Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Apr 18.
Published in final edited form as: Dev Biol. 2008 Apr 15;320(1):19–29. doi: 10.1016/j.ydbio.2008.03.045

TGF-β type I receptor Alk5 regulates tooth initiation and mandible patterning in a type II receptor-independent manner

Hu Zhao a, Kyoko Oka a, Pablo Bringas a, Vesa Kaartinen b, Yang Chai a,*
PMCID: PMC3629921  NIHMSID: NIHMS64619  PMID: 18572160

Abstract

TGF-β superfamily members signal through a heteromeric receptor complex to regulate craniofacial development. TGF-β type II receptor appears to bind only TGF-β, whereas TGF-β type I receptor (ALK5) also binds to ligands in addition to TGF-β. Our previous work has shown that conditional inactivation of Tgfbr2 in the neural crest cells of mice leads to severe craniofacial bone defects. In this study, we examine and compare the defects of TGF-β type II receptor (Wnt1-Cre;Tgfbr2fl/fl) and TGF-β type I receptor/Alk5 (Wnt1-Cre;Alk5fl/fl) conditional knockout mice. Loss of Alk5 in the neural crest tissue resulted in phenotypes not seen in the Tgfbr2 mutant, including delayed tooth initiation and development, defects in early mandible patterning and altered expression of key patterning genes including Msx1, Bmp4, Bmp2, Pax9, Alx4, Lhx6/7 and Gsc. Alk5 controls the survival of CNC cells by regulating expression of Gsc and other genes in the proximal aboral region of the developing mandible. We conclude that ALK5 regulates tooth initiation and early mandible patterning through a pathway independent of Tgfbr2. There is an intrinsic requirement for Alk5 signal in regulating the fate of CNC cells during tooth and mandible development.

Keywords: TGF-β, Alk5, Craniofacial development, Mouse, Mandible, Tooth

Introduction

Transforming growth factor β (TGF-β) belongs to a large superfamily of structurally related proteins including activins, bone morphogenetic proteins (BMPs) and growth differentiation factors (GDFs) (Massague, 1998). TGF-β superfamily members signal through a heteromeric complex consisting of a type I and a type II receptor. Upon ligand binding, type II receptors recruit and phosphorylate type I receptors, which then propagate the signal by phosphorylating Smad proteins. Phosphorylated Smads can form a complex and move into the nucleus, where they act as transcription factors (Shi and Massague, 2003). The number of TGF-β ligands greatly exceeds the number of type II and type I receptors. In humans, there are at least 33 TGF-β ligands; whereas only five type II and seven type I receptors have been found. Combinatorial interactions of different type I and type II receptors in the receptor complexes allow for specificity in ligand binding (Feng and Derynck, 2005). TGF-β ligands bind only to TGF-β RII. TGF-β RI (also known as ALK5) and ALK1 can both function as the type I receptor for TGF-βs and activate different Smad complexes (Feng and Derynck, 2005). In addition, ALK5 can also function as the type I receptor for GDF 8, 9 or 11 (Mazerbourg et al., 2004; Rebbapragada et al., 2003; Oh et al., 2004; Andersson et al., 2006). GDF8 binds ActRIIB and then partners with ALK5 to induce phosphorylation of Smad2/Smad3 (Rebbapragada et al., 2003). GDF9 interacts with BMPRII and ALK5 to phosphorylate Smad2/Smad3 (Mazerbourg et al., 2004). GDF11 interacts with ActRII and ALK5 to phosphorylate Smad2/Smad3 (Andersson et al., 2006). Some alternative downstream pathways for TGF-β have been identified, including MAPK, PI3-kinase, and small Rho-related GTPase (Dudas and Kaartinen, 2005). However, the relationship of these pathways to TGF-β receptors is not clear.

TGF-β is involved in various biological processes including embryonic development, cell proliferation, migration and differentiation, extracellular matrix (ECM) secretion and immunoregulation. During craniofacial development, TGF-β signals play important roles, especially in palatal development. Loss-of-function mutations in Tgfb2 or Tgfb3 result in cleft palate (Sanford et al., 1997; Kaartinen et al., 1995; Proetzel et al., 1995). The conventional knockout of Tgfbr2 results in early embryonic lethality (Oshima et al., 1996), preventing a full phenotypic analysis. The conditional knockout of Tgfbr2 in cranial neural crest (CNC) cells results in cleft palate, calvaria defect and other craniofacial bone defects (Ito et al., 2003; Sasaki et al., 2006). Tgfbr1/Alk5 conventional knockout mice die around embryonic day 8 (E8) as the result of failed angiogenesis (Larsson et al., 2001).

The first morphological sign of murine tooth development occurs around E11 as a local thickening of the dental epithelium. Incisor initiation begins about one half day earlier than molar initiation. The epithelium invaginates into the underlying condensed CNC-derived mesenchymal cells and forms the tooth bud at E12.5–E13.5. Towards the late bud stage, a signaling center, known as the enamel knot, that controls the morphology of the tooth germ is formed at the tip of the tooth germ (Tucker and Sharpe, 2004). Around E14.5, the tooth bud progresses to the cap stage and tooth morphology is established. Terminal differentiation occurs during the bell stage around E16.5 when the epithelium and mesenchyme differentiate into ameloblasts and odontoblasts, respectively.

The construction of a tooth involves a series of processes including tooth patterning, initiation and morphogenesis. Epithelial–mesenchymal interaction plays a key role in tooth development. The first identified interaction occurs at E9.5–E10.5 in mice, and recombination experiments have defined the oral epithelium as the source of induction signals (Mina and Kollar, 1987). After E11.5–E12.5, the tooth induction ability shifts, such that the mesenchyme then signals back to the epithelium. This shift in inductive ability appears to correlate with a shift of BMP4 expression from the epithelium to the mesenchyme (Tucker and Sharpe, 2004).

The role of TGF-β in early tooth development is not well understood. In part, it is because of the late appearance of TGF-β ligand expression during tooth development and the lack of a tooth phenotype in TGF-β knockout mutants. TGF-β1 expression first appears in the tooth bud at E13 (Vaahtokari et al., 1991). TGF-β2 and 3 are not expressed until the late bell stage (Pelton et al., 1990). The conditional knockout of Tgfbr2 in CNC cells leads to defects only in the terminal differentiation of odontoblasts (Oka et al., 2007b).

Mandible development involves both osteogenesis and chondrogenesis. Meckel’s cartilage first appears at around E12.5, and later it will serve as a template for mandible development and participate in mandible bone formation after ossification (Chai and Maxson, 2006; Carda et al., 2005; Melnick et al., 2005; Ramaesh and Bard, 2003). The coronoid, condylar and angular cartilages are classified as secondary cartilage (Beresford, 1975). They undergo endochondral ossification and help to form the proximal part of the mandible, whereas the distal part of the mandible is mainly formed through intramembranous ossification (Lee et al., 2001). TGF-β signals play important roles in mandible development. The conditional knockout of Tgfbr2 in cranial neural crest cells leads to craniofacial anomalies including defects in mandible development (Ito et al., 2003; Oka et al., 2007a).

Previously, we have noted that conditional knockout of Alk5 leads to cardiac outflow tract defects and severe craniofacial defects including cleft palate and facial cleft. The facial phenotypes of Alk5 mutants are more severe than those of Tgfbr2 mutants (Dudas et al., 2006; Wang et al., 2006). We also reported previously that proliferation and apoptosis rates were increased in the palatal mesenchyme of Alk5 mutants compared to the wild-type control, which suggests that signaling via ALK5 is required for cell survival in the palatal mesenchyme. In this study, we found that loss of Alk5 expression in CNC cells results in delayed tooth initiation and non-uniform mandible defects. Specifically, the proximal part of the mandible is more severely affected than the distal part. The expression of numerous genes involved in tooth development or mandible patterning is altered in Wnt1-Cre;Alk5fl/fl mice. Furthermore, the defects in tooth development and mandible patterning in Wnt1-Cre; Alk5fl/fl mice are Tgfbr2-independent.

Materials and methods

Mouse maintenance and genotyping

The Wnt1-Cre transgenic line, Alk5 and Tgfbr2 conditional knockout alleles have been described previously (Danielian et al., 1998; Ito et al., 2003; Dudas et al., 2006). Wnt1-Cre;Alk5fl/fll embryos were generated by mating Wnt1-Cre;Alk5fl/+ male mice with Alk5fl/fl female mice. Wnt1-Cre;Tgfbr2fl/fl embryos were generated by mating Wnt1-Cre;Tgfbr2fl/+ male mice with Tgfbr2fl/fl female mice. Wnt-1 Cre;Alk5fl/fl;Tgfbr2fl/fl double mutant embryos were generated by mating Wnt1-Cre;Alk5fl/+;Tgfbr2fl/+ male mice with Alk5fl/fl;Tgfbr2fl/fl female mice. Genotyping was carried out using PCR on tail tip or yolk sac DNA. Mutant embryos were identified by PCR genotyping for presence of the Cre transgene (Cre1, TGATGAGGTTCGCAAGAACC; Cre2, CCATGAGTGAAC-GAACCTGG), Alk5fl/fl allele (lnl5′-ATGAGTTATTAGAAGTTGTTT, lnl3′-ACCCTCTCACTCTTCCTGAGT and llox3′-GGAACTGGGAAAGGAGATAAC) or Tgfbr2fl/fl allele (8wa-TAAACAAGGTCCGGAGCCCA and mSAr-AGAGTGAAGCCGTGGTAGGTGAGCTTG). Noon on the plugging day was designated as E0.5. Embryos were precisely staged by somite counting and comparison with references (Kaufman, 1992). All mouse embryos used in this study were maintained in a C57BL6/J background.

Histology and in situ hybridizations

For routine histological analysis, embryos were fixed in 4% paraformaldehyde, embedded and sectioned at 5 μm. Paraffin sections of embryos were stained with hematoxylin and eosin according to standard histological procedures.

For in situ hybridization, embryos were harvested and fixed in 4% paraformaldehyde overnight at 4 °C. For embryos younger than E11.0, somites were counted to match the stage precisely. RNA probes were labeled with digoxigenin (Roche) and used for whole mount or sectional in situ hybridization as previously described (Wilkinson, 1992). For whole mount in situ hybridization, at least 3 embryos per genotypes were examined per probe. Goosecoid and Barx1 probes were the kind gifts of P. Sharpe (London, UK).

Cell proliferation assay

Cell proliferation was detected using BrdU incorporation experiments. Pregnant mice were injected intraperitoneally with 1 ml 10 mM BrdU in water per 100 g body weight, and embryos were collected 2 h later. Embryos were fixed overnight in 4% paraformaldehyde and embedded in paraffin. Histology sections (5 μm) were prepared according to standard techniques. BrdU was detected using the BrdU Staining Kit (ZYMED) according to the instructions of the manufacturer.

Apoptosis assay

Apoptosis was detected by TUNEL assay using the In Situ Cell Death Detection KIT (AP) (Roche) according to the manufacturer instructions. The paraffin sections were rehydrated and treated with proteinase K according to the instructions. After substrate reaction, slides were mounted with VECTASHIELD Mounting Medium (VECTOR) and observed under the fluorescent microscope.

Results

Deletion of Alk5 in cranial neural crest cells delays tooth initiation

In order to examine the function of Alk5 signaling during craniofacial development, we created Wnt1-Cre;Alk5fl/fl mutant embryos. In Wnt1-Cre;Alk5fl/fl mice, ALK5 expression was specifically lost in the mesenchyme but was unaffected in the epithelium (Suppl. Figs.1A–D). In addition, pSmad2 expression was reduced in dental mesenchyme of Wnt1-Cre; Alk5fl/fl mice compared to wild-type (Suppl. Figs. 3A, B). Defects were first detected at E11.0, including separated nasal processes, smaller mandible processes and slightly bulging forebrains (Figs. 1A–D). E11.0 is the stage when the first morphological sign of tooth initiation, thickened dental epithelium, is detectable (Cobourne and Sharpe, 2003). Typically during tooth development, incisor initiation occurs 0.5 day prior to that of the molar. At E12.5, the thickened epithelium invaginates into the underlying mesenchyme to form tooth buds (Figs. 1E, F, I, J). In Wnt1-Cre;Alk5fl/fl mutant embryos at E12.5, we did not observe any thickening of the incisor or molar epithelium (Figs. 1G, H, K, L). At E13.5, the incisor and molar tooth buds of wild-type embryos are clearly visible with condensing mesenchyme surrounding them (Figs. 1M, N, Q, R). In the mutant, however, we observed thickened epithelium in the incisor region (Figs. 1O, P) but not in the molar region (Figs. 1S, T). At E15.5, the incisor and molar tooth germs of wild-type embryos have reached the cap stage (Fig. 1U1, U2, U5, U6), whereas in the mutant they have only reached the bud stage (Fig. 1U3, U4, U7, U8).

Fig. 1.

Fig. 1

Wnt1-Cre;Alk5fl/fl mutant mice display delayed tooth initiation. (A–D) Side (A, B) and face (C, D) views of E11.5 wild-type and Wnt1-Cre;Alk5fl/fll littermate embryos. Alk5 embryos display abnormal phenotypes including bulging forebrain (outlined with broken lines), facial cleft (indicated by white arrow), small mandible processes and malformed maxilla processes. (E–L) At E12.5, the development of incisors (E, F) and molars (I, J) in both maxilla and mandible processes has reached the lamina stage in wild-type mice. In contrast, no epithelium thickening is detectable in the incisor (G, H) or molar regions (K, L) of Wnt1-Cre;Alk5fl/fl embryos. (M–T) At E13.5, incisor (M, N) and molar (Q, R) development has reached the bud stage in wild-type, with condensed mesenchyme tissue surrounding tooth buds. In Wnt1-Cre;Alk5fl/fl embryos at E13.5, epithelium thickening is visible at the prospective incisor region (O. P) but not the molar region (S, T). In wild-type embryos at E15.5, incisor (U1, U2) and molar (U5, U6) development has reached the cap stage (U1, U2). In Wnt1-Cre;Alk5fl/fl embryos at E13.5, incisor (U3, U4) and molar (U7, U8) development has only reached the bud stage. Arrows indicate position of the tooth germs. Tooth germs are outlined with dotted lines. fb, forebrain; np, nasal process; mx, maxilla process; md, mandible process. Scale bar in panel A=2 mm. Scale bar in panel E=50 μm.

We next examined the expression of Shh and Lef1 using whole mount in situ hybridization. Shh plays an important role in tooth initiation and is involved in dental epithelium proliferation and tooth bud formation (Cobourne and Sharpe, 2003). In wild-type embryos at E11.5, there was highly localized expression of Shh at the sites of prospective incisors and molars (Figs. 2A, C). In Wnt1-Cre;Alk5fl/fl mutant embryos, we observed localized expression of Shh in the maxilla processes but not in the mandible processes (Figs. 2B, D). Shh expression persisted in both the maxilla and mandible processes of E12.5 wild-type embryos with an increased intensity (Figs. 2E, G), whereas in the mutant its expression continued to be detectable only in the maxilla, but not in the mandible processes (Figs. 2F, H). At E13.5, Shh expression in wild-type embryos began to decrease in the maxilla processes and completely disappeared from the mandible processes (Figs. 2I, K). In contrast, Shh was still strongly expressed in Wnt1-Cre; Alk5fl/fl maxilla processes and began to appear in the mandible processes (Figs. 2J, L). Lef1 is also involved in tooth initiation (van Genderen et al., 1994). In wild-type embryos, we detected strong expression of Lef1 in discrete regions of the presumptive tooth germs at E12.5–E14.5 (Figs. 2M, O, Q, S, U). In contrast, we did not detect Lef1 expression in Wnt1-Cre;Alk5fl/fl tooth germs at E12.5 or E13.5 (Figs. 2N, P, R and T). We were able to detect Lef1 expression in Wnt1-Cre;Alk5fl/fl tooth germs beginning at E14.5 (Fig. 2V). Although Lef1 expression was delayed in the tooth germ of Wnt1-Cre;Alk5fl/fl mice, its expression in the nasal processes was indistinguishable from wild-type (data not shown). The changes in expression pattern of Shh and Lef1 are consistent with the results of our morphology study, and together they suggest that tooth initiation in the Wnt1-Cre;Alk5fl/fl mutant embryos is delayed by 1–2 days compared to wild-type. Moreover, the different onset of Shh expression in the prospective upper incisor and lower incisor regions suggests that different initiation mechanisms may be involved in regulating tooth initiation.

Fig. 2.

Fig. 2

Shh and Lef1 expression is delayed in Wnt1-Cre;Alk5fl/fl teeth. Analysis of Shh and Lef1 expression in wild-type and Wnt1-Cre;Alk5fl/fl maxilla and mandible processes by whole mount in situ hybridization. Arrowheads highlight Shh expression. (A–H) At E11.5 and E12.5, Shh expression is detectable in the maxilla (A, E) and mandible process (C, G) of wild-type embryos, but is only detectable in the maxilla (B, F) and not the mandible (D, H) of Wnt1-Cre;Alk5fl/fl embryos. (I–L) At E13.5, Shh expression is detectable in the maxilla process (I) of wild-type embryos, but it is no longer detectable in the mandible processes (K). In contrast, Shh expression is now clearly detectable in the Wnt1-Cre;Alk5fl/fl maxilla (J) and mandible (L). (M–T) At E12.5 and E13.5, Lef1 expression is detectable in wild-type maxilla (M, Q) and mandible processes (O, S) but not in Wnt1-Cre;Alk5fl/fl littermates (N, R, maxilla; P, T mandible). (U, V) At E14.5, Lef1 expression is visible in both wild-type (U) and mutant (V) tooth germ sections. Open arrowheads indicate the void of expression. Scale bar in panel A=2 mm. Scale bar in panel U=50 μm.

Enamel knot formation and terminal differentiation are delayed in Alk5 mutant embryos

We analyzed tooth enamel knot development in Wnt1-Cre;Alk5fl/fl embryos using Shh expression. In wild-type embryos, Shh expression was upregulated in the enamel knot at E15.5 (Figs. 3A, C). At E17.5, Shh expression continued to be highly localized in the enamel forming regions (Figs. 3E, G). In contrast, we did not detect Shh expression in the incisor or molar tooth germ of Wnt1-Cre;Alk5fl/fl embryos at E15.5 (Figs. 3B, D). At E17.5, we did observe Shh expression localized to incisor and molar tooth germs (Figs. 3F, H).

Fig. 3.

Fig. 3

Tooth development following initiation is also delayed in Wnt1-Cre;Alk5fl/fl mice. Immunohistochemistry of Shh and Amelogenin in wild-type and Wnt1-Cre;Alk5fl/fl sections. Black arrows indicate location of expression. White arrows indicate the locations of tooth germs in Wnt1-Cre;Alk5fl/fl embryos. (A–D) Shh expression is detectable in the incisors (A) and molars (C) of wild-type embryos but not in incisors (B) or molars (D) of Wnt1-Cre;Alk5fl/fl littermate embryos. (E–H) At E17.5, Shh expression is clearly visible in wild-type incisors (E) and molars (G) and Wnt1-Cre;Alk5fl/fl incisors (F) and molars (H). (I, J) Amelogenin is expressed in the wild-type newborn molar tooth germ (I) but not the Wnt1-Cre;Alk5fl/fl newborn molar tooth germ (J). Dotted lines outline tooth germs. Scale bar in panel A=100 μm.

Next, we assessed the status of terminal differentiation with amelogenin and dentin sialophosphoprotein (DSPP) expression. Typically, DSPP expression appears before amelogenin expression in the tooth germ, because dentin forms prior to enamel. Both amelogenin and DSPP were strongly expressed in newborn wild-type teeth (Fig. 3I and data not shown). In Wnt1-Cre;Alk5fl/fl newborns, we detected DSPP expression in both molars and incisors, whereas we detected amelogenin expression in incisors but not molars (Fig. 3J and data not shown). Thus, our data suggests that both enamel knot development and terminal differentiation are delayed in Wnt1-Cre;Alk5fl/fl mutants by 1–2 days.

Tooth initiation is unaffected in Wnt1-Cre;Tgfbr2fl/fl conditional knockout mice

If TGF-β functions as the ligand for a TGF type II receptor/ALK5 complex to regulate tooth initiation, Wnt1-Cre;Tgfbr2fl/fl conditional knockout mice should recapitulate the tooth phenotypes of Alk5 mutants. At E12.5, incisor tooth germs in wild-type and Wnt1-Cre; Tgfbr2fl/fl embryos reached the lamina stage with comparable size (Figs. 4A, B). Molar tooth germs in both wild-type and Wnt1-Cre;Tgfbr2fl/fl embryos also reached the lamina stage with comparable size (Figs. 4C, D). Throughout their development, tooth germs in Wnt1-Cre;Tgfbr2fl/fl embryos were indistinguishable from wild-type embryos, until E16.5 when terminal differentiation began (data not shown).

Fig. 4.

Fig. 4

Tooth initiation is unaffected in Wnt1-Cre;Tgfbr2 fl/fl conditional knockout mice. (A–D) HE staining of sections of incisor (A, B) and molar (C, D) tooth germs from wild-type and Wnt1-Cre;Tgfbr2fl/fl E12.5 embryos. (E–J) Whole mount in situ hybridization of wild-type and Wnt1-Cre;Tgfbr2fl/fl maxilla (E, G, I) and mandible (F, H, J) processes. Shh expression at E11.5 (E, F), Lef1 expression at E12.5 (G, H), and Bmp2 expression at E12.5 (I, J) are unaffected in the Wnt1-Cre;Tgfbr2fl/fl embryos. Arrows indicate locations of tooth germs. Arrowheads indicate the location of expression. Tooth germs are outlined with dotted lines. Scale bar in panel A=50 μm. Scale bar in panel E=2 mm.

Next, we examined tooth initiation in Tgfbr2 conditional knockout mice using whole mount in situ hybridization analysis to detect the development markers Shh, Bmp2 and Lef1. The expression of Shh, Bmp2 and Lef1 in Wnt1-Cre;Tgfbr2fl/fl was indistinguishable from wild-type (Figs. 4E–J).

In order to test the functional requirement for combinational TGF β IIR and IR complex, we analyzed tooth initiation in Wnt1-Cre;Alk5fl/f; Tgfbr2fl/fl double mutant mice. In Wnt1-Cre;Alk5fl/f;Tgfbr2fl/fl double mutant embryos, expression of both ALK5 and TGFβ RII was undetectable in the mesenchyme (Suppl. Figs. 2A–D). At E12.5, Wnt1-Cre; Alk5fl/f;Tgfbr2fl/fl embryos had a thickened epithelium at the prospective incisor sites but no thickening of the epithelium at the prospective molar region, whereas the wild-type tooth germs had already reached the lamina stage (Figs. 5A–D). At E15.5, incisor and molar tooth germs in wild-type embryos had reached the cap stage, but they remained in the bud stage in Wnt1-Cre;Alk5fl/f;Tgfbr2fl/fl embryos (Figs. 5E–H). Thus, tooth initiation in Wnt1-Cre;Alk5fl/f;Tgfbr2fl/fl double mutant mice is indistinguishable from the Wnt1-Cre;Alk5fl/fl single mutant, suggesting that the absence of TGF type II receptor and ALK5 does not have a combinatorial effect.

Fig. 5.

Fig. 5

Tooth phenotypes are indistinguishable in Wnt1-Cre;Tgfbr2fl/fl;Alk5fl/fl double knockout and Wnt1-Cre;Alk5fl/fl single knockout mice. HE staining of sections from wild-type and Wnt1-Cre;Tgfbr2fl/fl;Alk5fl/fl mice. (A–D) At E12.5, wild-type incisor (A) and molar (C) development has reached the lamina stage. In contrast, epithelium thickening was detectable in the incisor (B) but not the molar (D) region of Wnt1-Cre;Tgfbr2fl/fl; Alk5fl/fl embryos. (E–H) At E15.5, both incisors and molars have developed to the cap stage in wild-type embryos (E, G), whereas they remain in the bud stage in the double knockout embryos (F, H). Arrows indicate locations of tooth germs. Dotted lines outline tooth germs. Scale bar in panel A=50 μm. Scale bar in panel E=100 μm.

Severe mandible patterning defects in Wnt1-Cre;Alk5fl/flmice

Previous studies of Wnt1-Cre;Tgfbr2fl/fl mutant embryos indicated that the absence of Tgfbr2 leads to shortened proximal regions of the mandible (Oka et al., 2007a). We detected a similar, but more severe defect in the mandibles of Wnt1-Cre;Alk5fl/fl newborns (Fig. 6). Compared with wild-type or Wnt1-Cre;Tgfbr2fl/fl mice, the mandibles of Wnt1-Cre;Alk5fl/fl mice were dramatically shortened in the proximal region, but unchanged in length distal to the alveolar ridge (Figs. 6A, C, E). The mandible proximal structures, including condylar, coronoid and angular processes, were reduced in size in Tgfbr2 mutant mice relative to wild-type, but completely disappeared in Alk5 mutant mice (Figs. 6A–F). At the mandible distal region, the incisor alveolar bone in Tgfbr2 mutants was intact, whereas in Alk5 mutants it was absent. Side view outlines of wild-type, Wnt1-Cre;Tgfbr2fl/fl and Wnt1-Cre;Alk5fl/fl mandibles were aligned according to their incisor positions, which indicated dramatic oralaboral thickness reduction in Wnt1-Cre;Alk5fl/fl lies mostly in the aboral side of the mandible (Fig. 6I). Wnt1-Cre; Alk5fl/f;Tgfbr2fl/fl double mutant mandibles had similar defects to those of the Wnt1-Cre;Alk5fl/fl single mutant (Figs. 6G, H). Thus, defects in Wnt1-Cre;Alk5fl/fl mandibles are most severe in the proximal region. And in the distal region, defects are more severe in the aboral region.

Fig. 6.

Fig. 6

Comparison of mandible bone defects in Wnt1-Cre;Tgfbr2fl/fl, Wnt1-Cre;Alk5fl/fl, and Wnt1-Cre;Tgfbr2fl/fl;Alk5fl/fl mutant mice. Dorsal (A, C, E, G) and side (B, D, F, H) views of Alizarin red (bone)/Alcian blue (cartilage) stained mandible bone from wild-type, Wnt1-Cre;Tgfbr2fl/fl, Wnt1-Cre;Alk5fl/fl and Wnt1-Cre;Tgfbr2fl/fl;Alk5fl/fl E18.5 littermate embryos. Four lines were drawn to visualize the size difference between the samples. The anterior tips of all the samples were aligned to line 1. Line 2 crossed the alveolar ridge of the samples. Line 3 marked the posterior edge of the wild-type mandible. Line 4 marked the posterior edges of both the Alk5 and double conditional knockout mutant mandibles. The side view outlines of mandibles in panels B, D and F were aligned according to their incisor positions to display the more severe aboral defects in Wnt1-Cre;Alk5fl/fl mutant (I). Cr, coronoid process; Cn, condylar process; Ang, angular process; Inc, incisor. Scale bar=5 mm.

Increased apoptosis in Wnt1-Cre;Alk5fl/flmice

Analysis of Wnt1-Cre;Tgfbr2fl/fl mutant embryos indicated that TGF-β is required for CNC cell proliferation in the first branchial arch (Ito et al., 2003). To address the cellular mechanism of mandibular defects, we analyzed cell proliferation and apoptosis activities within the Wnt1-Cre;Alk5fl/fl samples. Our BrdU incorporation analysis showed that there was no cell proliferation defect in the mandible primordium in Wnt1-Cre;Alk5fl/fl mutants (data not shown). Increased apoptosis was first detected in Wnt1-Cre;Alk5fl/fl mice at around E12.5 (Figs. 7A–F). Moreover, we found that apoptosis signals appeared only on the aboral side of the maxilla or mandible mesenchyme (Fig. 7B), whereas we detected no apoptosis signal in the same region of wild-type mice (Fig. 7A). Compared with the distal region, the proximal region of the mandible process mesenchyme contained much stronger apoptosis signals (Figs. 7B, D, G). The increased apoptosis in the mesenchymal region of Wnt1-Cre;Alk5fl/fl mice persisted until E14.5 (data not shown). At E12.5, we detected increased apoptosis in a large area of the oral epithelium of both maxilla and mandible processes of Wnt1-Cre;Alk5fl/fl embryos, whereas we only detected apoptosis in diastema regions in wild-type embryos (Figs. 7E, F, H). The increased apoptosis in the epithelium region of Wnt1-Cre;Alk5fl/fl mice was only seen at E12.5 but not later stages (data not shown).

Fig. 7.

Fig. 7

Increased apoptosis in Wnt1-Cre;Alk5fl/fl embryos. TUNEL assays to detect cell death in E12.5 wild-type and Wnt1-Cre;Alk5fl/fl embryos. (A, B) Sagittal sections from the proximal region (schematic diagram on the left). (C, D) Sagittal sections from the distal region (schematic diagram on the left). Oral and aboral sides or the mandible were separated with dotted straight lines. (E, F) Sagittal sections from the epithelium of tooth-forming regions. (G and H) Histogram showing statistically significant increase in the ratio of apoptotic cells in the proximal, aboral region of Wnt1-Cre;Alk5fl/fl mutants and in the oral epithelium of Wnt1-Cre;Alk5fl/fl mutants compared with wild-type controls. Arrowheads indicate TUNEL signals. Broken lines in F outline the epithelium of the mandible and maxilla processes. WT, wild-type. mutant, Wnt1-Cre;Alk5fl/fl mutant. mx, maxilla process. md, mandible process. fb, forebrain. np, nasal process. Scale bar in panel A=100 μm.

Altered expression of genes involved in tooth initiation in Wnt1-Cre;Alk5fl/fl embryos

We next sought to identify Alk5 mediated downstream targets that might play a role in regulating the initiation of tooth development. We examined eight genes important for early tooth development, Bmp4, Fgf8, Pitx2, Islet1, Pax9, Msx1, Msx2 and Barx1. Their expression is localized to the epithelium or mesenchyme, and they are involved in the initiation of tooth development (Tucker and Sharpe 2004). At E10.5, Bmp4 was expressed in the distal epithelium of the maxilla and mandible processes in wild-type and Wnt1-Cre;Alk5fl/fl embryos (Figs. 8A, B). Bmp4 expression begins to shift from the oral epithelium to the mesenchyme at around E11.5, and at E12.5 its expression is localized primarily in the mesenchyme (Fig. 8I). Previous studies have suggested that the shift in Bmp4 localization may be responsible for the shift of tooth development induction ability from the dental epithelium to the mesenchyme (Tucker and Sharpe 2004). However, Bmp4 expression was only detectable in the oral epithelium at E12.5, not in the mesenchyme in Wnt1-Cre;Alk5fl/fl embryos (Fig. 8J).

Fig. 8.

Fig. 8

Altered expression of genes involved in tooth initiation in Wnt1-Cre;Alk5fl/fl mice. Whole mount in situ hybridization analysis of tooth initiation related genes in wild-type and Wnt1-Cre; Alk5fl/fl conditional knockout (CKO) embryos. (A, B) Bmp4 at E10.5. (C, D) Fgf8 at E10.5. (E, F) Pitx2 at E11.5. (G, H) Islet1 at E10.5. (I, J) Bmp4 at E12.5. Inserts show the differential expression of Bmp4 in the epithelium and mesenchyme from the same embryo. (K, L) Pax9 at E10.5. (M, N) Msx1 at E10.5. (O, P) Msx2 at E10.5. (Q, R) Barx1 at E10.5. Arrowheads highlight location of expression. Scale bar in panel A=2 mm.

We detected no change in expression pattern of Fgf8, Pitx2 and Islet1 in Wnt1-Cre;Alk5fl/fl embryos. Fgf8 was expressed in the proximal oral epithelium of maxilla and mandible processes of wild-type and Wnt1-Cre;Alk5fl/fl embryos at E10.5 (Figs. 8C, D). Pitx2 is involved in BMP4-FGF8 interactions during the tooth patterning process (Lu et al., 1999). Pitx2 was expressed in the oral epithelium of maxilla and mandible processes of wild-type and Wnt1-Cre;Alk5fl/fl mice at E11.5 (Figs. 8E, F). Islet1 was expressed in the distal oral epithelium of maxilla and mandible processes of wild-type and Wnt1-Cre;Alk5fl/fl mice at E10.5 (Figs. 8G, H).

In contrast, we did detect changes in expression of other candidate genes. Pax9 was expressed in the mesenchyme of nasal processes and prospective tooth-forming regions in wild-type mice at E10.5 (Fig. 8K). We detected a dramatic reduction in Pax9 expression level in Wnt1-Cre;Alk5fl/fl mice at E10.5 and E11.5 (Fig. 8L and data not shown). The expression of Msx1 was also dramatically reduced in Wnt1-Cre;Alk5fl/fl mice at E10.5 in the forebrain, nasal processes, maxilla processes and mandible processes (Figs. 8M, N). We also detected a reduction in Msx1 expression in Wnt1-Cre;Alk5fl/fl mice at E9.5 but not at E11.5 (data not shown). Msx2 expression was seen in the distal mesenchyme of E10.5 mutant maxilla and mandible processes with no difference from the control (Figs. 8O, P). Barx1 expression was seen in the proximal mesenchyme of E10.5 mutant maxilla and mandible processes with no difference from the control (Figs. 8Q, R).

Altered expressions of genes involved in craniofacial patterning in Wnt1-Cre;Alk5fl/fl embryos

Goosecoid (Gsc) and Lhx6/7 are homeobox genes that help to establish the oral–aboral patterning of the developing lower jaw (Tucker and Sharpe 2004). Lhx6/7 are necessary but not sufficient for tooth development, and their expression marks the region where the tooth buds will form (Tucker et al., 1999). Gsc expression is excluded from the Lhx6/7-expressing region in the lower jaw. The jaw is therefore divided into a tooth-forming LHX-positive domain and a non-tooth forming GSC-positive domain (Tucker et al.,1999). We detected Gsc expression at E9.5 in wild-type but not in Wnt1-Cre;Alk5fl/fl mandible processes (Figs. 9A, B). At E10.5, Gsc expression in the aboral mesenchyme of mandible processes and the second branchial arch was dramatically reduced in Wnt1-Cre;Alk5fl/fl mice compared with wild-type (data not shown). Lhx6 and Lhx7 were expressed in the oral mesenchyme of wild-type maxilla and mandible processes at E10.5 (Figs. 9C, E). The expression of Lhx6 and Lhx7 in Wnt1-Cre;Alk5fl/fl embryos was dramatically reduced at E10.5 (Figs. 9D, F). At E11.5, Lhx6/7 expression in Wnt1-Cre;Alk5fl/fl embryos was similar to wild-type in both pattern and intensity (data not shown).

Fig. 9.

Fig. 9

Altered expression of genes involved in bone development in Wnt1-Cre;Alk5fl/fl mice. Whole mount in situ hybridization analysis of bone development related genes in wild-type and Wnt1-Cre; Alk5fl/fl conditional knockout (CKO) embryos. (A, B) Gsc at E9.5. White broken lines outline the mandible arches. (C, D) Lhx6 at E10.5. (E, F) Lhx7 at E10.5. (G, H) Alx4 at E10.5. (I, J) Bmp2 at E13.5. (K, L) Dlx5 at E10.5. Arrowheads highlight location of expression. Scale bar in panel A=2 mm.

Alx4 is one of the Aristaless-like homeobox genes that are characterized by a paired-type homeobox and the presence of a small, conserved, C-terminal domain in the proteins encoded (Meijlink et al., 1999). Mice with mutations in Alx3/Alx4 have severe craniofacial abnormalities (Beverdam et al. 2001). Alx4 was expressed in the distal mesenchyme of E10.5 wild-type mandible and maxilla processes, but its expression in the mutant was dramatically attenuated (Figs. 9G, H). Bmp2 is important for both tooth and bone development (Chen et al., 2004; Aberg et al., 1997). At E13.5, Bmp2 expression was detectable in the nasal processes, maxilla processes, mandible processes, eye regions and whisker (Fig. 9I). In contrast, we detected only weak expression of Bmp2 in Wnt1-Cre;Alk5fl/fl embryos at E 13.5 (Fig. 9J). Bmp2 expression in Wnt1-Cre;Alk5fl/fl embryos was also dramatically reduced at E12.5 and E14.5 (data not shown). Dlx5 plays a role in craniofacial bone development and the knockout of Dlx5 results in craniofacial abnormalities affecting all four branchial arches (Acampora et al., 1999). We observed Dlx5 expression in nasal processes, the proximal region of mandible processes and the second branchial arches in wild-type and Wnt1-Cre;Alk5fl/fl embryos at E10.5 (Figs. 9K, L).

Discussion

Alk5 is required for the correct timing of tooth initiation

Our study reveals a new mechanism controlling the correct timing of tooth initiation. We found that tooth development is delayed by 1–2 days in Wnt1-Cre;Alk5fl/fl mice, and they never catch up with wild-type littermates throughout enamel knot formation and terminal differentiation. Both incisor and molar development is affected in the Alk5 mutant, suggesting that Alk5 is involved in an initiation mechanism universal to all teeth. The difference in the onset of Shh expression in upper incisors and lower incisors of Wnt1-Cre;Alk5fl/fl mice suggests they may involve different regulation mechanisms. One possible explanation is tissue origin. Lower incisors are derived solely from the mandible arch, whereas the upper incisors are derived from the maxilla process placode and nasal process placode, which merge later to form one upper incisor placode (Kriangkrai et al., 2006).

In Wnt1-Cre;Alk5fl/fl mice, the migration of neural crest cells into the first branchial arch region at E8.5 is unaltered relative to that of wild-type control embryos (Dudas et al., 2006). At E11.5 and E15.5, the distribution pattern is indistinguishable between mutants and controls as shown by the Rosa26 Cre reporter (R26R) β-galactosidase assay (Dudas et al., 2006). Therefore, the delayed tooth initiation in Wnt1-Cre;Alk5fl/fl mice is not due to delayed neural crest cell migration into the first branchial arch or the tooth-forming region. Other abnormalities in Wnt1-Cre;Alk5fl/fl mice arise around E11.0, including facial cleft, malformed maxilla and smaller mandible, coinciding in time with the tooth initiation events. One can argue that delayed tooth initiation could be a secondary defect due to the malformed maxillary and mandible structures. To address this issue, we reviewed the studies of other mutants exhibiting similar phenotypes around E11.0. Alx3/Alx4 double mutant mice have severely truncated maxilla and mandible due to increased apoptosis around E10.5 (Beverdam et al., 2001). However, tooth development initiates normally in Alx3/Alx4 double mutant mice, and Shh and Bmp2 expression are indistinguishable from wild-type (Beverdam et al., 2001 and personal communication with Meijlink). Similarly, Msx1/Msx2 double mutant mice first display abnormalities around E10.5 including severely truncated maxilla and mandible, cleft palate and other craniofacial defects. However, the molar tooth germ initiation is unaffected in Msx1/Msx2 double mutant embryos (data not shown). Thus, we believe that delayed tooth initiation is not necessarily a secondary defect due to malformed craniofacial structures.

Increased apoptosis may result in tooth initiation and mandible patterning defects in Alk5 mutant embryos

To understand the basis for the delayed tooth initiation of Alk5 mutants, we analyzed proliferation and cell death patterns. We could not detect significant differences in proliferation. In Alk5 mutant embryos from E10.0 to E14.5, we did detect apoptosis in a restricted region in the mesenchyme of the outgrowing maxilla, mandible and frontonasal processes, whereas we did not detect apoptosis in control embryos. Within the mutant mandible, apoptosis is restricted to the proximal and aboral region. Increased apoptosis in the mandible and maxilla processes may result in facial cleft, malformed maxilla and truncated mandibles in the Alk5 conditional knockout mutant (Dudas et al., 2006). We detected increased apoptosis in a broad region of oral epithelium in Wnt1-Cre;Alk5fl/fl embryos at E12.5, whereas at other stages no signal was detected in the oral epithelium (see Fig. 7 and data not shown). The increased apoptosis in the epithelium might be responsible for causing the delay in tooth initiation in Wnt1-Cre; Alk5fl/fl mutant embryos. However, this delay must be an indirect effect of Alk5 signaling because our Wnt1-Cre mediated Alk5 inactivation is limited within the CNC-derived mesenchyme. Epithelial–mesenchymal interaction is essential for tooth development. Before E10.5 in mice, the dental epithelium is the source of induction signals (Mina and Kollar, 1987). From E11.5, the tooth induction ability shifts to the mesenchyme and the mesenchyme signals back to the epithelium. The loss of Alk5 in the mesenchyme must alter some mesenchymal signal to the epithelium, which is essential for dental epithelium cells survival at E12.5.

Alk5 acts upstream of Pax9 in the dental mesenchyme and is critical for mediating the survival of dental epithelium through epithelial–mesenchymal interaction

Epithelial–mesenchymal interaction is the key mechanism to initiate tooth germ formation. At E9.5 or E10.5, over 90% of cells within the first branchial arch mesenchyme are neural crest-derived (Chai et al., 2000; Zhao et al., 2006). Therefore, conditional knockout of Alk5 in the neural crest may have a strong impact on the epithelial–mesenchymal interaction. Pax9, Bmp4 and Msx1 are among the most important molecules in mediating epithelial–mesenchymal interaction. Pax9 is one of the earliest mesenchymal markers of prospective tooth formation sites. Tooth development is arrested at the bud stage in Pax9-deficient embryos and expression of both Bmp4 and Msx1 in the dental mesenchyme is substantially reduced in the absence of Pax9 (Peters et al., 1998). Pax9 dosage reduction in vivo results in a developmental delay affecting the entire dentition (Kist et al., 2005). Msx1 is a direct downstream gene of Pax9. Pax9 protein is able to bind to Msx1 directly and then cooperatively regulate BMP4 expression in the dental mesenchyme (Ogawa et al., 2005, 2006). In our study we have detected a dramatic reduction of Pax9, Msx1 and Bmp4 expression in the mesenchyme. Reduction of Pax9 and Msx1 expression can be seen at E10.5, which is earlier than any other altered gene expression. The reduced mesenchymal Bmp4 expression is seen at E11.5. Therefore we propose that Pax9 and Msx1 are upstream of Bmp4 in the Alk5-mediated signaling cascade (Fig. 10). Bmp4 expression fails to shift from the dental epithelium to the mesenchyme in Wnt1-Cre;Alk5fl/fl mutant samples. The mesenchymal Bmp4 expression may play a critical role in the survival of dental epithelium cells during tooth development. Previous study shows that loss of Bmp signaling results in upregulation of apoptosis in the ectoderm of the medial nasal process of Nestin-Cre;Bmpr1A mutant mice. (Liu et al., 2005).

Fig. 10.

Fig. 10

Schematic diagram illustrating the crucial role of Alk5 in tooth initiation and mandible patterning. The top panel depicts the roles of Alk5 in tooth initiation. Tooth development is directly related to Bmp4 expression in the dental mesenchyme. Mesenchymal Bmp4 expression is regulated by Msx1, which is the downstream target of Pax9. Bmp4 signal in the dental mesenchyme regulates the apoptosis in the epithelium. The bottom panel shows the role of Alk5 plays in mandible patterning and development. The expression patterns of Lhx6/7, Gsc, Alx4 and Pax9 at early stages are important for establishing oral–aboral and proximal–distal pattern of the mandible. Alk5 acts upstream of these genes and therefore controls the mandible patterning. In addition, Alk5 also affects expression of Msx1 and Bmp2, which are important for the development of the mandible structures.

Alk5 regulates mandible patterning

The mandible is not a symmetrical structure and its development involves pattern formation. The mouse mandible can be divided into distal, proximal, oral and aboral regions (Fig. 10). Loss of Alk5 mainly causes defects in the aboral and proximal region. Since Alk5 is widely expressed in the first branchial arch without any specific pattern from E10.5 to E15 (Seki et al., 2006 and Suppl. Fig. 1), the patterning defects in the Alk5 conditional knockout mutant is not due to the specific Alk5 expression pattern. Loss of Alk5 reduced expression of Gsc, Lhx6/7, Bmp2 and Alx4 which are all known to be important for craniofacial patterning and bone development. Goosecoid (Gsc) and Lhx6/7 help to establish the oralaboral patterning of the developing lower jaw (Tucker and Sharpe 2004) and they are expressed in the mandible in an antagonizing pattern. Gsc knockout mice display hypoplasia of the lower jaw and a reduction of the coronoid and angular processes (Yamada et al., 1995; Rivera-Perez et al., 1995). Loss of Lhx7 results in a phenotype of cleft palate with incomplete penetrance and other skull structures appear normal (Zhao et al., 1999). Lhx6 null mutation leads to defects in the neuron migration and no craniofacial defect is reported (Liodis et al., 2007). Because Lhx6 and Lhx7 share a similar expression pattern and high sequence homology, they may have redundant functions, which may explain the minor defects in each of the mutant (Zhao et al., 1999). Loss of Pax9 leads to defects primarily in the proximal mandible region (Peters et al., 1998). Alx4 expression is mainly localized to the distal mandible and maxilla processes. The Alx3/4 double mutants exhibit smaller mandibular and maxillary processes due to increased apoptosis (Beverdam et al. 2001). The reduced expression of these genes in Wnt1-Cre;Alk5fl/fl embryos suggests that Alk5 acts as a master gene upstream of them to regulate mandible bone patterning (Fig. 10). The mandible patterning defects are directly caused by apoptosis in the proximal and aboral regions. Reduced expression of Alx3/Alx4 leads to upregulation of apoptosis in the craniofacial region (Beverdam et al. 2001).

Gsc has been suggested to maintain the survival of the head mesenchyme-derived precursor cells (Rivera-Perez et al., 1999). In Pax9, Lhx6 or Lhx7 null mutant, cell death is not carefully studied (Peters et al., 1998; Yamada et al., 1995; Zhao et al., 1999; Liodis et al., 2007; Rivera-Perez et al., 1995). It remains unclear which pathway links these factors to the process of apoptosis. These results suggest that Alk5 regulates craniofacial patterning by mechanisms that involve control of cell survival (Fig. 10).

ALK5 mediates a TGF-β independent signaling pathway to regulate tooth initiation and mandible patterning

TGF-β has been shown to be able to signal through alternative type I receptors including ALK1 and ALK2 (Oh et al., 2000; Ebner et al., 1993). Since the tooth and mandible defects in Alk5 mutants are more severe than in Tgfbr2 mutants, it’s unlikely that the loss of Alk5 is compensated by other alternative type I receptors.

Loss of Alk5 leads to tooth initiation and mandible patterning defects not seen in Wnt1-Cre;Tgfbr2fl/fl mice, suggesting that ALK5 can function independent of TGF-β RII. To date, the only ligands identified for TGF-β RII are TGF-β1, 2 and 3. The expression of these three ligands in the tooth-forming region is not detectable before E13, when initiation has already been completed (Vaahtokari et al., 1991; Pelton et al., 1990). Likewise, craniofacial defects in Alk5 mutant embryos can first be morphologically identified at around E11.5 and increased apoptosis in specific regions is observed from E11.5 to E13.5, whereas the morphological defects in Tgfbr2 mutants are first detectable at around E13.5. Moreover, apoptosis in Tgfbr2 mutants is indistinguishable from wild-type embryos (Oka et al., 2007a). Expression of numerous mandible development related genes including Pax9, Gsc, Lhx6/7, Alx4, Bmp2 was reduced at early stages in Alk5 mutants, but we have detected no similar change in Tgfbr2 mutants (Oka et al., 2007a and data not shown).

Besides TGF-β, GDF8, 9 and 11 are also able to utilize ALK5 as its type I receptor (Mazerbourg et al., 2004; Rebbapragada et al., 2003; Andersson et al., 2006). GDF8 is mainly related to skeleton muscle regulation (McPherron and Lee, 1997). GDF9 is expressed mainly in oocytes (Carabatsos et al., 1998). Only GDF11 is expressed in the craniofacial region and related to the craniofacial development (Nakashima et al., 1999). GDF11 is hypothesized to signal through ALK5 to regulate the palate development (Dudas et al., 2006). GDF11 conventional knockout mice have cleft palate, but their tooth development is normal and no obvious mandible defect is present. (McPherron et al., 1999 and our data not shown). In addition, expression of GDF11 in the mandible arch is seen only at E10.5 and disappears after that. Then the expression of GDF11 in the tooth-forming region is not seen until the late cap stage at E15.5 (Nakashima et al., 1999). In our experiments, beads soaked with GDF11 failed to induce expression of Msx1, Msx2, Bmp4, or Pax9 in E10.5 first branchial arch mesenchyme (data not shown). In the future, we will utilize in vitro cell culture and biochemical approaches to examine whether GDF11 may signal through ALK5 to regulate downstream targets.

In summary, we have uncovered roles for Alk5 in the tooth initiation and mandible patterning. Loss of Alk5 alters early expression of numerous tooth initiation or mandible patterning genes including Bmp4, Msx1, Pax9, Alx4, Lhx6 and Gsc. Increased apoptosis in the first branchial arch leads to mandible patterning defects. Tooth initiation delay is due to increased apoptosis in the dental epithelium, which is an indirect effect of inactivation of Alk5 in the mesenchyme. Since all these phenotypes are absent in Tgfbr2 mutants, Alk5 regulates tooth initiation and mandible patterning in a Tgfbr2-independent manner.

Supplementary Material

1
NIHMS64619-supplement-1.jpg (1,007.5KB, jpg)
2
3
4

Acknowledgments

We thank Dr. Julie Mayo for critical reading of the manuscript and Marek Dudas for skillful technical help and discussion. This study was supported by grants from the National Institute of Dental and Craniofacial Research, NIH (DE012711 and DE014078) to Yang Chai.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ydbio.2008.03.045.

References

  1. Aberg T, Wozney J, Thesleff I. Expression patterns of bone morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in morphogenesis and cell differentiation. Dev Dyn. 1997;210:383–396. doi: 10.1002/(SICI)1097-0177(199712)210:4<383::AID-AJA3>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
  2. Acampora D, Merlo GR, Paleari L, Zerega B, Postiglione MP, Mantero S, Bober E, Barbieri O, Simeone A, Levi G. Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5. Development. 1999;126:3795–3809. doi: 10.1242/dev.126.17.3795. [DOI] [PubMed] [Google Scholar]
  3. Andersson O, Reissmann E, Ibáñez CF. Growth differentiation factor 11 signals through the transforming growth factor-beta receptor ALK5 to regionalize the anterior–posterior axis. EMBO Rep. 2006;7:831–837. doi: 10.1038/sj.embor.7400752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Beresford WA. Schemes of zonation in the mandibular condyle. Am J Orthod. 1975;68:189–195. doi: 10.1016/0002-9416(75)90207-9. [DOI] [PubMed] [Google Scholar]
  5. Beverdam A, Brouwer A, Reijnen M, Korving J, Meijlink F. Severe nasal clefting and abnormal embryonic apoptosis in Alx3/Alx4 double mutant mice. Development. 2001;128:3975–3986. doi: 10.1242/dev.128.20.3975. [DOI] [PubMed] [Google Scholar]
  6. Carabatsos MJ, Elvin J, Matzuk MM, Albertini DF. Characterization of oocyte and follicle development in growth differentiation factor-9-deficient mice. Dev Biol. 1998;204:373–384. doi: 10.1006/dbio.1998.9087. [DOI] [PubMed] [Google Scholar]
  7. Carda C, Silvestrini G, Gomez ME, Peydro A, Bonucci E. Osteoprotegerin (OPG) and RANKL expression and distribution in developing human craniomandibular joint. Tissue Cell. 2005;37:247–255. doi: 10.1016/j.tice.2005.03.002. [DOI] [PubMed] [Google Scholar]
  8. Chai Y, Maxson RE. Recent advances in craniofacial morphogenesis. Dev Dyn. 2006;235:2353–2375. doi: 10.1002/dvdy.20833. [DOI] [PubMed] [Google Scholar]
  9. Chai Y, Jiang X, Ito Y, Bringas P, Jr, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development. 2000;127:1671–1679. doi: 10.1242/dev.127.8.1671. [DOI] [PubMed] [Google Scholar]
  10. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors. 2004;22:233–241. doi: 10.1080/08977190412331279890. [DOI] [PubMed] [Google Scholar]
  11. Cobourne MT, Sharpe PT. Tooth and jaw: molecular mechanisms of patterning in the first branchial arch. Arch Oral Biol. 2003;48:1–14. doi: 10.1016/s0003-9969(02)00208-x. [DOI] [PubMed] [Google Scholar]
  12. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol. 1998;8:1323–1326. doi: 10.1016/s0960-9822(07)00562-3. [DOI] [PubMed] [Google Scholar]
  13. Dudas M, Kaartinen V. Tgf-beta superfamily and mouse craniofacial development: interplay of morphogenetic proteins and receptor signaling controls normal formation of the face. Curr Top Dev Biol. 2005;66:65–133. doi: 10.1016/S0070-2153(05)66003-6. [DOI] [PubMed] [Google Scholar]
  14. Dudas M, Kim J, Nagy A, Larsson J, Karlsson S, Chai Y, Kaartinen V. Epithelial and ectomesenchymal role of the type I Tgf-beta receptor Alk5 during facial morphogenesis and palatal fusion. Dev Biol. 2006;296:298–314. doi: 10.1016/j.ydbio.2006.05.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ebner R, Chen RH, Lawler S, Zioncheck T, Derynck R. Determination of type I receptor specificity by the type II receptors for TGF-beta or activins. Science. 1993;262:900–902. doi: 10.1126/science.8235612. [DOI] [PubMed] [Google Scholar]
  16. Feng XH, Derynck R. Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol. 2005;21:659–693. doi: 10.1146/annurev.cellbio.21.022404.142018. [DOI] [PubMed] [Google Scholar]
  17. Ito Y, Yeo JY, Chytil A, Han J, Bringas P, Jr, Nakajima A, Shuler CF, Moses HL, Chai Y. Conditional inactivation of Tgfbr2 in cranial neural crest causes cleft palate and calvaria defects. Development. 2003;130:5269–5280. doi: 10.1242/dev.00708. [DOI] [PubMed] [Google Scholar]
  18. Kaartinen V, Voncken JW, Shuler C, Warburton D, Bu D, Heisterkamp N, Groffen J. Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial–mesenchymal interaction. Nat Genet. 1995;11:415–421. doi: 10.1038/ng1295-415. [DOI] [PubMed] [Google Scholar]
  19. Kaufman MH. The Atlas of Mouse Development. Academic Press; San Diego: 1992. [Google Scholar]
  20. Kist R, Watson M, Wang X, Cairns P, Miles C, Reid DJ, Peters H. Reduction of Pax9 gene dosage in an allelic series of mouse mutants causes hypodontia and oligodontia. Hum Mol Genet. 2005;14:3605–3617. doi: 10.1093/hmg/ddi388. [DOI] [PubMed] [Google Scholar]
  21. Kriangkrai R, Chareonvit S, Yahagi K, Fujiwara M, Eto K, Iseki S. Study of Pax6 mutant rat revealed the association between upper incisor formation and midface formation. Dev Dyn. 2006;235:2134–2143. doi: 10.1002/dvdy.20875. [DOI] [PubMed] [Google Scholar]
  22. Larsson J, Goumans MJ, Sjostrand LJ, van Rooijen MA, Ward D, Leveen P, Xu X, ten Dijke P, Mummery CL, Karlsson S. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J. 2001;20:1663–1673. doi: 10.1093/emboj/20.7.1663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee SK, Kim YS, Oh HS, Yang KH, Kim EC, Chi JG. Prenatal development of the human mandible. Anat Rec. 2001;263:314–325. doi: 10.1002/ar.1110. [DOI] [PubMed] [Google Scholar]
  24. Liodis P, Denaxa M, Grigoriou M, Akufo-Addo C, Yanagawa Y, Pachnis V. Lhx6 activity is required for the normal migration and specification of cortical interneuron subtypes. J Neurosci. 2007;27:3078–3089. doi: 10.1523/JNEUROSCI.3055-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lu MF, Pressman C, Dyer R, Johnson RL, Martin JF. Function of Rieger syndrome gene in left–right asymmetry and craniofacial development. Nature. 1999;401:276–278. doi: 10.1038/45797. [DOI] [PubMed] [Google Scholar]
  26. Liu W, Sun X, Braut A, Mishina Y, Behringer RR, Mina M, Martin JF. Distinct functions for Bmp signaling in lip and palate fusion in mice. Development. 2005;132:1453–1461. doi: 10.1242/dev.01676. [DOI] [PubMed] [Google Scholar]
  27. Massague J. TGF-beta signal transduction. Annu Rev Biochem. 1998;67:753–791. doi: 10.1146/annurev.biochem.67.1.753. [DOI] [PubMed] [Google Scholar]
  28. Mazerbourg S, Klein C, Roh J, Kaivo-Oja N, Mottershead DG, Korchynskyi O, Ritvos O, Hsueh AJ. Growth differentiation factor-9 signaling is mediated by the type I receptor, activin receptor-like kinase 5. Mol Endocrinol. 2004;18:653–665. doi: 10.1210/me.2003-0393. [DOI] [PubMed] [Google Scholar]
  29. McPherron AC, Lee SJ. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A. 1997;94:12457–12461. doi: 10.1073/pnas.94.23.12457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. McPherron AC, Lawler AM, Lee SJ. Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat Genet. 1999;22:260–264. doi: 10.1038/10320. [DOI] [PubMed] [Google Scholar]
  31. Meijlink F, Beverdam A, Brouwer A, Oosterveen TC, Berge DT. Vertebrate aristaless-related genes. Int J Dev Biol. 1999;43:651–663. [PubMed] [Google Scholar]
  32. Melnick M, Witcher D, Bringas P, Jr, Carlsson P, Jaskoll T. Meckel’s cartilage differentiation is dependent on hedgehog signaling. Cells Tissues Organs. 2005;179:146–157. doi: 10.1159/000085950. [DOI] [PubMed] [Google Scholar]
  33. Mina M, Kollar EJ. The induction of odontogenesis in non-dental mesenchyme combined with early murine mandibular arch epith elium. Arch Oral Biol. 1987;32:123–127. doi: 10.1016/0003-9969(87)90055-0. [DOI] [PubMed] [Google Scholar]
  34. Nakashima M, Toyono T, Akamine A, Joyner A. Expression of growth/differentiation factor 11, a new member of the BMP/TGFbeta superfamily during mouse embryogenesis. Mech Dev. 1999;80:185–189. doi: 10.1016/s0925-4773(98)00205-6. [DOI] [PubMed] [Google Scholar]
  35. Ogawa T, Kapadia H, Wang B, D’Souza RN. Studies on Pax9-Msx1 protein interactions. Arch Oral Biol. 2005;50:141–145. doi: 10.1016/j.archoralbio.2004.09.011. [DOI] [PubMed] [Google Scholar]
  36. Ogawa T, Kapadia H, Feng JQ, Raghow R, Peters H, D’Souza RN. Functional consequences of interactions between Pax9 and Msx1 genes in normal and abnormal tooth development. J Biol Chem. 2006;281:18363–18369. doi: 10.1074/jbc.M601543200. [DOI] [PubMed] [Google Scholar]
  37. Oh SP, Seki T, Goss KA, Imamura T, Yi Y, Donahoe PK, Li L, Miyazono K, ten Dijke P, Kim S, Li E. Activin receptor-like kinase 1 modulates transforming growth factor-beta 1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci U S A. 2000;97:2626–2631. doi: 10.1073/pnas.97.6.2626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Oh SP, Yeo CY, Lee Y, Schrewe H, Whitman M, Li E. Activin type IIA and IIB receptors mediate Gdf11 signaling in axial vertebral patterning. Genes Dev. 2004;16:2749–2754. doi: 10.1101/gad.1021802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Oka K, Oka S, Sasaki T, Ito Y, Bringas P, Jr, Nonaka K, Chai Y. The role of TGF-beta signaling in regulating chondrogenesis and osteogenesis during mandibular development. Dev Biol. 2007a;303:391–404. doi: 10.1016/j.ydbio.2006.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Oka S, Oka K, Xu X, Sasaki T, Bringas P, Jr, Chai Y. Cell autonomous requirement for TGF-beta signaling during odontoblast differentiation and dentin matrix formation. Mech Dev. 2007b;124:409–415. doi: 10.1016/j.mod.2007.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Oshima M, Oshima H, Taketo MM. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol. 1996;179:297–302. doi: 10.1006/dbio.1996.0259. [DOI] [PubMed] [Google Scholar]
  42. Pelton RW, Dickinson ME, Moses HL, Hogan BL. In situ hybridization analysis of TGF beta 3 RNA expression during mouse development: comparative studies with TGF beta 1 and beta 2. Development. 1990;110:609–620. doi: 10.1242/dev.110.2.609. [DOI] [PubMed] [Google Scholar]
  43. Peters H, Neubuser A, Kratochwil K, Balling R. Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev. 1998;12:2735–2747. doi: 10.1101/gad.12.17.2735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Proetzel G, Pawlowski SA, Wiles MV, Yin M, Boivin GP, Howles PN, Ding J, Ferguson MW, Doetschman T. Transforming growth factor-beta 3 is required for secondary palate fusion. Nat Genet. 1995;11:409–414. doi: 10.1038/ng1295-409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ramaesh T, Bard JB. The growth and morphogenesis of the early mouse mandible: a quantitative analysis. J Anat. 2003;203:213–222. doi: 10.1046/j.1469-7580.2003.00210.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rebbapragada A, Benchabane H, Wrana JL, Celeste AJ, Attisano L. Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol. 2003;23:7230–7242. doi: 10.1128/MCB.23.20.7230-7242.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rivera-Perez JA, Mallo M, Gendron-Maguire M, Gridley T, Behringer RR. Goosecoid is not an essential component of the mouse gastrula organizer but is required for craniofacial and rib development. Development. 1995;121:3005–3012. doi: 10.1242/dev.121.9.3005. [DOI] [PubMed] [Google Scholar]
  48. Rivera-Perez JA, Wakamiya M, Behringer RR. Goosecoid acts cell autonomously in mesenchyme-derived tissues during craniofacial development. Development. 1999;126:3811–3821. doi: 10.1242/dev.126.17.3811. [DOI] [PubMed] [Google Scholar]
  49. Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Friedman R, Boivin GP, Cardell EL, Doetschman T. TGFbeta2 knockout mice have multiple developmental defects that are non-overlapping with other TGFbeta knockout phenotypes. Development. 1997;124:2659–2670. doi: 10.1242/dev.124.13.2659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sasaki T, Ito Y, Bringas P, Jr, Chou S, Urata MM, Slavkin H, Chai Y. TGFbeta-mediated FGF signaling is crucial for regulating cranial neural crest cell proliferation during frontal bone development. Development. 2006;133:371–381. doi: 10.1242/dev.02200. [DOI] [PubMed] [Google Scholar]
  51. Seki T, Hong KH, Oh SP. Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 2006;86:116–129. doi: 10.1038/labinvest.3700376. [DOI] [PubMed] [Google Scholar]
  52. Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113:685–700. doi: 10.1016/s0092-8674(03)00432-x. [DOI] [PubMed] [Google Scholar]
  53. Tucker AS, Sharpe P. The cutting-edge of mammalian development; how the embryo makes teeth. Nat Rev Genet. 2004;5:499–508. doi: 10.1038/nrg1380. [DOI] [PubMed] [Google Scholar]
  54. Tucker AS, Yamada G, Grigoriou M, Pachnis V, Sharpe PT. Fgf-8 determines rostral–caudal polarity in the first branchial arch. Development. 1999;126:51–61. doi: 10.1242/dev.126.1.51. [DOI] [PubMed] [Google Scholar]
  55. Vaahtokari A, Vainio S, Thesleff I. Associations between transforming growth factor beta 1 RNA expression and epithelial–mesenchymal interactions during tooth morphogenesis. Development. 1991;113:985–994. doi: 10.1242/dev.113.3.985. [DOI] [PubMed] [Google Scholar]
  56. van Genderen C, Okamura RM, Farinas I, Quo RG, Parslow TG, Bruhn L, Grosschedl R. Development of several organs that require inductive epithelial–mesenchymal interactions is impaired in LEF-1-deficient mice. Genes Dev. 1994;8:2691–2703. doi: 10.1101/gad.8.22.2691. [DOI] [PubMed] [Google Scholar]
  57. Wang J, Nagy A, Larsson J, Dudas M, Sucov HM, Kaartinen V. Defective ALK5 signaling in the neural crest leads to increased postmigratory neural crest cell apoptosis and severe outflow tract defects. BMC Dev Biol. 2006;6:51–65. doi: 10.1186/1471-213X-6-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wilkinson DG. Whole mount in situ hybridization of vertebrate embryos. In: Wilkinson DD, editor. In situ hybridization. IRL; Oxford: 1992. pp. 75–83. [Google Scholar]
  59. Yamada G, Mansouri A, Torres M, Stuart ET, Blum M, Schultz M, De Robertis EM, Gruss P. Targeted mutation of the murine goosecoid gene results in craniofacial defects and neonatal death. Development. 1995;121:2917–2922. doi: 10.1242/dev.121.9.2917. [DOI] [PubMed] [Google Scholar]
  60. Zhao Y, Guo YJ, Tomac AC, Taylor NR, Grinberg A, Lee EJ, Huang S, Westphal H. Isolated cleft palate in mice with a targeted mutation of the LIM homeobox gene lhx8. Proc Natl Acad Sci U S A. 1999;96:15002–15006. doi: 10.1073/pnas.96.26.15002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhao H, Bringas P, Chai Y. An in vitro model for characterizing the post-migratory cranial neural crest cells of the first branchial arch. Dev Dyn. 2006;235:1433–1440. doi: 10.1002/dvdy.20588. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS64619-supplement-1.jpg (1,007.5KB, jpg)
2
3
4

RESOURCES