Suppression of MicroRNA-9 by Mutant EGFR Signaling Upregulates FOXP1 to Enhance Glioblastoma Tumorigenicity

Abstract

The EGF receptor (EGFR) is amplified and mutated in glioblastoma (GBM) where its common mutation (ΔEGFR, also called EGFRvIII) has a variety of activities that promote growth and inhibit death, thereby conferring a strong tumor-enhancing effect. This range of activities suggested to us that ΔEGFR might exert its influence through pleiotropic effectors, and we hypothesized that microRNAs (miRs) might serve such a function. Here, we report that ΔEGFR specifically suppresses one such miR, namely miR-9, through the Ras/PI3K/AKT axis that it is known to activate. Correspondingly, expression of miR-9 antagonizes the tumor growth advantage conferred by ΔEGFR. Silencing of FOXP1, a miR-9 target, inhibits ΔEGFR-dependent tumor growth and, conversely, de-repression of FOXP1, as a consequence of miR-9 inhibition, increases tumorigenicity. FOXP1 was sufficient to increase tumor growth in the absence of oncogenic ΔEGFR signaling. The significance of these findings is underscored by our finding that high FOXP1 expression predicts poor survival in a cohort of 131 GBM patients. Collectively, these data suggest a novel regulatory mechanism by which ΔEGFR suppression of miR-9 upregulates FOXP1 to increase tumorigenicity.

INTRODUCTION

Glioblastomas (GBM) infiltrate normal brain parenchyma, display a high degree of cellular and genetic intratumoral heterogeneity and exhibit limited responses to conventional therapies (1). Molecular analyses have shown that 40–50% of primary GBMs have EGFR amplification, overexpression and/or mutations (2). The most common EGFR mutant, ΔEGFR (also known as EGFRvIII and de2-7), is generated from an in-frame 801bp deletion of exons 2–7 (3), and is constitutively active and present in a high proportion of GBMs with EGFR amplification (2). ΔEGFR confers a variety of biological effects upon its expression, including resistance to radiation (4) and chemotherapeutic agents (5), promotion of tumor cell motility and invasion (6), enhancement of tumorigenicity in vivo (7), maintenance of GBM growth (8) and heterogeneity (9). Collectively, this broad spectrum of biological activities provides a compelling rationale for the molecular targeting of EGFR in GBM.

MicroRNAs (miRs) are a group of non-protein-encoding RNAs of 19–25nt in length that block translation or facilitate mRNA degradation upon binding to complementary sequences in the 3' UTR of their target mRNAs (10). MiR biogenesis is initiated upon the processing of primary transcripts by Drosha/DGCR8 complexes to yield 60–110 nt long hairpins containing precursor miRs (11). After export of the pre-miRs to the cytoplasm by exportin-5 (12), mature miRs are excised from the pre-miRs by the RNase III enzyme, Dicer (13), and loaded into RNA-induced silencing complex (RISC) (14). Within the RISC, mature miRs are guided to their appropriate target mRNAs to prevent translation. MiRs are highly conserved among distant species and are involved in many biological processes including cancer initiation, maintenance and progression (15).

Dysregulation of miR expression in cancers occurs through multiple mechanisms such as genomic alterations (15), miR gene methylation (15), aberrant transcription (16) and defective miR processing (15). Highlighting the importance of miRs in regulating the pathogenic effects of growth factor receptor signaling in GBM, miRs targeting oncogenic receptors such as EGFR, PDGFR and c-MET inhibit the invasion, proliferation, tumorigenicity and gliomagenesis induced by these receptors (17–19). Providing an example of a miR-dependent feedback mechanism in controlling growth factor receptor signaling, PDGF-induced suppression of EGFR activation requires miR-146b activity (20).

In this report, we sought to determine if miRs act as downstream effector molecules that regulate the oncogenic effects exerted by aberrant EGFR signaling in GBM. Collectively, our data suggest that the suppression of miR-9 by the ΔEGFR/Ras/PI3K/AKT axis provides a tumor growth advantage to ΔEGFR-driven tumors through the upregulation of the transcription factor, FOXP1. Silencing of FOXP1 inhibited the growth of ΔEGFR-driven tumors. Upregulation of FOXP1, as a consequence of inhibiting miR-9 activity, increased the tumorigenicity of GBM cells, suggesting that miR-9 is a tumor suppressor, while FOXP1 likely functions as an oncogenic factor in GBM. Finally, high FOXP1 expression was significantly associated with poor survival in GBM patients, further supporting the hypothesis that FOXP1 is an oncogenic driver downstream of EGFR signaling.

MATERIALS AND METHODS

Cell culture

U87 and U373 parental glioma cells and those expressing wild type EGFR (wt EGFR), ΔEGFR and dead kinase ΔEGFR (DK) and the U87Δ DY mutants were cultured as described (7, 21). LN229, U178, U251 and mouse Ink4a/Arf^−/−/Pten^−/− astrocytes were maintained in DMEM containing 10% FBS (22). Mouse Ink4a/Arf^−/−/Pten^−/− astrocytes expressing ΔEGFR were maintained in DMEM supplemented with 1µg/ml puromycin (22). Primary murine astrocyte cultures were established from the brainstems of postnatal day1–2 mouse Nf1^flox/flox pups, as described previously (23). Wild-type (WT) and Nf1-deficient (Nf1−/−) cultures were generated following infection with Adenovirus type 5 containing β-galactosidase (Ad5-LacZ) or Cre recombinase (Ad5-Cre) (University of Iowa Gene Transfer Vector Core, Iowa City, IA), respectively.

MiR microarray hybridization, quantification and analysis

Glioma cells were starved 48hrs prior to total RNA extraction using Trizol (Life Technologies, Carlsbad, CA). RNA labeling and hybridization to miR microarray chips was performed as described (24). In brief, 5 µg of total RNA from each sample was reverse transcribed using biotin end-labeled random-octamer oligonucleotide primers. Hybridization of biotin-labeled cDNA was performed on the new Ohio State University custom miRNA microarray chip (OSU_CCC version 3.0), which contains ≈ 1100 miRs probes, including 326 human and 249 mouse miR genes, spotted in duplicates. The hybridized chips were washed and processed to detect biotin-containing transcripts by streptavidin-Alexa647 conjugate and scanned on an Axon 4000B microarray scanner (Axon Instruments, Sunnyvale, CA). Hybridization signals were quantified using the GenePix 6.0 software (Axon Instruments). Average values of replicate spots of each miR were background subtracted, quantile normalized and subjected to further analysis (GEO accession: GSE53504).

Northern blotting

Total RNA (10–20µg) was diluted with 2× RNA sample loading buffer (95% formamide, 18mM EDTA, 0.25% SDS, 0.25% xylene cyanol and 0.25% bromophenol blue), denatured at 95°C for 5min and separated on 15% polyacrylamide gels containing 8M urea. The RNA was transferred to positively charged nylon membranes (GE Healthcare Bio-Sciences Corp, Piscataway, NJ) in 0.5× TBE using the Trans-Blot SD semi-dry electrophoretic transfer cell (Bio-Rad, Hercules, CA) and crosslinked to blots by UV irradiation (Strategene). Blots were pre-hybridized for 1hr in ULTRAhyb-Oligo buffer (Life Technologies) at 30°C. DNA probes were ³²P-labeled using the StarFire MiRNA Detection Kit (Integrated DNA Technologies, Coralville, IA), diluted into 10ml ULTRA-hyb oligo buffer and hybridized to the membranes overnight at 30°C. Blots were washed twice for 30min with 50ml of 2× SSC containing 0.5% SDS at 30°C and exposed to phosphor imaging screens (Bio-Rad). The miRNA and reference small RNA signals were obtained with the Personal Molecular Imager (Bio-Rad) and quantified with Quantity One Software (Bio-Rad). Blots were stripped in boiling 0.1% SDS for 15 min and allowed to cool to room temperature prior to re-probing. Probe sequences were, miR-9: 5’-TCA TAC AGC TAG ATA ACC AAA GA-3’, miR-9*: 5’-ACT TTC GGT TAT CTA GCT TTA T-3’, U44: 5’-CAT TTG CTA TCA TCA TCC AGG-3’ and snoRNA 202: 5’-CTT TCA TCA AGT CAG TAC AGC-3’.

Quantitative Real-Time PCR (qRT-PCR)

cDNA was synthesized from 1µg of DNase I-treated RNA using the SuperScript III First Stand Synthesis SuperMix for qPCR kit (Life Technologies). Triplicate qRT-PCR reactions were run for each sample using iQ SYBR Green Supermix and the iQ5 cycler (Bio-Rad). The following reaction conditions were used: 95°C for 5 min, 40 cycles of 95°C for 15s and 58°C for 60s. Data were normalized to the reference gene, GAPDH, and relative expression determined using the ^ΔΔCt formula. The primer sequences used to amplify hsa-pri-mir-9-1, hsa-pri-mir-9-2 and hsa-pri-miR-9-3 were as described previously (25). Mature miRNA expression was determined using small RNA Taqman assays according to manufacturer’s instructions (Life Technologies).

Growth factor stimulations and inhibitor studies

Recombinant EGF (50ng/ml, R & D Systems, Minneapolis, MN) was added to U87wt and U87Δ EGFR cells for the different lengths of time 48hrs after serum starvation. HGF (20ng/ml, PeproTech, Rocky Hill, NJ), PDGF-BB (PeproTech, 50ng/ml) and bFGF (PeproTech, 20ng/ml) and heparin (5µg/ml, STEMCELL, Technologies, Vancouver, BC, Canada) were added to serum starved U87 cells for 24hrs. Following 24 hr serum starvation, U87ΔEGFR were incubated with 5µM of a Raf kinase inhibitor (EMD Millipore, Billerica, MA) for 24 hr. ΔEGFR kinase activity was inhibited by treating serum starved cells with 0.5–1µM gefitinib (LC Laboratories,Woburn, MA) for 24–48hrs.

Western blotting

Western blotting was performed as described previously (26). Antibodies used in this study were as follows: anti-phosphotyrosine clone 4G10 antibody was obtained from EMD Millipore; anti-FOXP4 was from (Bethyl Labs, Montgomery, TX) anti-phospho-Akt, total Akt, phospho-ERK, total ERK, SOS1, phospho-S6 ribosomal protein, S6 ribosomal protein and FOXP1 were obtained from Cell Signaling (Danvers, MA); and PTEN and β-actin were from Santa Cruz Biotechnology (Dallas, Texas).

RNAi studies

SOS1 siRNAs and control siRNAs were obtained from Sigma-Aldrich (St Louis, MO) and Santa Cruz Biotechnology. Cells were reverse transfected with 20nM of siRNA duplexes using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. RNA and protein lysates were collected 48hrs after transfection.

RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE)

To map the 5’ end of the host gene of pri-mir-9-2, RLM-RACE was accomplished using the GeneRacer Kit (Life Technologies). In brief, 5µg of total RNA extracted from U87 cells was reverse transcribed using the SuperScript III RT enzyme reagents (Life Technologies). cDNA was amplified with the Expand Long Template PCR System (Roche Applied Science, Indianapolis, IN), GeneRacer 5’ primer, the miR-9-2 gene specific reverse primer, 5'- CAT TCT CAC ACG CTC CCC GGC GAT CT -3', and the nested reverse miR-9-2 primer, 5'- CAT TCT CAC ACG CTC CCC GGC GA -3'. PCR products were cloned using the TOPO TA Cloning Kit (Life Technologies), sequenced and aligned with Ref Seq RNAs (Feb 2009 GRCH/hg19 Assembly) using the UCSC Genome Browser to LINC00461 variant 1 (chr5: 87,960,263– 87,969,146).

Retroviral transduction

To produce retrovirus, 293T cells were transfected with pSuper-puro, pSuper-puro miR-9-1, pBABE-puro, pBABE-puro G129R PTEN, pBABE-puro PTEN, pBABE-puro kinase-dead Akt, MDH1-PGK-GFP-MIR-9 (Addgene, plasmid #25036), MDH1-PGK-GFP-2.0 (Addgene, plasmid #11375), pwzl-hygro (Addgene, plasmid # 18750) and pwzl-HRas G12V (Addgene, plasmid # 18749) together with pCL10A1 using Lipofectamine 2000 (Invitrogen). To produce lentiviruses, 293FT cells were co-transfected with pLKO.1-puro, pLKO.1-puro shFOXP1 (Sigma-Aldrich), miRZip control and miRZip-miR-9 (System Biosciences, Mountain View, CA) together with pCMVDR8.91 and pMD.G-VSV-G using Lipofectamine 2000. Viral supernatants were filtered at 48 and 72 h after transfection. For knock-down of the LINC00461 variant 1, the following oligonucleotides were synthesized and cloned into the pLKO.1-puro: forward oligo 5' CCGGTCTCAGCTAGATGGGTCTAAACTCGAGTTTAGACCCATCTAGCTGAGATTTTTG 3'; reverse oligo 5' AATTCAAAAATCTCAGCTAGATGGGTCTAAACTCGAGTTTAGACCCATCTAGCTGAGA 3'. Glioma cells were infected overnight in the presence of 8 µg/ml polybrene and then selected for 3 days in DMEM containing 2µg/ml puromycin. The stable clones were verified by Western blot and qRT-PCR.

Luciferase reporter assays

The FOXP1 3’ UTR, a miR-9 full length binding site (23 nt) and a mutant miR-9 binding site with 4 mismatched nucleotides were cloned between Xho1 and Not1 restrictions sites of the psiCHECK™-2 reporter plasmid (Promega, Madison, WI). Between 5 × 10⁴ and 1 × 10⁵ cells were plated into 24 well plates. Cells were co-transfected with 100nm reporter plasmid and 100nM microRNA mimics (Sigma-Aldrich, St. Louis, MO) or 100nM miR-9 Locked Nucleic Acids (Exiqon Inc., Woburn, MA). Relative luciferase activity was determined 30hrs after transfection.

In vivo tumorigenicity assays

Athymic nude mice 4-to-5 weeks of age were injected with 2.5 × 10⁵ U87Δ cells suspended in 0.1ml of PBS on each flank (5 × 10⁵ total cells per mouse). Tumor width (a) and length (b) were obtained using calipers and tumor volumes determined using the formula: V= ½ × a × b², where b ≤ a. Mice were euthanized when tumor volume exceeded 1500 mm³ or tumors became ulcerated, as directed by our institutional guidelines for animal welfare and experimental conduct. For tumorigenicity assays examining tumor growth kinetics upon inhibition of miR-9 activity or overexpression of FOXP1, mice were injected with 1 × 10⁶ to 5 × 10⁶ cells on each flank and tumor volumes determined as described above.

Statistical analysis

All data were analyzed for significance using KaleidaGraph software, where p < 0.05 was considered statistically significant. One-way ANOVA, the Krukal-Wallis test, Mann-Whitney test and two-tailed t-tests were used to compare groups. False discovery rate (FDR) was used to control multiple testing. A Kaplan-Meier curve for a cohort of 131 GBM patients was generated using Probe Set Analyzer (http://probesetanalyzer.com). The patient cohort is composed of 67 newly diagnosed cases of GBM and 64 cases of recurrent GBM with 80 patients being ≥ 50 yrs and 51 patients ≤ 50 yrs of age. The probe set for FOXP1 was retrieved and normalized expression levels adjusted to group patients into low (normalized expression intensity range 46–102) and high (normalized expression intensity range 173–528) FOXP1 expression categories.

RESULTS

ΔEGFR suppresses miR-9

To identify miRs regulated by EGFR, RNA from 2 different glioma cell lines (U87 and U373) were hybridized to miR expression arrays and analyzed. Each cell type was engineered to express wild type EGFR (wtEGFR), dead kinase ΔEGFR (DK) or ΔEGFR at elevated levels, similar to those observed in primary glioblastomas displaying EGFR overexpression (7). Parental cells expressing endogenous EGFR and wtEGFR cells stimulated with EGF for 1hr were also included in the analyses. We reasoned that 1hr of EGF stimulation was appropriate given that 20 min of EGF stimulation is sufficient to induce or suppress miR expression in breast and brain tumor cells (27).

In agreement with prior studies, four different glioma cell types analyzed showed high expression of miR-21, miR-221 and miR-26a as well as low miR-124, miR-137, miR-219-5p, has-miR-34a and miR-7 expression (28) (Supplemental Table S1). Our data revealed that the different cell lines displayed dramatically distinct miR profiles (Supplemental Table S1). Likely as a result of the distinct miR profiles displayed by the cell lines, we did not identify a common miR, or group of miRs, regulated by EGF in U87 an U373 cells. We also did not find a miR regulated in a similar manner by activated wtEGFR and ΔEGFR. Given that ΔEGFR signaling is distinct from wtEGFR signaling (29), we analyzed the data to identify miRs whose levels were changed in cells expressing ΔEGFR as compared to those expressing the other receptor types. We identified 10 miRs that were differentially expressed in ΔEGFR cells relative to parental, DK, wtEGFR, and wtEGFR cells stimulated with EGF (Table 1). Most of these miRs showed small expression changes, and we focused on miR-9 since it displayed a 3.9 fold downregulation in ΔEGFR cells (Table 1). We then validated the downregulation of miR-9 in U87 and U373 ΔEGFR cells (Figure 1a and 1b) by direct Northern blotting. Interestingly, mouse Ink4a/Arf^−/−/Pten^−/− astrocytes engineered with ΔEGFR (AstrocytesΔ) showed decreased miR-9 expression relative to the control astrocytes, suggesting a conserved cross-species mechanism of miR-9 regulation (Figure 1c). In addition, inhibition of ΔEGFR signaling with the gefitinib, an EGFR tyrosine kinase inhibitor, upregulated miR-9 expression, validating that miR-9 is regulated by ΔEGFR kinase activity (Figure 1d).

Table 1.

List of microRNAs putatively regulated by ΔEGFR

p-valuea	ΔEGFRb	Othersb	Fold changec	microRNAd
0.00005	1773	1421	1.3	hsa-miR-320
0.00010	1868	1471	1.3	hsa-miR-373*
0.00015	2139	1660	1.3	hsa-miR-24
0.00005	430	739	−1.7	hsa-miR-181c
0.00016	933	1273	−1.4	hsa-miR-181a
0.00091	103	405	−3.9	hsa-miR-9
0.00110	17	49	−2.9	hsa-miR-32
0.00396	2728	3449	−1.3	hsa-miR-181b
0.00538	566	763	−1.3	hsa-miR-10b
0.00642	15	25	−1.7	hsa-miR-424*

^ap-values of microRNAs demonstrating significant differences in expression at the nominal 0.01 level of the univariate test. FDR threshold was ≤ 0.05.

^bGeometric mean intensity values obtain from microRNA arrays are given for each group. Mean intensity of others group represents parental cells, cells expressing wt and DK EGFR and wt cells stimulated with EGF for 1hr.

^cFold change in microRNA expression in ΔEGFR cells relative to other cell types.

^dThe symbol * denotes those mature miRs showing reduced expression relative to miRs generated from opposite stands of the same pre-miR hairpin. MiRs with almost identical sequences are annotated with a lower case letter. For example, hsa-miR-181a, hsa-miR-181b and hsa-miR-181c are highly similar in sequence.

Figure 1.

Validation of miR-9 repression by ΔEGFR. (A) and (B) Northern blotting for miR-9 in triplicate glioma cell extracts validates the downregulation of miR-9 in U87 and U373 ΔEGFR cells (p-value ≤ 0.001). (C) Northern blotting and qRT-PCR show miR-9 downregulation in mouse ΔEGFR expressing astrocytes (p-value ≤ 0.002). (D) Inhibition of ΔEGFR kinase activity in U373Δ cells (left panel, 1µM gefitinib) and AstrocytesΔ (right panel, 0.5µM and 1µM treated) induces miR-9 expression. (E) Prolonged stimulation of U87wtEGFR cells with EGF does not suppress miR-9 expression.

Since it was plausible for sustained signaling through wtEGFR to inhibit miR-9 expression, we determined miR-9 expression after treating U87wtEGFR cells with EGF for different lengths of time. While ΔEGFR suppressed miR-9, prolonged activation of wtEGFR did not show a similar modulation of miR-9 expression (Figure 1e). We also observed that treatment of U87 cells with EGF, PGDF-β, bFGF and HGF for 24hrs did not significantly affect miR-9 expression (Supplemental Figure S1a). Moreover, treatment of U87ΔEGFR cells with EGF did not affect miR-9 expression (Supplemental Figure S1b), suggesting that the downstream signaling components utilized by ΔEGFR to suppress miR-9 are not likely utilized to the same degree nor in the same manner by activated wtEGFR. Collectively, these data show that ΔEGFR signaling negatively regulates miR-9 expression.

ΔEGFR negatively regulates pri-miR-9-2

We next sought to clarify the step at which ΔEGFR disrupts miR-9 biogenesis. In cancer cells, alterations of miR biogenesis have been shown to occur through transcriptional dysregulation of miR host genes, changes in the rates of processing precursor miRs to mature miRs and degradation of pre-miRs (15). In humans and mice, three primary transcripts (pri-miR-9-1, pri-miR-9-2 and pri-miR-9-3) (25) are processed to give rise to mature miR-9. We first examined the relative expression levels of the miR-9 encoding primary transcripts in human normal brain tissue and U373 and U87 cells. Normal human brain expression of all three transcripts was detected at relatively low cycle threshold values by qRT-PCR (Supplemental Table S2). In contrast, only pri-miR-9-2 was expressed at high levels and reliably detected in U87 and U373 cells. Examination of human and mouse pri-miR-9-2 expression revealed that ΔEGFR downregulates pri-miR-9-2 (Figure 2a). These data indicated that the downregulation of miR-9 was due to negative transcriptional regulation of pri-miR-9-2 by ΔEGFR, rather than alterations in miR-9 processing (30). To rule out pri-miR-9-2 degradation as the mechanism for miR-9 suppression by ΔEGFR, pri-miR-9-2 expression was determined after 6hr treatment of U373 and mouse astrocyte parental and ΔEGFR cells with the transcriptional inhibitor, actinomycin D, which illustrated that ΔEGFR did not increase the rate of pri-miR-9-2 degradation (Figure 2b). As the processing of pri-miR-9-2 gives rise to two mature miRs, miR-9 and miR-9*, we reasoned that miR-9* should also be downregulated by ΔEGFR. Indeed, miR-9* downregulation was displayed by ΔEGFR human GBM cells and mouse astrocytes (Figure 2c).

Figure 2.

ΔEGFR downregulates pri-miR-9-2. (A) ΔEGFR negatively regulates expression of the mouse and human primary transcript, pri-miR-9-2, encoding for miR-9 (p value ≤ 0.001). (B) The rate of pri-miR-9-2 degradation is not accelerated by ΔEGFR. MiR-9 expression was analyzed in U373 cells and mouse astrocytes treated for 6 hrs with Actinomycin C to block transcription. (C) ΔEGFR downregulates miR-9* expression. Northern blotting revealed the suppression of miR-9*, generated from pri-miR-9-2, in ΔEGFR cells.

The Ras/PI3K/AKT axis suppresses miR-9

To further determine the signaling pathway components involved in regulating miR-9 downstream of ΔEGFR, we analyzed the levels of miR-9 in U87 cells expressing ΔEGFR mutants bearing tyrosine to phenylalanine (Y→F) substitutions that disrupt the binding of adaptor proteins to ΔEGFR (21). The U87DY1 (Y1173F) and U87DY2 (Y1068/1173F) mutants showed no change in miR-9 expression relative to control U87ΔEGFR cells (Figure 3a). However, miR-9 was upregulated in the U87DY5 (Y992/1068/1086/1148/1173F) mutant (Figure 3a). We have previously shown that Ras activity is elevated in U87ΔEGFR cells (21). Given that the U87DY5 and U87dead kinase ΔEGFR (DK) mutants are defective in binding to Grb2 and Shc and thus impaired in their ability to interact with Ras (21), relative to U87DY1, U87DY2 and control U87ΔEGFR cells, we hypothesized that Ras activity is required to suppress miR-9. To test this hypothesis, we first silenced the SOS1 positive regulator of Ras activity, in U87ΔEGFR cells and, as would be predicted, SOS1 silencing induced miR-9 expression (Figure 3b). Introduction of an active mutant H-Ras allele, G12V, into parental U87 and U373 cells also increased Ras expression and activity, as indicated by the increased activation of AKT and ERK relative to control cells (Figure 3c) and Ras activity was sufficient to suppress miR-9 expression (Figure 3c). Repression of miR-9 was not observed in Nf1-null murine astrocytes relative to normal astrocytes, suggesting that activation of Ras, as a consequence of Nf1 gene inactivation (31), is not sufficient to suppress miR-9 in untransformed astrocytes (Supplemental Figure S2a). Supporting Ras involvement in repressing miR-9 in transformed astrocytes is information derived from analysis of The Cancer Genome Atlas (TCGA) GBM dataset that showed that miR-9 expression is lower in the mesenchymal GBM subtype known to show loss, mutation and/or decreased expression of the Nf1 tumor suppressor gene (Supplemental Figure S2b).

Figure 3.

The Ras/PI3K/AKT axis is required for miR-9 repression. (A) MiR-9 expression was determined in mutant ΔEGFR alleles bearing tyrosine to phenylalanine substitutions. The U87DY5 mutant with impaired binding to Ras shows upregulation of miR-9 (p-value ≤ 0.005). (B) SOS1 silencing upregulates miR-9 in U87ΔEGFR cells (p-value ≤ 0.004). (C) H-Ras G12V suppresses miR-9 (p-value ≤ 0.006). (D, left panels) Treatment of U87ΔEGFR cells with a Raf inhibitor does not modulate miR-9. (D, middle and right panels) Introduction of wild type PTEN (p-value ≤ 0.004) or dead kinase AKT (DKAKT, p-value ≤ 0.04), relieved the suppression of miR-9 in U87ΔEGFR cells.

To determine the pathway downstream of Ras required for suppressing miR-9, we inhibited either the Ras/Raf/MEK/ERK or the Ras/PI3K/AKT axis. Inhibitor-mediated blockade of Raf1 in U87ΔEGFRcells had no effect on miR-9 levels (Figure 3d) while disruption of PI3K activity by exogenous expression of PTEN in U87ΔEGFR cells caused upregulated miR-9 expression relative to cells infected with catalytically inactive PTEN (Figure 3d). Finally, infection of U87ΔEGFR cells with dead kinase AKT also upregulated miR-9 (Figure 3d). Overall, these data show that the Ras/PI3K/AKT axis suppresses miR-9.

MiR-9 targets FOXP1

A limited number of miR-9 targets have been identified in GBM cells to date (32, 33). Western blotting of some of the validated glioma-associated miR-9 targets revealed no correlation between target expression levels and miR-9 levels in ΔEGFR cells relative to parental cells (data not shown). Consequently, we used starBase (34) to identify novel miR-9 targets in GBM reasoning that starBase would significantly reduce the rate of false positive predictions since it integrates data from 21 high-throughput CLIP-Seq experiments with miR target sites predicted from 6 target prediction programs (34). The intersection of CLIP-seq data with target sites predicted by TargetScan and PicTar yielded a list of 30 putative miR-9 targets (Supplemental Table S3). Since miRs often induce target mRNA degradation, the mean signal obtained from probes on Affymetrix GeneChip Genome U133A arrays (6) for each putative target from U87ΔEGFR cells was divided by the mean signal from U87DK cells. Four putative targets showing a Δ/DK ratio ≥ 1.5 were selected for validation by qPCR, as well as seven putative targets not represented on the Affymetrix arrays (Supplemental Table S3). As none of the screened targets were significantly altered at the mRNA level, we reasoned that miR-9 likely blocks translation of its targets as previously reported (35). We deemed FOXP family members to be prime candidates as the FOXP1 and FOXP4 3’UTRs contain two predicted miR-9 binding sites. As western blotting did not reveal an inverse correlation of miR-9 and FOXP4 expression levels (Supplemental Figure S3) in U87 and U373DK cells relative to U87 and U373 ΔEGFR cells, we focused on FOXP1 given that miR-9 regulates FOXP1 in neurons (35). Western blotting revealed that FOXP1 expression was higher in human and mouse (U87, U373 and mouse astrocytes) ΔEGFR cells displaying low miR-9 expression relative to parental U373 cells and mouse astrocytes or U87DK cells with high miR-9 expression (Figure 4a). Overexpression of miR-9 in U87ΔEGFR cells and AstrocytesΔ caused downregulation of FOXP1 (Figure 4B). Conversely, transduction of U87 cells with a miRZip miR-9 vector, designed to produce anti-sense RNA to inactivate miR-9, induced FOXP1 expression (Figure 4C). To show a direct interaction between miR-9 and FOXP1, the 3’UTR of FOXP1 was cloned into a luciferase reporter vector and cells were co-transfected with the FOXP1 reporter vector and a non-specific miR mimic or a miR-9 mimic. Transfection of U87Δ cells with the miR-9 mimic significantly repressed FOXP1 reporter activity relative to cells transfected with the control miR mimic (Figure 4D). Inhibition of miR-9 activity in U373 cells using anti-miR-9 locked nucleic acids induced a de-repression of the luciferase activity of the FOXP1 reporter (Figure 4E). Collectively, these data indicate that FOXP1 is a miR-9 target in GBM cells.

Figure 4.

MiR-9 targets FOXP1. (A) FOXP1 expression inversely correlates with miR-9 expression. Parental and DK cells with higher miR-9 expression exhibit decreased FOXP1 protein levels relative to ΔEGFR cells showing low miR-9 expression. (B) Overexpression of miR-9 in U87Δ and AstrocytesΔ downregulate FOXP1 expression. (C) Inhibition of miR-9 activity using the miRZipmiR-9 vector upregulates FOXP1. (D) U87ΔEGFR cells were co-transfected with control or miR-9 mimics and FOXP1 3’ UTR luciferase reporter, miR-9 and mutant miR-9 reporters. MiR-9 mimics repressed the FOXP1 and miR-9 reporters (p ≤ 0.02) but not the mutant miR-9 reporters. (E) U373 cells were co-transfected with anti-miR-9 oligonucleotides and the FOXP1 3’ UTR luciferase reporter, miR-9 and mutant miR-9 reporters. Inhibition of miR-9 activity relieved the repression of FOXP1 and miR-9 reporters (p ≤ 0.03).

MiR-9 and FOXP1 regulate tumorigenicity

ΔEGFR confers an increased in vivo tumorigenic capacity to GBM cells (7, 8). The suppression of miR-9 by ΔEGFR suggested the possibility that miR-9 might antagonize the tumor growth advantage conferred by ΔEGFR signaling. To test this, U87ΔEGFR cells stably overexpressing miR-9 were subcutaneously implanted into nude mice (Figure 5a). Vector control U87ΔEGFR tumors were significantly larger than tumors formed by U87DK (Figure 5a). U87ΔEGFR tumors overexpressing miR-9 were similar in size to U87DK tumors (Figure 5a) and significantly smaller than U87 ΔEGFR tumors, indicating that miR-9 antagonizes the increased tumorigenicity conferred to GBM cells by ΔEGFR.

Figure 5.

MiR-9 and FOXP1 regulate tumorigenicity. (A) U87ΔEGFR cells were infected with pSuper vector (pS) and pSmiR-9-1 vector to upregulate miR-9 (top panel). Mice were subcutaneously implanted with U87DK, U87ΔpS and U87ΔmiR-9 cells. The growth of U87DK and U87ΔmiR-9 tumors was significantly slower compared to U87ΔpS tumors (p-value ≤ 0.01). (B) Mice implanted with U87miRZip control cells developed significantly smaller tumors relative to mice implanted with U87miRZip miR-9 cells showing impaired miR-9 activity (p-value ≤ 0.03). (C) Knock-down of FOXP1 dramatically impaired the growth of U87ΔEGFR tumors (p-value ≤ 0.02). (D) Overexpression of FOXP1 increases the tumorigenic capacity of U373 and U251 cells (p-value ≤ 0.02). (E) Kaplan-Meir survival curve analysis reveals that high FOXP1 predicts poor survival in a cohort of 131 GBM patients.

The data also suggested that miR-9 might negatively regulate the tumorigenic capacity of GBM cells lacking ΔEGFR. To disrupt miR-9 expression, we first used 5’ RACE to map the host gene of pri-miR-9-2 in U87 cells (Supplemental Figure S4a). The pri-miR-9-2 host gene was identified to be the large intergenic non-coding RNA, LINC00461 variant 1. Silencing of LINC00461 variant 1 downregulated miR-9 expression and thus confirmed that LINC00461 variant 1 is processed to give rise to miR-9 (Supplemental Figure S4b). Silencing LINC00461 variant 1 significantly accelerated tumor growth relative to control tumors (Supplemental Figure S4c). To directly confirm that miR-9 negatively regulates tumorigenicity, U87miRZip control cells and U87miRZip miR-9 cells, showing impaired miR-9 function (Figure 4c), were implanted into nude mice. Inhibition of miR-9 significantly increased the tumor growth rate of U87 cells (Figure 5b), showing that miR-9 negatively regulates GBM tumorigenicity.

Repression of FOXP1 by miR-9 appeared to be an attractive mechanism by which miR-9 antagonizes the tumor growth advantage conferred by ΔEGFR (Figure 5a), since upregulation of miR-9 represses FOXP1 in ΔEGFR cells (Figure 4b) and disruption of miR-9 activity upregulated FOXP1 (Figure 4c), and consequently, increased tumorigenicity (Figure 5b). Support for this was obtained by demonstrating that knock-down of FOXP1 using two shRNAs dramatically inhibited the growth of U87ΔEGFR tumors (Figure 5c and Supplemental Figure 5). Overexpression of FOXP1 increased the tumorigenic capacity of both U373 and U251 cells demonstrating that FOXP1 is sufficient to enhance tumor growth (Figure 5d). The significance of this finding is underscored by the significant (p-value ≤ 3.9e-06) correlation of high FOXP1 expression with poor survival in a cohort of 131 GBM patients (Figure 5e).

DISCUSSION

In this report, we sought to determine the role of miRs in mediating several of the pathogenic effects induced by aberrant EGFR signaling in GBM. Although wtEGFR and ΔEGFR share the same cytoplasmic signaling domains, ΔEGFR, but not wtEGFR, repressed miR-9. Underlining the specificity of this, the activation of several other growth factor receptor tyrosine kinases (RTKs) also had no effect on miR-9. It is likely that persistent signaling from ΔEGFR, as a result of its slow rate of internalization, is involved in the preferential suppression of miR-9 by this mutant receptor (36). Supporting the role of persistent pathway activation in suppressing miR-9, mutant H-Ras G12V alone was sufficient to repress miR-9. Analysis of the TCGA GBM dataset showed decreased miR-9 expression preferentially in GBM tumors with a mesenchymal GBM expression signature and known to show loss, mutation and/or decreased expression of the negative regulator of Ras, neurofibromin (37). Those GBMs with a classical signature and that harbor EGFR amplification and mutants such as ΔEGFR, did not show suppression of miR-9. Since exon arrays lack the sensitivity to reliably detect ΔEGFR in classical GBM samples that co-express wtEGFR and ΔEGFR, correlations between miR-9 expression levels and ΔEGFR expression are predicted to be imprecise. As well, the heterogeneous expression of wtEGFR and ΔEGFR (9) limit the sensitivity in detecting low miR-9 expression in classical GBMs. In support of our observation that wtEGFR does not repress miR-9, we found that classical GBM samples did not display low miR-9 expression.

As activation of the PI3K/AKT axis is more robustly induced by ΔEGFR than by wtEGFR, we examined the pathway components downstream of ΔEGFR and Ras required for repressing miR-9 (38, 39) and found that the PI3K/AKT signaling axis is obligatory. Ras-mediated induction of c-Myc positively regulated miR-9 transcription in breast and neuroblastoma cells (16) and the Ras-Myc-miR-9 axis promoted breast cancer metastasis. Highlighting the importance of Ras/ERK /c-Myc axis in regulating miR-9, c-Myc was shown to positively regulate miR-9 in multiple tumor models (16, 40, 41) and constitutively active EGFR mutants in lung cancer cells require the Ras/ERK /c-Myc axis to positively regulate miR-9 (42). Collectively, these studies implicate Ras as a key regulator of miR-9 levels in cancer.

The repression of miR-9 by ΔEGFR suggested that miR-9 is a tumor suppressor. Consistent with this, miR-9 inhibited the growth of ΔEGFR-dependent tumors and inhibition of miR-9 activity enhanced tumor growth. Jeon and colleagues reported that ID4 inhibited miR-9* expression to promote chemoresistance, glioma self-renewal and tumorigenicity by induction of the miR-9* target, SOX-2 (32). In GBM CD133⁺ stem cells, miR-9 and miR-9* were highly expressed and required for GBM stem cell renewal (43). Interestingly, miR-9 and miR-9* acted in a cooperative manner to repress the novel tumor suppressor, CAMTA1 (43). We identified the transcription factor, FOXP1, as a novel miR-9 target in GBM cells where their expression was inversely correlated. Correspondingly, the induction of FOXP1 by inhibition of miR-9 increased tumor growth, while knock-down of FOXP1 inhibited the growth of ΔEGFR tumors. Our data suggest that FOXP1 is a likely tumor promoting factor in GBM.

Overexpression of FOXP1 confers a poor prognosis to lymphoma (44) and hepatocellular carcinoma (45), suggesting that FOXP1 is an oncogene. However, in breast cancer (46) and T cell lymphomas (47), FOXP1 expression is associated with favorable outcomes, suggesting a possible tissue specific role as a tumor suppressor. FOXP1 increases the proliferation of the ERα positive breast cancer cell line, MCF-7, suggesting that FOXP1 serves as a surrogate marker for ER-dependent breast cancers (48). FOXP1 expression is restricted to neurons within different regions of the brain (49, 50). As we observed FOXP1 expression in tumors of glial lineage, it is plausible that FOXP1 induction is required for the de-differentiation of astrocytes to multipotent stem cell-like progenitors during the gliomagenesis process in the setting of oncogenic ΔEGFR signaling. Given that miR-9 expression is higher in the minority CD133⁺ stem cell compartment of GBMs (43), low miR-9 expression might induce FOXP1 to provide for a rapid and lethal expansion of the non-stem cell compartment. The role we have uncovered for FOXP1 and its transcriptional targets may yield novel therapeutic approaches and targets to improve GBM patient survival.