Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2013 Mar;57(3):1542–1545. doi: 10.1128/AAC.02332-12

Complete Sequence of a blaKPC-2-Harboring IncFIIK1 Plasmid from a Klebsiella pneumoniae Sequence Type 258 Strain

Liang Chen a, Kalyan D Chavda a, Roberto G Melano b,c,d, Michael R Jacobs e, Michael H Levi f, Robert A Bonomo g,h, Barry N Kreiswirth a,✉
PMCID: PMC3591897  PMID: 23295924

Abstract

We report the nucleotide sequence of a novel blaKPC-2-harboring IncFIIK1 plasmid, pBK32179, isolated from a carbapenem-resistant Klebsiella pneumoniae ST258 strain from a New York City patient. pBK32179 is 165 kb long, consists of a large backbone of pKPN3-like plasmid, and carries an 18.5-kb blaKPC-2-containing element that is highly similar to plasmid pKpQIL. pBK32179-like plasmids were identified in 8.3% of strains in a collection of 96 K. pneumoniae isolates from hospitals in the New York City area.

TEXT

Carbapenem-resistant Enterobacteriaceae, especially Klebsiella pneumoniae, are associated with increased mortality and morbidity (1), posing a significant threat for both community and hospitalized patients. Currently, K. pneumoniae carbapenemase (KPC) is the most prevalent carbapenemase in the United States (2). A single KPC-producing K. pneumoniae clone, sequence type 258 (ST258), which initially emerged in the United States (3), has now successfully spread to a number of different geographic regions (2). Controlling the dissemination of carbapenem resistance is problematic, as the KPC-encoding gene, blaKPC, is located on Tn4401 or Tn4401-like transposons and carried on variable transferable plasmids, thereby facilitating the inter- and intraspecies dissemination of resistance (4–6).

Different incompatibility (Inc) replicon groups of blaKPC-harboring plasmids have been reported, including IncFII, IncL/M, IncN, IncR, IncX, and ColE1 groups (5, 7–11). Among them, IncFII plasmids have been widely distributed in various species of Enterobacteriaceae, and they harbor a number of resistance determinants, including extended-spectrum β-lactamases (ESBLs) (e.g., blaCTX-M-15) and plasmid-mediated AmpCs (blaCMY and blaDHA), as well as quinolone and aminoglycoside resistance genes (12, 13). Several IncFII KPC-encoding plasmids have been completely sequenced and characterized (12, 14–17). The first K. pneumoniae ST258-associated plasmid, pKpQIL, a 113-kb plasmid belonging to the IncFIIK2 group by replicon sequence typing (RST) (12), has spread in the United States, Israel, Poland, and Italy (14, 18–21). Other IncFII plasmids, including pKP48 (151 kb, IncFIIK5) (15) and pKPHS2 (111 kb, IncFIIK2) (16), have been described in strains from China, where the blaKPC gene was carried on a distinct Tn4401-like element (6) and mainly associated with K. pneumoniae ST11 strains (single-locus variant of ST258). Another 21,138-bp IncFIIK2 plasmid, p39SLMT (GenBank accession no. HQ589350), was also deposited in GenBank (www.ncbi.nlm.nih.gov). Recently, an IncFIIK1 plasmid, pKPN101-IT (108 kb), was described from one K. pneumoniae ST101 strain in Italy (17). The frequent identification of KPC-encoding IncFII plasmids suggests that IncFII plasmids may be the primary vehicle for the dissemination of KPC. Here, we report a novel 165-kb blaKPC-2-harboring IncFIIK1 plasmid isolated from a strain of the epidemic K. pneumoniae clone ST258.

As part of a regional surveillance program established in 2010, we determined the genetic characteristics of a K. pneumoniae isolate, BK32179, that was recovered from a urine culture in a patient with a urinary tract infection (UTI) in a New York City hospital. Multilocus sequence typing (MLST) confirmed that the isolate belonged to the epidemic K. pneumoniae ST258 clone (22). PCR amplification of β-lactamase genes and sequencing of the amplicons demonstrated the presence of blaKPC-2, blaTEM-1, and blaSHV-11 (23–25). Plasmid DNA was extracted from strain BK32179 using a Qiagen plasmid maxi kit (Qiagen, Valencia, CA), followed by electroporation into Escherichia coli DH10B using a Gene Pulser II instrument (Bio-Rad Laboratories). Transformants were selected on Luria-Bertani (LB) agar plates containing 100 μg/ml ampicillin and then screened by multiplex real-time PCR for the presence of the blaKPC gene (23). blaKPC PCR-positive transformants were examined by S1-pulsed-field gel electrophoresis (S1-PFGE) analysis, and a transformant with a single plasmid was selected and subjected to susceptibility testing. MICs were determined by broth microdilution in cation-adjusted Mueller-Hinton broth (MHB) using Sensititre GNX2F panels (Thermo Fisher Scientific, Waltham, MA) according to Clinical and Laboratory Standards Institute methods and interpretations (26, 27).

K. pneumoniae BK32179 exhibited resistance to imipenem (MIC, 8 μg/ml), ertapenem (MIC, >4 μg/ml), meropenem (MIC, >8 μg/ml), doripenem (MIC, >2 μg/ml), cefotaxime (MIC, 32 μg/ml), ceftazidime (MIC, >16 μg/ml), and aztreonam (MIC, >16 μg/ml) but was susceptible to aminoglycosides (amikacin and gentamicin), tetracyclines (doxycycline and minocycline), and fluoroquinolones (ciprofloxacin and levofloxacin), as well as colistin (MIC, 0.5 μg/ml) and polymyxin B (MIC, 0.5 μg/ml). The E. coli DH10B transformant showed an antimicrobial resistance profile similar to that of the parental strain but had lower MICs against imipenem (MIC, 2 μg/ml), ertapenem (MIC, 1 μg/ml), meropenem (MIC, 2 μg/ml), and doripenem (MIC, 1 μg/ml).

Plasmid replicon typing (28) and replicon sequence typing (RST) (12) of the E. coli DH10B transformant indicated that the blaKPC-2 gene was carried by an IncFIIK1 plasmid of approximately 165 kb (estimated by S1-PFGE), which is distinct from previously sequenced KPC-bearing IncFII plasmids. This plasmid was therefore selected for complete plasmid genome sequencing. The blaKPC-2-harboring plasmid was extracted from an E. coli DH10B transformant, and the plasmid genome was sequenced by the Roche 454 GS-FLX platform. Sequencing reads were assembled into consensus de novo assembly contigs using the Roche Genome Sequencer FLX software GS Assembler. Sequence gaps on the plasmid were closed by PCR and standard Sanger sequencing; putative open reading frames (ORFs) were predicted and annotated using the RAST (rast.nmpdr.org) server (29).

Plasmid pBK32179 was determined to be 165,295 bp in size, with an average GC content of 52.7%, and harbored 165 predicted ORFs (Fig. 1). The overall structure of pBK32179 is highly similar (87% query coverage and 100% maximum nucleotide identity by Blast) to that of the plasmid pKPN3 (GenBank accession no. CP000648), harbored by the multidrug-resistant K. pneumoniae strain MGH 78578 (ATCC 700721) which was isolated from Massachusetts in 1994 (genome.wustl.edu/genomes/view/klebsiella_pneumoniae/). The region in common between pBK32179 and pKPN3 exhibited >99.5% nucleotide similarity and contained genes responsible for plasmid replication, maintenance, transmission, and metal (arsenic, copper, and silver) resistance (Fig. 1).

Fig 1.

Fig 1

Comparative analysis of IncFIIK plasmids pKPN3 (CP000648), pKPN4 (CP000649), pKpQIL (GU595196), and pBK32179 (JX430448). Light blue shading denotes shared regions of homology (>99.5% nucleotide similarity). Open reading frames (ORFs) are indicated by arrows and colored based on predicted gene function. Orange arrows indicate plasmid scaffold regions. The genes associated with the tra locus are indicated by green arrows, and replication-associated genes are denoted as dark blue arrows. Antimicrobial resistance genes are indicated by red arrows, while copper, mercury, and silver resistance genes are shown by light blue arrows. Other genes in the accessory region are indicated by yellow arrows. Small black arrowheads beneath the plasmids indicate the locations of primers used for PCR screening of pBK32179-like plasmids. Primer sequences used for PCRs were as follows: 1, repA-F (CTTCACGTCCCGTTTTGATT), 2, repA-R (CGCTTCAGCGCTTCTTTATC) (657 bp); 3, hel-F (ATGGTGGGGGAAAAATTCAT), 4, 4401-R (GTCACGTCAAGCGAGGAGTC) (1,996 bp); 5, repA2-F (ACGTTAAGATCACCGGTTCG), and 6, repA2-R (TAGGCTGACTGCACCAGATG) (271 bp). pBK32179-like plasmids are positive by targets of primer sets 1/2, 3/4, and 5/6, while pKpQIL-, pKPN4-, and pKPN3-like plasmids are positive only by PCRs of primer sets 1/2 and/or 5/6 but not set 3/4.

An 18,545-bp region of pBK32179 (from nucleotide 3,686 to 22,230), encompassing the blaKPC-2-bearing Tn4401a, which is not found in pKPN3, showed >99.99% identity with the plasmid pKpQIL harbored by an ST258 K. pneumoniae strain isolated in Israel (30). The only difference between the two plasmids is that pBK32179 harbors blaKPC-2 and pKpQIL harbors blaKPC-3. Together, these findings suggest that plasmid pBK32179 may have been created by a Tn4401-carrying element from a pKpQIL-like plasmid displacing the region between ATP-dependent helicase gene hel and IS26 on a pKPN3-like plasmid (Fig. 1). The helicase gene hel, located downstream of IncFIIK1 repA, was truncated from the 5′ end as a result of the Tn4401-carrying element displacement, lending further credence to the idea that pBK32179 acquired this element from a pKpQIL-like plasmid. Notably, pKpQIL has the same scaffold as pKPN4 (30) (Fig. 1), a second plasmid harbored by K. pneumoniae strain MGH 78578, demonstrating that both pKpQIL- and pBK32179-like plasmids (pKPN4 and pKPN3 backbone plasmids) can coexist within the same isolate even though they are from the same incompatibility group. Similarly, a recent study from Italy reported the coexistence of plasmid pKpQIL-IT (pKpQIL-like) and pKPN-IT (pKPN3- and pBK32179-like) in the same K. pneumoniae ST258 isolate (14). This finding supports our observation that one IncFIIK plasmid may acquire a blaKPC-carrying Tn4401 element through horizontal transfer from another IncFIIK plasmid with a different backbone in the same strain.

To determine the prevalence of the pBK32179-like plasmids among KPC-positive K. pneumoniae isolates in our surveillance study, we developed three PCR screening strategies targeting the aforementioned hel gene and Tn4401 junction, IncFIIK repA, and the second IncFIB-like repA2 (Fig. 1). The analysis revealed that plasmids like pKpQIL, pKPN3, and pKPN4 are positive for one or two targets (IncFIIK repA and/or repA2), while pBK32179-like plasmids are positive for all three targets (Fig. 1).

Using this approach, we tested 96 K. pneumoniae clinical isolates from our previous study that were collected from five hospitals in New Jersey and New York between 2010 and 2011 (24). The sequence type and blaKPC variant were previously characterized (24). The PCR analysis revealed that 75 (78.1%) and 79 (82.2%) of the isolates were positive using primers targeting repA and repA2, respectively, while 70 (72.9%) were positive with both repA primers. Eight (8.3%) were positive for all three targets, covering isolates from four of five hospitals in New Jersey or New York. pBK32179-like plasmids of these eight isolates were successfully transferred to E. coli J53 by conjugation (31). Restriction enzyme EcoRV digestion of these eight plasmids from their E. coli J53 transformants revealed profiles similar to that of the test plasmid, pBK32179, in support of the high degree of homology of these pBK32179-like plasmids. Consistent with the genotype of strain BK32179, all eight isolates carry blaKPC-2 and belong to ST258, indicating that the spread of pBK32179-like plasmids is associated with the dissemination of the epidemic ST258 clone.

In summary, this study described the complete sequence of a novel blaKPC-2-harboring IncFIIK1 plasmid. The comparative DNA analysis among related plasmids provides evidence to suggest that the rapid evolution of carbapenem resistance can occur by horizontal transfer of carbapenem resistance between plasmids of the same Inc group. This study contributes to the understanding of genetic characteristics of KPC-encoding plasmids and provides useful information for differentiating and tracking the prevalent IncFIIK KPC-encoding plasmids.

Nucleotide sequence accession number.

The complete nucleotide sequence of pBK32179 was deposited in GenBank under accession no. JX430448.

ACKNOWLEDGMENTS

This study was supported by a grant (to B.N.K.) from the National Institutes of Health (1R01AI090155). This work was also supported by Public Health Service grants R01AI072219 and R01AI063517 (to R.A.B.) from the National Institutes of Health and funds and/or facilities provided by the Cleveland Department of Veterans Affairs, the Veterans Affairs Merit Review Program, and the Geriatric Research Education and Clinical Center VISN 10 to R.A.B.

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Published ahead of print 7 January 2013

REFERENCES

  • 1. Gupta N, Limbago BM, Patel JB, Kallen AJ. 2011. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin. Infect. Dis. 53:60–67 [DOI] [PubMed] [Google Scholar]
  • 2. Nordmann P, Naas T, Poirel L. 2011. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 17:1791–1798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Kitchel B, Rasheed JK, Patel JB, Srinivasan A, Navon-Venezia S, Carmeli Y, Brolund A, Giske CG. 2009. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrob. Agents Chemother. 53:3365–3370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Naas T, Cuzon G, Villegas M-V, Lartigue M-F, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the β-lactamase blaKPC gene. Antimicrob. Agents Chemother. 52:1257–1263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Gootz TD, Lescoe MK, Dib-Hajj F, Dougherty BA, He W, Della-Latta P, Huard RC. 2009. Genetic organization of transposase regions surrounding blaKPC carbapenemase genes on plasmids from Klebsiella strains isolated in a New York City hospital. Antimicrob. Agents Chemother. 53:1998–2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Shen P, Wei Z, Jiang Y, Du X, Ji S, Yu Y, Li L. 2009. Novel genetic environment of the carbapenem-hydrolyzing beta-lactamase KPC-2 among Enterobacteriaceae in China. Antimicrob. Agents Chemother. 53:4333–4338 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Andrade LN, Curiao T, Ferreira JC, Longo JM, Climaco EC, Martinez R, Bellissimo-Rodrigues F, Basile-Filho A, Evaristo MA, Del Peloso PF, Ribeiro VB, Barth AL, Paula MC, Baquero F, Canton R, Darini AL, Coque TM. 2011. Dissemination of blaKPC-2 by the spread of Klebsiella pneumoniae clonal complex 258 clones (ST258, ST11, ST437) and plasmids (IncFII, IncN, IncL/M) among Enterobacteriaceae species in Brazil. Antimicrob. Agents Chemother. 55:3579–3583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Cuzon G, Naas T, Truong H, Villegas MV, Wisell KT, Carmeli Y, Gales AC, Venezia SN, Quinn JP, Nordmann P. 2010. Worldwide diversity of Klebsiella pneumoniae that produce β-lactamase blaKPC-2 gene. Emerg. Infect. Dis. 16:1349–1356 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Mataseje LF, Boyd DA, Willey BM, Prayitno N, Kreiswirth N, Gelosia A, Poutanen SM, Low DE, Jenkins SG, Katz K, Mulvey MR. 2011. Plasmid comparison and molecular analysis of Klebsiella pneumoniae harbouring blaKPC from New York City and Toronto. J. Antimicrob. Chemother. 66:1273–1277 [DOI] [PubMed] [Google Scholar]
  • 10. Kassis-Chikhani N, Frangeul L, Drieux L, Sengelin C, Jarlier V, Brisse S, Arlet G, Decre D. 2013. Complete nucleotide sequence of the first KPC-2- and SHV-12-encoding IncX plasmid, pKpS90, from Klebsiella pneumoniae. Antimicrob. Agents Chemother. 57:618–620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Chen L, Chavda KD, Fraimow HS, Mediavilla JR, Melano RG, Jacobs MR, Bonomo RA, Kreiswirth BN. 2013. Complete nucleotide sequence of blaKPC-4- and blaKPC-5-harboring IncN and IncX plasmids from Klebsiella pneumoniae strains isolated in New Jersey. Antimicrob. Agents Chemother. 57:269–276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Villa L, Garcia-Fernandez A, Fortini D, Carattoli A. 2010. Replicon sequence typing of IncF plasmids carrying virulence and resistance determinants. J. Antimicrob. Chemother. 65:2518–2529 [DOI] [PubMed] [Google Scholar]
  • 13. Carattoli A. 2009. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother. 53:2227–2238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Garcia-Fernandez A, Villa L, Carta C, Venditti C, Giordano A, Venditti M, Mancini C, Carattoli A. 2012. Klebsiella pneumoniae ST258 producing KPC-3 identified in Italy carries novel plasmids and OmpK36/OmpK35 porin variants. Antimicrob. Agents Chemother. 56:2143–2145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Jiang Y, Yu D, Wei Z, Shen P, Zhou Z, Yu Y. 2010. Complete nucleotide sequence of Klebsiella pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2, blaDHA-1, qnrB4, and armA. Antimicrob. Agents Chemother. 54:3967–3969 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Liu P, Li P, Jiang X, Bi D, Xie Y, Tai C, Deng Z, Rajakumar K, Ou HY. 2012. Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug-resistant strain isolated from human sputum. J. Bacteriol. 194:1841–1842 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Frasson I, Lavezzo E, Franchin E, Toppo S, Barzon L, Cavallaro A, Richter SN, Palu G. 2012. Antimicrobial treatment and containment measures of an extremely drug-resistant Klebsiella pneumoniae ST101 isolate carrying pKPN101-IT, a novel fully sequenced blaKPC-2 plasmid. J. Clin. Microbiol. 50:3768–3772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Warburg G, Hidalgo-Grass C, Partridge SR, Tolmasky ME, Temper V, Moses AE, Block C, Strahilevitz J. 2012. A carbapenem-resistant Klebsiella pneumoniae epidemic clone in Jerusalem: sequence type 512 carrying a plasmid encoding aac(6′)-Ib. J. Antimicrob. Chemother. 67:898–901 [DOI] [PubMed] [Google Scholar]
  • 19. Leavitt A, Chmelnitsky I, Ofek I, Carmeli Y, Navon-Venezia S. 2010. Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain. J. Antimicrob. Chemother. 65:243–248 [DOI] [PubMed] [Google Scholar]
  • 20. Leavitt A, Carmeli Y, Chmelnitsky I, Goren MG, Ofek I, Navon-Venezia S. 2010. Molecular epidemiology, sequence types, and plasmid analyses of KPC-producing Klebsiella pneumoniae strains in Israel. Antimicrob. Agents Chemother. 54:3002–3006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Baraniak A, Grabowska A, Izdebski R, Fiett J, Herda M, Bojarska K, Zabicka D, Kania-Pudlo M, Mlynarczyk G, Zak-Pulawska Z, Hryniewicz W, Gniadkowski M. 2011. Molecular characteristics of KPC-producing Enterobacteriaceae at the early stage of their dissemination in Poland, 2008–2009. Antimicrob. Agents Chemother. 55:5493–5499 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol. 43:4178–4182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Chen L, Mediavilla JR, Endimiani A, Rosenthal ME, Zhao Y, Bonomo RA, Kreiswirth BN. 2011. Multiplex real-time PCR assay for detection and classification of Klebsiella pneumoniae carbapenemase gene (blaKPC) variants. J. Clin. Microbiol. 49:579–585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chen L, Chavda KD, Mediavilla JR, Zhao Y, Fraimow HS, Jenkins SG, Levi MH, Hong T, Rojtman AD, Ginocchio CC, Bonomo RA, Kreiswirth BN. 2012. Multiplex real-time PCR for detection of an epidemic KPC-producing Klebsiella pneumoniae ST258 clone. Antimicrob. Agents Chemother. 56:3444–3447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Costa D, Vinue L, Poeta P, Coelho AC, Matos M, Saenz Y, Somalo S, Zarazaga M, Rodrigues J, Torres C. 2009. Prevalence of extended-spectrum beta-lactamase-producing Escherichia coli isolates in faecal samples of broilers. Vet. Microbiol. 138:339–344 [DOI] [PubMed] [Google Scholar]
  • 26. CLSI 2012. Performance standards for antimicrobial susceptibility testing; 22nd informational supplement, M100–S22. CLSI, Wayne, PA [Google Scholar]
  • 27. CLSI 2012. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard—9th edition (M07-A9). CLSI, Wayne, PA [Google Scholar]
  • 28. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63:219–228 [DOI] [PubMed] [Google Scholar]
  • 29. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O, Vonstein V, Wilke A, Zagnitko O. 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9:75 doi:10.1186/1471-2164-9-75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Leavitt A, Chmelnitsky I, Carmeli Y, Navon-Venezia S. 2010. Complete nucleotide sequence of KPC-3-encoding plasmid pKpQIL in the epidemic Klebsiella pneumoniae sequence type 258. Antimicrob. Agents Chemother. 54:4493–4496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Wang M, Tran JH, Jacoby GA, Zhang Y, Wang F, Hooper DC. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242–2248 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES