Skip to main content
The FASEB Journal logoLink to The FASEB Journal
. 2013 Nov;27(11):4572–4584. doi: 10.1096/fj.13-232751

Infection with the carcinogenic liver fluke Opisthorchis viverrini modifies intestinal and biliary microbiome

Jordan L Plieskatt *,, Raksawan Deenonpoe , Jason P Mulvenna §, Lutz Krause , Banchob Sripa , Jeffrey M Bethony *,†,1, Paul J Brindley *,†,1
PMCID: PMC3804743  PMID: 23925654

Abstract

Opisthorchis viverrini is a fish-borne trematode endemic in East Asia. Following ingestion, the flukes locate to the biliary treȩ where chronic infection frequently leads to cholangiocarcinoma (CCA). The mechanisms by which O. viverrini infection culminates in CCA remain unknown. An unexplored aspect is its influence on the host microbiome. In the hamster, infection with this pathogen reliably leads to CCA. Genomic DNAs of microbiota from colorectal contents and bile of hamsters and from whole O. viverrini were examined in this model of fluke-induced CCA. Microbial communities were characterized by high-throughput sequencing of variable regions 7–9 of prokaryotic 16S ribosomal DNA. Of ∼1 million sequences, 536,009 with useable reads were assignable to 29,776 operational taxonomy units (OTUs) and, in turn, to 20 phyla and 273 genera of Bacteria or Archaea. Microbial community analyses revealed that fluke infection perturbed the gastrointestinal tract microbiome, increasing Lachnospiraceae, Ruminococcaceae, and Lactobacillaceae, while decreasing Porphyromonadaceae, Erysipelotrichaceae, and Eubacteriaceae (P≤0.05). More than 60 OTUs were detected in the biliary system, which confirmed bacteriobilia and a noteworthy community of microbes associated with the parasites. The fluke-associated microorganisms included potential pathogens from the Enterobacteriaceae and Listeriaceae and others, including Cyanobacteria and Deinococci, usually found in external environments. Given that opisthorchiasis is distinguished from other helminth infections by a robust inflammatory phenotype with conspicuously elevated IL-6, and that inflammation of the biliary system leads to periductal fibrosis, which is a precursor of CCA, the flukes and their microbiota may together drive this distinctive immune response.—Plieskatt, J. L., Raksawan, D., Mulvenna, J. P., Krause, L., Sripa, B., Bethony, J. M., Brindley, P. J. Infection with the carcinogenic liver fluke Opisthorchis viverrini modifies intestinal and biliary microbiome.

Keywords: opisthorchiasis, microbiota, neglected tropical disease, infection-related cancer, cholangiocarcinoma


More than 20% of all human cancers in the developing world are associated with infectious disease (1). Links between the hepatitis B and C viruses and hepatocellular carcinoma are well known, as are links with some other viruses and bacteria. However, less well known is the strong association between helminth (worm) parasites and cancer. The World Health Organization's International Agency for Research on Cancer recognizes 3 helminth infections as definitive causes of cancer: the liver flukes Opisthorchis viverrini and Clonorchis sinensis and the blood fluke Schistosoma hematobium (13). Liver fluke infection is a major public health problem in East Asia and Eastern Europe, where more than 40 million people are infected. O. viverrini infection is endemic in Thailand, Laos, Vietnam, and Cambodia (4, 5). A food-borne disease, opisthorchiasis has been extensively studied in Thailand, where estimates indicate that 8 million people are infected (4). Humans acquire the infection by eating raw or undercooked fish infected with the metacercariae of the parasite (5). On ingestion, the larval parasites excyst in the duodenum, and juvenile flukes migrate into the biliary tree. In the bile ducts, the parasites mature over 6 wk into adult flukes, which graze on the biliary epithelia. Eggs from the parasites are shed in bile and exit the infected person in the fecal stream. Where sanitation is less than optimal, the eggs may enter freshwater ecosystems, where the O. viverrini eggs are ingested by freshwater snails. The parasite undergoes transformation within the snail, culminating in the release of cercariae that seek out and penetrate the skin of a freshwater fish. Infection leads to hepatobiliary disease, including cholangitis, periductal fibrosis, cholecystitis, obstructive jaundice, hepatomegaly, and cholelithiasis (6). More problematic, experimental and epidemiologic evidence strongly implicates liver fluke infection in the etiology of a major subtype of liver cancer, cholangiocarcinoma (CCA), also referred to as bile duct cancer (1, 2).

Bile duct cancer is a malignancy with a dismal prognosis. The tumors are slow growing and spread longitudinally along the bile ducts, with periductal and mass-forming extensions. The poor prognosis is owing to its silent clinical character, difficulty in early diagnosis, and limited therapeutic approaches. Median survival is <24 mo. Surgical management is the only potentially curative treatment, but it is restricted to early-stage disease. However, CCA has a worldwide distribution, beyond East Asia, where patients frequently develop CCA de novo without obvious risk factors. Several conditions are associated with an elevated risk of CCA. In the United States, primary sclerosing cholangitis is the well-known precursor. In Thailand and elsewhere in East Asia, where infections with liver flukes are definitive risk factors for cancer, the risk factors share a common determinant of long-standing inflammation and chronic injury of the biliary epithelium, including that caused by persistent parasitism by these fish-borne trematodes (611).

The precise mechanism by which O. viverrini infection culminates in CCA is not known, although it is likely to be multifactorial, including a diet rich in nitrosamines, local and systemic chronic inflammation, and the secretion of mitogens and other mediators by the parasite (10, 12). One area not yet studied is the influence of this parasite on the microbiome of the host. Other helminth parasites are capable of influencing the microbiome, potentially modulating gastrointestinal inflammation in response to the appearance of pathogenic strains (1315).

The Syrian (golden) hamster, Mesocricetus auratus, provides an informative laboratory model of liver fluke–induced periductal fibrosis of the biliary tree and bile duct cancer. O. viverrini infection of this rodent reliably leads to bile duct cancer within months (16). Given the changes in the microbiota that may accompany the initiation and establishment of these hepatobiliary disorders, we examined the microbiome of the gastrointestinal (GI) tract of this model, including the biliary system, during O. viverrini infection. In our study, infection of hamsters with this carcinogenic liver fluke perturbed the microbiome of the GI, in particular by increasing the numbers of the Lachnospiraceae, Ruminococcaceae, Lactobacillaceae, and others, while decreasing Porphyromonadaceae, Erysipelotrichaceae, and Eubacteriaceae. We also describe a diverse microbial community associated with the liver flukes within the mammalian biliary tree (and, thereby, also present the first report of the microbiome of any trematode). These perturbations in microbiota, especially the involvement of the bacteria and archaeans that are associated with the flukes, may drive the distinctive inflammatory response of chronic opisthorchiasis, including prominently elevated IL-6 (10, 11). This response promotes biliary periductal fibrosis in humans that, in turn, is conducive to the emergence of opisthorchiasis-associated bile duct cancer (7, 8, 10, 11).

MATERIALS AND METHODS

Ethics statement

This study involving experimental infection of hamsters with the liver fluke O. viverrini was approved by the Animal Ethics Committee of Khon Kaen University, based on the Ethics of Animal Experimentation of National Research Council of Thailand.

Infection of hamsters with O. viverrini

Metacercariae of O. viverrini were collected from infected fish obtained from reservoirs in Khon Kaen province, Thailand. The fish were digested with pepsin (17). Four Syrian golden hamsters, Mesocricetus auratus, were infected through an intragastric tube with 50 metacercariae each. Four other hamsters were included as noninfected controls, but otherwise were housed in identical conditions in the same room as the infected rodents. The hamsters were maintained at the animal facility, Faculty of Medicine, Khon Kaen University. All 8 hamsters were euthanized at 6 wk after infection, when adult O. viverrini flukes and bile were retrieved from the bile ducts and gall bladder of the infected hamsters, bile from the gall bladder of the control hamsters, and colorectal contents (feces) from each hamster. The bile was aspirated aseptically from the gall bladder with a 27-gauge needle. The bile was stored in >95% ethanol, flukes were stored in >95% ethanol or PBS (pH 7.2), and the feces were stored without buffer, at −20 to −80°C for 6 mo.

Preparation of microbial genomic DNA (gDNA)

Colorectal feces of hamsters

gDNA was isolated from feces from the colon and rectum of 4 O. viverrini-infected and 4 control hamsters. Samples (∼250 mg) from each hamster were processed individually with the EZNA Stool DNA kit (Omega Biotek, Norcross, GA, USA), according to the manufacturer's protocol for pathogen detection. Concentration, purity, and integrity of the gDNA (and from other samples described later) were determined by spectrophotometry (Nanodrop 1000; NanoDrop Technologies, Wilmington, DE, USA) and 2100 Bioanalyzer/DNA 12000 Kit (Agilent Technologies, Palo Alto, CA, USA) (Supplemental Fig. S1). The gDNAs were stored at −80°C.

Liver flukes

Two methods were used to isolate gDNA from worms preserved in ethanol or PBS. The worms were pelleted by centrifugation (4000 g, 10 min), supernatants were removed, and pellets were air dried at 37°C for 10 min. DNase/RNase-free water (100 μl) was added, after which flukes (about 5 adult worms) were pulverized with a motorized micropestle (Kontes, Vineland, NJ, USA). gDNAs were isolated with the EZNA Bacterial DNA kit (Omega Biotek), according to the manufacturer's protocol for difficult-to-lyse bacteria, and stored at −80°C. An alternative method was used with 1 sample of worms that had been stored in PBS. These worms were pulverized, after which the EZNA SQ Tissue DNA kit (Omega Biotek) for purification from animal tissue was used, with one modification: 0.75 mg lysozyme was added during the first incubation at 60°C for 20 min. In total, 3 gDNA preparations were analyzed, each from a different infected hamster.

Bile

At necropsy, bile was collected from the gall bladders of the 4 O. viverrini-infected hamsters and pooled (∼500 μl). Similarly, bile was collected from the control (noninfected) hamsters. The bile was clarified by centrifugation (4000 g, 10 min) at room temperature, the supernatant removed, and the pellets resuspended in water. gDNA was extracted from the pelleted material by using the EZNA Bacterial DNA kit (Omega Biotek), according to the kit's protocol for difficult-to-lyse bacteria, and was stored at −80°C. No microbial DNA was recovered from the bile of the control, noninfected hamsters (Supplemental Fig. S1). Given that the bile of healthy persons and rodents is sterile, the failure to recover microbial DNA was not unexpected (18, 19).

Amplification of 16S rRNA genes and pyrosequencing

Universal primers, 5′-GYAACGAGCGCAACCC [1099; forward (F)] and 5′-AAGGAGGTGATCCAGCCGCA [1541; reverse (R)] were used to amplify hypervariable regions (HVRs) 7–9 of the bacterial 16S rRNA gene (expected size of the amplicons, ∼420 nt; ref. 20). Primers were synthesized and deployed as described in the manufacturer's literature for GS FLX Titanium Series Lib-A Chemistry (Roche Diagnostics GmbH, Mannheim, Germany). The amplicons were purified, equally pooled, and used as templates for emulsion PCR. DNA beads from the emulsion PCRs were subjected to 454 pyrosequencing with GS Titanium reagents (Roche Diagnostics). 16S rRNA gene sequencing was performed by Seq Wright (Houston, TX, USA).

Sequence processing, OTU-based analysis, phylogeny, and diversity analysis

FASTA sequences of amplified 16S small subunit rRNA genes were processed through the CloVR-16S pipeline (http://clovr.org; refs. 2123), using an Amazon Elastic Compute Cloud (EC2) instance, Amazon Machine Image (AMI) identifier ami-31890e58 (Amazon, North Seattle WA, USA). After parsing in UCHIME to remove chimeras (24), quantitative insight into microbial ecology (QIIME; ref. 23) was used for comparison and analysis of microbial communities, and the RDP classifier was used to cluster sequences and assign them into an operational taxonomy unit (OTU) in the National Center for Biotechnology Information (NCBI; Bethesda, MD, USA) taxonomy, with an identity threshold of ≥95% (25, 26). Subsequently, mothur (27) was used to examine the α and β diversity of the microbial communities. After taxonomic assignment, the files were also uploaded to Calypso Web V3, (http://bioinfo.qimr.edu.au/calypso/), a data-mining and visualization tool for 16S rRNA datasets, to further investigate diversity by using rarefaction curves, principal coordinates analysis (PCoA), multivariate and regression analyses, and analysis of variance. Differences in global community composition among the groups were assessed by comparing the intragroup and intergroup Jaccard distances between community profiles (OTU level) by Wilcoxon rank test.

OTU-specific PCRs

OTU-specific PCRs were performed on representative bacterial phylotypes, as follows: Aerococcaceae Facklamia [forward (F): 5′-TAACGAGCGCAACCCTTATC, reverse (R): 5′-CCCAATCATCTATCCCACCTTC], Flavobacteriaceae Flavobacterium (F: 5′-GAGTCAAGTCGGGAACTCTAAC, R: 5′-GGATCATGGCTGATATCCGATTA), Acetobacteraceae Muricoccus (F: 5′-CGGCTACCTTGTTACGACTT, R: 5′-ATCAGATATCGCGAGGCAAC), Sphingomonadaceae Novosphingobium (F: 5′-T CTGCCTCTCATTGCTGAGTTA, R: 5′-CACGCGAGTGTGAGCTAAT), and Comamonadaceae Variovorax (F: 5′-CAAGTCCTCATGGCCCTTATAG), R: 5′-CCGATACGGCTACCTTGTTAC). Amplifications were performed with GoTaq polymerase and reagents (Promega, Madison, WI, USA), with thermal cycling at 94°C, 1 min; 54°C, 45 s; and 72°C, 1 min, for 35 cycles. The products were sized by electrophoresis through 1–1.5% agarose in Tris acetate-EDTA, stained with ethidium bromide, and photographed. gDNAs (4 ng/μl) were used as templates in some cases (as were the microbial 16S rRNA gene amplicons), obtained by using the primers specific for HVRs 7–9 (6 ng/μl after the latter amplicons had been sized; ∼420 nt; GeneRuler 1 kb Plus DNA Ladder; Thermo Scientific, Pittsburgh, PA, USA), and purified (Wizard SV Gel and PCR Clean-Up System; Promega).

Phylogenetic analysis

Phylograms were inferred by using the maximum-likelihood method based on the Kimura 2-parameter model (28). A discrete γ distribution was used to model evolutionary rate differences among the sites. Trees were drawn to scale, with branch lengths measured in the number of substitutions per site. Positions containing gaps and missing data were eliminated. Analyses were conducted in MEGA5 (29).

Database accession

Sequence data from this study are available at the Sequence Read Archive (SRA), NCBI, U.S. National Library of Medicine (Bethesda, MD, USA) under accession number SRA065893.

RESULTS

OTUs from 273 genera of Bacteria and Archaea

Sequences from the colorectal feces, bile, and O. viverrini worms were amplified with primers targeting HVRs 7–9 of the prokaryotic 16S rRNA genes. Of ∼1 million sequences obtained, 536,009 with useable reads were assignable to 29,776 OTUs and, in turn, to 20 phyla and 273 genera of the domains Bacteria and Archaea (Fig. 1, Table 1, and Supplemental Table S1). Ten percent of these reads were from bile, 32% from the liver flukes, 29% from infected hamster colon, and 29% from normal hamster colon. Whereas 98% of the 273 OTUs identified were bacterial, the remainder were archaeal, from at least 2 phyla of the Archaea kingdom (Table 1 and Supplemental Table S1).

Figure 1.

Figure 1.

Taxonomic clusters of microbiomes based on 16S rRNA sequences from colorectal feces from control and O. viverrini-infected hamsters and bile from the infected hamsters and from the O. viverrini worms parasitizing the hamsters. Heat maps at the phylum (A) and genus (B) levels were created with the Skiff visualization tool of CloVR (2123). After normalization, the values were transformed to proportions within each sample, after which the logarithm of all proportions was taken. HAMFU1-U4, colon contents (feces) from control (uninfected) hamsters; HAMF1-F4, colon contents from infected hamsters; HAMBIPOOL, bile from infected hamsters; HAMOVG1-G2, O. viverrini worms from hamsters; HAMOVS1, O. viverrini gDNA extracted with lysozyme from hamsters.

Table 1.

Bacteria and Archaea phyla and number of reads detected in hamster colon contents, hamster bile, and whole O. viverrini worms by pyrosequencing of amplicons targeting prokaryotic 16S rRNA genes

Phylum Colon, normal
Colon, infected
OV
Bile, infected
1 2 3 4 1 2 3 4 G1 G2 S1
Bacteria
    Actinobacteria 193 353 1,159 130 79 24 53 102 49 74 19 115
    Bacteroidetesa 19,632 9,291 7,999 18,615 7,284 5,558 5,616 9,011 7 10 1 3
    Cyanobacteria 0 0 0 0 0 0 0 1 5 0 0 1
    Deferribacteres 0 0 4 1 16 5 4 1 0 2 1 0
    Deinococcus_Thermus 0 0 0 0 0 0 0 0 0 15 0 2
    Fibrobacteres 45 0 0 7 0 2 0 0 0 0 0 0
    Firmicutes 18,589 26,748 30,491 10,742 31,456 27,870 29,913 22,168 53,003 61,413 14,934 46,897
    Fusobacteria 0 4 3 13 0 0 0 0 0 0 0 0
    Gemmatimonadetes 0 0 0 4 0 0 0 0 1 40 0 0
    Othera 406 420 427 317 1,004 643 775 945 615 2,732 1,672 6,672
    Proteobacteria 753 1,789 2,540 6,212 2,383 959 1,571 4,914 788 2,046 31,679 799
    Spirochaetes 0 0 2 1 24 37 14 72 0 0 0 0
    TM7 0 0 0 1 12 40 2 2 0 0 0 0
    Tenericutes 0 0 0 1 0 2 0 0 0 0 0 0
    Thermomicrobia 0 0 0 0 0 0 0 0 3 0 0 0
    Verrucomicrobia 14 17 19 25 50 12 5 6 0 0 0 0
    Root_Othera 7 5 11 14 17 10 18 13 497 1,020 934 10
        Total reads 157,004 152,693 171,560 54,499
        Composition (%) 29 29 32 10
Archaea
    Crenarchaeota 0 0 0 0 0 0 0 1 0 0 0 0
    Euryarchaeota 0 3 14 94 26 1 0 0 0 0 1 0
    Other 5 3 2 4 13 4 9 6 0 29 38 0
        Total reads 125 60 68 0
        Composition (%) 49 24 27 0

OV, O. viverrini.

a

Representative phyla (nonexclusive list) where significant differences were apparent among the microbial communities in colon contents: infected hamsters, control hamsters, and the biliary tree (worms and bile).

The carcinogenic liver fluke O. viverrini modified the GI tract microbiota

Significant differences in the microbiota were seen in O. viverrini-infected hamsters vs. the uninfected, control hamsters. Differences were apparent at all taxonomic levels examined, from phylum to genus. The representative taxonomic clusters presented in Fig. 1 illustrate the differences at the phylum (Fig. 1A) and genus (Fig. 1B) levels. At the phylum level, members of Spirochaetes (P≤0.02) and Bacteria_Other (P≤0.01) were more prevalent in the colorectal contents of the infected hamsters than in those of the control hamsters (Fig. 1A and Table 1), whereas at the genus level, numerous other differences were observed (Figs. 1B, 2, and 3). Specifically, the colorectal feces of the infected hamsters exhibited more Ruminococcaceae, Lachnospiraceae, and Lactobacillus than did those of the control animals. By contrast, there were more Porphyromonadaceae, Erysipelotrichaceae, and Eubacteriaceae in the colorectal feces of control hamsters than in the infected ones (Figs. 2 and 3). The microbial communities in the colorectal feces of the infected and control hamsters included a higher prevalence of OTUs belonging to the orders Clostridaiales and Bacteroidales and the families Ruminococcaceae and Desulfovibrionaceae (Fig. 2) than did the microbiota identified in the O. viverrini worms and bile of the infected hamsters. Conversely, increased OTUs were seen in worms and bile, compared with those in the colorectal feces—specifically, Lactobacillus, Bacilli_Other, and Bacteria_Other (Figs. 1, 2, and 3B; Table 1; and Supplemental Table S1).

Figure 2.

Figure 2.

Composition of the microbial communities in adult O. viverrini liver flukes, bile, and colorectal feces from control and liver fluke–infected hamsters. Comparison of microbial communities from colorectal feces from control and O. viverrini-infected hamsters, from O. viverrini worms, and from the bile of infected hamsters. Bubble volumes reveal the number of OTUs of the genera.Colon, control 1–4: HAMFU1-U4, control hamsters; Colon, infected 1–4: HAMF1-F4, infected hamsters; Liver flukes 1–3: HAMOVG1 and -G2 and HAMOVS1, O. viverrini worms (HAMOVS1, gDNA extracted with lysozyme); Bile 1: HAMBIPOOL, bile from infected hamsters. Data are expressed as mean abundance (%).

Figure 3.

Figure 3.

Significant differences were evident among the microbial communities in the control hamsters and in the hamsters infected with O. viverrini. Community compositions are presented for families/genera of microorganisms that exhibited differences among groups. A) Bacterial composition (mean abundance) of colorectal feces in the control and O. viverrini-infected hamsters. B) Bacterial composition of the colorectal contents (feces) of the control and O. viverrini-infected hamsters, of the whole O. viverrini worms, and of the bile from infected hamsters. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

Striking differences in diversity among the communities were evident in the colorectal feces of the control and infected hamsters, in the bile of the infected hamsters, and in the worms living in the bile within the bile ducts (Figs. 2 and 3; Table 1; and Supplemental Table S1). Rarefaction analysis of community richness (Fig. 4A) revealed greater alpha diversity in microbial communities in the colon than in the bile and worms. The microbial communities of the colorectal contents of the infected hamsters, in turn, were more diverse than those in the control animals (Figs. 2 and 4 and Table 1). The communities associated with the liver flukes and bile were less diverse than those of the colorectal contents. As quantified by Shannon index, β-diversity revealed a similar trend, with mean indices of 2.7, 2.4, 0.8, and 0.6 from infected colon, control colon, bile, and O. viverrini, respectively (Fig. 4B). Global community composition diverged significantly among these microbiomes, as measured by the Jaccard distance (P<0.05), with the exception of O. viverrini and bile (P=0.65) (not shown). O. viverrini in bile exhibited the shortest pair-wise median Jaccard distance (0.43), followed by the distance of O. viverrini from infected feces (0.93) and bile from infected feces (0.94). (Indeed, it was not reasonable or practical to separate the worm/bile communities, given that the worms resided in the bile.) The greatest differences in global community composition were found when comparing bile with normal colorectal feces (0.97) and O. viverrini infected with control feces (0.98). PCoA (Fig. 4C) confirmed the dissimilarity in global community composition among the O. viverrini-infected and the control feces of the hamsters and the similarity between the O. viverrini worms and the bile of the hamsters from which the worms were recovered. As mentioned above, it is not feasible to separate the worms from the bile, and the close identity of the microbial communities of O. viverrini worms and the bile would reflect ingested microbes contained in the bile by the worms and release of endogenous microbes from the flukes into the bile where they reside. Last, rodent-to-rodent differences were not significant; each of the 4 control hamsters exhibited similar microbiota in the colorectum. Similarly, individual differences among the 4 infected hamsters were not significant (Figs. 1, 2, and 4 and Table 1).

Figure 4.

Figure 4.

Community diversity in microbiota in O. viverrini-infected hamsters. A) Rarefaction plot of α diversity. B) Community diversity according to the Shannon index (mean) at genus-level phylotype; significant community diversity was evident. C) PCoA illustrating dissimilarity among the phylotype structures of the GI tract microbiota of the O. viverrini-infected and control hamsters and the O. viverrini worms from the bile ducts of the infected hamsters.

More genomic DNA was recovered from 250 mg of colorectal feces of the infected hamsters (range, 21.0–99.7 μg gDNA) than from that of control hamsters (range, 3.7–7.9 μg) (P≤0.05; Supplemental Fig. S1), indicating a difference in overall microbial load. Further, as evidenced by the rarefaction and Shannon indices, microbial diversity was greater in the colorectal feces of the O. viverrini-infected than in the control hamsters (Fig. 4A). However, differences in the percentages of total OTUs were not apparent between the infected and the control colorectal feces (Table 1 and data not shown), despite the higher microbiotic mass in the fluke-infected hamsters.

Noteworthy microbiota was associated with the carcinogenic liver fluke O. viverrini

Approximately 1000 OTUs were scored in the worm/bile samples, compared with >6000 to >9000 in the colorectal feces of the control and O. viverrini-infected hamsters, respectively. The rarefaction plot indicated that most of the microorganisms associated with O. viverrini and bile had been identified, given that the slopes of these curves plateaued after ∼20,000 reads were sampled. By contrast, the rarefaction curves of the colorectal feces remained steep, indicating that additional reads would be needed to reach saturation coverage and comprehensive identification of these microbial communities (Fig. 4A).

More than 20 OTUs of Bacteria and Archaea were present at higher, often much higher, levels in the worms and bile than in the colorectum (Supplemental Table S1). These included phylotypes from the Propionibacterineae, Burkholderia, Brevundimonas, Comamonas, Enterobacteriaceae including Citrobacter, Gammaproteobacteria_Other, Incertae sedis 5_Tepidimonas, Lactobacillus, Acinetobacter, Mesorhizobium, and Pseudomonadaceae, including Pseudomonas, Flavimonas, and Thermomonas (Supplemental Table S1). Members of the order Lactobacillales were the most abundant OTUs in the worms and bile. Furthermore, ∼60 OTUs that were detected in the biliary system were not detected in the colorectal contents by pyrosequencing (Supplemental Table S1). Not only were these OTUs from numerous phyla of the Bacteria and Archaea domains, they also included phylotypes from genera that are potential pathogens in humans, including Bordetella, Brochothrix, Burkholderia, Leminorella, Pseudomonas, Serratia, and Sphingomonas, all of which are gram-negative or -positive bacteria. This biliary tract microbiota also included microbes known usually from the external environment, including freshwater, soil, and even volcanic springs: Cyanobacteria, Methylobacterium, Mesorhizobium, Flavobacterium, Truepera, and others. The presence of these OTUs was intriguing: for example, Deinococcus from the phylum Deinococcus-Thermus (given the well-known radioresistance and resistance to environmental extremes of the Deinococci; ref. 30) and halophiles of the order Oceanospirillales (31). A phylogram of some of the liver fluke–associated microbes is presented in Fig. 5, to display the diversity of this distinctive biliary tree microbiome. This representative sample includes 18 OTUs from 6 phyla of the Archaea and Bacteria domains.

Figure 5.

Figure 5.

Phylogram of the diverse community of microbes associated with the O. viverrini worms parasitizing the biliary tree of hamsters. Of the ∼60 worm-associated OTUs, 18 are presented on branches with OTU identifications. The phyla and classes to which OTUs of these representative microorganisms were assigned also are shown. The phylogram was inferred by using the maximum likelihood method. A discrete γ distribution was used to model evolutionary rate differences among sites (5 categories; +G, parameter=1.3283). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 18 nucleotide sequences; positions containing gaps and missing data were eliminated, and the dataset included a total of 162 positions.

To further investigate whether these microbes were indeed present only in the biliary system, we used OTU-specific PCRs targeting 5 of the OTUs listed in Supplemental Table S1, to more thoroughly search the colorectal feces. [The rarefaction curve for the infected colon contents remained steep (Fig. 4A), indicating that many species had yet to be detected.] The 5 OTUs were Aerococcaceae Facklamia, Flavobacteriaceae Flavobacterium, Acetobacteraceae Muricoccus, Sphingomonadaceae Novosphingobium, and Comamonadaceae Variovorax. We deployed oligonucleotide primers specific for the 16S rRNA genes of each of the 5 target microbes and performed the PCRs with the original gDNA preparations. Four of the five—the Facklamia, Flavobacterium, Muricoccus, and Variovorax OTUs—were detected also in the hamster feces, although the signals were generally weaker than those in the worm/bile gDNA and, in general, were stronger in the infected compared with the control hamster feces (not shown). By contrast, the Novosphingobium OTU was not detected in the colorectal feces. Subsequently, the broad-range HVR 7, 8, and 9 primers were used again to amplify the 16S rRNA genes, and these amplicons served as templates for OTU-specific PCRs targeting the 5 phylotypes. This nested, OTU-specific PCR approach also failed to detect the Novosphingobium OTU in feces (Supplemental Fig. S2). Together, the findings of the high-throughput pyrosequencing and OTU-specific PCRs strongly indicated that some OTU level phylotypes were present only in the O. viverrini worms from the bile ducts, presumably transported there with the parasites.

Liver fluke–associated Archaea

Phylotypes assigned to the domain Archaea were identified in the microbial communities of the colorectal feces in the control and infected hamsters, even though the 16S rRNA gene-specific primers that were deployed specifically target Bacteria (rather than Archaea; ref. 20). The archaeal OTUs belonged to the phylum Euryarchaeota; class Methanobacteria; and genera Methanobrevibacter, Methanosphaera, Methanothermobacter, and others. These particular microbes are well known from the mammalian digestive tract and the oral cavity; they are methanogens (32). Several others were present in the O. viverrini adult worms, but notably, not all were apparently from the Euryarchaeota (Table 1). The phylogeny including the constituent phyla of the Archaea domain is not well established, because these prokaryotes often occur in extreme geographic environments and often cannot be cultured. Whereas many species are known among the invertebrates (including termites, corals, and sponges), archaeans have not been described among the flatworms (33). The pathogenic potential of archaeans in human disease is of increasing interest (32, 34).

DISCUSSION

Escalating interest in the microbiome is leading to a general understanding that perturbations in microbial communities are associated with human disease (15). Moreover, microbiomes can provide markers of risk, diagnosis, and prognosis of disease, including inflammatory bowel disease, diabetes, obesity, and bowel cancer (35). Nematode infection can influence the diversity and ecology of intestinal bacteria. For example, Lacterobacillaceae increase in abundance in the ileum of mice infected with the nematode, Heligmosomoides polygyrus (36). The clinical consequences of these shifts in microbiota can be beneficial; for example, therapeutic infection with whipworm ameliorates inflammatory bowel disease (13, 14). We now report that parasitism of the biliary tract of hamsters by O. viverrini leads to shifts in the microbiota farther down the alimentary tract, reflected in the colorectal contents, including the likely outgrowth or suppression of sensitive species in a fashion similar to that of other inflammation-related diseases (15, 35, 37). Although the infection of hamsters with 50 metacercariae reflects a heavy infection and hence may not model closely the infection loads of the general population in endemic locations, it very likely models parasite burdens of heavily infected persons who are at increased risk of CCA (38). Moreover, this infection dose is well tolerated by hamsters and has been used in laboratory investigations of the pathogenesis of liver fluke infection (39).

Our study involved infection of Syrian hamsters with O. viverrini, followed by deep sequencing of 16S rRNA genes, to investigate the microbiota during parasitism by this fluke. As a control, the microbiota of nonparasitized hamsters was examined. Although a comprehensive catalog of the microbiome of this rodent has not been established, details are becoming available. The gut microbiome has been characterized in other mammals and exhibits a similar microbiota at higher taxonomic levels (4043). The microbiome of hamster feces is composed primarily by members of the bacterial orders Bacteroidales and Clostridiales, with contributions by the Desulfovibrionales, Fibrobacterales, Anaeroplasmatales, Actinobacteridae, and Gammaproteobacteria (44). We observed a similar profile, showing that the OTUs of the phyla Bacteroidetes, Firmicutes, and Proteobacteria were abundant in the colorectal contents.

However, perturbations in microbial communities were evident in parasitized hamsters, including increased contributions from the Lachnospiraceae, Ruminococcaceae, and Lactobacillaceae and concomitant decreases in Porphyromonadaceae, Erysipelotrichaceae, and Eubacteriaceae in the colorectal contents.

A remarkable microbiota was associated with the flukes. First, >60 OTUs were detected in the worms and bile, either solely or at higher levels than in the colorectum. These biliary system microbes—those in the worms, the bile, or both—included Lactobacillus, Burkholderia, Pseudomonas, Flavimonas, Acinetobacter, and Enterobacteriaceae family members including Citrobacter. In humans, inflammation of the colon is often accompanied by microbial dysbiosis, characterized by the decreased representation of obligate anaerobes and increased abundance of facultative anaerobes of the family Enterobacteriaceae (42). Second, many OTUs were identified only in the biliary system, with the O. viverrini worms retrieved from the bile ducts and in bile, definitively documenting bacteriobilia in the fluke-infected hamsters. Bacterial and parasitic cholangitis are frequent complications of opisthorchiasis (45). Infection with O. viverrini can induce biliary stasis that, after long-standing obstruction, leads to infection by microorganisms from the intestine, resulting in ascending cholangitis (8). In a similar fashion, biliary blockage due to CCA also induces ascending cholangitis (9, 4547). We anticipate that the potentially pathogenic microorganisms detected in our study obtained entry into the biliary tree during the migration of the liver fluke from the duodenum; these included Pseudomonas, Serratia, Leminorella, and Bartonella. These bacteria are facultative pathogens and several, including Sphingomonas, which are also widely distributed in water and soil, are gaining increasing attention as nosocomial infections (4851).

Given that numerous species were not detected in the feces and, occasionally, not even in the bile of the infected hamsters and notwithstanding that investigation by deeper sequencing might detect many of these OTUs in the colon, the presence of this community of bile duct–localized, worm-associated microbes suggests that they were ushered into the biliary tree by the liver flukes. Considering the spectrum of taxonomic assignments among this biliary system microbial community, the presence of putatively commensal microbes of the liver flukes is intriguing. The group included archaeans; bacteria such as Methylobacterium that fix nitrogen in plant roots; microbes that participate in removal of iron and other metals in waste water (Leptothrix); and species of the Rhodobacteraceae, which includes methylotrophs from aquatic environments. The group also included Agrobacterium, a soil phytopathogen that elicits tumors in host plants, is used in genetic engineering, has been shown to transform HeLa cells by transfer of its tumor-inducing (Ti) plasmid, and has even been implicated in the oncogenesis of Hodgkin lymphoma (5255). We speculate that these microbes, including facultative pathogens, hitchhike on the metacercariae of O. viverrini during the establishment of helminth infection (56).

GI tract microbes are essential in the development and growth of (at least some) parasitic worms (57). Moreover, the gut microbiota is necessary for the development of a healthy immune response (58). Indeed, the lack of exposure to helminth infection outside low- and middle-income countries appears linked to increasing rates of allergic and other autoimmune diseases (the hygiene hypothesis; refs. 13, 59, 60). As with other helminth infections, including hookworms and schistosomes, infection with O. viverrini drives the immune response toward a Th2 profile, characterized by elevated cytokines IL-4, IL-5, and IL-13; total and parasite-specific immunoglobulin (Ig) G4 and IgE; and peripheral blood eosinophilia; and increases in the regulatory cytokine IL-10 and regulatory T cells (60). However, in contrast to the typical Th2 phenotype established in chronic helminth infection, these regulatory responses fail to modulate the robust local and systemic inflammation induced by this trematode. The marked inflammation of chronic opisthorchiasis manifests as periductal fibrosis, as determined by abdominal ultrasonography (61) and in the elevated, systemic IL-6 and cellular responses in vitro (10, 11, 62), which has been linked with development of fibrosis and neoplasia in other infection–related contexts (63). Sripa et al. (10) speculate that this situation establishes a smoldering and polarized inflammatory milieu that promotes the fibrosis and malignancy common to CCA (64).

Chronic inflammation is central to a range of malignancies (65). As a cause of inflammation, a dysregulated immune response to commensal bacteria in an intestinal bowel disorder is predictive of colon cancer (66). Inflammation due to Helicobacter pylori is a key indicator for gastric cancers (66, 67). Alterations in microbiota have systemic effects on glucose tolerance, body weight, fat mass, oxidative stress, and macrophage infiltration marker expression in visceral adipose tissue (68). Biliary inflammation has been linked with ulcerative colitis and hence O. viverrini-induced perturbations of microbial communities could contribute to inflammation by exposing the cholangiocytes to microbes or metabolites of enteric or parasite-associated microbes (7, 8) and recruitment of mucosal lymphocytes to the biliary system (69). In addition, perturbations in the microbiota may be responses to bile constitution, since O. viverrini infection affects composition and concentration of bile acids (70, 71). Bile acid composition influences gut microbiota (72) and can promote pathobiont expansion and inflammation (73). Moreover, the dysbiosis associated with inflammatory bowel diseases leads to bile acid dysmetabolism that, in turn, exacerbates inflammation (74).

Whereas evolution of host–parasite relationships of helminths and vertebrates has programmed mammals characteristically to react immunologically to helminth parasites with a Th2-dominated response (75), infection with O. viverrini is associated with an idiosyncratic, mixed Th1/Th2 phenotype with prominently elevated proinflammatory cytokine IL-6 (10, 11, 62). Microbiome perturbations may underlie or at least contribute to this distinctive phenotype and, more profoundly, underlie why O. viverrini causes cancer, a conspicuously unusual and unarguably unwelcome sequela of a helminth infection. Divergence in microbial communities may arise through immunologic responses to the liver fluke, through the mediators that it releases (76), or through the conveyance of microbes by the worm to the biliary system from the outside world or from the mammalian GI tract. Whatever the cause, however, the microbial changes that ensue may contribute to the carcinogenicity of opisthorchiasis. Cholangiocytes, the epithelial cells that line bile ducts, and the cells from which malignancy develops as CCA, are dynamic cells that recognize and react to insult and injury (7, 8, 77). They express Toll-like receptors and can operate as professional antigen-presenting cells. Cholangiocyte N-Ras mediates LPS-induced IL-6 and proliferation (7779). We now conjecture that the insult may originate in the fluke-associated microbiota, in addition to (or even rather than) the parasite. This possibility merits examination, given, for example, the well-characterized interactions among the CagA virulence factor of H. pylori, epithelial cells, and gastric cancer (80). However, this investigation may be challenging because of the community diversity of this microbiome, from which arises multiple pathogen-activated molecular patterns, the presence of noncultivable species, the absence of information from microbial ligand–cholangiocyte receptor communications, syntrophic archaeal–bacterial interactions, and other obstacles (32).

In summary, infection with O. viverrini led to changes in the microbial communities of the GI tract, including the emergence of microbes in the biliary system. These novel findings in an instructive rodent model of opisthorchiasis provide the impetus to investigate the influence of infection with this pathogen on the human microbiome, including within the biliary tree where the inflammatory and fibrotic responses originate during opisthorchiasis, and the relationships among live fluke infection, GI tract microbiota, and CCA. We predict that superinfection involving microbial pathogens routinely occurs during opisthorchiasis, and we now hypothesize that microbes and liver flukes together elicit host inflammatory responses. We also hypothesize that the microbes described in the biliary system originate from the external environment (i.e., are present with liver fluke metacercariae at initiation of parasite infection, from the alimentary tract of the infected individual, or both). If changes in microbiomes, similar to those we have reported here, also occur in chronically infected people, the dysbiosis of microbial communities would represent another dimension of liver fluke–induced CCA (6, 810). Liver fluke–induced CCA is usually an intrahepatic cancer, and whereas there is limited evidence that cancer caused by O. viverrini infection is different from other intrahepatic CCAs (1, 6, 81, 82), closer scrutiny of this aspect would be instructive, given the current findings that revealed changes in the GI tract microbiota associated with O. viverrini infection. In parallel, these findings impel deeper investigation of the microbiome in the context of opisthorchiasis, including exploration of fungi and other eukaryotes by 18S rRNA gene–targeted approaches, environmental shotgun sequencing of the entire metagenome (15, 43) and, moreover, investigation of the microbiome of metacercariae and other developmental stages of this carcinogenic parasite.

Supplementary Material

Supplemental Data

Acknowledgments

The authors thank Dr. Steven Zeichner for discussions that led to this study and Drs. Victoria Mann and Gabriel Rinaldi for comments on the manuscript. SeqWright, Inc. (Houston, TX, USA) provided bioinformatics advice after performing the pyrosequencing.

This work was partially supported by U.S. National Cancer Institute (NCI) grants R01CA155297 to J.M.B. and P.J.B and R01CA164719 to J.P.M. and P.J.B and by U.S. National Institute of Allergy and Infectious Disease (NIAID) grant P50AI098639 to B.S., J.M.B., and P.J.B. J.P.M. is the recipient of a fellowship from the National Health and Medical Research Council of Australia (NHMRC), and P.J.B. and J.M.B. were supported by the Dr. Cyrus and Myrtle Katzen Cancer Research Center at George Washington University (Washington, DC, USA) The contents of the article are solely the responsibility of the authors and do not necessarily represent the official views of the NIAID, NCI, U.S. National Institutes of Health, or NHMRC.

This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.

AMI
Amazon Machine Image
CCA
cholangiocarcinoma
gDNA
genomic DNA
GI
gastrointestinal
HVR
hypervariable region
NCBI
National Center for Biotechnology Information
PCoA
principal coordinates analysis
OTU
operational taxonomy unit
QIIME
quantitative insight into microbial ecology

REFERENCES

  • 1. De Martel C., Ferlay J., Franceschi S., Vignat J., Bray F., Forman D., Plummer M. (2012) Global burden of cancers attributable to infections in 2008: a review and synthetic analysis. Lancet Oncol. 13, 607–615 [DOI] [PubMed] [Google Scholar]
  • 2. Bouvard V., Baan R., Straif K., Grosse Y., Secretan B., El Ghissassi F., Benbrahim-Tallaa L., Guha N., Freeman C., Galichet L., Cogliano V. (2009) A review of human carcinogens, Part B: biological agents. Lancet Oncol. 10, 321–322 [DOI] [PubMed] [Google Scholar]
  • 3. (2012) Biological agents: a review of human carcinogens. IARC Monogr. Eval. Carcinog. Risks Hum. 100, 1–441 [PMC free article] [PubMed] [Google Scholar]
  • 4. Sithithaworn P., Andrews R. H., Nguyen V. D., Wongsaroj T., Sinuon M., Odermatt P., Nawa Y., Liang S., Brindley P. J., Sripa B. (2012) The current status of opisthorchiasis and clonorchiasis in the Mekong Basin. Parasitol. Int. 61, 10–16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Sripa B., Bethony J. M., Sithithaworn P., Kaewkes S., Mairiang E., Loukas A., Mulvenna J., Laha T., Hotez P. J., Brindley P. J. (2011) Opisthorchiasis and opisthorchis-associated cholangiocarcinoma in Thailand and Laos. Acta Trop. 120(Suppl. 1), S158–S168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Blechacz B., Komuta M., Roskams T., Gores G. J. (2011) Clinical diagnosis and staging of cholangiocarcinoma. Nat. Rev. Gastroenterol. Hepatol. 8, 512–522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Johnson C., Han Y., Hughart N., McCarra J., Alpini G., Meng F. (2012) Interleukin-6 and its receptor, key players in hepatobiliary inflammation and cancer. Transl. Gastrointest. Cancer 1, 58–70 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. O'Hara S. P., Tabibian J. H., Splinter P. L., Larusso N. F. (2013) The dynamic biliary epithelia: molecules, pathways, and disease. J. Hepatol. 58, 575–582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Razumilava N., Gores G. J. (2013) Classification, diagnosis, and management of cholangiocarcinoma. Clin. Gastroenterol. Hepatol. 11, 13–21 e11; quiz e13–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Sripa B., Brindley P. J., Mulvenna J., Laha T., Smout M. J., Mairiang E., Bethony J. M., Loukas A. (2012) The tumorigenic liver fluke Opisthorchis viverrini: multiple pathways to cancer. Trends Parasitol. 28, 395–407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Sripa B., Mairiang E., Thinkhamrop B., Laha T., Kaewkes S., Sithithaworn P., Tessana S., Loukas A., Brindley P. J., Bethony J. M. (2009) Advanced periductal fibrosis from infection with the carcinogenic human liver fluke Opisthorchis viverrini correlates with elevated levels of interleukin-6. Hepatology 50, 1273–1281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Satarug S., Haswell-Elkins M. R., Sithithaworn P., Bartsch H., Ohshima H., Tsuda M., Mairiang P., Mairiang E., Yongvanit P., Esumi H., Elkins D. B. (1998) Relationships between the synthesis of N-nitrosodimethylamine and immune responses to chronic infection with the carcinogenic parasite, Opisthorchis viverrini, in men. Carcinogenesis 19, 485–491 [DOI] [PubMed] [Google Scholar]
  • 13. Weinstock J. V. (2012) Autoimmunity: the worm returns. Nature 491, 183–185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Broadhurst M. J., Ardeshir A., Kanwar B., Mirpuri J., Gundra U. M., Leung J. M., Wiens K. E., Vujkovic-Cvijin I., Kim C. C., Yarovinsky F., Lerche N. W., McCune J. M., Loke P. (2012) Therapeutic helminth infection of macaques with idiopathic chronic diarrhea alters the inflammatory signature and mucosal microbiota of the colon. PLoS Pathog. 8, e1003000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Schloissnig S., Arumugam M., Sunagawa S., Mitreva M., Tap J., Zhu A., Waller A., Mende D. R., Kultima J. R., Martin J., Kota K., Sunyaev S. R., Weinstock G. M., Bork P. (2013) Genomic variation landscape of the human gut microbiome. Nature 493, 45–50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Bhamarapravati N., Thammavit W., Vajrasthira S. (1978) Liver changes in hamsters infected with a liver fluke of man, Opisthorchis viverrini. Am. J. Trop. Med. Hyg. 27, 787–794 [DOI] [PubMed] [Google Scholar]
  • 17. Laha T., Pinlaor P., Mulvenna J., Sripa B., Sripa M., Smout M. J., Gasser R. B., Brindley P. J., Loukas A. (2007) Gene discovery for the carcinogenic human liver fluke, Opisthorchis viverrini. BMC Genomics 8, 189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Csendes A., Fernandez M., Uribe P. (1975) Bacteriology of the gallbladder bile in normal subjects. Am. J. Surg. 129, 629–631 [DOI] [PubMed] [Google Scholar]
  • 19. Valero M. A., Navarro M., Garcia-Bodelon M. A., Marcilla A., Morales M., Hernandez J. L., Mengual P., Mas-Coma S. (2006) High risk of bacterobilia in advanced experimental chronic fasciolosis. Acta Trop. 100, 17–23 [DOI] [PubMed] [Google Scholar]
  • 20. Nossa C. W., Oberdorf W. E., Yang L., Aas J. A., Paster B. J., Desantis T. Z., Brodie E. L., Malamud D., Poles M. A., Pei Z. (2010) Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome. World J. Gastroenterol. 16, 4135–4144 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Angiuoli S. V., Matalka M., Gussman A., Galens K., Vangala M., Riley D. R., Arze C., White J. R., White O., Fricke W. F. (2011) CloVR: a virtual machine for automated and portable sequence analysis from the desktop using cloud computing. BMC Bioinformatics 12, 356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. White J. R., Arze C., Matalka M, The CloVR Team, White O., Angiuoli S. V., Fricke W. F. (2011) Phylogenetic microbial community composition analysis based on 16S ribosomal RNA amplicon sequencing: standard operating procedure, version1.1. Nat. Preced. 10.1038/npre.2011.5888.3 [DOI] [Google Scholar]
  • 23. Caporaso J. G., Kuczynski J., Stombaugh J., Bittinger K., Bushman F. D., Costello E. K., Fierer N., Pena A. G., Goodrich J. K., Gordon J. I., Huttley G. A., Kelley S. T., Knights D., Koenig J. E., Ley R. E., Lozupone C. A., McDonald D., Muegge B. D., Pirrung M., Reeder J., Sevinsky J. R., Turnbaugh P. J., Walters W. A., Widmann J., Yatsunenko T., Zaneveld J., Knight R. (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7, 335–336 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Edgar R. C., Haas B. J., Clemente J. C., Quince C., Knight R. (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 27, 2194–2200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Wang Q., Garrity G. M., Tiedje J. M., Cole J. R. (2007) Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 73, 5261–5267 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Hamady M., Knight R. (2009) Microbial community profiling for human microbiome projects: tools, techniques, and challenges. Genome. Res. 19, 1141–1152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Schloss P. D., Westcott S. L., Ryabin T., Hall J. R., Hartmann M., Hollister E. B., Lesniewski R. A., Oakley B. B., Parks D. H., Robinson C. J., Sahl J. W., Stres B., Thallinger G. G., Van Horn D. J., Weber C. F. (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Kimura M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120 [DOI] [PubMed] [Google Scholar]
  • 29. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Cox M. M., Battista J. R. (2005) Deinococcus radiodurans: the consummate survivor. Nat. Rev. Microbiol. 3, 882–892 [DOI] [PubMed] [Google Scholar]
  • 31. Jensen S., Duperron S., Birkeland N. K., Hovland M. (2010) Intracellular Oceanospirillales bacteria inhabit gills of Acesta bivalves. FEMS Microbiol. Ecol. 74, 523–533 [DOI] [PubMed] [Google Scholar]
  • 32. Horz H. P., Conrads G. (2011) Methanogenic Archaea and oral infections: ways to unravel the black box. J. Oral Microbiol. 10.3402/jom.v3i0.5940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Lange M., Westermann P., Ahring B. K. (2005) Archaea in protozoa and metazoa. Appl. Microbiol. Biotechnol. 66, 465–474 [DOI] [PubMed] [Google Scholar]
  • 34. Eckburg P. B., Lepp P. W., Relman D. A. (2003) Archaea and their potential role in human disease. Infect. Immun. 71, 591–596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Virgin H. W., Todd J. A. (2011) Metagenomics and personalized medicine. Cell 147, 44–56 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Walk S. T., Blum A. M., Ewing S. A., Weinstock J. V., Young V. B. (2010) Alteration of the murine gut microbiota during infection with the parasitic helminth Heligmosomoides polygyrus. Inflamm. Bowel Dis. 16, 1841–1849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Lupp C., Robertson M. L., Wickham M. E., Sekirov I., Champion O. L., Gaynor E. C., Finlay B. B. (2007) Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2, 204. [DOI] [PubMed] [Google Scholar]
  • 38. Haswell-Elkins M. R., Mairiang E., Mairiang P., Chaiyakum J., Chamadol N., Loapaiboon V., Sithithaworn P., Elkins D. B. (1994) Cross-sectional study of Opisthorchis viverrini infection and cholangiocarcinoma in communities within a high-risk area in northeast Thailand. Int. J. Cancer 59, 505–509 [DOI] [PubMed] [Google Scholar]
  • 39. Lvova M. N., Tangkawattana S., Balthaisong S., Katokhin A. V., Mordvinov V. A., Sripa B. (2012) Comparative histopathology of Opisthorchis felineus and Opisthorchis viverrini in a hamster model: an implication of high pathogenicity of the European liver fluke. Parasitol. Int. 61, 167–172 [DOI] [PubMed] [Google Scholar]
  • 40. Eckburg P. B., Bik E. M., Bernstein C. N., Purdom E., Dethlefsen L., Sargent M., Gill S. R., Nelson K. E., Relman D. A. (2005) Diversity of the human intestinal microbial flora. Science 308, 1635–1638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Frank D. N., St. Amand A. L., Feldman R. A., Boedeker E. C., Harpaz N., Pace N. R. (2007) Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. U. S. A. 104, 13780–13785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Winter S. E., Winter M. G., Xavier M. N., Thiennimitr P., Poon V., Keestra A. M., Laughlin R. C., Gomez G., Wu J., Lawhon S. D., Popova I. E., Parikh S. J., Adams L. G., Tsolis R. M., Stewart V. J., Baumler A. J. (2013) Host-derived nitrate boosts growth of E. coli in the inflamed gut. Science 339, 708–711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Maurice C. F., Haiser H. J., Turnbaugh P. J. (2013) Xenobiotics shape the physiology and gene expression of the active human gut microbiome. Cell 152, 39–50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Peterfreund G. L., Vandivier L. E., Sinha R., Marozsan A. J., Olson W. C., Zhu J., Bushman F. D. (2012) Succession in the gut microbiome following antibiotic and antibody therapies for Clostridium difficile. PLoS One 7, e46966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Carpenter H. A. (1998) Bacterial and parasitic cholangitis. Mayo Clin. Proc. 73, 473–478 [DOI] [PubMed] [Google Scholar]
  • 46. Tajiri T., Yoshida H., Mamada Y., Taniai N., Yokomuro S., Mizuguchi Y. (2008) Diagnosis and initial management of cholangiocarcinoma with obstructive jaundice. World J. Gastroenterol. 14, 3000–3005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Boonyanugomol W., Chomvarin C., Sripa B., Bhudhisawasdi V., Khuntikeo N., Hahnvajanawong C., Chamsuwan A. (2012) Helicobacter pylori in Thai patients with cholangiocarcinoma and its association with biliary inflammation and proliferation. HPB (Oxford). 14, 177–184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Mahlen S. D. (2011) Serratia infections: from military experiments to current practice. Clin. Microbiol. Rev. 24, 755–791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Blekher L., Siegman-Igra Y., Schwartz D., Berger S. A., Carmeli Y. (2000) Clinical significance and antibiotic resistance patterns of Leminorella spp., an emerging nosocomial pathogen. J. Clin. Microbiol. 38, 3036–3038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Ryan M. P., Adley C. C. (2010) Sphingomonas paucimobilis: a persistent Gram-negative nosocomial infectious organism. J. Hosp. Infect. 75, 153–157 [DOI] [PubMed] [Google Scholar]
  • 51. Que Y. A., Moreillon P. (2011) Infective endocarditis. Nat. Rev. Cardiol. 8, 322–336 [DOI] [PubMed] [Google Scholar]
  • 52. Emerson D., Fleming E. J., McBeth J. M. (2010) Iron-oxidizing bacteria: an environmental and genomic perspective. Annu. Rev. Microbiol. 64, 561–583 [DOI] [PubMed] [Google Scholar]
  • 53. Dourado M. N., Andreote F. D., Dini-Andreote F., Conti R., Araujo J. M., Araujo W. L. (2012) Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association. Genet. Mol. Biol. 35, 142–148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Kunik T., Tzfira T., Kapulnik Y., Gafni Y., Dingwall C., Citovsky V. (2001) Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 98, 1871–1876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Sauter C. (1995) Is Hodgkin's disease a human counterpart of bacterially induced crown-gall tumours? Lancet 346, 1433. [DOI] [PubMed] [Google Scholar]
  • 56. Gendrel D., Kombila M., Beaudoin-Leblevec G., Richard-Lenoble D. (1994) Nontyphoidal salmonellal septicemia in Gabonese children infected with Schistosoma intercalatum. Clin. Infect. Dis. 18, 103–105 [DOI] [PubMed] [Google Scholar]
  • 57. Hayes K. S., Bancroft A. J., Goldrick M., Portsmouth C., Roberts I. S., Grencis R. K. (2010) Exploitation of the intestinal microflora by the parasitic nematode Trichuris muris. Science 328, 1391–1394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Tlaskalova-Hogenova H., Stepankova R., Kozakova H., Hudcovic T., Vannucci L., Tuckova L., Rossmann P., Hrncir T., Kverka M., Zakostelska Z., Klimesova K., Pribylova J., Bartova J., Sanchez D., Fundova P., Borovska D., Srutkova D., Zidek Z., Schwarzer M., Drastich P., Funda D. P. (2011) The role of gut microbiota (commensal bacteria) and the mucosal barrier in the pathogenesis of inflammatory and autoimmune diseases and cancer: contribution of germ-free and gnotobiotic animal models of human diseases. Cell. Mol. Immunol. 8, 110–120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Rook G. A. (2012) Hygiene hypothesis and autoimmune diseases. Clin. Rev. Allergy Immunol. 42, 5–15 [DOI] [PubMed] [Google Scholar]
  • 60. McSorley H. J., Maizels R. M. (2012) Helminth infections and host immune regulation. Clin. Microbiol. Rev. 25, 585–608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Mairiang E., Laha T., Bethony J. M., Thinkhamrop B., Kaewkes S., Sithithaworn P., Tesana S., Loukas A., Brindley P. J., Sripa B. (2012) Ultrasonography assessment of hepatobiliary abnormalities in 3359 subjects with Opisthorchis viverrini infection in endemic areas of Thailand. Parasitol. Int. 61, 208–211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Sripa B., Thinkhamrop B., Mairiang E., Laha T., Kaewkes S., Sithithaworn P., Periago M. V., Bhudhisawasdi V., Yonglitthipagon P., Mulvenna J., Brindley P. J., Loukas A., Bethony J. M. (2012) Elevated plasma IL-6 associates with increased risk of advanced fibrosis and cholangiocarcinoma in individuals infected by Opisthorchis viverrini. PLoS Negl. Trop. Dis. 6, e1654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Stauffer J. K., Scarzello A. J., Jiang Q., Wiltrout R. H. (2012) Chronic inflammation, immune escape, and oncogenesis in the liver: a unique neighborhood for novel intersections. Hepatology 56, 1567–1574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Balkwill F., Charles K. A., Mantovani A. (2005) Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell 7, 211–217 [DOI] [PubMed] [Google Scholar]
  • 65. Fukata M., Abreu M. T. (2008) Role of Toll-like receptors in gastrointestinal malignancies. Oncogene 27, 234–243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Peek R. M., Jr., Blaser M. J. (2002) Helicobacter pylori and gastrointestinal tract adenocarcinomas. Nat. Rev. Cancer 2, 28–37 [DOI] [PubMed] [Google Scholar]
  • 67. Houghton J., Wang T. C. (2005) Helicobacter pylori and gastric cancer: a new paradigm for inflammation-associated epithelial cancers. Gastroenterology. 128, 1567–1578 [DOI] [PubMed] [Google Scholar]
  • 68. Cani P. D., Bibiloni R., Knauf C., Waget A., Neyrinck A. M., Delzenne N. M., Burcelin R. (2008) Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 57, 1470–1481 [DOI] [PubMed] [Google Scholar]
  • 69. Adams D. H., Eksteen B. (2006) Aberrant homing of mucosal T cells and extra-intestinal manifestations of inflammatory bowel disease. Nat. Rev. Immunol. 6, 244–251 [DOI] [PubMed] [Google Scholar]
  • 70. Changbumrung S., Tungtrongchitr R., Migasena P., Chamroenngan S. (1990) Serum unconjugated primary and secondary bile acids in patients with cholangiocarcinoma and hepatocellular carcinoma. J. Med. Assoc. Thai. 73, 81–90 [PubMed] [Google Scholar]
  • 71. Wonkchalee O., Boonmars T., Kaewkes S., Chamgramol Y., Aromdee C., Wu Z., Juasook A., Sudsarn P., Boonjaraspinyo S., Pairojkul C. (2012) Comparative studies on animal models for Opisthorchis viverrini infection: host interaction through susceptibility and pathology. Parasitol. Res. 110, 1213–1223 [DOI] [PubMed] [Google Scholar]
  • 72. Islam K. B., Fukiya S., Hagio M., Fujii N., Ishizuka S., Ooka T., Ogura Y., Hayashi T., Yokota A. (2011) Bile acid is a host factor that regulates the composition of the cecal microbiota in rats. Gastroenterology 141, 1773–1781 [DOI] [PubMed] [Google Scholar]
  • 73. Devkota S., Wang Y., Musch M. W., Leone V., Fehlner-Peach H., Nadimpalli A., Antonopoulos D. A., Jabri B., Chang E. B. (2012) Dietary-fat-induced taurocholic acid promotes pathobiont expansion and colitis in Il10−/− mice. Nature 487, 104–108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Duboc H., Rajca S., Rainteau D., Benarous D., Maubert M. A., Quervain E., Thomas G., Barbu V., Humbert L., Despras G., Bridonneau C., Dumetz F., Grill J. P., Masliah J., Beaugerie L., Cosnes J., Chazouilleres O., Poupon R., Wolf C., Mallet J. M., Langella P., Trugnan G., Sokol H., Seksik P. (2013) Connecting dysbiosis, bile-acid dysmetabolism and gut inflammation in inflammatory bowel diseases. Gut 62, 531–539 [DOI] [PubMed] [Google Scholar]
  • 75. Allen J. E., Wynn T. A. (2011) Evolution of Th2 immunity: a rapid repair response to tissue destructive pathogens. PLoS Pathog. 7, e1002003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Robinson M. W., Donnelly S., Hutchinson A. T., To J., Taylor N. L., Norton R. S., Perugini M. A., Dalton J. P. (2011) A family of helminth molecules that modulate innate cell responses via molecular mimicry of host antimicrobial peptides. PLoS Pathog. 7, e1002042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Syal G., Fausther M., Dranoff J. A. (2012) Advances in cholangiocyte immunobiology. Am. J. Physiol. Gastrointest. Liver Physiol. 303, G1077–G1086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. O'Hara S. P., Splinter P. L., Trussoni C. E., Gajdos G. B., Lineswala P. N., LaRusso N. F. (2011) Cholangiocyte N-Ras protein mediates lipopolysaccharide-induced interleukin 6 secretion and proliferation. J. Biol. Chem. 286, 30352–30360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Chen X. M., O'Hara S. P., Nelson J. B., Splinter P. L., Small A. J., Tietz P. S., Limper A. H., LaRusso N. F. (2005) Multiple TLRs are expressed in human cholangiocytes and mediate host epithelial defense responses to Cryptosporidium parvum via activation of NF-kappaB. J. Immunol. 175, 7447–7456 [DOI] [PubMed] [Google Scholar]
  • 80. Wroblewski L. E., Peek R. M., Jr., Wilson K. T. (2010) Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin. Microbiol. Rev. 23, 713–739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Jinawath N., Chamgramol Y., Furukawa Y., Obama K., Tsunoda T., Sripa B., Pairojkul C., Nakamura Y. (2006) Comparison of gene expression profiles between Opisthorchis viverrini and non-Opisthorchis viverrini associated human intrahepatic cholangiocarcinoma. Hepatology 44, 1025–1038 [DOI] [PubMed] [Google Scholar]
  • 82. De Martel C., Plummer M., Franceschi S. (2010) Cholangiocarcinoma: descriptive epidemiology and risk factors. Gastroenterol. Clin. Biol. 34, 173–180 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from The FASEB Journal are provided here courtesy of The Federation of American Societies for Experimental Biology

RESOURCES