Abstract
Most identified Drosophila appendage-patterning genes encode DNA-binding proteins, whose cross-regulatory interactions remain to be better characterized at the molecular level, notably by studying their direct binding to tissue-specific transcriptional enhancers. A fine-tuned spatio-temporal expression of bric-a-brac2 (bab2) along concentric rings is essential for proper proximo-distal (P-D) differentiation of legs and antennae. However, within the genetic interaction landscape governing limb development, no transcription factor directly controlling bab2 expression has been identified to date. Using site-targeted GFP reporter assay and BAC recombineering, we show here that restricted bab2 expression in leg and antennal imaginal discs relies on a single 567-bp-long cis-regulatory module (CRM), termed LAE (for leg and antennal enhancer). We show that this CRM (i) is necessary and sufficient to ensure normal bab2 activity in developing leg and antenna, and (ii) is structurally and functionally conserved among Drosophilidae. Through deletion and site-directed mutagenesis approaches, we identified within the LAE essential sequence motifs required in both leg and antennal tissues. Using genetic and biochemical tests, we establish that in the LAE (i) a key TAAT-rich activator motif interacts with the homeodomain P-D protein Distal-less (Dll) and (ii) a single T-rich activator motif binds the C2H2 zinc-finger P-D protein Rotund (Rn), leading to bab2 up-regulation respectively in all or specifically in the proximal-most ring(s), both in leg and antenna. Joint ectopic expression of Dll and Rn is sufficient to cell-autonomously activate endogenous bab2 and LAE-driven reporter expression in wing and haltere cells. Our findings indicate that accuracy, reliability and robustness of developmental gene expression do not necessarily require cis-regulatory information redundancy.
Author Summary
In insects, leg and antenna are homologous limbs, though derive from a single ancestral appendage. In Drosophila, leg and antennal development along the proximo-distal (P-D) axis relies on relatively-well known genetic cascades, in which most appendage-patterning genes encode transcription factors (TF). However, their cross-regulatory interactions remain to be better characterized at the molecular level. A fine-tuned expression of the bric-a-brac2 (bab2) gene is essential for normal leg and antennal segmentation. However, within the genetic cascades governing P-D limb development, no TF directly controlling bab2 expression has been identified to date. We show here that restricted bab2 expression in developing leg and antenna is governed by a single enhancer, termed LAE, which is necessary and sufficient in-vivo to ensure bab2 functions there. We show that leg and antennal cis-regulatory elements are closely associated and that essential LAE sites interact with Distal-less (Dll) and Rotund (Rn) TFs, leading to bab2 activation in all or specifically in the proximal-most expressing cells, respectively. Finally, joint ectopic expression of Dll and Rn is sufficient to instruct wing and haltere cells to up-regulate bab2. Taken together, our work indicates that a single enhancer is necessary and sufficient to reliably govern bab2 expression in distinct morphogenetic fields.
Introduction
Fine-tuned spatial and temporal transcriptional regulation is essential to ensure proper development [1], [2]. Reliability of developmental gene regulation is governed by tissue-specific cis-regulatory modules (CRM) or “enhancers”, often situated far away from gene promoters, whereas robustness and accuracy of gene expression could be ascribed to partially-redundant “shadow” enhancers [3]. Morphogenesis of the Drosophila adult leg along the proximo-distal (P-D) axis offers a good model to decipher how patterning genes are tightly controlled at the transcriptional level and integrated within the well characterized limb-specific genetic cascades [4]–[9]. Nevertheless, owing to the large number of leg patterning genes encoding DNA-binding proteins and the complexity of their cross interactions, it is a challenge to determine which transcription factors (TF) are directly implicated in the regulation of a given P-D gene and how they functionally interact upon binding to discrete DNA sites. Toward a full understanding at the molecular level of the genetic interaction landscape governing limb development, it is thus crucial to gain better knowledge of the CRM(s) controlling the fine-tuned expression of each member of the underlying gene regulatory network.
The Drosophila leg is composed of ten segments which are articulated to each other by characteristic joints [8]. The distal portion of the adult leg, the tarsus, is divided into five segments (ts1–5), and P-D tarsal patterning occurs by successive intercalations of new positional fates within the growing leg imaginal disc [5], [9]. Early on during this process, wingless and decapentaplegic signalling pathways regulate the expression of transcription factors encoded by Distal-less (Dll), dachshund (dac) and homothorax (hth) P-D genes [10]–[13]. Dll, dac and hth are activated in concentric domains that define the distal, medial and proximal parts of the adult appendages, respectively [14], [15]. Together with EGFR signalling emanating from the distal-most cells, these so-called leg “gap” genes in turn regulate downstream TF-encoding genes, that include spineless, rotund, bric-a-brac1/2, BarH1/2 and apterous, all expressed dynamically in the tarsal domain [5], [9]. Unlike the leg, in the antennal imaginal disc Dll and hth expression domains overlap, leading to the specific activation of spalt and cut [16]. Except for the regulation of the early-acting Dll and dac gap genes [14], [15], few direct interactions have been established within the leg and antennal P-D regulatory cascades. Here, we choose the bric-a-brac (bab) locus as a model to study the integrated regulation of P-D patterning genes implicated in distal leg and antennal segmentation.
The bab locus consists of two paralogous genes, bab1 and bab2, encoding BTB transcription factors [17], [18]. Although both genes are partially redundant in other developmental processes, only bab2 is indispensible for distal leg and antennal segmentation [17], [18]. However, both bab1 and bab2 display dynamic expression in similar restricted P-D sub-domains with distinct expression patterns between leg and antenna [17], [18]. Initially expressed homogeneously within the Dll-expressing distal domain in early-mid third-instar larvae (L3), the bab1/bab2 expression pattern in late L3 resolves to four concentric rings in the leg or two concentric rings in the antennal imaginal discs [17]. Later on at pupal and adult stages a P-D expression gradient within each ring is observed which is essential for ts2–4 and antennal a3–5 segment joint formation [17]–[19].
In both developing leg and antenna, all aspects of the bab2 expression pattern require the activity of the homeodomain Dll protein [19]–[21]. In addition to Dll, bab2 expression is dependent on spineless (ss), at the exclusion of the distal-most ring [19]. Indeed, spineless encodes a bHLH-PAS family TF that is transiently expressed in ts1–3 from early to mid L3 stage [19], [21], [22]. Of note, unlike leg, ss expression is maintained in developing antenna [22], notably under the direct control of Dll [23]. In addition to positive inputs from Dll and ss, bab2 expression is restricted proximally by dac activity [19] and distally by a gradient of EGFR signalling [21], [24]. Lastly, graded bab2 expression, both distally and proximally, has been linked to Notch signalling via a repressive effect of bowl activity [25], [26].
Although several bab2 regulators have been identified, to date none has been shown to be direct and no limb-specific CRM has been identified. Starting from a previous systematic identification of tissue-specific enhancers within the 150-kilobase (kb)-long bab locus performed by Williams et al. [27], we characterized here an evolutionarily-conserved 567 base pair (bp) CRM, which reproduces expression of the bab2 endogenous gene, both in leg and antennal tissues. This CRM (termed LAE, for leg and antennal enhancer) is physically and functionally conserved between D. melanogaster and D. virilis. We find that the LAE is both necessary and sufficient in-vivo to ensure proper bab2 expression in leg and antennal imaginal discs, and for normal segmentation of the mature appendices. Using targeted deletions and site-directed mutagenesis, we show that leg and antennal cis-regulatory elements are closely associated. Furthermore, activation of bab2 expression in proximal- and distal-most rings is dependent on separate DNA elements. Moreover, we show that discrete essential LAE sites interact with Distal-less and Rotund transcription factors leading to bab2 activation in all or specifically in the proximal-most expressing cells, respectively. Finally, ectopic co-expression of Dll and Rn is sufficient to instruct wing and haltere cells to up-regulate bab2. Taken together, our work indicates that a single enhancer, under the direct control of the P-D proteins Dll and Rn, is necessary and sufficient to reliably govern Drosophila bab2 expression in distinct limb morphogenetic fields.
Results
A conserved cis-regulatory module recapitulates limb-specific bab2 expression
A systematic study of the 150-kb bab locus identified leg-specific cis-regulatory elements within a 11 kb region encompassing two overlapping genomic fragments (termed BP42 and BP47) localized between the bab1 and bab2 transcription units (Figure 1A) [27]. Both BP42 and BP47 fragments also reproduce the antennal bab2 expression (Supplementary Figure S1). To identify limb-specific bab CRMs, we further dissected the relevant 11-kb region, using a sequence-directed GFP reporter assay (see Materials and methods) [28]. Six overlapping genomic fragments (#1 to 6) (Figure 1A) were examined for GFP expression in both developing leg and antenna. Only fragments #3 and #4 drove strong GFP expression in leg as well as antennal tissues (Figure S1) indicating that the relevant cis-regulatory information is located within the 1.5 kb sequence shared by BP42 and BP47. In confirmation of this, a fragment (#7) containing only this 1.5 kb region was sufficient to reliably reproduce bab2 expression in leg and antennal tissues (Figure S1).
Before dissecting further the 1.5 kb fragment, we examined its evolutionary conservation among 12 Drosophila species whose genome sequences were available [29]. LAE sequences were identified and aligned. Only three >20 bp motifs (termed CR1-3) are highly conserved among Drosophilidae (Figures 1B and S2). We therefore tested the activity of a 567-bp fragment (#8) encompassing the CR1-3 motifs, and found that its activity faithfully recapitulated spatial and temporal bab2 expression in both developing leg and antenna (Figure 1C–D). From two Drosophilidae species having diverged 40–60 millions years ago, we then tested the equivalent 0.7-kb D. virilis region and found that its regulatory activity was similar to that of the D. melanogaster LAE (Figure 1D, compare G–G′ and H–H′ to E–E′ and F–F′, respectively), supporting the functional importance of the conserved CR1-3 motifs. Taken together these data indicate that the evolutionarily-conserved 567-bp region contains regulatory information sufficient to recapitulate limb-specific bab2 expression, both in developing leg and antenna. We therefore termed this region LAE, for leg and antennal enhancer.
LAE is necessary and sufficient for bab2 expression and function in-vivo
To define whether the LAE is also necessary to ensure normal bab expression in-vivo, we used a P[acman] BAC construct (26B15) [30], including the bab2 transcription unit and the LAE-containing intergenic region (see Figure 1A). Adults homozygous for the babAR07 null allele display shortened tarsi with segmental joint fusions, particularly the fully penetrant fusion of ts4–5 (Figure 2A–B) [18]. A single copy of the intact 26B15 BAC construct was sufficient to restore normal Bab2 protein expression in both developing leg and antenna (Figure 2A, J and O, respectively), as well as to rescue bab mutant phenotypes (Figure 2A–B, arrowheads in E), suggesting the lack of a remote shadow enhancer located within bab1 or elsewhere in the vicinity of the bab locus. In contrast, no appendage-specific Bab2 expression could be detected for a LAE-deleted version of the 26B15 BAC construct (Figure 2A–B, K and P). Further, phenotypic rescue could neither be observed (Figure 2A–B, see arrows in F). We conclude that in our experimental conditions the LAE cis-regulatory module appears to be strictly required for bab2 expression and function in developing limbs. Of note, the wild-type 26B15 BAC and its LAE-minus version were both capable of partially restoring dominant abdominal pigmentation defects of babAR07 heterozygous females (Figure S3) (see discussion).
To ask whether the LAE is also sufficient to ensure normal Bab2 expression in developing limbs, we then tested the ability of an LAE-driven bab2 cDNA construct (LAE-bab2cDNA) to rescue babAR07 phenotypes. Normal leg segmentation and limb-specific Bab2 expression were restored by a single copy of the LAE-bab2cDNA construct (Figure 2A–B, G, L and Q), demonstrating that the LAE is both essential and sufficient for limb-specific bab2 expression and function.
LAE includes shared leg and antennal regulatory information
To functionally dissect the LAE, we tested serially truncated constructs removing either 3′ or 5′ sequences (Figure 3). Deletion of 89 bp at the 3′-end (F3 construct), that removed the CR3 motif, led to a modest decrease in GFP expression (72 and 77% of signal strength, compared to the entire LAE, in leg and antennal tissues, respectively) without affecting expression in the right cells (Figure 3, B–B′ and I–I′). Deletion of 248 additional bp (S5 construct) further reduced the level of expression (35 and 32% in leg vs. antenna) (Figure 3, C–C′ and J–J′, respectively). Deletion of 93 additional bp at the 3′-end (S1 construct), removing the CR2 sequence, led to a drastic reduction of the signal strength (10 and 3%), with a nearly-complete loss of GFP expression in the distal-most bab2-expressing cells, in either leg or antennal tissues (Figure 3, arrows in D–D′ and K–K′, respectively). Of note, a deletion of 37 additional bp, non-strictly-conserved across all Drosophilidae, led to nearly-complete loss of all rings (not shown), indicating their critical role. These 3′-deletion data support the following conclusions: (i) 327 bp from the 3′ half, including CR3, are required for signal intensity; (ii) whereas the remaining 230 bp from the 5′-half, including CR1-2, are sufficient for limb-specific expression, among which (iii) 93 bp encompassing CR2 are required for making the distal bab2-expressing ring.
Conversely, a 100-bp 5′ deletion removing the CR1 sequence (F1 construct) led to complete loss of limb-specific GFP expression (Figure 3, F–F′ and M–M′). This indicates a key regulatory function for CR1 in all bab2-expressing leg and antennal cells. Nevertheless, the 68-bp CR1 sequence alone (B1 construct) did not drive either leg- or antennal expression (Figure 3, G–G′ and N–N′, respectively). These data indicate that CR1 is critical but not sufficient for GFP-reporter activity in both developing appendages. As the CR2-containing F1 construct deleted for CR1 did not allow GFP expression (above), we conclude that CR2 is also not sufficient for LAE activity in the distal-most bab2-expressing ring.
Given that the CR1 sequence is not sufficient for LAE activity, we then examined the functional significance of the poorly-conserved 32-bp-long 5′-flanking region (see Figure S2). Its deletion (S3 construct) led to reduced expression levels in the two proximal-most leg rings (spanning tarsi ts1–2 and ts2–3) and the proximal antennal ring (spanning a3–4 segments) (Figure 3, brackets in E–E′ and L–L′, respectively), but specificity retained (i.e., expression in the right cells at the late L3 stage).
Taken together these data indicate that (i) the entire LAE is required to recapitulate normal spatial, temporal and quantitative bab2 expression patterns; (ii) leg and antennal expression employ shared regulatory information; (iii) the 337 bp 3′-part is only required for signal strength; and finally (iv) the 230 bp 5′-part is critical for signal specificity, with a key role of the CR1 sequence, while the 32 bp 5′-end and CR2 sequences are required quantitatively for normal expression levels in the proximal- and distal-most rings, respectively.
CR1 includes separate activating and repressive regulatory elements
Its central role in limb-specific expression led us to dissect the 68-bp-long CR1 sequence by substituting each 8 bp by a linker sequence (see Materials and methods) (Figure 4A). Though all eight CR1-mutated LAE constructs (LS1-8) detectably affected GFP expression qualitatively and/or quantitatively (Figures 4B and S4), four (LS1, 2, 5 and 8) displayed strong defects. LS2 showed almost complete loss of GFP expression in both leg and antennal tissues (Figure 4B, E–E′ and J–J′, respectively), indicating it affects a crucial positive input. LS1 led to strong up-regulation in inter-ring cells in the developing leg (Figure 4B, arrows in D–D′), suggesting a distinct role in inter-ring suppression. LS5 showed globally decreased GFP expression (30%), but more pronounced in the proximal-most leg and antennal ring (Figure 4B, brackets in F–F′ and K–K′, respectively). Finally, LS8 displayed decreased GFP expression specifically in the proximal-most bab2-expressing ring, again in both leg and antennal tissues (Figure 4B, brackets in G–G′ and L–L′, respectively). As to milder effects of other mutants, (i) the LS4 and LS6 constructs displayed a partial GFP intensity decrease in the proximal-most ring, particularly marked in leg tissues; (ii) LS7 showed a partial inter-ring de-repression in leg tissues; (ii) whereas LS3 and LS6 exhibited a slight GFP intensity decrease specifically in antennal tissues (50% each) (Figure S4).
Taken together these site-directed mutagenesis data indicate (i) tightly-associated leg and antennal CR1 regulatory information, and (ii) that the LS2 sub-sequence is indispensible for LAE activity.
Distal-less is the central direct bab2 activator in developing appendages
Having identified key cis-regulatory DNA elements, we next sought positively acting factors that directly bind there. We noticed that the critical LS2 motif is embedded within an A/T-rich sequence (AAAATTAATGGTAATAA), including three potential homeodomain (HD)-binding sites (TAAT or ATTA motifs) of which two were disrupted in the LS2 mutant. Given that HD-containing Dll protein is cell-autonomously required for bab2 expression [21], we therefore examined whether the LAE-GFP reporter also requires Dll activity, using clonal analysis. As for endogenous bab2, GFP expression was abolished in mutant leg and antennal clones for DllSA1, a protein-null allele (Figure 5A, D–D″′ and E–E″′, respectively). This indicates that Dll is cell-autonomously required for LAE regulatory activity, and therefore suggest a direct binding of the HD-containing Dll transcription factor to the LAE, potentially through the key activating LS2 motif within CR1.
In addition to the 3 present in CR1, the entire LAE comprises 8 additional putative HD-binding sites of which 7 are clustered within the CR2 and CR3 sequences (Figures 5B and S2). To test whether Dll is able to bind in-vitro to the TAAT/ATTA-containing LAE sequences, we used an electrophoretic mobility shift assay (EMSA). All LAE fragments including one to six of the 11 TAAT/ATTA motifs bound in-vitro translated Dll, albeit with distinct affinities (Figure 5B). Unexpectedly, given the key role in-vivo of the LS2 region, each TAAT or ATTA site in CR1 showed rather low in-vitro affinity (DNA fragments #1–2), when tested individually. We therefore examined whether Dll binds with a higher efficiently to a larger DNA fragment including the three TAAT/ATTA motifs present in CR1 (i.e., AAAATTAATGGTAATAA). As a matter of fact, Dll strongly bound this extended fragment (#6) (Figure 5B). Furthermore, stable interaction was strictly dependent upon the three TAAT/ATTA motifs. Whereas singly-mutated (TAAT vs. CCCC) fragments bound Dll with lower affinity, the mutation of the double overlapping TAAT/ATTA sites (ATTAAT vs. CCCCAT; probe #9) showed a stronger effect, while Dll binding was abolished when all three TAAT/ATTA motifs were mutated (probe #7).
To investigate whether the extended AT-rich sequence mediates in-vivo regulation by Dll, we then introduced the same TAAT-mutated sequence (i.e., CAAACCCCATGGCCCCAAGCA) into the LAE-GFP reporter (H4 construct). The H4 construct no longer expressed GFP either in leg or antennal tissues (Figure 5C, F–F′ and G–G′, respectively), indicating that these three HD-binding sites are crucial for LAE activity in-vivo. Surprisingly, mutation of the two overlapping TAAT/ATTA motifs was silent in-vivo (LS3 mutant; Figure 4B). In fact, a new HD-binding site capable of stably interacting with Dll in-vitro (not shown) has been fortuitously created in LS3 (see Figure 4A), providing a likely rationale for this discrepancy.
Taken together, in-vitro and in-vivo data establish that Dll-dependent activation of bab2 expression in developing leg or antenna, involves direct binding to the conserved HD-binding sites of the CR1 regulatory sequence.
Rotund only contributes to bab2 activation in proximal leg and antennal rings
Having shown above that normal LAE activity in the proximal-most bab2-expressing cells is mediated by its 32-bp 5′-end region (R32) (Figure 3, E–E′ and L–L′), we then sought for candidate transcription factors encoded by known limb P-D patterning genes. One, spineless, has been previously shown to regulate bab2 expression in the leg proximal-most rings [19]. However, we found no evidence for any putative binding site for the Ss/Tango bHLH-PAS heterodimer (GCGTG) [31], [32] in R32, and even in the entire LAE. A second candidate was rotund (rn), a spineless target gene [9], [33] encoding a C2H2 zinc-finger protein and whose expression corresponds to proximal tarsal segments [9]. First, we compared expression patterns of both genes, using rn-Gal4 and UAS-GFP constructs. GFP expression takes place in the right cells and at the right time [34], but is still detected beyond the mid L3 stage due to perdurance of Gal4 and GFP proteins. At late L3 stage, perduring rn-Gal4 expression is only detected in the proximal-most Bab2-expressing tissues, and extends more proximally than bab2, particularly in antennal tissues (Figure 6, A–A″′ and B–B″′; see yellow and white brackets, for distal versus proximal bab2-only and rn-only expressing cells, respectively). To analyse the role of rn on bab2 and LAE-driven expression, we generated mitotic clones (GFP deficient) of cells homozygous for the rn16 null allele. Strong cell-autonomous reduction of endogenous bab2 (in blue) and LAE-RFP reporter (in red) expression was then observed for leg and antennal clones overlapping the proximal-most bab2-expressing rings (Figure 6, C–C″′ and D–D″′, respectively). This indicates that rn activity on bab2 is spatially restricted and contributes to bab2 expression only in ts1–2 leg and a3–4 antennal tissues.
Rotund directly activates bab2 through the LAE T-rich 5′end region
Next, we examined whether the Rn protein activates bab2 expression via the R32 sequence at the LAE 5′end, specifically required for GFP reporter expression in the proximal-most tarsal and antennal bab2-expressing ring(s). To further confirm its functional requirement, we deleted the R32 sequence in the context of the 230-bp S5-GFP construct (Figure 3), recapitulating leg and antennal bab2 expression, although with lower level than the full size LAE (Figure 7A, D–D′ and G–G′, respectively). The R32-deleted S5 fragment (S10) drove relatively strong GFP expression in the distal-most ring but only very weakly in the proximal-most ring(s), particularly in antennal tissues (Figure 7A, brackets in E–E′ and H–H′). These data confirm that the R32 sequence is required for full LAE-driven expression in proximal bab2-expressing cells in both tarsal and antennal tissues.
The R32 sequence includes a 6-bp-long oligo-T track (T6) embedded within a 13-bp-long T-rich (T13) sequence (TTCGTTTTTTGTT), that resembles binding sites for the vertebrate Rn homolog [35]. To test whether the Rn protein is able to bind effectively to T13 in LAE, EMSA experiments were performed with DNA probes covering either the T13 sequence (probe #1) alone or the complete R32 sequence (#2) (Figure 7B). Though in-vitro translated Rn bound both probes, the R32 fragment was bound about 5-fold more than T13 (Figure 7B, compare lanes 1 and 2). R32 includes a sequence matching the consensus binding site for Drosophila Rn, as determined by recent bacterial one-hybrid binding site data [32] (see Figure 7B). The T6 track appeared critical for specific binding, as R32 and T13 fragments mutated in the T6 track (probes #3–4) were not stably bound by Rn. The EMSA experiments thus indicate that the LAE T13 region constitutes a strong binding site for Rn.
To examine the functional importance of the Rn binding site in-vivo, we added the T13 sequence to the truncated S10 construct to yield the H3 construct. We found that the H3-GFP reporter activity in leg and antennal tissues was similar to that of S5-GFP (Figure 7A, brackets in F–F′ and I–I′, respectively). Even though the GFP expression level remained somewhat low in the developing antenna, we conclude that the T13 sequence is sufficient for GFP-reporter activation in the proximal-most bab2-expressing rings in both the leg and antennal imaginal discs. To further confirm that T13 is essential to mediate direct up-regulation of bab2 by the Rn activator, we performed rotund gain-of-function (GOF) experiments, using the S5 and S10 reporter constructs. Ectopically-expressed Rn (Dll>Rn) activated endogenous bab2 and S5-GFP expression throughout the Dll-expressing leg and antennal cells (Figure 7C, J–J′ and L–L′, respectively), whereas the T13-deficient S10 construct displayed GFP expression neither in leg nor in antennal tissues (Figure 7C, K–K′ and M–M′, respectively). Surprisingly, the normal GFP-expressing rings of cells were also no longer detected, suggesting that Rn protein behaves as an indirect repressor, in addition to being a direct bab2 activator through the T13 sequence.
Taken together with the clonal analyses, we deduce that (i) Rn activity is necessary (in proximal but not in distal rings) and sufficient (when ectopically expressed throughout the Dll domain) for bab2 and LAE-driven activation and (ii) this regulation is direct, via Rn binding to the LAE T13 sequence.
Joint ectopic expression of Dll and Rn is sufficient to activate bab2 in dorsal limb tissues
The above experiments indicated that both Dll and Rn are required together for full bab2 and LAE-dependent reporter activation. This raised the possibility that Dll and Rn together can instruct cells to up-regulate the LAE. To investigate their joint instructive properties, we mis-expressed Dll, Rn or Dll+Rn in wing, haltere and eye tissues using flip-out GOF experiments [36]. bab2 is weakly expressed in restricted domains in developing dorsal appendages (around the wing pouch and in the haltere pouch [19]) but silent in eye tissues. Of note, LAE-driven reporter expression could not be detected either in developing wing, haltere or eye (not shown).
Sustained ectopic expression of Dll protein in developing wing disc induces the entire leg P-D differentiation program including bab2 expression [37]. We therefore used an hsp70-Flp construct to generate small or even single cell clones through heat induction in second- or third-instar larval tissues. In such conditions, mis-expressed Dll appeared inefficient in ectopically activating bab2 as well as LAE-RFP expression in eye, wing and haltere discs (0/50, 9/180 and 0/150 examined clones, respectively) (Figure 8, A–A″′; not shown). Significantly, the few RFP positive clones in the wing disc all corresponded to cells that normally express bab2 (not shown). In equivalent analyses with mis-expressed Rn, eye, wing and haltere clones induced neither endogenous bab2 nor LAE-RFP expression (n>50 for each tissue) (Figure 8, B–B″′; not shown), even in wing and haltere cells normally expressing bab2. In striking contrast, on co-expressing Dll+Rn proteins, a large proportion of examined wing and haltere clones (120/180 and 130/180, respectively) cell-autonomously activated both bab2 and LAE-RFP expression (Figure 8, C–C″′; not shown). Further, in most of the LAE-RFP non-expressing wing and haltere clones, Dll protein was not detectably accumulated (not shown). Significantly, eye clones co-expressing Dll+Rn failed to activate endogenous bab2 and LAE-driven reporter genes (not shown), indicating tissue specificity for their joint instructive properties. These data establish that ectopic co-expression of Dll and Rn is sufficient in instructing dorsal appendage cells to activate endogenous bab2 and LAE-driven reporter expression, presumably adopting a “proximal-ring transcriptional mode”, supporting (i) their direct binding to the LAE and (ii) a tissue-specific functional synergy involving these two transcription factors.
Discussion
In this report, we have characterized a 567-bp-long evolutionarily-conserved enhancer element ensuring bab2 expression in distal leg and antennal epithelial cells, from larval to adult stages. In contrast to the view that enhancer redundancy be a rule of thumb for developmental genes [38], our rescue experiments indicate that this single CRM isolated from 150 kb of the bric-a-brac locus is both necessary and sufficient to reliably govern gene expression in distinct limb morphogenetic fields. Further, we have shown that (i) the LAE regulatory activity is under the direct control of Dll, (ii) full expression in proximal-most rings depends on the direct binding of Rn, and (iii) each transcription factor interacts with a single critical binding site. Lastly, joint mis-expression of both Dll and Rn is sufficient to ectopically up-regulate endogenous bab2 as well as LAE-RFP expression in wing and haltere cells.
Leg versus antennal bab2 regulation
The Drosophila leg and antenna are thought to be homologous structures evolved from a common ancestral appendage, as shown by leg-to-antenna or antenna-to-leg transformations caused by mis-expression of P-D patterning or homeotic genes [16], [22], [39]–[42]. To our knowledge, bab2 is the first example of a developmental gene for which a single transcriptional enhancer is shown to be both necessary and sufficient to accurately ensure a complex gene expression pattern in distinct limb morphogenetic fields. As none of our mutated LAE constructs specifically affected antennal or leg expression, our findings thus support the idea that an ancestral P-D genetic cascade emerged before limb diversification in insects.
LAE comprises separate signal specificity and intensity booster regions
bab2 expression in developing leg and antennal discs is dynamic and complex, going from broad regional expression at early L3 stage to precisely positioned rings, and later on, to graded expression at pupal and adult stages [17]–[19]. Limb-specific regulation occurs through the 230-bp-long 5′ half of the LAE, which integrates positive inputs from both Dll and Rn transcription factors, whereas the 327-bp-long 3′ half appears to be required for signal amplification to confer robust expression, but is unable alone to drive any GFP-reporter expression. The presence of this signal intensity “booster” could explain the apparent lack of shadow enhancer [38], as indicated by our phenotypic rescue experiments (Figure 2). Conversely, the 26B15 BAC construct partially rescues the bab mutant abdominal pigmentation defects (Figure S3), suggesting it may contain a shadow enhancer to assist the abdominal cis-regulatory elements identified previously within the bab1 transcription unit (i.e., excluded from the 26B15 BAC; see Figure S3) [27]. Even though we cannot formally exclude that the bab locus includes a remote secondary enhancer assisting the LAE in other environmental or genetic backgrounds, our data suggest that a single locus can harbor both partially-redundant (abdominal) and “master” (limb) tissue-specific transcriptional enhancers with distinct functional constraints.
The Dll protein is a necessary, but not sufficient, general limb-specific bab2 activator
In this study, we have established that bab2 is a direct target of the Dll homeodomain-containing transcription factor, acting through at least the critical AAATTAATGGTAAT composite binding site present in the CR1 sequence (Figure 9A). Interestingly, similar A/T-rich Dll binding sites are also present in enhancers of ss and dac (i.e., AATTTAATGGTAAA and AAATTATATTTAAT, respectively), two other direct Dll target genes [15], [23], suggesting a conserved CRM grammar for Dll-regulated genes. Although Dll protein is expressed throughout the larval, pupal and adult stages, onset of bab2 expression starts only at the early-mid L3 stage, in the form of a circular domain within the Dll-expressing distal territory (Figure 9B) [19]. Consistently, we have shown that the Dll transcription factor is required but not sufficient for cell-autonomous bab2 expression (Figure 8A). In addition to the critical CR1 TAAT-rich sequence, we have shown that Dll protein also binds strongly in-vitro to the other HD-binding sites (Figure 5B). It is thus formally possible that the Dll transcriptional activator may contribute to the signal intensity “booster” effect of the LAE 3′-half (Figure 9A). However, signal boosting sequences situated in the middle of the LAE (i.e., between positions 231–478; see Figure 3) do not contain TAAT motifs, indicating that at least one other activating transcription factor is involved. In conclusion, in addition to Dll, characterization of new TF(s) interacting with LAE 3′-half sequences may help to better understand CRM activity, both in terms of tissue specificity and expression enhancement.
Rotund protein: a proximal-specific intermediate between spineless and bab2?
The specific requirement for rotund activity in bab2 proximal regulation contrasts with data reported in St-Pierre et al. [34], showing apparently normal bab2 expression in rn mutant leg discs. However, although a large bab2-expressing ring does indeed appear in mid L3 rn mutant larvae, the mature 4-ring pattern never emerges later on, and instead two presumably-distal rings are detected at late L3 stage (not shown). For the first time, we report that ectopically-expressed Rn protein is sufficient to activate and maintain bab2 throughout the Dll expression domain, in both developing leg and antenna (Figure 7C). In light of the dependence of rn expression in leg ts1–3 tissues on ss activity [9], our data may provide a rationale for why ss activity is required in proximal bab2 regulation [19]. Moreover, Dll and Rn transcriptional activators, that are both necessary for full bab2 expression in leg and antennal proximal-most ring cells, are also jointly sufficient to ectopically activate bab2 (and LAE-RFP reporter) expression in wing and haltere but not in eye tissues, thus forming a context-specific instructive couple. The molecular basis of their functional synergy remains to be deciphered. Furthermore, in the proximal bab2-expressing domain, Dll and Rn are likely to function together with additional, still-unknown activators binding to LS4–5 and LS8 sequences (Figures 4B and S4B), and whose identification will certainly provide insights into the tissue specificity of the LAE.
Molecular bases for transient activity of Rn on bab2 expression in developing leg?
Rotund transcription factor is required for proximal bab2 expression in both legs and antennae. However, unlike antenna, rn (and spineless) expression is transient in leg tissues. In addition to their previously described roles in ts1–3 growth [9], [33], we propose that transiently-expressed ss and rn counteract repressive activities of dac and/or bowl, both of which are dynamically expressed during the critical L3 stage [9], [25]. In fact, de Celis and Bray [25] anticipated that a transiently-expressed bab2 activator should be present to relieve transient repression by bowl. Consistent with this view, ss activity represses bowl (and dac) expression [25], [33], in addition to its role in rn activation. As bowl (and dac) expression has decayed in the tarsal cells which earlier transiently expressed ss and rn, maintenance of bab2 expression would no longer require Rn activity. Maintenance of antennal Rn (and Ss) expression may in fact counteract additional bab2 repressors whose expression persists throughout development, such as hth and spalt (Figure 9B) [19]. Identification of repressive elements within the LAE will help address these issues. None of 16 different LAE reporter constructs displayed detectable de-repression in the proximal- and distal-most territories, suggesting thus the existence of functionally-redundant repressive DNA elements or alternatively of a competition between transcriptional repressors and activators for binding to the same sites. Of note, site-directed mutagenesis identified a leg inter-ring repression element (LS1 motif) at the CR1 3′-end. Inter-ring repression has been linked to Notch signalling [25]. However, the absence of putative Su(H) binding sites from the LAE sequence suggests that Notch-mediated repression is likely to be indirect. As the LS1 repressive motif is precisely located in the immediate vicinity of the critical composite HD-binding site (Figure 9A), competitive binding processes may well operate between Dll and LS1-bound repressor(s). Whatever the nature of the latter, a functional link with Dac, a non-specific DNA binding protein known to function as part of a multi-protein complex [43], certainly will deserve to be investigated.
A model for bab2 regulation in developing limbs
Our findings, coupled with results of previous studies [19], allow us to propose a model for distal limb-specific bab2 regulation (Figure 9). bab2 expression starts during the early-mid L3 stage at about 84 hours (hr) after egg laying (AEL) as a circular domain nested within the earlier-initiated Dll expression domain [44]–[46]. Our data indicate that Dll is required but not sufficient to activate bab2. We suppose that a hypothetical distal activator (X) binding to CR2 (Figure 9A) may contribute to the onset of bab2 expression. In response to EGFR signalling, bab2 down-regulation in the distal-most leg territory occurs in mid L3 tissues (at ∼90–96 hr AEL), giving rise to a single large ring (Figure 9B, depicted in dark green). Note that EGFR-mediated bab2 repression has not been yet described in the distal antenna. From about the same stage, as rotund expression starts (∼84–96 hr AEL), a second ring emerges proximally, both in the antenna and the leg tissues (Figure 9B, light green). By late L3 stage (120 hr AEL), bab2 expression consists of two well-separated rings in the developing antenna and of four concentric rings of distinct intensities in the developing leg. The two proximal-most rings (light green), depending on transient Rn activity, and the two distal-most rings (dark green) emerge both by tarsal growth and inter-ring down-regulation (through at least the LS1-binding repressor). Of note, rotund activity is indirectly required for the appearance of the two distal-most rings, due to its role in ts3 growth [9]. Lastly, in the developing leg, precise ring positioning depends on repression by EGFR and Notch signalling [21], [24], the molecular bases for their action remaining to be deciphered.
LAE is under strong evolutionary constraints among Drosophilidae and beyond
The LAE identified in the present work is systematically located between bab1 and bab2 transcription units of 22 Drosophilidae species for which the entire bab locus sequence is available (not shown). This suggests strong topological constraints during evolution. As (i) the duplicated bab genes are merely co-expressed during leg and antennal development [17], (ii) we have shown a critical role of the LAE in ensuring bab2 expression (this study) and (iii) no other limb-specific cis-regulatory regions could be identified within the 150-kb bab locus [27], we thus infer that the LAE is likely to reliably govern bab1 expression as well. Consistent with our assumption that strong functional constraints have operated during evolution, a LAE-like sequence with partially conserved CR1-2 sequences is even present between paralogous bab1 and bab2 genes of the tsetse fly Glossina morsitans (Figure S5A and not shown), which diverged from Drosophilidae about 260 million years ago [47]. Furthermore, we have shown that the LAE from D. virilis ensures normal regulatory functions in D. melanogaster. Although strongly conserved among Sophophora subgenus species (i.e. D. melanogaster group), the T13 Rn-binding site is poorly conserved in D. virilis and related Drosophila subgenus species (Figure S5B). It is formally possible that Rn has been co-opted recently in the Sophophora subgenus. Alternatively, D. virilis Rn could act through subgenus-specific LAE sequences. Consistent with this hypothesis, a T13-related sequence, only conserved among Drosophila subgenus species, is located between CR1-2 (Figure S5B). Investigating the molecular basis of Rn action in the positive regulation of bab2 may provide an entry point to tackle these evolutionary issues.
Materials and Methods
Fly stocks, culture and genetic manipulations
Drosophila lines were grown on standard yeast extract-sucrose medium. The vasa-PhiC31 ZH2A attP stock was kindly provided by F. Karch and was used to generate most of the transgenic GFP and RFP reporters and the two P[acMan] BAC constructs. rn or Dll mutant clones were generated by 30 minute (mn) heat shocks at 38°C, in early first- to late second-instar larvae of genotypes: (i) y w hsFlp; FRT82B Ub-GFP/FRT82B rn16 and (ii) y w hsFlp; arm-lacZ FRT42D/DllSA1 FRT42D, respectively. Flip-out clones over-expressing either Dll, Rn or both Dll plus Rn were generated by 40mn heat shocks at 38°C, in second- or third-instar larvae of genotypes: (i) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Dll, (ii) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Rn1 and (iii) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Dll UAS-Rn1, respectively. UAS-GFP.[S65T], UAS-Rn1 and rn-Gal4 lines were obtained from the Bloomington stock center. UAS-Dll and DllEM212-Gal4 line were provided by S. Cohen and M. Suzanne, respectively.
Reporter constructs, mutagenesis, BAC recombineering and germline transformation
Genomic DNA fragments from the D. melanogaster or D. virilis bab locus were amplified by standard PCR (using the following primer pairs: cccgaattcGCGCCTAACTAGCCAACAAT/cccggatCCTTTGACTCCGCTTTCGTCTTC and cccgaattcGAAACATCACGTTATCTAGCCACA/cccggatccAGAGTTGCTTGCACACACTCAC, respectively; BamHI and EcoRI restriction sites are underlined), cloned into pBP-S3aG, a home-made derivative of the attB-containing pS3aG plasmid obtained from T.M. Williams and S. Carroll [27]. Of note, the pBP-S3aG vector includes the TATA-less bab2 minimal promoter. The pLAE-RFP and pLAE-Bab2 plasmid constructs were made by substituting the GFP insert of the pLAE-GFP construct by a pH2B-RFP insert (obtained from A. Vincent) or a bab2 full-length cDNA (from pNB-bab2), respectively. Site-directed mutagenesis (including linker scanning) was performed by PCR, using the overlap extension method [48]. All constructs were sequence-verified. BAC recombineering and PhiC31-mediated germline transformation were performed as described [49]. The LAE was validated through insertions within several attP genomic sites, including the 2A platform on the X chromosome that was used for all constructs reported in this study.
LAE sequence identification and alignment
The genomic sequences homologous to the D. melanogaster LAE were recovered by Blat analysis at the UCSC Genome Browser website (http://genome.ucsc.edu/cgi-bin/hgBlat?command=start) and aligned with MAFFT (http://mafft.cbrc.jp/alignment/server/). The multiple alignment was then shaded with Boxshade (http://www.ch.embnet.org/software/BOX_form.html).
Immunofluorescence and image quantification
Third-instar larval imaginal discs were prepared and stained using standard procedures. Confocal analyses were done with a LEICA TCS SP5 microscope. Rat anti-Bab2 [17] and rabbit anti-Dll [50] antibodies were used at 1/2000 and 1/200, respectively. For each reporter construct, GFP fluorescence quantification was obtained from 10 distinct T2 leg and eye-antennal discs (i) dissected from late third-instar larvae grown in the same environmental conditions (temperature and larval density), and then (ii) fixed in the same conditions. Confocal images were analyzed with ImageJ software, using the same area (centered on the distalmost ring of cells), laser excitation settings (75% maximal detection) and brightness/contrast image acquisition.
In-vitro translation and electrophoretic mobility-shift assay
Dll and Rn proteins were synthesized by coupled in-vitro transcription/translation with T7 RNA polymerase and rabbit reticulocyte lysate (TNT assay, Promega). pET-Dll and pCS2-MycRn plasmid constructs were obtained from S. Cohen and P. Couso, respectively. EMSA experiments were performed mainly as described [51], using Novex 6% DNA retardation gels (InvitroGene). Probes were assembled from synthetic oligonucleotides including 4 additional G bases at their 5′-ends, labeled with the Klenow fragment of E. coli DNA polymerase I in presence of [α-32P]dCTP, and purified on mini Quick spin columns (Roche). Specific activities were roughly similar for all tested probes. Free and shifted probes were revealed with a PhosphorImager.
Supporting Information
Acknowledgments
We thank T. Kojima, G. Campbell, G. Boekhoff-Falk, S. Cohen, N. Gompel, T.M. Williams, S. Carroll, P. Couso, M. Suzanne, A. Vincent, F. Laski and the Bloomington Stock Center for fly stocks and reagents, and the Developmental Studies Hybridoma Bank (DSHB) at the University of Iowa for antibodies. We are grateful to A. Vincent, S. Plaza, M. Crozatier and C. Immarigeon for discussions and helpful suggestions on the manuscript or during the course of this work. We thank S. Bernat-Fabre and J. Favier for technical assistance, as well as C. Faucher and O. Bardot for their contributions to this project. Lastly, we acknowledge the Toulouse RIO Imaging platform.
Funding Statement
This work was supported by grants from the French governmental agency for Research (CNRS), the Paul Sabatier University (UPS) and the “Association pour la Recherche sur le Cancer” (ARC). AB was supported by the CNRS and the Midi Pyrenees Region. LHM-V was supported by the Mexican CONACYT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Levine M, Tjian R (2003) Transcription regulation and animal diversity. Nature 424: 147–151. [DOI] [PubMed] [Google Scholar]
- 2. Levine M (2010) Transcriptional enhancers in animal development and evolution. Curr Biol 20: R754–763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Lagha M, Bothma JP, Levine M (2012) Mechanisms of transcriptional precision in animal development. Trends Genet 2012: 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Couso JP, Bishop SA (1998) Proximo-distal development in the legs of Drosophila. Int J Dev Biol 42: 345–352. [PubMed] [Google Scholar]
- 5. Estella C, Voutev R, Mann RS (2012) A dynamic network of morphogens and transcription factors patterns the fly leg. Curr Top Dev Biol 98: 173–198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Galindo MI, Couso JP (2000) Intercalation of cell fates during tarsal development in Drosophila. Bioessays 22: 777–780. [DOI] [PubMed] [Google Scholar]
- 7. Kojima T (2004) The mechanism of Drosophila leg development along the proximodistal axis. Dev Growth Differ 46: 115–129. [DOI] [PubMed] [Google Scholar]
- 8. Morata G (2001) How Drosophila appendages develop. Nat Rev Mol Cell Biol 2: 89–97. [DOI] [PubMed] [Google Scholar]
- 9. Natori K, Tajiri R, Furukawa S, Kojima T (2012) Progressive tarsal patterning in the Drosophila by temporally dynamic regulation of transcription factor genes. Dev Biol 361: 450–462. [DOI] [PubMed] [Google Scholar]
- 10. Abu-Shaar M, Mann RS (1998) Generation of multiple antagonistic domains along the proximodistal axis during Drosophila leg development. Development 125: 3821–3830. [DOI] [PubMed] [Google Scholar]
- 11. Diaz-Benjumea FJ, Cohen B, Cohen SM (1994) Cell interaction between compartments establishes the proximal-distal axis of Drosophila legs. Nature 372: 175–179. [DOI] [PubMed] [Google Scholar]
- 12. Lecuit T, Cohen SM (1997) Proximal-distal axis formation in the Drosophila leg. Nature 388: 139–145. [DOI] [PubMed] [Google Scholar]
- 13. Wu J, Cohen SM (1999) Proximodistal axis formation in the Drosophila leg: subdivision into proximal and distal domains by Homothorax and Distal-less. Development 126: 109–117. [DOI] [PubMed] [Google Scholar]
- 14. Estella C, McKay DJ, Mann RS (2008) Molecular integration of wingless, decapentaplegic, and autoregulatory inputs into Distalless during Drosophila leg development. Dev Cell 14: 86–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Giorgianni MW, Mann RS (2011) Establishment of medial fates along the proximodistal axis of the Drosophila leg through direct activation of dachshund by Distalless. Dev Cell 20: 455–468. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Dong PD, Chu J, Panganiban G (2000) Coexpression of the homeobox genes Distal-less and homothorax determines Drosophila antennal identity. Development 127: 209–216. [DOI] [PubMed] [Google Scholar]
- 17. Couderc JL, Godt D, Zollman S, Chen J, Li M, et al. (2002) The bric à brac locus consists of two paralogous genes encoding BTB/POZ domain proteins and acts as a homeotic and morphogenetic regulator of imaginal development in Drosophila. Development 129: 2419–2433. [DOI] [PubMed] [Google Scholar]
- 18. Godt D, Couderc JL, Cramton SE, Laski FA (1993) Pattern formation in the limbs of Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for specification and proper segmentation of the tarsus. Development 119: 799–812. [DOI] [PubMed] [Google Scholar]
- 19. Chu J, Dong PD, Panganiban G (2002) Limb type-specific regulation of bric a brac contributes to morphological diversity. Development 129: 695–704. [DOI] [PubMed] [Google Scholar]
- 20. Campbell G, Tomlinson A (1998) The roles of the homeobox genes aristaless and Distal-less in patterning the legs and wings of Drosophila. Development 125: 4483–4493. [DOI] [PubMed] [Google Scholar]
- 21. Galindo MI, Bishop SA, Greig S, Couso JP (2002) Leg patterning driven by proximal-distal interactions and EGFR signaling. Science 297: 256–259. [DOI] [PubMed] [Google Scholar]
- 22. Duncan DM, Burgess EA, Duncan I (1998) Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev 12: 1290–1303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Duncan D, Kiefel P, Duncan I (2010) Control of the spineless antennal enhancer: direct repression of antennal target genes by Antennapedia. Dev Biol 347: 82–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Campbell G (2002) Distalization of the Drosophila leg by graded EGF-receptor activity. Nature 418: 781–785. [DOI] [PubMed] [Google Scholar]
- 25. de Celis Ibeas JM, Bray SJ (2003) Bowl is required downstream of Notch for elaboration of distal limb patterning. Development 130: 5943–5952. [DOI] [PubMed] [Google Scholar]
- 26. Greenberg L, Hatini V (2009) Essential roles for lines in mediating leg and antennal proximodistal patterning and generating a stable Notch signaling interface at segment borders. Dev Biol 330: 93–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Williams TM, Selegue JE, Werner T, Gompel N, Kopp A, et al. (2008) The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Cell 134: 610–623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104: 3312–3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, et al. (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450: 203–218. [DOI] [PubMed] [Google Scholar]
- 30. Venken KJ, Carlson JW, Schulze KL, Pan H, He Y, et al. (2009) Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nat Methods 6: 431–434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Kozu S, Tajiri R, Tsuji T, Michiue T, Saigo K, et al. (2006) Temporal regulation of late expression of Bar homeobox genes during Drosophila leg development by Spineless, a homolog of the mammalian dioxin receptor. Dev Biol 294: 497–508. [DOI] [PubMed] [Google Scholar]
- 32. Noyes MB (2012) Analysis of specific protein-DNA interactions by bacterial one-hybrid assay. Methods Mol Biol 786: 79–95. [DOI] [PubMed] [Google Scholar]
- 33. Pueyo JI, Couso JP (2008) The 11-aminoacid long Tarsal-less peptides trigger a cell signal in Drosophila leg development. Dev Biol 324: 192–201. [DOI] [PubMed] [Google Scholar]
- 34. St Pierre SE, Galindo MI, Couso JP, Thor S (2002) Control of Drosophila imaginal disc development by rotund and roughened eye: differentially expressed transcripts of the same gene encoding functionally distinct zinc finger proteins. Development 129: 1273–1281. [DOI] [PubMed] [Google Scholar]
- 35. Torrungruang K, Alvarez M, Shah R, Onyia JE, Rhodes SJ, et al. (2002) DNA binding and gene activation properties of the Nmp4 nuclear matrix transcription factors. J Biol Chem 277: 16153–16159 Epub 12002 Feb 16126. [DOI] [PubMed] [Google Scholar]
- 36. Struhl G, Basler K (1993) Organizing activity of wingless protein in Drosophila. Cell 72: 527–540. [DOI] [PubMed] [Google Scholar]
- 37. Gorfinkiel N, Morata G, Guerrero I (1997) The homeobox gene Distal-less induces ventral appendage development in Drosophila. Genes Dev 11: 2259–2271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Perry MW, Boettiger AN, Levine M (2011) Multiple enhancers ensure precision of gap gene-expression patterns in the Drosophila embryo. Proc Natl Acad Sci U S A 108: 13570–13575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Casares F, Mann RS (1998) Control of antennal versus leg development in Drosophila [see comments]. Nature 392: 723–726. [DOI] [PubMed] [Google Scholar]
- 40. Cummins M, Pueyo JI, Greig SA, Couso JP (2003) Comparative analysis of leg and antenna development in wild-type and homeotic Drosophila melanogaster. Dev Genes Evol 213: 319–327. [DOI] [PubMed] [Google Scholar]
- 41. Pai CY, Kuo TS, Jaw TJ, Kurant E, Chen CT, et al. (1998) The Homothorax homeoprotein activates the nuclear localization of another homeoprotein, extradenticle, and suppresses eye development in Drosophila. Genes Dev 12: 435–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Struhl G (1981) A homoeotic mutation transforming leg to antenna in Drosophila. Nature 292: 635–638. [DOI] [PubMed] [Google Scholar]
- 43. Chen R, Amoui M, Zhang Z, Mardon G (1997) Dachshund and eyes absent proteins form a complex and function synergistically to induce ectopic eye development in Drosophila. Cell 91: 893–903. [DOI] [PubMed] [Google Scholar]
- 44. Cohen SM, Bronner G, Kuttner F, Jurgens G, Jackle H (1989) Distal-less encodes a homoeodomain protein required for limb development in Drosophila. Nature 338: 432–434. [DOI] [PubMed] [Google Scholar]
- 45. Cohen SM, Jürgens G (1989) Proximal-distal pattern formation in Drosophila: cell autonomous requirement for Distal-less gene activity in limb development. EMBO J 8: 2045–2055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Cohen SM (1990) Specification of limb development in the Drosophila embryo by positional cues from segmentation genes. Nature 343: 173–177. [DOI] [PubMed] [Google Scholar]
- 47. Liu R, Lehane S, He X, Lehane M, Hertz-Fowler C, et al. (2010) Characterisations of odorant-binding proteins in the tsetse fly Glossina morsitans morsitans. Cell Mol Life Sci 67: 919–929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51–59. [DOI] [PubMed] [Google Scholar]
- 49. Venken KJ, He Y, Hoskins RA, Bellen HJ (2006) P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314: 1747–1751. [DOI] [PubMed] [Google Scholar]
- 50. Panganiban G, Sebring A, Nagy L, Carroll S (1995) The development of crustacean limbs and the evolution of arthropods. Science 270: 1363–1366. [DOI] [PubMed] [Google Scholar]
- 51. Gebelein B, McKay DJ, Mann RS (2004) Direct integration of Hox and segmentation gene inputs during Drosophila development. Nature 431: 653–659. [DOI] [PubMed] [Google Scholar]
- 52. Noyes MB, Christensen RG, Wakabayashi A, Stormo GD, Brodsky MH, et al. (2008) Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites. Cell 133: 1277–1289. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.