 annotation [10], [15], [47],

c

Ratio represents the fold increase in the expression of genes in CM17 as compared to GM17. In some cases neighbouring genes with lower than 3-fold ratios are also indicated.

Organization and Conservation of the bgu Operon in S. pneumoniae

The bgu locus spans the genes SPD1830-33 (Fig. 2). SPD1830 (here named bguA) encodes a glycosyl hydrolase belonging to the BglB family, which has high similarity (30% identity) to celA of S. pneumoniae and other streptococci. Next, the downstream three genes (SPD1831-33, named bguDBC), encode PTS system IICBA components that show high similarity (29–30% identity) with celDCB located in the cel locus of various streptococci, including S. pneumoniae. Upstream of bguA, a gene encoding a GntR family transcriptional factor (named bguR) is located. The presence of this transcription factor in the DNA region upstream of the bgu operon indicates that it may function as a transcriptional regulator of the bgu operon (see also below).

Figure 2. Organization of the bgu operon in S. pneumoniae D39.

Figure 2

Lollipop structure represents transcriptional terminator. Black arrows represent promoter regions. See text for further details.

In a previous study, we have studied the role of CelR in the regulation of the cel locus [8]. However, the cel locus was found to be absent from 50% of the S. pneumoniae strains present in the KEGG database. We also analyzed all the strains of S. pneumoniae available on the KEGG website for the presence of the bgu operon. Notably, this operon is 100% conserved in all the sequenced strains of S. pneumoniae available on KEGG database. This suggests an important role of this operon in carbohydrate metabolism, probably of cellobiose or related/analogous compounds [17]. In subsequent experiments, we focused in more detail on the molecular basis of the transcriptional regulation of the bgu operon.

Cellobiose-dependent Expression of the bgu Operon

To examine whether the observed altered expression of the bgu operon in the transcriptome analyses was due to a specific effect of cellobiose, we constructed an ectopic transcriptional lacZ-fusion to the bguA promoter in the D39 wild-type strain. This strain was grown in M17 medium supplemented with 0.5% of different carbon sources (Cellobiose, Fructose, Galactose, Glucose, Lactose, Mannose, Maltose, NAG, Raffinose, Sucrose and Trehalose). The highest expression of PbguA was observed in the presence of cellobiose (Table 5). The presence of glucose led to the lowest expression of PbguA. These results confirm the microarray data and additionally show that expression of PbguA is controlled specifically by cellobiose.

Table 5. Specific β-galactosidase activity (miller units) of D39 wild-type containing the PbguA-lacZ fusion grown in M17 medium with different added sugars (0.5% w/v).

Specific β-Galactosidase Activity (Miller Units) in M17 medium
Sugars PbguA-lacZ
No 124 (4)
Cellobiose 515 (6)
Fructose 121 (9)
Galactose 122 (7)
Glucose 105 (6)
Lactose 125 (9)
Mannose 129 (5)
Maltose 131 (6)
NAG 130 (8)
Rafinose 116 (7)
Sucrose 103 (5)
Trehalose 125 (4)

Standard deviation of 3 independent experiments is given in parentheses.

To further investigate the role of glucose in the regulation of PbguA, we grew the cells in the presence of a certain constant concentration of glucose, with an increasing concentration of cellobiose, as mentioned in Table 6. At 0.2% glucose, the lowest expression of PbguA was observed. This level of expression could not be increased by adding 0.5% cellobiose to the medium. Thus, cellobiose increases the expression of PbguA, whereas glucose decreases its expression, whereby the last compound appears to overrule the first when present at the same time.

Table 6. Specific β-galactosidase activity (miller units) of D39 wild-type containing the PbguA-lacZ fusion grown in M17 medium with different combinations of added sugars (% w/v).

Specific β-Galactosidase Activity (Miller Units) in M17 medium
Sugars PbguA-lacZ
No 115 (2)
0.1% C 205 (3)
0.2% C 340 (5)
0.3% C 380 (5)
0.5% C 490 (17)
1% C 650 (13)
0.1% G 109 (2)
0.2% G 107 (3)
0.3% G 103 (7)
0.5% G 105 (5)
1% G 101 (8)
0.1% G +0.1% C 112 (6)
0.1% G +0.2% C 122 (4)
0.1% G +0.5% C 140 (8)
0.2% G +0.1% C 109 (1)
0.2% G +0.2% C 108 (3)
0.2% G +0.5% C 112 (5)

Standard deviation of 3 independent experiments is given in parentheses. G, Glucose. C, Cellobiose.

SPD1829 (bguR) is a Repressor of the bgu Operon

Adjacent to the bgu operon, a putative GntR-family regulator is located (SPD1829), which we named BguR. We hypothesized that this regulator could be involved in the observed regulation of the bgu operon. To investigate the role of BguR, the bguR gene was replaced by a spectinomycin-resistance marker by means of allelic replacement. To examine the effect of the bguR deletion on the transcriptome of S. pneumoniae, the transcriptome of the bguR mutant strain (SS300) was compared to that of the D39 wild-type strain grown in GM17 (0.5% glucose+M17) medium. GM17 medium was used, since low expression of the bgu operon was observed in the presence of glucose, which we hypothesized to represent a condition with maximal repression of the bgu operon by BguR. These transcriptome data revealed that the expression of 13 genes was significantly altered due the deletion of bguR (Table 7). The expression of bguR was five-fold downregulated confirming the inactivation of the bguR gene in the bguR deletion strain (SS300). The most highly upregulated genes were the ones constituting the bgu operon (more than 20-fold), indicating a role/function of BguR as the repressor of the bgu operon. Another strong effect caused by deletion of bguR was the upregulation of an operon involved in maltose/maltodextrin metabolism [30]. These results show that inactivation of bguR brings about only a modest change in the transcriptome of S. pneumoniae D39, and furthermore imply a role of BguR in repressing the expression of the bgu operon.

Table 7. Summary of transcriptome comparison of S. pneumoniae strain D39 ΔbguR and D39 wild-type grown in GM17.

D39 locus taga Functionb Ratioc
SPD0311 Glucan 1,6-alpha-glucosidase, DexB 3.2
SPD0771 Lactose phosphotransferase system repressor, LacR 4.3
SPD0772 1-phosphofructokinase, putative 4.1
SPD0773 PTS system, fructose specific IIABC components 4.0
SPD1830 Glycosyl hydrolase, family 1, BguA 89.6
SPD1831 PTS system, IIC component, BguD 127.8
SPD1832 PTS system, IIB component, BguB 47.4
SPD1833 PTS system, IIA component, BguC 21.8
SPD1932 Glycogen phosphorylase family protein 10.0
SPD1933 4-alpha-glucanotransferase, MalQ 14.0
SPD1934 Maltose/maltodextrin ABC transporter, MalX 4.7
SPD1935 Maltodextrin ABC transporter, MalC 2.6
SPD1829 GntR family transcriptional regulator, BguR −5.2
a

Gene numbers refer to D39 locus tags.

b

D39 annotation/TIGR4 annotation [10], [15], [47],

c

Ratio represents the fold increase in the expression of genes in CM17 as compared to GM17.

Regulation of PbguA in ccpA, bguR and bguDBC Mutant Strains

To further confirm that BguR is responsible for the repression of the bgu operon that was upregulated in the bguR mutant strain (SS300), we introduced the PbguA-lacZ into D39 wild-type and the bguR mutant. In GM17 (0.5% Glucose+M17) medium specific β-galactosidase activity was highly increased in the bguR mutant as compared to D39 wild-type (Table 8). This not only confirms the data of the bguR mutant transcriptome but also shows that BguR carries out repression of the bgu operon via the PbguA.

Table 8. Specific β-Galactosidase activity (miller units) of D39 wild-type, ΔbguR, ΔccpA, and ΔbguDBC mutants all containing the PbguA-lacZ transcriptional fusion grown in M17 medium supplemented with added concentrations (0.5% w/v) of cellobiose (C) and glucose (G).

Specific β-Galactosidase Activity (Miller Units)
WT ΔbguR ΔccpA ΔbguDBC
P bguA (GM17) 115 (5) 1660 (17) 111 (8) 116 (9)
P bguA (CM17) 610 (10) 1690 (15) 580 (12) 599 (17)

Standard deviation of three independent measurements is given in parentheses.

CcpA is considered a master transcriptional regulator in the control of carbohydrate utilization and metabolism genes in Gram-positive bacteria including S. pneumoniae [13], [31], [32]. To investigate a possible role of CcpA in the regulation of the bgu operon, we measured specific β-galactosidase activity of PbguA-lacZ in a ccpA mutant strain. No difference in expression of PbguA was observed in the ccpA mutant as compared to the wild-type strain when cells were grown in M17 with either cellobiose or glucose (Table 8). In addition, no CcpA binding site (cre) was found in the PbguA promoter [13]. Thus, these data show that regulation of the bgu operon in S. pneumoniae is independent of CcpA.

In S. mutans, regulation of the cel locus by CelR requires the phosphorylation of CelR by one of the PTS components, namely CelD [21]. Therefore, to investigate a possible role of the BguDBC proteins in the regulation of the bgu operon via an effect on BguR activity, we measured specific β-galactosidase activity of PbguA-lacZ in a bguDBC mutant strain. No difference in expression of PbguA was observed in the bguDBC mutant as compared to the wild-type D39 strain, when cells were grown in M17 medium with cellobiose or glucose (Table 8). This suggests that the components of the Bgu PTS system are not required for activation of BguR in the presence of cellobiose. However, we cannot exclude that other PTS systems or signaling cascades confer a regulatory effect on BguR.

Identification of the BguR Operator Site

The data presented above strongly suggest a direct effect of BguR on PbguA. To identify a possible BguR operator sequence, a 5′ promoter truncation study was performed with the bguA promoter. A diagram of the bguA promoter truncation is shown in Fig. 3. Truncation of PbguA near to the predicted -35 core promoter sequence (PbguA-5.4) relieved the repressive action of BguR on PbguA, suggesting the presence of a putative BguR operator in this deleted region of the promoter. Further bioinformatics analysis of this area revealed the presence of a 20-bp palindromic region (5′-AAAAATGTCTAGACAAATTT-3′) that is overlapping with the -35 site and that might act as the BguR operator site. Deletion of half of this predicted operator site (PbguA-5.5) led to high expression of PbguA in CM17 (0.5% Cellobiose+M17) and GM17 (0.5% Glucose+M17) medium in the wild-type (Fig. 3). However, when the PbguA was truncated only a few base pairs upstream of the predicted operator site (PbguA-5.3), expression was similar to that of the full-length promoter (Fig. 3). Therefore, these data suggest that the predicted operator site is functional and acts as the BguR operator site.

Figure 3. Analysis of truncations of PbguA.

Figure 3

A schematic overview of the bguA promoter truncations is shown. The table on the right gives the specific β-galactosidase activity of the truncated promoters in GM17 (0.5% glucose+M17) and CM17 (0.5% cellobiose+M17). Standard deviation is given in parentheses. The oval indicates the position of the putative BguR operator site, while the sequence of the BguR operator site is given above.

The entire genome of S. pneumoniae D39 was searched for the presence of the BguR operator site by using Genome2D. Also, the promoters of the putative fructose and maltose utilization gene clusters were analyzed manually for the presence of the BguR operator site. However, we could not find a sequence that resembles it, suggesting that the bgu operon is the only direct target of BguR.

The cel Locus is Required for D39 to Grow on Cellobiose, While the bgu Operon is Not

As in a previous study it had been shown that deletion of celR or celD from the cel locus leads to growth inhibition in CDM with cellobiose as the carbon source [7], and since the bgu locus was implicated in the uptake of cellobiose and amygdalin [17], we decided to mutate bguDBC and compare the growth of ΔbguDBC, ΔcelR (which has no expression of the cel locus) [7], [8], and ΔcelR-bguDBC in the presence of 0.5% cellobiose and 0.5% glucose with that of D39 wild-type (Fig. 4). In the presence of glucose, all strains grew similar as the wild-type. However, clear growth differences were observed in the presence of cellobiose. As mentioned before, D39 wild-type grows with two distinct exponential phases in the presence of cellobiose. A similar growth pattern was observed for the ΔbguDBC mutant strain, but the ΔcelR and ΔcelR-bguDBC mutant strains were not able to start the second exponential phase. These data suggest that the cel locus is important for S. pneumoniae D39 to grow on cellobiose, while under these conditions the bgu operon, although its expression is responsive to cellobiose, is not.

Figure 4. Growth of S. pneumoniae D39 wild-type (♦) and its isogenic mutants celR (▪), bguDBC (▴) and celR-bguDBC (X) in M17 (A), 0.5% glucose+M17 (B) and 0.5% cellobiose+M17 (C).

Figure 4

Discussion

In many bacteria, including S. pneumoniae, glucose is considered one of the primary sources of energy for metabolic processes. However, the existence of numerous other sugar-specific systems in S. pneumoniae implies its ability to utilize various other carbon sources in the absence of glucose [10], [15][17]. The role of different systems dedicated to the uptake and metabolism of different sugars including cellobiose, maltose, galactose, sucrose and raffinose has been explicitly investigated for S. pneumoniae [7], [8], [11], [13], [16], [17], [30], [33][36]. In a previous study, we described the role of the cellobiose-dependent transcriptional activator (CelR) in the regulation of the cellobiose utilization gene cluster (cel locus) [8]. Intriguingly, the cel locus is not conserved in all the sequenced strains of S. pneumoniae that are available on the KEGG website. This might indicate that S. pneumoniae harbors other ways of cellobiose utilization. To be able to more thoroughly understand the effect of cellobiose on S. pneumoniae, we applied transcriptome profiling and various ways to study transcriptional gene regulation. The data show that, besides the cel locus, expression of a second operon (bgu) is responsive to cellobiose as well, which we show to be mediated by the transcriptional regulator BguR. The fact that the bgu operon is 100% conserved in different pneumococcal strains suggests that it has an important physiological function in the life style of S. pneumoniae. Indeed, like celR, bguD was also found in one of the STM (Signature-tagged mutagenesis) studies, where it was implicated in lung infection [37].

The phosphoenolpyruvate-dependent (PEP) phosphotransferase system (PTS) is a major carbohydrate uptake system in bacteria, which not only phosphorylates different carbohydrates during uptake but also plays a major role in genetic regulation of metabolic activities [38][40]. In S. mutans, it has been shown that CelR has two PRD (PTS regulation domain) domains and phosphorylation (by glucose and cellobiose PTSs) at H226, H332 and H576 is required for the activation of CelR in the presence of cellobiose, while phosphorylation of H284 and H391 leads to inhibition of the CelR-dependent activation in the presence of glucose [21]. A similar role of these histidine residues as well as a phosphorylatable cysteine residue located in the EIIB domain of CelR is also elaborated on in S. pneumoniae [18]. The phosphorylatable cysteine was shown to affect the length of the lag phase during the shift from growth on glucose to that on cellobiose and other β-glucosides. In addition, PTS SPD0502, which might transport β-glucosides as well [18], was found to be responsible for the extended lag phase, whereas the Bgu PTS that we describe here did not. Interestingly, the gene encoding the SPD0502 PTS was found to be upregulated during growth on cellobiose at T1 in our microarray experiment described in this study (Table 4 and S1). Thus, complex regulatory interactions around CelR take place.

In the BguR amino acid sequence no similar regulatory domains could be identified. In agreement with this, we could not find an effect of deletion of the bgu PTS genes on the cellobiose- and glucose-dependent regulation of PbguA via BguR. Therefore, it remains to be determined how the signal of the carbohydrate source is transferred to BguR. In addition, no effect of CcpA on the regulation of the bgu operon could be detected, in accordance with previous studies [13]. Thus, expression of the bgu locus seems to be governed by a single transcriptional regulator, BguR, possible via direct binding of glucose and cellobiose to its C-terminal UTRA (UbiC transcription regulator-associated) domain and the regulation of the bgu locus is independent of the Cel system.

As reported in our previous study, the cel locus and the CelR regulatory site of S. pneumoniae were found to be highly conserved in other streptococci, although not all pneumococcal strains contain this operon [7]. Blast searches revealed a high conservation of the bgu operon in all the strains of S. pneumoniae that are available on the KEGG website. However, no similar bgu operon organization could be found in other streptococcal species using BLAST searches. Thus, the bgu operon seems to be specific for S. pneumoniae.

Blast searches with BguR revealed high similarity of this protein with the previously characterized GntR-type transcriptional regulator GmuR in Bacillus subtilis [41], BgcR in Escherichia coli [42] and DasR in Streptomyces coelicolor [43]. Moreover, the BguR operator site that we proposed in this study is also similar to the predicted GmuR (5′-tAAATGTaTAGACAttTa-3′) operator site in the order of bacillales [44]. GmuR was found to be involved in the regulation of the gmuBACDREFG operon, encoding glucomannan utilization genes [41]. Expression of this operon was induced by cellobiose and mannobiose, which are possible degradation products of the action of GmuG on glucomannan, and repressed by glucose [41]. Interestingly, GmuBAC has 31–46% identity with BguDBC while GmuR has 46% identity with BguR. Although we did not observe an effect of deletion of the bgu operon on growth on cellobiose, it could be involved in the utilization of other glucomannan degradation products such as 4-O-β-D-mannopyranosyl-D-mannopyranose (β-1,4-D-mannobiose), and 4-O-β-D-glucopyranosyl-D-mannopyranose. Intestinal anaerobic bacteria encounter glucomannan and are able to degrade and ferment it [45]. Therefore, it is possible that the degradation products of glucomannan are present in the environment of S. pneumoniae as well, by uptake from the intestine.

BgcR is a positive transcriptional regulator of a bgc operon which consists of 5 genes including genes encoding PTS subunits IIB (BgcE), IIA (BgcF), IIC (BgcI) and phospho-β-glucosidase (BgcA), and is found to be involved in the utilization of cellobiose and other β-glucosides (arbutin and salicin) at low temperature in E. coli [42]. However, salicin was not found to be fermented by the Bgu system and arbutin was shown to be taken up by the Cel system in S. pneumoniae [7], [17]. Given the high similarity of the Bgc proteins with the proteins encoded in the bgu operon, we cannot exclude a role of the bgu operon in the utilization of arbutin or analogous sugars that S. pneumoniae encounters in its natural environment.

Deletion of the genes encoding the PTS components (bguDBC) of the bgu operon has no effect on growth compared to the wild-type in the presence of cellobiose as the sole carbon source, whereas deletion of celR (impairing expression of the cel locus) does. Recent studies in S. pneumoniae R6 have shown that deletion of bguD did lead to an increased lag-phase on cellobiose and a slight effect on growth on amygdalin [17], [18]. However, deletion of celD led to strong inhibition of growth of S. pneumoniae R6 on amygdalin, cellobiose, esculin and gentiobiose [17]. Thus, the cel locus is primarily responsible for β-glucoside utilization in S. pneumoniae and the exact role of the bgu operon in the uptake and metabolism of β-glucosides remains to be determined.

Interestingly, the BguR operator site could only be found in the promoter region of the bguA gene. This suggests that the bgu operon is the only direct target of BguR. However, deletion of bguR also led to upregulation of maltose- and fructose utilization gene clusters. The mal gene cluster is regulated by malR, a maltose-dependent transcriptional repressor [30], [46]. Therefore, the upregulation of the mal gene cluster might be an indirect effect of the high upregulation of the bgu operon. However, the regulatory mechanism of the putative fructose utilization gene cluster in S. pneumoniae has not yet been explored. It could well be that the LacR type regulator encoded in this gene cluster directly regulates it.

Supporting Information

Table S1

Overview of all significantly up- or downregulated in the presence of cellobiose, compared to growth in the presence of glucose, at time point T1 and T2.

(XLSX)

Acknowledgments

We are thankful to Anja Ridder for editing this manuscript.

Funding Statement

SS is supported by the HEC-NUFFIC overseas scholarship program by HEC (Higher Education commission) Pakistan and TGK was supported by the EU-funded Pneumopath project HEALTH-F3-2009-222983. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Bogaert D, de GR, Hermans PW (2004) Streptococcus pneumoniae colonisation: The key to pneumococcal disease. Lancet Infect Dis 4: 144–154. [DOI] [PubMed] [Google Scholar]
  • 2. Kadioglu A, Weiser JN, Paton JC, Andrew PW (2008) The role of streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol 6: 288–301. [DOI] [PubMed] [Google Scholar]
  • 3. Obaro S, Adegbola R (2002) The pneumococcus: Carriage, disease and conjugate vaccines. Journal of Medical Microbiology 51: 98–104. [DOI] [PubMed] [Google Scholar]
  • 4. McGeer A, Low DE (2003) Is resistance futile? Nature Medicine 9: 390–392. [DOI] [PubMed] [Google Scholar]
  • 5. Brown SA, Palmer KL, Whiteley M (2008) Revisiting the host as a growth medium. Nat Rev Microbiol 6: 657–666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mitchell TJ (2003) The pathogenesis of streptococcal infections: From tooth decay to meningitis. Nat Rev Microbiol 1: 219–230. [DOI] [PubMed] [Google Scholar]
  • 7. McKessar SJ, Hakenbeck R (2007) The two-component regulatory system TCS08 is involved in cellobiose metabolism of streptococcus pneumoniae R6. Journal of Bacteriology 189: 1342–1350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Shafeeq S, Kloosterman TG, Kuipers OP (2011) CelR-mediated activation of the cellobiose-utilization gene cluster in streptococcus pneumoniae. Microbiology (Reading, England) 157: 2854–2861. [DOI] [PubMed] [Google Scholar]
  • 9. McAllister LJ, Ogunniyi AD, Stroeher UH, Paton JC (2012) Contribution of a genomic accessory region encoding a putative cellobiose phosphotransferase system to virulence of streptococcus pneumoniae PloS One. 7: e32385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lanie JA, Ng WL, Kazmierczak KM, Andrzejewski TM, Davidsen TM, et al. (2007) Genome sequence of avery's virulent serotype 2 strain D39 of streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. Journal of Bacteriology 189: 38–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Giammarinaro P, Paton JC (2002) Role of RegM, a homologue of the catabolite repressor protein CcpA, in the virulence of streptococcus pneumoniae. Infection and Immunity 70: 5454–5461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Rosenow C, Maniar M, Trias J (1999) Regulation of the alpha-galactosidase activity in streptococcus pneumoniae: Characterization of the raffinose utilization system. Genome Research 9: 1189–1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Carvalho SM, Kloosterman TG, Kuipers OP, Neves AR (2011) CcpA ensures optimal metabolic fitness of streptococcus pneumoniae D39. Submitted 6: e26707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Iyer R, Camilli A (2007) Sucrose metabolism contributes to in vivo fitness of streptococcus pneumoniae. Molecular Microbiology 66: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Hoskins J, Alborn WE, Jr., Arnold J, Blaszczak LC, Burgett S, et al. (2001) Genome of the bacterium streptococcus pneumoniae strain R6. Journal of Bacteriology 183: 5709–5717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Buckwalter CM, King SJ (2012) Pneumococcal carbohydrate transport: Food for thought Trends in Microbiology. [DOI] [PMC free article] [PubMed]
  • 17. Bidossi A, Mulas L, Decorosi F, Colomba L, Ricci S, et al. (2012) A functional genomics approach to establish the complement of carbohydrate transporters in streptococcus pneumoniae. PLoS One 7: e33320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Boianelli A, Bidossi A, Gualdi L, Mulas L, Mocenni C, et al. (2012) A non-linear deterministic model for regulation of diauxic lag on cellobiose by the pneumococcal multidomain transcriptional regulator CelR PloS One. 7: e47393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kilic AO, Tao L, Zhang Y, Lei Y, Khammanivong A, et al. (2004) Involvement of streptococcus gordonii beta-glucoside metabolism systems in adhesion, biofilm formation, and in vivo gene expression. Journal of Bacteriology 186: 4246–4253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. King SJ (2010) Pneumococcal modification of host sugars: A major contributor to colonization of the human airway? Mol Oral Microbiol 25: 15–24. [DOI] [PubMed] [Google Scholar]
  • 21. Zeng L, Burne RA (2009) Transcriptional regulation of the cellobiose operon of streptococcus mutans. Journal of Bacteriology 191: 2153–2162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Terzaghi BE, Sandine WE (1975) Improved medium for lactic streptococci and their bacteriophages. Applied and Environmental Microbiology 29: 807–813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Kloosterman TG, Bijlsma JJE, Kok J, Kuipers OP (2006) To have neighbour's fare: Extending the molecular toolbox for streptococcus pneumoniae. Microbiology (Reading, England) 152: 351–359. [DOI] [PubMed] [Google Scholar]
  • 24. Shafeeq S, Kloosterman TG, Kuipers OP (2011) Transcriptional response of streptococcus pneumoniae to zn(2+) limitation and the repressor/activator function of AdcR. Metallomics 3: 609–618. [DOI] [PubMed] [Google Scholar]
  • 25. Halfmann A, Hakenbeck R, Bruckner R (2007) A new integrative reporter plasmid for streptococcus pneumoniae. FEMS Microbiology Letters 268: 217–224. [DOI] [PubMed] [Google Scholar]
  • 26. Israelsen H, Madsen SM, Vrang A, Hansen EB, Johansen E (1995) Cloning and partial characterization of regulated promoters from lactococcus lactis Tn917-lacZ integrants with the new promoter probe vector, pAK80. Applied and Environmental Microbiology 61: 2540–2547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Shafeeq S, Yesilkaya H, Kloosterman TG, Narayanan G, Wandel M, et al. (2011) The cop operon is required for copper homeostasis and contributes to virulence in streptococcus pneumoniae. Molecular Microbiology 81: 1255–1270. [DOI] [PubMed] [Google Scholar]
  • 28. Kloosterman TG, Hendriksen WT, Bijlsma JJ, Bootsma HJ, van Hijum SA, et al. (2006) Regulation of glutamine and glutamate metabolism by GlnR and GlnA in streptococcus pneumoniae. Journal of Biological Chemistry 281: 25097–25109. [DOI] [PubMed] [Google Scholar]
  • 29. van Hijum SAFT, Garcia de la Nava J, Trelles O, Kok J, Kuipers OP (2003) MicroPreP: A cDNA microarray data pre-processing framework. Appl Bioinformatics 2: 241–244. [PubMed] [Google Scholar]
  • 30. Nieto C, Espinosa M, Puyet A (1997) The maltose/maltodextrin regulon of streptococcus pneumoniae. differential promoter regulation by the transcriptional repressor MalR. Journal of Biological Chemistry 272: 30860–30865. [DOI] [PubMed] [Google Scholar]
  • 31. Lulko AT, Buist G, Kok J, Kuipers OP (2007) Transcriptome analysis of temporal regulation of carbon metabolism by CcpA in bacillus subtilis reveals additional target genes. Journal of Molecular Microbiology and Biotechnology 12: 82–95. [DOI] [PubMed] [Google Scholar]
  • 32. Zomer AL, Buist G, Larsen R, Kok J, Kuipers OP (2007) Time-resolved determination of the CcpA regulon of lactococcus lactis subsp. cremoris MG1363. Journal of Bacteriology 189: 1366–1381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Marion C, Aten AE, Woodiga SA, King SJ (2011) Identification of an ATPase, MsmK, which energizes multiple carbohydrate ABC transporters in streptococcus pneumoniae. Infection and Immunity 79: 4193–4200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Tyx RE, Roche-Hakansson H, Hakansson AP (2011) Role of dihydrolipoamide dehydrogenase in regulation of raffinose transport in streptococcus pneumoniae. Journal of Bacteriology 193: 3512–3524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Marion C, Burnaugh AM, Woodiga SA, King SJ (2011) Sialic acid transport contributes to pneumococcal colonization. Infection and Immunity 79: 1262–1269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shafeeq S, Kloosterman TG, Rajendran V, Kuipers OP (2012) Characterization of the ROK-family transcriptional regulator RokA of streptococcus pneumoniae D39 Microbiology (Reading, England) 158 (Pt 12), 2917–2926. [DOI] [PubMed]
  • 37. Hava DL, Camilli A (2002) Large-scale identification of serotype 4 streptococcus pneumoniae virulence factors. Molecular Microbiology 45: 1389–1406. [PMC free article] [PubMed] [Google Scholar]
  • 38. Deutscher J, Francke C, Postma PW (2006) How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiology and Molecular Biology Reviews : MMBR 70: 939–1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Postma PW, Lengeler JW, Jacobson GR (1993) Phosphoenolpyruvate:Carbohydrate phosphotransferase systems of bacteria. Microbiological Reviews 57: 543–594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Lengeler JW, Jahreis K (2009) Bacterial PEP-dependent carbohydrate: Phosphotransferase systems couple sensing and global control mechanisms Contributions to Microbiology. 16: 65–87. [DOI] [PubMed] [Google Scholar]
  • 41. Sadaie Y, Nakadate H, Fukui R, Yee LM, Asai K (2008) Glucomannan utilization operon of bacillus subtilis FEMS Microbiology Letters. 279: 103–109. [DOI] [PubMed] [Google Scholar]
  • 42. Neelakanta G, Sankar TS, Schnetz K (2009) Characterization of a beta-glucoside operon (bgc) prevalent in septicemic and uropathogenic escherichia coli strains. Applied and Environmental Microbiology 75: 2284–2293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Rigali S, Nothaft H, Noens EE, Schlicht M, Colson S, et al. (2006) The sugar phosphotransferase system of streptomyces coelicolor is regulated by the GntR-family regulator DasR and links N-acetylglucosamine metabolism to the control of development Molecular Microbiology. 61: 1237–1251. [DOI] [PubMed] [Google Scholar]
  • 44. Novichkov PS, Laikova ON, Novichkova ES, Gelfand MS, Arkin AP, et al. (2010) RegPrecise: A database of curated genomic inferences of transcriptional regulatory interactions in prokaryotes Nucleic Acids Research. 38: D111–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Matsuura Y (1998) Degradation of konjac glucomannan by enzymes in human feces and formation of short-chain fatty acids by intestinal anaerobic bacteria Journal of Nutritional Science and Vitaminology. 44: 423–436. [DOI] [PubMed] [Google Scholar]
  • 46. Nieto C, Puyet A, Espinosa M (2001) MalR-mediated regulation of the streptococcus pneumoniae malMP operon at promoter PM. influence of a proximal divergent promoter region and competition between MalR and RNA polymerase proteins. Journal of Biological Chemistry 276: 14946–14954. [DOI] [PubMed] [Google Scholar]
  • 47. Tettelin H, Nelson KE, Paulsen IT, Eisen JA, Read TD, et al. (2001) Complete genome sequence of a virulent isolate of streptococcus pneumoniae. Science 293: 498–506. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

Overview of all significantly up- or downregulated in the presence of cellobiose, compared to growth in the presence of glucose, at time point T1 and T2.

(XLSX)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES