Abstract
Genetic disturbances during dental development influence variation of number and shape of the dentition. In this study, we tested if genetic variation in enamel formation genes is associated with molar-incisor hypomineralization (MIH), also taking into consideration caries experience. DNA samples from 163 cases with MIH and 82 unaffected controls from Turkey, and 71 cases with MIH and 89 unaffected controls from Brazil were studied. Eleven markers in five genes [ameloblastin (AMBN), amelogenin (AMELX), enamelin (ENAM), tuftelin (TUFT1), and tuftelin-interacting protein 11 (TFIP11)] were genotyped by the TaqMan method. Chi-square was used to compare allele and genotype frequencies between cases with MIH and controls. In the Brazilian data, distinct caries experience within the MIH group was also tested for association with genetic variation in enamel formation genes. The ENAM rs3796704 marker was associated with MIH in both populations (Brazil: p=0.03; OR=0.28; 95% C.I.=0.06–1.0; Turkey: p=1.22e–012; OR=17.36; 95% C.I.=5.98–56.78). Associations between TFIP11 (p=0.02), ENAM (p=0.00001), and AMELX (p=0.01) could be seen with caries independent of having MIH or genomic DNA copies of Streptococcus mutans detected by real time PCR in the Brazilian sample. Several genes involved in enamel formation appear to contribute to MIH.
Keywords: Dental Enamel, Amelogenesis, Dental Enamel Hypoplasia, Dental Caries, Dental Caries Susceptibility
Introduction
The dental enamel is the most mineralized tissue of the human body, characterized by a highly complex developmental process (1). This process involves ameloblasts, which are known by their higher sensitive (2,3). The amelogenesis phase of the enamel development is under strict genetic control, and the size, shape, shade, caries susceptibility (4), and even enamel microhardness (5) can be affected by genetic variation. Different kinds of enamel defects may occur depending on the stage of development affected. The dental defect known as enamel hypoplasia is the result of the reduction of enamel thickness, which occurs during the secretory phase of amelogenesis. When ameloblasts are affected in the late amelogenesis stage of mineralization or maturation, a defect in the enamel translucence can occur. These defects are called enamel hypomineralization (6,7). A common pattern of enamel hypomineralization affects molars and incisors. This dental defect is called the molar incisor hypomineralization (MIH). Clinically, it presents asymmetric severity with demarcated opacities that vary in color shade from white to yellow/brownish, with sharp demarcation between the affected and sound enamel (8).
The first report of MIH dates from the late 70′s (9). In 2001, this defect was given a new name (MIH) with the definition of a “systemic hypomineralization” that affects one or more permanent first molars with or without permanent incisor involvement (10). The main characteristic of teeth with MIH is porous enamel that can be easily damaged due to masticatory forces. This can result in exposed dentinal tissues that may facilitate the development of carious lesions hence MIH is associated with caries (8, 11–17).
Children with MIH could present more intense dental sensitivity due to temperature variations (18). This is the result of the combination of the chronic pulp inflammation and innervation of the region right under the hypomineralized area (19). Consequently, children with MIH may have hampered anesthetic action, which can affect their behavior.
There is no conclusive data in relation to the etiology of MIH (17). Considering that the entire enamel formation process is under genetic control4, it is reasonable to hypothesize that genetic variations could be associated with alterations in the amelogenesis. Genetic mutations have been associated with different kinds of amelogenesis imperfecta (20). Also, susceptibility to caries has been associated with genetic variation (5,21–29). Therefore, we hypothesize that variation in genes involved in the enamel formation contributes to increased MIH experience in humans.
Subjects and Methods
Subject Screening and Sample Collection
Two cohorts, one from Brazil and the second from Turkey, were studied. Biologically unrelated subjects were recruited as approved by the São Paulo State University (#45/10), Istanbul University (2006/2508), and University of Pittsburgh (PRO0710045 and PRO12080056) Institutional Review Boards and informed consent/assent was obtained from all participants and their parents. Eligible individuals were enrolled in the Pedodontics Clinics of São Paulo State University and Istanbul University and in daycare facilities in Araraquara, Brazil (n=160) and Istanbul, Turkey (n=245). The exclusion criteria included having evidence of a syndrome, fluorosis, or use of a fixed appliance. Calibrated examiners carried out the clinical examination. In Brazil, F.J. was calibrated by L.S-P. In Turkey, E.B.T. calibrated M.B. Exam calibrations were performed according to the following protocol: First, the calibrator presented to the examiner the criteria for MIH detection, showing pictures of several situations to be observed in the exam and discussing each of these situations in a session that lasted one to two hours. Next, the calibrator and examiner(s) examined 10 to 20 subjects and discussed each case. In Brazil, the intraexaminer agreement was assessed by a second clinical examination in 10% of the sample after two weeks, with a kappa of 1.0. In Turkey, E.B.T. and M.Y. pre-screened subjects, and M.B. performed the full exam. The MIH diagnosis was performed according to the EAPD (European Association of Paediatric Dentistry) criteria (12). Cases were defined as a subject with MIH phenotype, while controls were defined as subjects with no evidence of MIH (including no evidence of fluorosis). Clinical examinations were done with the use of a flashlight and mouth mirror. In addition, in the Brazilian site, caries experience data (DMFT/dmft) was collected according to established protocols. In brief, visible lesions in dentin, as well as visible active lesions in enamel (white spots) and failed restorations with decayed tissue were scored as decayed. An explorer was gently used for assessing the smoothness of tooth surfaces. Gauze was used to dry and clean teeth prior to exam. Artificial light and a dental operatory were used for all evaluations. White spot lesions were distinguished from developmental enamel defects simply on clinical grounds based on the association of the lesions with areas of mature plaque and location on the tooth (i.e., white lesion appearing to be slightly supragingival, either associated with slight gingival inflammation or healthy gingival tissue, combined with the aspect of the lesion when dry (white chalk looking versus dry). No radiographs were available. Exam calibrations were performed according to the following protocol: First, the calibrator (L.S-P.) presented to the examiner (F.J.) the criteria for caries detection, showing pictures of several situations to be observed in the exam (sound and decayed tooth surfaces, filled teeth with and without secondary lesions, missing teeth due to caries or due to other reasons) and discussed each of these situations in a session that lasted one to two hours. Next, the calibrator and examiner(s) examined 10 to 20 subjects and discussed each case. Drinking water in the Istanbul region is not artificially fluoridated. Demographical characteristics of the enrolled subjects are presented in Table 1.
Table 1.
Demographical characteristics.
| Brazil (n=160) | Turkey (n=245) | Both Populations (n=405) | |||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| MIH | No MIH | p-value | MIH | No MIH | p-value | MIH | No MIH | p-value | |
|
| |||||||||
| Mean age in years (Standard Deviation) | 13(7.6) | 38(6.8) | 0.00001 | 9.7(1.5) | 5.9(0.11) | <0.00001 | 10.5(4.5) | 22.8(16.9) | <0.0001 |
|
| |||||||||
| Gender | |||||||||
| Male | 37(52.1) | 38(42.7) | 0.24 | 78(65.0) | 42(35.0) | 0.61 | 115(59.0) | 80(41.0) | 0.63 |
| Female | 34(47.9) | 51(57.3) | 85(68.0) | 40(32.0) | 119(56.7) | 91(43.3) | |||
| Characteristics of MIH Sample | ||||||
|---|---|---|---|---|---|---|
|
| ||||||
| MIH Severity | Brazil | Turkey | Both Populations | |||
|
|
||||||
| n | % | n | % | n | % | |
|
| ||||||
| Mild | 42 | 59.1 | 19 | 11.7 | 61 | 26 |
| Severe | 29 | 40.9 | 144 | 88.3 | 173 | 74 |
Unstimulated saliva samples were obtained from all participants (subjects were asked to spit) and they were stored in Oragene DNA Self-Collection kits (DNA Genotek Inc.) at room temperature until being processed. No centrifugation was performed in the saliva samples. No plaque samples were collected. DNA was extracted according to the manufacturer's instructions.
Genotyping
Eleven single-nucleotide polymorphism (SNP) markers were selected in genes involved in enamel formation (Table 2) and genotyped using predesigned TaqMan™ genotyping assays (30). For all TaqMan assays, DNA amplification was carried out in 3.0μl volume containing 1.0 μl of 2.0 ng/μl of DNA and 2.0 μl of primers and TaqMan master mix. The amplifications were made in a GeneAmp® PCR System 9700 (Perkin Elmer Applied Biosystems, Foster City, California, USA) and fluorescent signals detected at a 7900 HT Sequence Detection System (Applied Biosystems, Foster City, California, USA).
Table 2.
Markers studied.
| Gene | Locus | Marker public ID | Base pair change |
|---|---|---|---|
|
| |||
| Ameloblastin (AMBN) | 4q21 | rs496502 | G/T |
| rs4694075 | C/T | ||
|
| |||
| Amelogenin (AMELX) | Xp22.31-p22.1 | rs17878486 | C/T |
| rs946252 | C/T | ||
|
| |||
| Enamelin (ENAM) | 4q13.3 | rs3796704 | A/G |
| rs12640848 | A/G | ||
|
| |||
| Tuftelin (TUFT1) | 1q21 | rs3790506 | A/G |
| rs233736 | A/G | ||
| rs4970957 | A/G | ||
|
| |||
| Tuftelin interacting protein 11 (TFIP11) | 22q12.1 | rs134136 | C/T |
| rs5997096 | C/T | ||
Presence of Genomic DNA of Streptococcus mutans
To generate data on Streptoccocus mutans colonization in the Brazilian cohort that had caries data, we interrogated DNA samples extracted from human saliva for evidence of copies of genomic DNA of the bacteria. Real-time PCR was performed by the use of the ABI PRISM 7900HT Fast Real-Time PCR System (Applied Biosystems). Each reaction tube contained 10 ul of reaction mixture, including 1 X SYBR Green PCR buffer, 0.025 U/ul of AmpliTaqGold DNA polymerase, 0.01 U/ul of AmpErase UNG (uracil N-glycosylase), 1.2 mM of each of the dNTPs, 3mM MgCL2 (SYBR Green PCR Core Reagents, Applied Biosystems), 2 ul of human DNA extracted from saliva samples and 0.8 mM of each primer specific to Streptococcus mutans (forward 5'AGCCATGCGCAATCAACAGGTT3' and reverse 5'CGCAACGCGAACATCTTGATCAG3'). The specificity of these primers was tested previously (31) and Streptococcus mutans genomic DNA (Streptococcus mutans ATCC® 25175) was included in all reactions as positive control and standard DNA curves were generated. The cycling conditions were 2 minutes at 50°C for uracil N-glycosylase (this treatment prevents carryover cross-contamination by digesting uracil-containing fragments generated prior the PCR assay), 10 minutes at 95°C for activation of AmpliTaqGold, 40 cycles of 15 seconds at 95°C for denaturation and 1 minute at 68°C for annealing and extension. Values of the threshold cycle (Ct) above zero were considered positive for Streptococcus mutans infection based on the successful amplification of the target sequence. These values were correlated with DMFT scores and alpha of 0.05 was considered statistically significant.
Statistical Analysis
The χ2, Fisher's exact, and Student t tests were performed to compare gender and age frequencies and to test for deviations in the allele and genotype distributions between the groups. Deviations from Hardy-Weinberg equilibrium were also examined also using the χ2 test (tested both the MIH and control groups). Comparisons of allele and genotype frequencies between cases and controls were performed taking into consideration MIH detection, as well as considering MIH severity (mild versus severe). In mild cases there are demarcated enamel opacities without enamel breakdown. In severe cases there are demarcated enamel opacities with breakdown, caries, spontaneous hypersensitivity and strong aesthetic concerns (32). The risk associated with individual alleles or genotypes was calculated as the odds ratio (OR) with 95% confidence intervals (C.I.). A probability level of p<0.0045 was considered to indicate statistical significance in the analysis by marker (0.05/11) or p<0.002 for the analysis by each marker based on severity of MIH (0.05/22). Finally, we performed logistic regression modeling to test the association between genetic variation and caries experience, adjusting the analysis by Streptococcus mutans colonization status and MIH status. Adjusting the analysis by MIH status is important since our previous data suggest MIH is associated with greater caries experience in this population (33).
Results
All genotypes were in Hardy-Weinberg equilibrium (data not shown). Supplemental Tables 1 and 2 summarize the results of the allele and genotype frequency comparisons in the Brazilian population. Considering the comparison between the total number of cases (MIH) and controls (no MIH), borderline results were found for ENAM rs3796704 (p=0.02 for the allele frequency, and p=0.06 for the genotype frequency). Individuals carrying the A allele appear to be protected against MIH development (OR=0.42; 95% C.I.=0.2–0.47). When MIH severity was considered in the analysis, statistically significant difference in allele frequency was observed for the AMBN rs4694075 marker (p= 0.003; OR=0.46; 95% C.I.=0.26–0.8), with the T allele suggesting a protective role. The ENAM rs3796704 was also associated with MIH severity (OR=0.28; 95% C.I.=0.06–1.0), since the G allele was more frequent in the severe MIH subgroup (p=0.03) in comparison with the no MIH subgroup. A suggestive overrepresentation of the TT genotype of the TFIP11 rs5997096 marker was seen in cases with severe MIH diagnosis (p=0.01) when compared with cases with mild diagnosis. On the other hand, the TT genotype of the TFIP11 rs134136 was overrepresented in cases with mild MIH diagnosis (p=0.02).
In regards to the Turkish population, the comparison between cases and controls showed association with MIH for the TUFT1 rs2337360, rs4970957, rs3790506 markers, as well as the AMBN rs4694075, ENAM rs3796704, and TFIP11 rs5997096, considering both the allele and genotype distributions (Supplemental Table 3). Most significant associations with protection against the development of MIH were found for the TUFT1 rs4970957 (p=3.287e–023; OR=0.12; 95% C.I.=0.08–0.19), and rs3790506 (p=1.64e–0.11; OR=0.19; 95% C.I.=0.11–0.33) markers and TFIP11 rs5997096 (p=0.00027; OR=0.49; 95% C.I.=0.49–0.74). The most significant result was for ENAM rs3796704, since it was observed that individuals who carry the G allele were 17 times more likely to be affected by MIH than those who carry the A allele (p=1.22e–012; OR=17.36; 95% C.I.=5.98–56.78). When MIH severity was considered in the Turkish population (Supplemental Table 4), suggestive associations were noted for allele and genotype frequencies for the following SNPs: TUFT1 rs4970957 (p<0.001) and rs3790506 (p<0.01), ENAM rs3796704 (p<0.01), and TFIP11 rs5997096 (p<0.05).
We also analyzed MIH based on caries experience (DMFT) scores in the Brazilian cohort. The DFMT mean was 5.04 ± 3.12, however we did not find any differences in the level of colonization of Streptococcus mutans based on having detectable copies of Streptococcus mutans genomic DNA in caries free individuals versus individuals with caries experience. Table 3 shows the allele and genotype frequencies of the polymorphisms investigated in MIH patients related to caries experience (individuals with DMFT up to 3 versus individuals with DMFT 4 or higher). Suggestive associations were found for three markers: TFIP11 rs134136 (p=0.01; OR=1.78; 95% C.I.=1.08–2.94 for allele frequency), and AMELX rs946252 (p=0.001; OR=0.16; 95% C.I.=0.09–0.27 for allele frequency) and rs17878486 (p=0.03; OR=0.53; 95% C.I.=0.29–0.98 for allele frequency and p=0.03 for genotype frequency). Table 4 summarizes the results of the regression analysis adjusted by, age, Streptococcus mutans and MIH statuses. Associations between the same markers in TFIP11 (p=0.02) and AMELX (p=0.01) could be seen with caries independent of having MIH or genomic DNA copies of Streptococcus mutans detected by real time PCR. In addition, ENAM was associated with caries when specific genetic models were considered in the analysis.
Table 3.
Summary of the allele and genotype frequency comparisons related to caries experience in Brazilians with MIH.
| Subjects | Alleles (%) | p-value | OR (95%C.I.) | Genotypes (%) | p-value | |||
|---|---|---|---|---|---|---|---|---|
| TUFT1 | ||||||||
|
| ||||||||
| rs2337360 | A | G | AA | AG | GG | |||
|
|
|
|||||||
| Low | 49(31.4) | 107(65.6) | 0.81 | 1.06(0.64–1.76) | 6(7.7) | 37(47.4) | 35(44.9) | 0.79 |
| High | 49(32.7) | 101(67.3) | 8(10.7) | 33(44.0) | 34(45.3) | |||
|
| ||||||||
| rs4970957 | A | G | AA | AG | GG | |||
|
| ||||||||
| Low | 124(75.6) | 40(24.4) | 0.99 | 1.00(0.58–1.72) | 50(61.0) | 24(29.3) | 8(9.8) | 0.56 |
| High | 118(75.6) | 38(24.4) | 45(57.7) | 28(35.9) | 5(6.4) | |||
|
| ||||||||
| rs3790506 | A | G | AA | AG | GG | |||
|
|
|
|||||||
| Low | 51(31.1) | 113(68.9) | 0.49 | 0.84(0.51–1.4) | 8(9.8) | 35(42.7) | 39(47.6) | 0.72 |
| High | 43(27.6) | 113(72.4) | 7(9.0) | 29(37.2) | 42(53.8) | |||
|
| ||||||||
| AMBN | ||||||||
|
| ||||||||
| rs4694075 | C | T | CC | CT | TT | |||
|
| ||||||||
| Low | 79(48.2) | 85(51.8) | 0.43 | 1.19(0.75–1.89) | 16(19.5) | 47(57.3) | 19(23.2) | 0.27 |
| High | 82(52.6) | 74(47.4) | 23(29.5) | 36(46.2) | 19(24.4) | |||
|
| ||||||||
| rs496502 | T | G | GG | GT | TT | |||
|
| ||||||||
| Low | 121(76.6) | 37(23.4) | 0.52 | 1.19(0.67–2.12) | 48(60.8) | 25(31.6) | 6(7.6) | 0.62 |
| High | 121(79.6) | 31(20.4) | 48(63.2) | 25(32.9) | 3(3.9) | |||
|
| ||||||||
| ENAM | ||||||||
|
| ||||||||
| rs12640848 | A | G | AA | AG | GG | |||
|
| ||||||||
| Low | 83(50.7) | 81(49.3) | 0.78 | 1.07(0.66–1.73) | 21(25.6) | 41(50.0) | 20(24.4) | 0.4 |
| High | 70(52.2) | 64(47.3) | 13(16.9) | 44(57.1) | 20(26.0) | |||
|
| ||||||||
| rs3796704 | A | G | AA | AG | GG | |||
|
|
|
|||||||
| Low | 21(13.6) | 133(86.4) | 0.76 | 0.9(0.44–1.85) | 1(1.3) | 19(24.7) | 57(74.0) | 0.13 |
| High | 19(12.5) | 133(87.5) | 4(5.3) | 11(14.5) | 61(80.3) | |||
|
| ||||||||
| TFIP11 | ||||||||
|
| ||||||||
| rs5997096 | C | T | CC | CT | TT | |||
|
| ||||||||
| Low | 61(38.1) | 99(61.9) | 0.16 | 1.39(0.86–2.23) | 9(11.3) | 43(53.8) | 28(35.0) | 0.07 |
| High | 70(46.1) | 82(53.9) | 19(25.0) | 32(42.1) | 25(32.9) | |||
|
| ||||||||
| rs134136 | T | C | CC | CT | TT | |||
|
| ||||||||
| Low | 68(50.7) | 66(49.3) | 0.01 | 1.78(1.08–2.94) | 30(36.6) | 38(46.3) | 14(17.1) | 0.17 |
| High | 101(64.8) | 55(36.2) | 38(48.7) | 25(32.1) | 15(19.2) | |||
|
| ||||||||
| AMELX | ||||||||
|
| ||||||||
| rs946252 | T | C | CC | CT | TT | |||
|
|
|
|||||||
| Low | 139(85.8) | 23(14.2) | 0.001 | 0.16(0.09–0.27) | 63(77.8) | 13(16.0) | 5(6.2) | 0.99 |
| High | 134(85.9) | 22(14.1) | 61(78.2) | 12(15.4) | 5(6.4) | |||
|
| ||||||||
| rs17878486 | C | T | CC | CT | TT | |||
|
|
|
|||||||
| Low | 41(25.0) | 123(75.0) | 0.03 | 0.53(0.29–0.98) | 15(18.3) | 11(13.4) | 56(68.3) | 0.03 |
| High | 23(15.1) | 129(84.9) | 4(5.3) | 15(19.7) | 57(75.0) | |||
Note: OR (95% C.I.)= Odds ratios; 95% confidence intervals
Table 4.
Summary of the regression analysis of the association between caries and genetic variation in enamel formation genes adjusted by age, MIH, and Streptococcus mutans statuses.
| Gene/Marker | Genotypes | Multivariate analysis | Test/model | Genotypes | P-value | |
|---|---|---|---|---|---|---|
| P-value | OR (95%C.I.) | |||||
| AMELX | ||||||
| rs946252 | CC | Reference | Reference | Genotype | CC/CT/TT | 0.72 |
| CT | 0.88 | 0.93 (0.39–2.22) | Dominant Model | CC+CTvsTT | 0.51 | |
| TT | 0.97 | 1.02 (0.28–3.73) | Recessive Model | CCvsCT+TT | 0.70 | |
| rs17878486 | CC | Reference | Reference | Genotype | CC/CT/TT | 0.04 |
| CT | 0.01 | 5.38(1.38–20.98) | Dominant Model | CC+CTvsTT | 0.35 | |
| TT | 0.02 | 3.91(1.21–12.55) | Recessive Model | CCvsCT+TT | 0.01 | |
| TFIP11 | ||||||
| rs5997096 | CC | Reference | Reference | Genotype | CC/CT/TT | 0.07 |
| CT | 0.03 | 0.34(0.13–0.88) | Dominant Model | CC+CTvsTT | 0.78 | |
| TT | 0.07 | 0.41(0.41–1.09) | Recessive Model | CCvsCT+TT | 0.02 | |
| rs134136 | CC | Reference | Reference | Genotype | CC/CT/TT | 0.38 |
| CT | 0.07 | 0.52(0.26–1.05) | Dominant Model | CC+CTvsTT | 0.37 | |
| TT | 0.69 | 0.84(0.35–2.01) | Recessive Model | CCvsCT+TT | 0.17 | |
| AMBN | ||||||
| rs4694075 | CC | Reference | Reference | Genotype | CC/CT/TT | 0.78 |
| CT | 0.11 | 0.53(0.25–1.16) | Dominant Model | CC+CTvsTT | 0.63 | |
| TT | 0.42 | 0.69(0.28–1.7) | Recessive Model | CCvsCT+TT | 0.75 | |
| rs496502 | GG | Reference | Reference | Genotype | GG/GT/TT | 0.80 |
| GT | 0.17 | 0.60(0.29–1.2) | Dominant Model | GG+GTvsTT | 0.51 | |
| TT | 0.85 | 0.86(0.19–3.88) | Recessive Model | GGvsGT+TT | 0.82 | |
| ENAM | ||||||
| rs12640848 | AA | Reference | Reference | Genotype | AA/AG/GG | 0.05 |
| AG | 0.19 | 1.73(0.76–3.96) | Dominant Model | AA+AGvsGG | 0.01 | |
| GG | 0.32 | 1.6(0.62–4.11) | Recessive Model | AAvsAG+GG | 0.43 | |
| rs3796704 | AA | Reference | Reference | Genotype | AA/AG/GG | 0.01 |
| AG | 0.1 | 1.15(0.01–1.5) | Dominant Model | AA+AGvsGG | 0.02 | |
| GG | 0.25 | 0.27(0.02–2.58) | Recessive Model | AAvsAG+GG | <0.00001 | |
| TUFT1 | ||||||
| rs3790506 | AA | Reference | Reference | Genotype | AA/AG/GG | 0.54 |
| AG | 0.87 | 0.91(0.29–2.84) | Dominant Model | AA+AGvsGG | 0.76 | |
| GG | 0.78 | 1.17(0.38–3.59) | Recessive Model | AAvsAG+GG | 0.36 | |
| rs233736 | AA | Reference | Reference | Genotype | AA/AG/GG | 0.23 |
| AG | 0.49 | 0.66(0.2–2.12) | Dominant Model | AA+AGvsGG | 0.19 | |
| GG | 0.57 | 0.71(0.22–2.32) | Recessive Model | AAvsAG+GG | 0.15 | |
| rs4970957 | AA | Reference | Reference | Genotype | AA/AG/GG | 0.50 |
| AG | 0.45 | 1.02(0.53–1.95) | Dominant Model | AA+AGvsGG | 0.54 | |
| GG | 0.5 | 0.27(0.66–2.57) | Recessive Model | AAvsAG+GG | 0.47 | |
Bold font indicates p-values lower than 0.05.
Discussion
Considering that there is no conclusive data in relation to the etiology of MIH (17), to the best of our knowledge, this is the first study to evaluate the possible association between MIH and variants in genes related to enamel formation. An important discussion point is that there is still some debate if MIH is a truly recognizable distinct condition. Enamel defects restricted to incisors and molars can be considered purely environmental in origin (i.e., infection) or mistaken by under ascertained cases of amelogenesis imperfecta, particularly in the instance that children at ages when the only permanent teeth erupted are the incisors and molars. In our study, some subjects are as young as 6 years of age with the case group ranging to 20 years. It is possible to argue that some younger subjects may have amelogenesis imperfecta. Mutations in AMELX and ENAM, two genes which markers were included in our study, can lead to amelogenesis imperfecta. Most cases of amelogenesis imperfecta are caused by mutations in ENAM, which can be inherited as autosomal dominant or recessive. About 5% of cases are X-linked recessive forms of the condition linked to mutations in AMELX (33). Estimates of the prevalence of amelogenesis imperfecta range from 1 in 700 in northern Sweden to 1 in 14,000 in the US (34). Hence, although we may have one or two cases of amelogenesis imperfecta in our sample, we do not expect them to greatly impact the association results of common variants in these genes. But even more importantly, while inactivating mutations of these genes lead to full blown amelogenesis imperfecta, hypomorphic variants (i.e., common SNPs in the population) could play a role during enamel formation and lead to mild forms of defects that affect just portions of the dentitions and are less severe. Also, the limitation related to the age of the subjects can affect the diagnosis of older individuals. In adult subjects, developmental enamel defects may have been masked by restorations and remineralizing agents, so the accuracy of diagnosis of presence/absence of enamel defects may be questioned. The consequence of this potential bias is including controls with undetected enamel defects, which would implicate in possibly missing true associations. If on one hand, this is a concern, on the other hand, it may suggest that the associations found in this study are indeed due to true biological relationships, since differences between cases and controls were significant enough to overcome the chance some controls have been misclassified as such.
The morphologic appearance of ameloblasts differs at each successive stage of the enamel development (presecretory, secretory, transitional, and maturation) with corresponding marked changes in the expression of several well-characterized genes (35–38). During the progression from the earlier to the later stages of enamel maturation a dynamic process takes place with cellular, biochemical, genetic, and epigenetic changes in the developing tissue. It is noted that high rates of mineral acquisition, associated fluctuations in extracellular pH, and resorption of extracellular enamel proteins occur. During maturation stage, ameloblasts change from having a tall, thin, and highly polarized organization (characteristic of the secretory stage), to having a low columnar and widened morphology. These results indicate that ameloblasts undergo widespread molecular changes during the maturation stage of amelogenesis (39). It has been suggested that the enamel defect observed in MIH occurs due to ameloblasts sensitization during the maturation phase of dental enamel, leading to hypomineralized enamel (10).
The present study suggested trends for association between hypomineralized enamel and genetic variation in enamel formation genes. It was possible to note that some variants indicated a trend for association with susceptibility to MIH, while others showed a trend in the other direction, suggesting a protective effect against the development of MIH. Interestingly, for both independent populations investigated, no association was found in regards to AMELX, a fundamental gene that secretes the main protein of dental enamel, the amelogenin, during the secretion stage of amelogenesis. This can suggest that the enamel defect in MIH seems not to be directly related with the function of amelogenin during the secretion stage of amelogenesis.
Amelx, Enam, and Ambn have their expression levels decreased by the late maturation stage of amelogenesis (39). However, these changes are subtler for Ambn. This finding is in agreement with reports that Ambn is expressed during the maturation stage (35). Although no gross morphological changes have been described between early and late maturation of the enamel organ, a number of ultrastructural changes (vacuolation patterns and lysosomal content) occurs. Moreover, inferred physiological activities, such as those possibly derived from differences in pH and differences in the rates of mineral acquisition described earlier between these two stages (40,41), are probably related to differences in gene regulation (42). We found a trend for association between variation in AMBN and MIH in both cohorts, which may suggest that variation in the regulation of AMBN is a mechanism that leads to MIH.
Tuftelin has been suggested to play an important role during the development and mineralization of enamel, but its precise function is still unclear. It is also expressed in several non-mineralizing soft tissues, suggesting that Tuftelin has a universal function and/or a multifunctional role (43). Tuftelin-interacting protein 11 (TFIP11) was first identified in a yeast two-hybrid screening as a protein interacting with tuftelin. The ubiquitous expression of TFIP11 suggested that it might have other functions in non-dental tissues (44). We found evidence for a trend of association between genetic variation of TUFT1 and TFIP11 and MIH, which suggest these genes are potentially involved in individual predisposition to MIH.
We also evaluated the association between genetic markers in enamel formation genes and caries, based on MIH. Since we do not had radiographs to review, there is the potential that some carious lesions went undetected, however this is a limitation for the whole sample and there is no reason to believe cases and controls would have been differently affected by this limitation. Cases of MIH have their caries experience suggestively associated with variants in AMELX, ENAM, and TFIP11. The association between AMELX or ENAM and caries has been reported in hypomineralized-free enamel (5,22,24). Genetic changes leading to abnormal protein function or decreased amounts of protein could lead to some degree of disorganization of the enamel prisms that increases the individual's susceptibility to caries (5). The association with TFIP11 is intriguing since previous attempts to detect this association have failed (21,22,24). TFIP11 was associated with early stages of enamel demineralization and fluoride-mediated remineralization (5), which suggest that genetic analyses of caries should take into consideration more detailed description of the disease status.
Our study has some obvious limitations. Cases and controls were not perfectly matched. There were slightly more females than males among the cases (although this difference was not statistically significant). Caries experience (DMFT scores) tends to increase with age; however, we do not think the age difference between cases and controls greatly impacted our results since controls were older than cases in the Brazilian population studied. Finally, population substructure may have gone undetected. In Istanbul, 75% of the population is Turkish, and Kurds, Armenians, Jews, and Greeks represent the remainder (24). In the Brazilian group from Araraquara, the population is fully interbred. Brazilians form one of the most heterogeneous populations in the world, resulting from interethnic crosses between Europeans (mainly Portuguese and Italians), Africans (brought as slaves), and autochthonous Amerindians (45).
Our study provides rationale to expand this work to other genes that are suggested to be involved in hypomineralized/hypocalcified amelogenesis imperfecta. These genes include KLK4 (46), MMP20 (47), WDR72 (48), and FAM83H (49). Similar to the amelogenesis imperfecta causing genes ENAM and AMELX, the hypothesis is that genetic variation in these genes that do not have such dramatic consequences as full-blown amelogenesis imperfecta may cause localized form of enamel. hypomineralization.
In summary, we provide new insight into the development of hypomineralized enamel defects. Considering that the maturation period of tooth enamel that is commonly affected by MIH (first permanent molars and permanent incisors) corresponds to the last trimester of pregnancy to the third year of a child's life, it is possible that genetic variation may somehow interact with environmental factors. Further studies are needed to assess this potential interaction as well as patterns of penetrance of MIH.
Supplementary Material
Acknowledgements
The authors have no conflict of interest to declare. We are indebted to all subjects that participate in this study. Sarah Vinski revised the text for grammar and style. This work was supported by the Brazilian Agencies São Paulo State Foundation (FAPESP 2011/13636-5) and CAPES Foundation (6936/11–3), the Research Fund of Istanbul University (Project Number: UDP-29688/2013 to F.S.), and by NIH grant R01-DE18914 (to A.R.V.).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Fincham AG, Moradian-Oldak J, Simmer JP. The structural biology of the developing dental enamel matrix. J Struct Biol. 1999;126(3):270–299. doi: 10.1006/jsbi.1999.4130. [DOI] [PubMed] [Google Scholar]
- 2.Paine ML, Zhu DH, Luo W, Bringas PJ, Goldberg M, Whitel SN. Enamel biomineralization defects result from alterations to amelogenin self-assembly. J Struct Biol. 2000;132(3):191–200. doi: 10.1006/jsbi.2000.4324. [DOI] [PubMed] [Google Scholar]
- 3.Simmer JP, Hu JC. Expression, structure, and function of enamel proteinases. Connect Tissue Res. 2002;43(2–3):441–449. doi: 10.1080/03008200290001159. [DOI] [PubMed] [Google Scholar]
- 4.Simmer JP, Hu JCC. Dental enamel formation and its impact on clinical dentistry. J Dent Educ. 2001;65(9):896–905. [PubMed] [Google Scholar]
- 5.Shimizu T, Ho B, Deeley K, Briseño-Ruiz J, Faraco IM, Jr, Schupack BI, et al. Enamel formation genes influence enamel microhardness before and after cariogenic challenge. PLoS ONE. 2012;7(9):e45022. doi: 10.1371/journal.pone.0045022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Suckiling GW. Developmental defects of enamel-historical and present-day perspectives of their pathogenesis. Adv Dent Res. 1989;3(2):87–94. doi: 10.1177/08959374890030022901. [DOI] [PubMed] [Google Scholar]
- 7.Seow WK. Clinical diagnosis of enamel defects: Pitfalls and practical guidelines. Int Dent J. 1997;47(3):173–182. doi: 10.1002/j.1875-595x.1997.tb00783.x. [DOI] [PubMed] [Google Scholar]
- 8.Weerheijm KL, Duggal M, Mejàre I, Papagiannoulis L, Koch G, Martens LC, et al. Judgement criteria for molar incisor hypomineralization (MIH) in epidemiologic studies: a summary of the European meeting on MIH held in Athens, 2003. Eur J Paediatr Dent. 2003;4(3):110–113. [PubMed] [Google Scholar]
- 9.Koch G, Hallonsten AL, Ludvigsson N, Hansson BO, Holst A, Ullbro C. Epidemiologic study of idiopathic enamel hypomineralization in permanent teeth of Swedish children. Community Dent Oral Epidemiol. 1987;15(5):279–285. doi: 10.1111/j.1600-0528.1987.tb00538.x. [DOI] [PubMed] [Google Scholar]
- 10.Weerheijm KL. Molar incisor hypomineralisation (MIH) Eur J Paediatr Dent. 2003;4(3):115–120. [PubMed] [Google Scholar]
- 11.Jälevik B, Klingberg G, Barregard L, Noren JG. The prevalence of demarcated opacities in permanent first molars in a group of Swedish children. Acta Odontol Scand. 2001;59(5):255–260. doi: 10.1080/000163501750541093. [DOI] [PubMed] [Google Scholar]
- 12.Leppaniemi A, Lukinmaa PL, Alaluusua S. Nonfluoride hypomineralizations in the permanent first molars and their impact on the treatment need. Caries Res. 2001;35(1):36–40. doi: 10.1159/000047428. [DOI] [PubMed] [Google Scholar]
- 13.Balmer RC, Laskey D, Mahoney E, Toumba KJ. Prevalence of enamel defects and MIH in non-fluoridated and fluoridated communities. Eur J Paediatr Dent. 2005;6(4):209–212. [PubMed] [Google Scholar]
- 14.Muratbegovic A, Markovic N, Selimovic MG. Molar incisor hypomineralization in Bosnia and Herzegovina: prevalence, etiology and clinical consequences in medium caries activity population. Eur Arch Paediatr Dent. 2007;8(4):189–194. doi: 10.1007/BF03262595. [DOI] [PubMed] [Google Scholar]
- 15.Preusser SE, Ferring V, Wleklinski C, Wetzel WE. Prevalence and severity of molar incisor hypomineralization in a region of Germany- a brief communication. J Public Health Dent. 2007;67(3):148–150. doi: 10.1111/j.1752-7325.2007.00040.x. [DOI] [PubMed] [Google Scholar]
- 16.Cho SY, Ki Y, Chu V. Molar incisor hypomineralization in Hong Kong Chinese children. Int J Paediatr Dent. 2008;18(5):348–352. doi: 10.1111/j.1365-263X.2008.00927.x. [DOI] [PubMed] [Google Scholar]
- 17.Alaluusua S. Aetiology of Molar-Incisor Hypomineralization: a systematic review. Eur Arch Paediatr Dent. 2010;11(2):53–58. doi: 10.1007/BF03262713. [DOI] [PubMed] [Google Scholar]
- 18.Weerheijm KL, Jalevik B, Alaluusua S. Molar-incisor hypomineralization. Caries Res. 2001;35(5):390–391. doi: 10.1159/000047479. [DOI] [PubMed] [Google Scholar]
- 19.Rodd HD, Morgan CR, Day PF, Boissonade FM. Pulpal expression of TRPV1 in molar incisor hypomineralization. Eur Arch Paediatr Dent. 2007;8(4):184–188. doi: 10.1007/BF03262594. [DOI] [PubMed] [Google Scholar]
- 20.Gutiérrez S, Torres D, Briceño I, Gómez AM, Baquero E. Clinical and molecular analysis of the enamelin gene ENAM in Colombian families with autosomal dominant amelogenesis imperfecta. Genet Mol Biol. 2012;35(3):557–566. doi: 10.1590/S1415-47572012000400003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Slayton RL, Cooper ME, Marazita ML. Tuftelin, mutans streptococci, and dental caries susceptibility. J Dent Res. 2005;84(8):711–714. doi: 10.1177/154405910508400805. [DOI] [PubMed] [Google Scholar]
- 22.Deeley K, Letra A, Rose EK, Brandon CA, Resick JM, Marazita ML, et al. Possible association of amelogenin to high caries experience in Guatemalan-Mayan population. Caries Res. 2008;42(1):8–13. doi: 10.1159/000111744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Vieira AR, Marazita ML, Mchenry TG. Genome-wide scan finds suggestive caries loci. J Dent Res. 2008;87(5):435–439. doi: 10.1177/154405910808700506. [DOI] [PubMed] [Google Scholar]
- 24.Patir A, Seymen F, Yildirim M, Deeley K, Cooper ME, Marazita ML, et al. Enamel formation genes are associated with high caries experience in Turkish children. Caries Res. 2008;42(5):394–400. doi: 10.1159/000154785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ozturk A, Famili P, Vieira AR. The antimicrobial peptide DEFB1 is associated with caries. J Dent Res. 2010;89(6):631–636. doi: 10.1177/0022034510364491. [DOI] [PubMed] [Google Scholar]
- 26.Shaffer JR, Wang X, Feingold E, Lee M, Begum F, Weeks DE, et al. Genome-wide association scan for childhood caries implicates novel genes. J Dent Res. 2011;90(12):1457–1462. doi: 10.1177/0022034511422910. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tannure PN, Küchler EC, Falagan-Lotsch P, Amorim LMF, Luiz RR, Costa MC, et al. MMP13 polymorphism decreases risk for dental caries. Caries Res. 2012;46(4):401–407. doi: 10.1159/000339379. [DOI] [PubMed] [Google Scholar]
- 28.Tannure PN, Küchler EC, Lips A, Costa MC, Luiz RR, Granjeiro JM, et al. Genetic variation in MMP20 contributes to higher caries experience. J Dent. 2012;40(5):381–386. doi: 10.1016/j.jdent.2012.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang X, Shaffer JR, Zeng Z, Begum F, Vieira AR, Noel J, et al. Genome-wide association scan of dental caries in the permanent dentition. BMC Oral Health. 2012;12(1):57. doi: 10.1186/1472-6831-12-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Olivier M, et al. High-throughput genotyping with single nucleotide polymorphisms. Genome Res. 2001;11(7):1262–1268. doi: 10.1101/gr.157801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yano A, Kaneko N, Ida H, Yamaguchi T, Hanada N. Real-time PCR for quantification of Streptococcus mutans. FEMS Microbiol Lett. 2002;217(1):23–30. doi: 10.1111/j.1574-6968.2002.tb11451.x. [DOI] [PubMed] [Google Scholar]
- 32.Lygidakis NA, Wong F, Jälevik B, Vierrou AM, Alaluusua S, Espelid I. Best clinical practice guidance for clinicians dealing with children presenting with molar-incisorhypomineralisation (MIH): An EAPD policy document. Eur Arch Paediatr Dent. 2010;11(2):75–81. doi: 10.1007/BF03262716. [DOI] [PubMed] [Google Scholar]
- 33.Jeremias F, Souza JF, Silva CMC, Cordeiro RD, Zuanon AC, Santos-Pinto L. Dental caries experience and molar-incisor hypomineralization. Acta Odontol Scand. 2013 doi: 10.3109/00016357.2012.734412. Epub ahead of print. [DOI] [PubMed] [Google Scholar]
- 34.Stephanopoulos G, Garefalaki ME, Lyroudia K. Genes and related proteins involved in amelogenesis imperfecta. J Dent Res. 2005;84(12):1117–1126. doi: 10.1177/154405910508401206. [DOI] [PubMed] [Google Scholar]
- 35.Winter GB, Brook AH. Enamel hypoplasia and anomalies of the enamel. Dent Clin North Am. 1975;19(1):3–24. [PubMed] [Google Scholar]
- 36.Nanci A, Zalzal S, Lavoie P, Kunikata M, Chen W-Y, Krebsbach PH, et al. Comparative immunochemical analyses of the developmental expression and distribution of ameloblastin and amelogenin in rat incisors. J Histochem Cytochem. 1998;46(8):911–934. doi: 10.1177/002215549804600806. [DOI] [PubMed] [Google Scholar]
- 37.Hu JCC, Sun X, Zhang C, Simmer JP. A comparison of enamelin and amelogenin expression in developing mouse molars. Eur J Oral Sci. 2001;109(2):125–132. doi: 10.1034/j.1600-0722.2001.00998.x. [DOI] [PubMed] [Google Scholar]
- 38.Paine ML, White SN, Luo W, Fong H, Sarikaya M, Snead ML. Regulated gene expression dictates enamel structure and tooth function. Matrix Biol. 2001;20(5–6):273–292. doi: 10.1016/s0945-053x(01)00153-6. [DOI] [PubMed] [Google Scholar]
- 39.Bartlett JD, Ganss B, Goldberg M, Moradian-Oldak J, Paine ML, Snead ML, et al. Protein-protein interactions of the developing enamel matrix. Curr Top Dev Biol. 2006;74(1):57–115. doi: 10.1016/S0070-2153(06)74003-0. [DOI] [PubMed] [Google Scholar]
- 40.Lacruz RS, Smith CE, Chen Y-B, Hubbard MJ, Hacia JG, Paine ML. Gene-expression analysis of early- and late-maturation-stage rat enamel organ. Eur J Oral Sci. 2011;119(Suppl 1):149–157. doi: 10.1111/j.1600-0722.2011.00881.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Smith CE. Stereological analysis of organelle distribution within rat incisor enamel organ at successive stages of amelogenesis. INSERM. 1984;125(1):273–282. [Google Scholar]
- 42.Salama AH, Bailey RJ, Eisenmann DR, Zaki AE. Quantitative cytochemistry of lysosomal structures in rat incisor maturation enamel organ. Arch Oral Biol. 1990;35(7):535–539. doi: 10.1016/0003-9969(90)90084-n. [DOI] [PubMed] [Google Scholar]
- 43.Deutsch D, Leiser Y, Shay B, Fermon E, Taylor A, Rosenfeld E, et al. The human tuftelin gene and the expression of tuftelin in mineralizing and nonmineralizing tissues. Connect Tissue Res. 2002;43(2–3):425–434. doi: 10.1080/03008200290001186. [DOI] [PubMed] [Google Scholar]
- 44.Wen X, Lei YP, Zhou YL, Okamoto CT, Snead ML, Paine ML. Structural organization and cellular localization of tuftelin-interacting protein 11 (TFIP11) Cell Mol Life Sci. 2005;62(9):1038–1046. doi: 10.1007/s00018-005-4547-z. [DOI] [PubMed] [Google Scholar]
- 45.Alves-Silva J, Santos MS, Guimarães PEM, Ferreira ACS, Bandelt HJ, Pena SDJ, et al. The ancestry of Brazilian mtDNA lineages. Am J Hum Genet. 2000;679(2):444–461. doi: 10.1086/303004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Hart PS, Hart TC, Michalec MD, Ryu OH, Simmons D, Hong S, et al. Mutation in kallikrein 4 causes autosomal recessive hypomaturitation amelogenesis imperfecta. J Med Genet. 2004;41(7):545–549. doi: 10.1136/jmg.2003.017657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kim J-W, Simmer JP, Hart TC, Hart PS, Ramaswami MD, Bartlett JD, et al. MMP20 mutation in autosomal recessive pigmented hypomaturation amelogenesis imperfecta. J Med Genet. 2005;42(3):271–275. doi: 10.1136/jmg.2004.024505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.El-Sayed W, Parry DA, Shore RC, Ahmed M, Jafri H, Rashid Y, et al. Mutations in the beta propeller WDR72 cause autosomal-recessive hypomaturation amelogenesis imperfecta. Am J Hum Genet. 2009;85(5):699–705. doi: 10.1016/j.ajhg.2009.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kim J-W, Lee S-K, Lee ZH, Park J-C, Lee K-E, Park M-H, et al. FAM83H motations in families with autosomal-dominant hypocalcified amelogenesis imperfecta. Am J Hum Genet. 2008;82(2):489–494. doi: 10.1016/j.ajhg.2007.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.