Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2014 Mar 31;9(3):e93476. doi: 10.1371/journal.pone.0093476

Identification of Genes Differentially Expressed between Resistant and Susceptible Tomato Lines during Time-Course Interactions with Xanthomonas perforans Race T3

Heshan Du 1,#, Wenhui Li 1,#, Yuqing Wang 1, Wencai Yang 1,*
Editor: Ji-Hong Liu2
PMCID: PMC3970963  PMID: 24686403

Abstract

Bacterial spot caused by several Xanthomonas sp. is one of the most devastating diseases in tomato (Solanum lycopersicum L.). The genetics of hypersensitive resistance to X. perforans race T3 has been intensively investigated and regulatory genes during the infection of race T3 have been identified through transcriptional profiling. However, no work on isolating regulatory genes for field resistance has been reported. In this study, cDNA-amplified fragment length polymorphism technique was used to identify differentially expressed transcripts between resistant tomato accession PI 114490 and susceptible variety OH 88119 at 3, 4 and 5 days post-inoculation of the pathogen. Using 256 selective primer combinations, a total of 79 differentially expressed transcript-derived fragments (TDFs) representing 71 genes were obtained. Of which, 60 were up-regulated and 4 were down-regulated in both tomato lines, 4 were uniquely up-regulated and 2 were uniquely down-regulated in PI 114490, and 1 was specifically up-regulated in OH 88119. The expression patterns of 19 representative TDFs were further confirmed by semi-quantitative and/or quantitative real time RT-PCR. These results suggested that the two tomato lines activated partly similar defensive mechanism in response to race T3 infection. The data obtained here will provide some fundamental information for elucidating the molecular mechanism of response to race T3 infection in tomato plants with field resistance.

Introduction

Bacterial spot severely affects tomato (Solanum lycopersicum L.) fruit production and quality in both open field and protected area [1]. The causal agent is a complex of at least four species of Xanthomonas (X. euvescatoria, X. vescatoria, X. perforans, and X. gardneri) with five races designated T1 through T5 based on their virulence on tomato differential genotypes [2]-[4]. Due to the existence of multiple pathogen species and races, marginal efficacy of commonly applied chemicals, development of resistance to these chemicals in bacterial populations, and a lack of available disease resistance traits in commercial cultivars, control of the disease has not been effective once epidemics start [5], [6]. Exploiting host resistance gene(s) combined with important defense response genes for developing cultivars with durable resistance is considered as an effective approach to manage the disease.

The resistance to race T3 of bacterial spot in tomato can be either qualitatively or quantitatively inherited. Two S. pimpinellifolium accessions PI 128216 and LA 1589 as well as one unimproved tomato breeding line Hawaii 7981 show both hypersensitive response (HR) and field resistance to race T3. The HR is conditioned by single dominant genes of Xv3 in Hawaii 7981 [7], Rx4 in PI 128216 [8], and RxLA1589 in LA 1589 [9]. These three genes have been mapped to the same region on chromosome 11 and might be the same gene or allelic genes [1]. Field resistance to race T3 in these lines shows partial or incomplete dominance, requiring interactions between Xv3 and some modifiers in Hawaii 7981 [10], or depending on gene dosage and genetic backgrounds in PI 128216 [11].

The S. lycopersicum var. cerasiforme accession PI 114490 has been considered as a durable source for resistance to bacterial spot due to its high level of field resistance to four races T1-T4 [5]. Classical genetic analysis of resistance to race T2 using F2 and inbred backcross populations derived from PI 114490 suggests that genetic control is conferred by a minimum of two loci [12], and resistance to races T3 and T4 is conditioned by at least four quantitative trait loci (QTL) [13], [14]. A couple of QTLs are common for resistance to races T2, T3, and T4. Although there is no or few lesions on PI 114490, the bacterial population of race T3 in its leaves is not significantly different from that in susceptible variety OH 88119 [15]. In addition, PI 114490 does not show HR to the pathogen of bacterial spot [1]. Therefore, the mechanism of resistance in PI 114490 seems complicated and different from that in those lines with HR to the pathogen.

Despite extensive efforts have been made on understanding the genetic basis of resistance, little is known about the defense regulation and mechanism underlying inducible response to race T3 of bacterial spot in tomato. To date, a total of 426 genes differentially expressed during the time-course of HR to race T3 in Hawaii 7981[16] and 1345 genes triggered by recognition of the Xanthomonas type III effector AvrXv3 [17] have been identified. These genes have been predicted to participate in a complex molecular network of regulation including components of defense responses, stress transcriptional regulation factors, signal transduction components, and regulators of primary and secondary metabolisms. Furthermore, several genes involved in the disease resistance process have been isolated through this approach [18], [19]. However, these studies are based on hypersensitive response to the pathogen of bacterial spot in tomato plants and may not cover all genes during the process of field resistance.

The complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) is a powerful method to obtain a wide collection of differentially expressed transcript profiles even if rarely expressed during the process of response to abiotic or biotic stresses [20][22], enabling discovery of novel genes without any prior knowledge of gene sequences [23]. Moreover, compared with hybridization-based approaches including DNA chips and microarrays, cDNA-AFLP has a relatively low startup cost and enables distinguishing expression patterns of highly homologous gene family members [24]. The cDNA-AFLP technique has been successfully employed to identify differentially expressed genes in various plant-pathogen systems [22], [23], [25][27]. In this study, we isolate 71 genes differentially expressed in resistant line PI 114490 and susceptible line OH 88119 during time-course of response to bacterial spot race T3 using the cDNA-AFLP technique. The expression patterns of 19 genes are validated using semi-quantitative RT-PCR and/or quantitative real time RT-PCR (qRT-PCR). The data obtained here will provide some basic information for understanding the molecular mechanism of response to bacterial spot race T3 infection in tomato plants with field resistance.

Materials and Methods

Plant materials

Two tomato lines, the S. lycopersicum var. cerasiforme accession PI 114490 with field resistance and a variety OH 88119 susceptible to X. perforans race T3 [14], were used in this study. All seeds were surface sterilized with 4% NaClO for 5 min and germinated in 288 Square Plug Trays (Taizhou Longji Gardening Materials Co., Ltd, Zhejiang, China) in a sterilized mixture of peat and vermiculite (3:1). One-month old seedlings were transplanted into 10 cm (diameter) x 8 cm (height) pots filled with the same sterilized peat : vermiculite mixture and placed in a growth room with 28/25°C day/night cycle and 14 h photoperiod. Water and fertilizer were provided as needed.

Inoculum preparation and inoculation

X. perforans race T3 strain Xv829 was grown on yeast, dextrose, and calcium carbonate (YDC) agar medium [28] at 28°C for 48 to 72 h. Bacterial cells were collected and resuspended to A600  =  0.2 (approximately 3×108 colony forming units per ml) using sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. About five to six- week old seedlings were spray-inoculated with bacterial suspensions, whereas control plants (mock-treatment) were sprayed with the same sterile solution. Leaf samples were collected from the infected and mock-treated plants at 3, 4, and 5 days post-inoculation (DPI) for RNA isolation.

RNA isolation and cDNA synthesis

Total RNA was isolated from both infected and mock-treated leaves using Trizol reagent following the manufacturer’s instructions (Invitrogen, CA, USA). The RNA integrity was monitored by 1.2% (w/v) agarose gel electrophoresis and the concentration was determined using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, DE, USA). mRNA was isolated following the protocol of polyA Tract mRNA isolation system kit (Promega, WI, USA), and used as the template for double-stranded cDNA synthesis using M-MLV reverse transcriptase (TaKaRa, Dalian, Liaoning, China). The double-stranded cDNAs were purified using phenol/chloroform extraction and ethanol precipitation, and then stored at -20°C.

cDNA-AFLP analysis

The template for cDNA-AFLP was prepared using the method described in Bachem et al. [29]. Approximately 100 ng cDNA from each sample was first digested with restriction enzyme EcoR I at 37°C for 8 h, and then with Mse I at 65°C for 8 h. The double-stranded adapters were ligated to the digested products using T4 DNA ligase (Promega) at 16°C overnight. After ligation of the adapters, 1 μl diluted ligation mixture (1∶10) was used as the template for pre-amplification in a 20 μl reaction mixture containing 10 μl Taq10 2×Master Mix (Ausable Biotechnology, Beijing, China), 8 μl ddH2O, and 0.5 μl (10 μM) pre-amp primers. The PCR thermal cycling parameters were as follows: 94°C for 3 min, 26 cycles of 94°C for 30 s, 56°C for 1 min, and 72°C for 1min, and a final extension at 72°C for 5 min. The pre-amplified products were diluted (1:50) with ddH2O for selective amplification using 256 AFLP selective primer combinations under the following conditions: 94°C for 3 min, 12 cycles of 94°C for 30 s, 65°C for 30 s (decrease by 0.7 each cycle), and 72°C for 1 min, then by 23 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 1min, and an extra extension at 72°C for 5 min for the last reaction. Following the selective amplification, 10 μl of each PCR product was mixed with 2 μl of formamide stop/loading buffer (95% formamide, 20 mM EDTA, pH 8.0, and bromophenol blue), denatured at 98°C for 10 min, and then chilled immediately on ice. The products were separated on 7% denaturing polyacrylamide gel at a constant power (95W) for 4.5 h using 20 cm×45cm gel apparatus (Model: JY-CX1B, Beijing Junyi-Dongfang Electrophoresis Equipments Co., Ltd, Beijing, China ) and visualized using the silver-staining approach [30].

Isolation and sequence analysis of differentially expressed transcript-derived fragments (TDFs)

AFLP fragments with persistent up- or down-regulated at 3, 4 and 5 DPI were excised from polyacrylamide gels with a clean razor blade, directly rinsed with 200 μl TE buffer (10 mM Tris and 1 mM EDTA, pH 8.0), and then incubated in 100 μl TE for 10 min using a boiling water bath. The fragments were re-amplified using the same conditions of selective amplification protocol described above with the corresponding primers. The resulting PCR products were separated on 1.5% agarose gel and purified using Agarose Gel purification Kit (Biomed Co., Beijing, China).

The purified PCR products were ligated into the pMD19-T vector (Takara), transformed into E. coli DH5α competent cells, and plated on Luria-Bertani (LB) agar medium containing 50 μg/ml ampicillin. The recombinant clones were verified by PCR, and at least two positive clones were sequenced at Sunbiotech Company (Beijing, China). Each sequence was searched against the International Tomato Annotation Group (ITAG) Release 2.3 Predicted CDS (SL2.40) in the Sol Genomics Network (SGN) (http://solgenomics.net) database using BLASTX program to obtain the function annotation. Gene ontology analysis was performed using GoPipe [31] through BLASTP against Swiss-Prot and TrEMBL database. The WEGO software (http://wego.genomics.org.cn) was used for gene ontology (GO) classification and plotting [32].

RT-PCR and qRT-PCR analysis

To confirm the results of cDNA-AFLP analysis, 19 strongly differentially expressed TDFs were chosen for semi-quantitative RT-PCR and/or qRT-PCR analysis. Since the sequence lengths of TDFs were short, the sequences of corresponding CDS from SGN were used to design gene-specific primers. The specific primers for TDF792 were designed using the sequence of 3′UTR region obtained using the SMARTer RACE cDNA Amplification Kit (Clontech Laboratories Inc., CA, USA). The specificity of each primer pair was confirmed by analyzing PCR products on agarose gel and melting curve during real-time PCR.

RT-PCR was performed using the method described in Pei et al. [8], and the products were separated on 1.2% agarose gel, stained with ethidium bromide, and photographed using a GIAS-4400 Gel Documentation System (Beony Science and Technology Co., Beijing, China). qRT-PCR was conducted in a 20 μl reaction volume consisting of 10 μl SYBR-Green supermix (TaKaRa), 0.2 μl ROXII, 0.2 μl each of forward and reverse primers (10 μM), and 9.4 μl cDNA templates diluted (1:40) from the first strand cDNA solution prepared for cDNA-AFLP. Reactions were heated at 95°C for 3 min followed by 40 cycles of 95°C for 15 s, 57°C for 30 s, and 72°C for 15 s using the ABI 7500 machine (Applied Biosystems, CA, USA). All samples were performed in triplicate with the control sample as the internal reference. The relative expression of the target genes was calculated by normalizing Ct values in each sample against the EF1-α using comparative C-T method [33].

Results

Responses to X. perforans race T3 in OH 88119 and PI 114490

The development of disease on plants was monitored each day after inoculation. No symptom was observed on both PI 114490 and OH 88119 plants prior to 4 DPI. Small lesions with yellow haloes developed on the leaves of OH 88119 on 5 DPI, and subsequently expanded to form large necrotic areas throughout the inoculated leaves in the late stage of the disease (Fig. 1A). In contrast, PI 114490 always showed few and small lesions restricted to portions of the leaves (Fig. 1B). This was consistent with our previous observations [15].

Figure 1. Foliar lesions on tomato plants after spray-inoculation with bacterial spot race T3 (Xanthomonas perforans) strain Xv829.

Figure 1

A: Lesions on a leaf of the susceptible line OH88119. B: Lesion on a leaf of the resistant line PI 114490.

Based on the progress of disease development, the time-course transcriptional profiling of PI 114490 and OH 88119 were conducted to identify differentially expressed genes during the process of race T3 infection. Infected and mock-treated leaves were harvested at 3, 4 and 5 DPI for RNA isolation and cDNA-AFLP analysis.

Isolation and analysis of differentially expressed TDFs

A total of about 6400 TDFs with sizes of 100 bp to 500 bp were amplified using 256 AFLP selective primer combinations. Various types of differentially expressed TDFs between PI 114490 and OH 88119 at three time-points (3, 4, and 5 DPI) were observed, which mainly included commonly and persistently up- or down-regulated in both lines (Fig. 2a,b), specifically up- or down-regulated in either PI 114490 or OH 88119 (Fig. 2c,d), constitutively expressed only in PI 114490 or OH 88119 (Fig. 2e-g). Considering the occurrence of fragments unique to PI 114490 or OH 88119 might be due to the mutation of restriction sites for EcoR I or Mse I, only TDFs commonly presented in both lines with persistently up- or down-regulated at three time-points were excised from the polyacrylamide gel. Therefore, 122 TDFs were recovered from the gels, and 108 were successfully sequenced. Due to inconsistency between sequences derived from two clones, 29 TDFs were discarded and the remaining 79 TDFs were retained for further analysis (Table 1). Among the 79 TDFs, 68 (86.1%) showed up-regulated and four showed down-regulated expression in both PI 114490 and OH 88119, four were specifically up-regulated and two were specifically down-regulated in PI 114490, and one displayed specifically up-regulated in OH 88119 (Table 1).

Figure 2. Enumerating main types of differentially expressed fragment during cDNA-AFLP analysis.

Figure 2

PT: PI 114490 inoculated with T3. PM: PI 114490 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. OT: OH 88119 inoculated with T3. OM: OH 88119 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. A: Common persistent up-regulated TDF (indicated by an arrow) in both tomato lines. B: Common persistent down-regulated TDF in both tomato lines. C: Specific persistent up-regulated TDF in PI 114490. D: Specific persistent down-regulated TDF in PI 114490. E: Constitutive expressed only in PI 114490. F: Constitutive expressed only in OH 88119. G: Length polymorphism fragment between two tomato lines.

Table 1. Differentially expressed patterns of TDFs during inoculation with race T3 and their annotation detected in Sol Genomics Network database.

TDF No. Primer combinationa Length (bp)b Annotationc Gene locus from ITAG2.3
Up-regulated in both genotypes
773/349 AG-CA/GG-AA 157/305 Kunitz-type protease inhibitor Solyc03g098780.1.1
263/670/790 TA-GC/AA-CT/TA-AG 282/102/129 Cysteine proteinase inhibitor Solyc00g071180.2.1
741 CA-GC 305 Jasmonate ZIM domain 2 Solyc03g122190.2.1
721 CA-CT 321 1-aminocyclopropane-1-carboxylate oxidase Solyc07g049530.2.1
30 TT-AA 208 Chitinase Solyc10g055800.1.1
671 AT-GG 177 Malic enzyme Solyc05g050120.2.1
720 GG-CT 334 Polyphenol oxidase Solyc08g074680.2.1
656 CG-AA 382 N-acetyltransferase Solyc08g068710.1.1
794 TT-CA 119 Homology to unknown gene Solyc08g066600.2.1
300 AT-TG 95 Subtilisin-like protease Solyc01g087850.2.1
108 TG-AT 180 Subtilisin-like protease Solyc10g084320.1.1
13 TA-AA 287 Cathepsin B Solyc02g069100.2.1
270 GC-TT 112 Peroxidase Solyc03g006700.2.1
24 AC-AT 257 Lipase-like protein Solyc04g010250.2.1
792 TT-GC 108 U-box domain-containing protein Solyc11g068940.1.1
289 AT-AG 179 Peroxisomal membrane protein Solyc01g091730.2.1
710 GA-CG 122 Serine carboxypeptidase S28 family protein Solyc03g033620.2.1
297 AT-TG 129 Pheromone receptor-like protein Solyc04g079350.1.1
673 AT-CA 125 ATP-binding cassette 1 Solyc04g015970.2.1
318 AC-TC 240 Phenylalanine ammonia-lyase Solyc09g007920.2.1
308 AG-AT 205 Short-chain dehydrogenase/reductase protein Solyc07g047800.2.1
22/12/791 TA-AA/TA-AA/TT-GC 246/296/180 heat shock protein 70 Solyc09g010630.2.1
317 AC-TC 277 Anthocyanidin synthase Solyc10g076540.1.1
255 TA-GT 363 HhH-GPD family protein Solyc11g007580.1.1
702 TG-CC 125 peroxidase Solyc01g105070.2.1
626 CA-TG 190 Diacylglycerol O-acyltransferase Solyc01g095960.2.1
701/624 TG-CG 228/455 Spermidine synthase 1 Solyc03g007240.2.1
745 CT-GC 291 Serine carboxypeptidase 1 Solyc06g083020.1.1
281 AA-AC 146 Cytochrome P450 Solyc09g098030.2.1
711 GT-GG 227 Cytochrome P450 Solyc04g079730.1.1
81 GT-GT 218 hydroxycinnamoyltransferase-like protein Solyc11g071480.1.1
770 AG-GG 106 Glutamyl-tRNA (Gln) amidotransferase Solyc11g071550.1.1
781 GC-CC 146 Wound-induced basic protein Solyc06g083340.2.1
744 CA-CA 73 Jasmonate ZIM-domain protein 3 Solyc01g005440.2.1
87 GT-AT 251 AP2-like ethylene-responsive transcript factor. Solyc11g072600.1.1
668 AA-CT 107 Calmodulin-binding protein Solyc07g006830.2.1
260 AC-GG 173 Heat shock protein 90 Solyc12g015880.1.1
321 TT-GT 205 Heat shock protein DnaJ domain protein Solyc02g062350.2.1
319 AC-TC 126 Heat shock protein 90 Solyc07g065840.2.1
657/662 CG-AA/CG-CA 149/140 TO54-2 Solyc06g024210.1.1
775 TG-CG 154 60S ribosomal protein Solyc12g044720.1.1
655 CT-TC 111 Glycogen synthase Solyc03g083090.2.1
348 GG-AA 199 Cell division protease FtsH homolog Solyc02g032960.2.1
654 CT-TC 86 Receptor like kinase, RLK Solyc10g081910.1.1
712/83 GT-CT/GT-GA 235/220 Alcohol dehydrogenase zinc-binding protein Solyc12g010960.1.1
601 GC-TG 149 Protein phosphatase 2C containing protein Solyc08g077150.2.1
600 GC-TG 141 Myb transcription factor Solyc03g112390.2.1
776 TG-CA 229 Chalcone isomerase protein Solyc02g067870.2.1
667 AA-CA 466 PAS Solyc07g017740.2.1
61 TC-TA 214 Ycf2 Solyc01g007640.2.1
66 TC-TT 213 5&apos-bisphosphate nucleotidase-like protein Solyc02g079250.2.1
11 TA-AA 385 Heme oxygenase 1 Solyc12g009470.1.1
746 CT-GC 291 Serine carboxypeptidase 1 Solyc06g083040.2.1
666 CG-TC 111 Ras-related protein Rab-25 Solyc09g098170.2.1
789 TT-GC 122 F-box/LRR-repeat protein 3 Solyc10g076290.1.1
771 AG-GC 105 Amino acid transporter Solyc02g065680.2.1
777 TG-CA 236 Adenosine kinase Solyc10g086190.1.1
606 GC-TC 183 CHP-rich zinc finger protein-like Solyc01g073840.1.1
772 AG-CA 159 no hits found
742 CA-GC 280 no hits found
Down-regulated in both genotypes
625 CA-TG 311 Os07g0175100 protein Solyc07g040960.1.1
115 TG-AC 225 Unknown Protein Solyc07g056640.1.1
52 TC-AC 254 Single-stranded DNA binding protein Solyc10g086150.1.1
780 GC-CG 168 Unknown Protein Solyc01g103110.2.1
Specifically up-regulated in PI 114490
795 GA-GC 156 Cell division protease ftsH Solyc03g007760.2.1
740 CG-CA 140 Proline rich protein Solyc12g009650.1.1
747 CT-CA 212 no hits found
785 AT-GC 280 no hits found
Specifically up-regulated in OH 88119
352 CA-AA 301 Myb transcription factor Solyc09g011780.2.1
Specifically down-regulated in PI 114490
262 TA-GC 185 expressed protein Solyc09g010540.2.1
17 TA-AA 229 Heavy-metal-associated domain-containing protein Solyc02g087150.2.1
a

Two selective nucleotide at the 3′terminus of each primer.

b

Multiple cDNA length indicates different TDFs with different sequences from the same gene.

c

“No hits found”indicates that the sequence of TDF do not show any sequence similarity to known cDNA sequences in ITAG Release 2.3 Predicted CDS (SL2.40) database.

Based on the ITAG annotation, the 79 TDFs represented 71 genes (Table 1). Four TDFs (TDF742, TDF747, TDF772, and TDF785) did not show sequence similarity to any gene in the tomato predicted CDS database. However, searching these four TDFs in tomato WGS Chromosomes (SL2.40) sequences indicated that TDF742 and TDF785 were probably derived from 3′ non-coding sequences of Solyc00g009760.2.1 (Cytochrome P450 monooxygenase) and Solyc11g051200.1.1 (Cytochrome P450 like_TBP), respectively. TDF772 was probably derived from 5′ non-coding sequence of Solyc07g065890.2.1 (Uridine kinase). TDF747 had high sequence identity (97.6%) to SGN-E258658.

Gene ontology enrichment analysis of differentially expressed genes

Based on the functional annotation using GoPipe [31], 61 of the 71 differentially expression genes had GO terms. Gene ontology enrichment analyses assigned the 61 genes to 22 functional groups in three main categories including cellular component, molecular function, and biological process (Fig. 3). The dominant subcategories for each main category were cell, binding, and metabolic process, respectively. In molecular function category, genes involved in catalytic activity also well represented, while the cellular component category mainly consisted of cell part. It was noteworthy that 11 differentially expressed genes involved in “response to stimulus” category (GO:0050896) within biological process. With the exception of TDF352 that was specifically up-regulated in OH 88119, the remaining 10 TDFs (30, 270, 702, 260, 318, 791, 352, 600, 87, and 255) were up-regulated in both PI 114490 and OH 88119. Functional annotation analysis revealed that some differentially expressed TDFs that were not classified into the ‘response to stimulus’ subcategory could also be induced during other biotic and abiotic stresses. The TDF781 without GO term showed approximately 91.5% of amino acid identity with PvPR4, one of the smallest wound-induced proteins that mRNA expression level increased 10-fold upon wounding over a period of 24 h in Phaseolus vulgaris [34]. Another TDF108 (Solyc10g084320.1.1, Subtilisin-like protease) not assigned to the ‘response to stimulus’ subcategory was significantly up-regulated in tomato plants with response to Clavibacter michiganesis subsp. michiganesis at 4 and 8 DPI [35].

Figure 3. Gene classification based on Gene ontology (GO) enrichment for differentially expressed genes.

Figure 3

Validation of expression patterns for selected genes

To select a reliable reference gene for RT-PCR and qRT-PCR analysis, the expression of commonly used reference genes (EF1-α, 18S rRNA and Ubi) was analyzed with the same sample used for cDNA-AFLP analysis. When cDNA concentration of all the samples was adjusted to 0.4 μg/20 μl in qRT-PCR reaction system, the sample’s Ct values of EF1-α and 18S rRNA were at ranges of 20.3–20.9 and 16.2–16.9, respectively, while the expression profiles of Ubi varied among samples (data not shown). Combining the current results and internal reference genes used in literatures [36], [37], the EF1-α was used to normalize the amount of cDNA of all samples.

A total of 19 strongly modulated TDFs (Table 2) were used to validate the cDNA-AFLP results. Based on the functional annotation in literatures, majority of these TDFs were associated with massive defense response processes including jasmonic acid biosynthesis pathways (TDF711and TDF741), ethylene biosynthesis (TDF87 and TDF721), defense-related enzymes (TDF30, TDF657, TDF673 TDF702, TDF108, TDF701, TDF712, and TDF745), and cell death related (TDF792 and TDF781). The remaining (TDF625, TDF626, TDF666, TDF667, and TDF794) did not match any known defense response genes.

Table 2. Sequences of specific primer pairs used for RT- and qRT-PCR amplification.

TDF No. Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
30 ATGACCCCTCAATCACCAAAG TGTCACCAGGACTAACTCCAAGA
87 GCCGCAATCAAATGTAATG TCCTGCTGGCTACCTTCAC
108 TCCATTGCTGCTGGTAGTCC TCAGAAGTGACGGTCCCTTCT
625 AAAGGTCTCGTCAGGGTTCT TGTAGCCAATCTCCAAATGC
626 TTGTGTTAGTTCCGTTGAGTATCG CCCAAACAAGTTGAGGAAAAATT
657 CTCTTCCACTTTTCTACGGTCC CCCAACTTCCTATAACTCTCCC
666 ACGTTTGTTGAATCGAGGG CAGATGATGAGGGTGAGGAG
667 GATGTCTTCGTTTGGCATAT TTTCGTGATGGAGTGGGATA
673 ATCGGCGGCAGAAATAAG TTGAAATGTGGCGTCAGG
701 TCTCTCTCGGATTCCTTCTTCTTTT CTTCCCATCCATAGTCCTCC
702 AGCATTATGTCCACAAAACGG CTCAATCCAAGAAATCCCCTG
711 TTCATCGGAGAAGAAGGGGAG GACCAGCAACAATCTTGAAACC
712 TTCATGGTCGTATTGCTGTG GAGCACCAGGAGCACTTTCA
721 GGGACATTACAAGAAGTGCA GCTTAGGACATGGTGGATAG
741 ACCTCCAGATTAAGCCAGAC GCTTAGGACATGGTGGATAG
745 AAAAGGTATTGAGCTGGAGTA ATAAGTCATCTGAAATGAGGC
781 CCTCTGTTCCTTGGGCTTCT CCAACGACGATGATTTACGAC
792 CTTTTGACAAAACAATAGAATAG ATTGTGATTTCCAACTTTCTA
794 AGGAAGAATGCGTCTAAAGTT CAGTGATGATGGTGGAAAGG
EF1-α TACTGGTGGTTTTGAAGCTG AACTTCCTTCACGATTTCATCATA
18SrRNA AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA
Ubi GAAAACCCTAACGGGGAAG GCCTCCAGCCTTGTTGTAAA

The first strand cDNA of 3 or 5 DPI was used for the RT-PCR validation (Fig. 4). Except that TDF625 was down-regulated, other 18 TDFs showed up-regulation in both PI 114490 and OH 88119 upon race T3 infection, which were consistent with cDNA-AFLP data. qRT-PCR was used to confirm the fold change of expression levels for 10 TDFs at 3, 4, and 5 DPI. It was very clear that TDF625 was down-regulated and the other nine TDFs were up-regulated at different time-points of infection in both PI 114490 and OH 88119, differing in their induction timing and the strength of expression patterns (Fig. 5). TDF30, DF702 and TDF721 displayed significantly high fold-induction in both tomato genotypes during three time-points of infection. At 3 DPI, the expressions of eight TDFs (30, 108, 702, 721, 711, 657, 673, and 792) with homologies to pathogenesis or defense-related genes were significantly induced to higher levels in resistant PI 114490 than susceptible OH88119. However, the up-regulated fold changes of TDF721, TDF711 and TDF657 were then reinforced significantly only in OH 88119 at 4 and 5 DPI. The expression level of TDF745 was significantly up-regulated in OH 88119 at 3 DPI, but fold change value was higher in PI 114490 at 4 and 5 DPI. These results were almost consistent with cDNA-AFLP analysis, indicating the reliability of cDNA-AFLP results.

Figure 4. Images of cDNA-AFLP and Semi-quantitative RT-PCR analysis of 19 representative TDFs in leaves of tomato lines PI 114490 and OH 88119 at various time-points after inoculation of bacterial spot race T3 strain Xv829.

Figure 4

PT: PI 114490 inoculated with T3. PM: PI 114490 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. OT: OH 88119 inoculated with T3. OM: OH 88119 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. The EF1-α was used as a constitutive control for the RT-PCR.

Figure 5. qRT-PCR analysis of 10 differentially expressed TDFs in tomato.

Figure 5

PT: PI 114490 inoculated with T3. PM: PI 114490 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. OT: OH 88119 inoculated with T3. OM: OH 88119 mock-inoculated with the sterile solution containing 10 mM MgSO4·7H2O and 0.025% (v/v) Silwet L77. Gene expression was determined relative to EF1-α transcript levels in the same samples. The data are means SD of three experimental replicates. The asterisk above the bars indicates statistically significant differences between the infected samples and corresponding mock treatment.

Discussion

The progresses on understanding genetics of host resistance [1] and the emergency of the pathogen genome sequencing [38], [39] have urged bacterial spot to be a suitable pathosystem for investigating the mechanism of tomato-Xanthomonas interactions. Although several loci conferring HR to races T1, T3, or T4 of bacterial spot have been mapped [1], [5], and a candidate gene Rx4 conferring HR to race T3 in S. pimpinellifolium accession PI 128216 and genes responding to race T3 in tomato line Hawaii 7981 during the process of HR have been identified [8], [16], [17], none of these HR genes has been cloned. Therefore, the mechanism of resistance to bacterial spot in tomato remains unclear. Particularly, less work has been done on identification and characterization of genes during the disease process in tomato lines with only field resistance. Using the cDNA-AFLP approach, we here identified 79 TDFs differentially expressed during the disease process in resistant line PI 114490 and susceptible tomato line OH 88119. The expression patterns of some TDFs were further verified by RT-PCR and/or qRT-PCR, suggesting that these TDFs might contribute to host response to the pathogen of bacterial spot during the disease process in tomato. This will provide some fundamental information for investigating the mechanisms of resistance to bacterial spot in tomato.

The number (71) of differentially expressed genes identified in tomato lines PI 114490 and OH 88119 during the disease process was lower comparing to a total of 426 genes identified from tomato line Hawaii 7981 [16]. This could be due to several reasons. First, different techniques might contribute to the difference in numbers of genes identified in two studies. Suppression subtractive hybridization and microarray analysis were used in the previous study [16], while cDNA-AFLP technique was used in this study. Without parallel experiments using these techniques in one study, it was hard to tell the difference in terms of efficiency between two techniques. Second, different criteria might cause different numbers of genes identified in two studies. Gibly et al. [16] only used the resistant tomato line Hawaii 7981 to identify differentially expressed genes with RNAs isolated from pooled leaf tissues collected at various time-points after inoculation. Here we used two tomato lines including one resistance line PI 114490 and one susceptible line OH 88119, and only genes persistently up- or down-regulated at 3, 4, and 5 DPI in both lines were selected. This approach excluded a lot of genes with different expression patterns at three time-points in two tomato lines, which might result in loss of some genes involved in the disease process. Third, different responses to race T3 of tomato bacterial spot in two resistance lines and different inoculation method might also contribute to different numbers of differentially expressed genes identified in two studies. Gibly et al. [16] used infiltration inoculation to incite HR in Hawaii 7981 and we used spray inoculation to evaluate field resistance in PI 114490. Plants with HR should develop localized cell death at infection sites in a short time (<24 h) to restrict pathogen growth, while plants with field resistance might take up to several days to response. Fourth, the number (23.4) of TDFs per primer combination was lower comparing to a previous study of 48.8 TDFs per primer combination in the tomato-Cladosporium fulvum pathosystem [25], which could also contribute to the less genes identified in this study. However, the ratio of differentially expressed TDFs (1.2%) in this study was close to 1% in Gabriëls et al. [25]. Therefore, cDNA-AFLP technique could be used to identify genes differently expressed in tomato plants during the infection of bacterial spot pathogen.

The genetics of field resistance to bacterial spot race T3 in tomato line PI 114490 is complicated. At least five QTLs on chromosomes 1, 3, 8, 11, and 12 with small effect (6.5–11.7%) have been reported to date [14], [15], suggesting that the high level of field resistance in PI 114490 requires interaction of some of these QTLs [14]. In the present study, 31 of 71 genes were on the five chromosomes having QTLs and 12 genes were at the QTL regions. Particularly, the TDF785 (Solyc11g051200.1.1, Cytochrome P450 like_TBP) locating on the QTL region of chromosome 11 was exclusively up-regulated in PI 114490, indicating that this TDF might be associated with the QTL. In addition, although most TDFs showed up-regulated in both PI 114490 and OH 88119, the expression patterns were different. For example, the up-regulation of TDF721 showed a reduction trend at 3, 4, and 5 DPI in PI 114490, but an increase trend in OH 88119 (Fig. 5). Therefore, the regulatory mechanism could also be complicated.

Three pathways, Microbe/Pathogen-Associated Molecular Patterns recognition, effector recognition, and phytohormone pathways, have been proposed for plant immune response. Each pathway involves in interactions among many genes. Phytohormones including salicylic acid (SA), gaseous ethylene (ET), and jasmonic acid (JA) can regulate local and systemic resistance to invasive pathogens [40]. The plant hormone ET is an important component of defense signaling [41], [42]. Genes encoding AP2-like ethylene-responsive transcript factor (AP2/ERF) and 1-aminocyclopropane-1-carboxylate oxidase (ACC) play an important role in response to mechanical damage and symptom development by pathogen attack [35], [43], [44]. Tomato ethylene-responsive transcript factor (ERF) Pti4, Pti5 and Pti6 directly interact with Pto resistance gene [42] and play a role in activation of pathogenesis-related genes, resulting in enhanced defense against certain bacterial and fungal pathogens [45][47]. Based on the annotation, the TDF87 identified in this study is a member of the ERF protein family. It showed different levels of up-regulation in both resistant tomato line PI 114490 and susceptible line OH 88119 during the X. perforans race T3 infection, suggesting that it might contribute to the defense against the pathogen. In addition to its contributing to resistance in some plant-pathogen interactions, ethylene is also involved in chlorosis symptom development. The ethylene -insensitive Arabidopsis and soybean plants showed less chlorosis symptoms than wild-type plants [48], [49]. The TDF721, a member of ACC family, was up-regulated during the pathogen infection in tomato lines PI 114490 and OH 88119. However, the resistant line PI 114490 showed less disease symptom on leaves than the susceptible line OH 88119, which might due to the differential up-regulation of TDF721 in two tomato lines.

Many plant pathogens have evolved virulence strategies to regulate JA signaling pathway in their hosts to facilitate infection and production of disease symptoms [50], [51]. We here identified four up-regulated genes (TDF281, TDF711, TDF741, and TDF744) that might contribute to the regulation of JA biosynthesis during tomato-X. perforans interactions. TDF281 and TDF711 were homologous to different Cytochrome P450 (Table 1). They were induced in both PI 114490 and OH 88119 but the expressions were higher in OH 88119 than in PI 114490 at 4 and 5 DPI (Fig. 5). Blast search revealed that both genes contain allene oxide synthase activity, which is the key enzyme in the JA biosynthesis pathway [52], [53]. TDF741 and TDF744 were annotated as Jasmonate ZIM domain 2 (JAZ2) and Jasmonate ZIM-domain protein 3 (JAZ3), respectively (Table 1). The differentially expressed JAZ genes were also observed in bean-Xanthomonas axonopodis pv. phaseoli interaction [54] and Arabidopsis -Pseudomonas syringae interactions [51]. Characterization of mutants encoding truncated JAZ proteins and RNAi line have demonstrated that some JAZ proteins are both negative regulators of JA signaling and disease symptom development [51], [55], [56]. Therefore, it is very likely that these two TDFs might play important roles in altering JA signaling to impact on symptom development in tomato-X. perforans race T3 interaction.

In summary, response to X. perforans in tomato plants involves a complicated network regulated by a large number of defense/pathogenesis-related genes. Using the cDNA-AFLP technique, a total of 79 TDFs representing 71 genes with different expression patterns during the pathogen infection were identified in this study. Differential expression of several JA- and ET-related genes during the process of the pathogen infection indicates that co-activation of JA and ET signaling pathways may play key roles in response to X. perforans race T3 in tomato plants.

Acknowledgments

The authors would like to thank Dr. David M. Francis in the Department of Horticulture and Crop Science at the Ohio State University for providing the seeds of tomato lines and Dr. Jeffrey B. Jones in the Department of Plant Pathology at the University of Florida for providing race T3 of the bacterial spot pathogen.

Funding Statement

The work was partly supported by National Natural Science Foundation of China (31372073), Specialized Research Fund for the Doctoral Program of Higher Education (20110008110019) and Beijing Modern Agro-industry Technology Research System. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Yang W (2013) Recent advances on genetics and mapping of resistance to bacterial spot in tomato. Acta Hortic Sin 40: 1731–1740. [Google Scholar]
  • 2. Jones JB, Lacy GH, Bouzar H, Minsavage GV, Stall RE, et al. (2005) Bacterial spot - Worldwide distribution, importance and review. Acta Hortic 695: 27–33. [Google Scholar]
  • 3. Jones JB, Bouzar H, Stall RE, Almira EC, Roberts PD, et al. (2000) Systematic analysis of xanthomonads (Xanthomonas spp.) associated with pepper and tomato lesions. Int J Syst Evol Microbiol 50: 1211–1219. [DOI] [PubMed] [Google Scholar]
  • 4. Astua-Monge G, Minsavage GV, Stall RE, Davis MJ, Bonas U, et al. (2000) Resistance of tomato and pepper to T3 strains of Xanthomonas campestris pv. vesicatoria is specified by a plant-inducible. Mol Plant Microbe In 13: 911–921. [DOI] [PubMed] [Google Scholar]
  • 5. Stall RE, Jones JB, Minsavage GV (2009) Durability of resistance in tomato and pepper to Xanthomonads causing bacterial spot. Annu Rev Phytopathol 47: 265–284. [DOI] [PubMed] [Google Scholar]
  • 6. Yang W, Chen J, Zhang X, Francis DM, Yang WC, et al. (2007) Recent advances in classification of tomato bacterial spot pathogen, genetics of resistance, and marker-assisted selection. Sci Agric Sin 40: 283–290. [Google Scholar]
  • 7. Scott JW, Stall RE, Jones JB, Somodi GC (1996) A single gene controls the hypersensitive response of Hawaii 7981 to race 3 (T3) of the bacterial spot pathogen. Rpt Tomato Genet Coop 46: 23. [Google Scholar]
  • 8. Pei C, Wang H, Zhang J, Wang Y, Francis DM, et al. (2012) Fine mapping and analysis of a candidate gene in tomato accession PI128216 conferring hypersensitive resistance to bacterial spot race T3. Theor Appl Genet 124: 533–542. [DOI] [PubMed] [Google Scholar]
  • 9. Sun H, Liu X, Li W, Yang W (2011) Preliminary mapping of a gene in tomato accession LA1589 conferring resistance to race T3 of bacterial spot. J Agr Univ Hebei 34 (6): 65–69. [Google Scholar]
  • 10. Scott JW, Jones JB, Somodi GC (2001) Inheritance of resistance in tomato to race T3 of the bacterial spot pathogen. J Am Soc Hortic Sci 126: 436–441. [Google Scholar]
  • 11. Robbins MD, Darrigues A, Sim S-C, Masud MAT, Francis DM (2009) Characterization of hypersensitive resistance to bacterial spot race T3 (Xanthomonas perforans) from tomato accession PI 128216. Phytopathology 99: 1037–1044. [DOI] [PubMed] [Google Scholar]
  • 12. Scott JW, Francis DM, Miller SA, Somodi GC, Jones JB (2003) Tomato bacterial spot resistance derived from PI 114490; Inheritance of resistance to race T2 and relationship across three pathogen races. J Am Soc Hortic Sci 128: 698–703. [Google Scholar]
  • 13. Hutton SF, Scott JW, Yang W, Sim S-C, Francis DM, et al. (2010) Identification of QTL associated with resistance to bacterial spot race T4 in tomato. Theor Appl Genet 121: 1275–1287. [DOI] [PubMed] [Google Scholar]
  • 14. Sun H, Zhang J, Wang Y, Scott JW, Francis DM, et al. (2011) QTL analysis of resistance to bacterial spot race T3 in tomato. Acta Hortic Sin 38: 2297–2308. [Google Scholar]
  • 15.Sun HJ, Wei JL, Zhang JY, Yang WC (2014) A comparison of disease severity measurements using image analysis and visual estimates using a category scale for genetic analysis of resistance to bacterial spot in tomato. Eur J Plant Pathol DOI 10.1007/s10658-013-0371-8.
  • 16. Gibly A, Bonshtien A, Balaji V, Debbie P, Martin GB, et al. (2004) Identification and expression profiling of tomato genes differentially regulated during a resistance response to Xanthomonas campestris pv. vesicatoria . Mol Plant Microbe In 17: 1212–1222. [DOI] [PubMed] [Google Scholar]
  • 17. Balaji V, Gibly A, Debbie P, Sessa G (2007) Transcriptional analysis of the tomato resistance response triggered by recognition of the Xanthomonas type III effector AvrXv3. Funct Integr Genomics 7: 305–316. [DOI] [PubMed] [Google Scholar]
  • 18. Melech-Bonfil S, Sessa G (2010) Tomato MAPKKKε is a positive regulator of cell-death signaling networks associated with plant immunity. Plant J 64: 379–391. [DOI] [PubMed] [Google Scholar]
  • 19. Melech-Bonfil S, Sessa G (2011) The SlMKK2 and SlMPK2 genes play a role in tomato disease resistance to Xanthomonas campestris pv. vesicatoria . Plant Signal Behav 6: 154–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Vuylsteke M, Peleman JD, van Eijk MJT (2007) AFLP-based transcript profiling (cDNA-AFLP) for genome-wide expression analysis. Nat Protoc 2: 1399–1413. [DOI] [PubMed] [Google Scholar]
  • 21. Daurelio LD, Petrocelli S, Blanco F, Holuigue L, Ottado J, et al. (2011) Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. J Plant Physiol 168: 382–391. [DOI] [PubMed] [Google Scholar]
  • 22. Dinari A, Niazi A, Afsharifar AR, Ramezani A (2013) Identification of upregulated genes under cold stress in cold-tolerant chickpea using the cDNA-AFLP approach. Plos One 8: 52757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Santaella M, Suarez E, Lopez C, Gonzalez C, Mosquera G, et al. (2004) Identification of genes in cassava that are differentially expressed during infection with Xanthomonas axonopodis pv. manihotis . Mol Plant Pathol 5: 549–558. [DOI] [PubMed] [Google Scholar]
  • 24. Reijans M, Lascaris R, Groeneger AO, Wittenberg A, Wesselink E, et al. (2003) Quantitative comparison of cDNA-AFLP, microarrays, and GeneChip expression data in Saccharomyces cerevisiae . Genomics 82: 606–618. [DOI] [PubMed] [Google Scholar]
  • 25. Gabriëls SHEJ, Takken FLW, Vossen JH, de Jong CF, Liu Q, et al. (2006) cDNA-AFLP combined with functional analysis reveals novel genes involved in the hypersensitive response. Mol Plant Microbe In 19: 567–576. [DOI] [PubMed] [Google Scholar]
  • 26. Polesani M, Desario F, Ferrarini A, Zamboni A, Pezzotti M, et al. (2008) cDNA-AFLP analysis of plant and pathogen genes expressed in grapevine infected with Plasmopara viticola . BMC Genomics 9: 142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Lin YT, Jan FJ, Lin CW, Chung CH, Chen JC, et al. (2013) Differential gene expression in response to Papaya ringspot virus infection in Cucumis metuliferus using cDNA-amplified fragment length polymorphism analysis. Plos One 8: e68749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lelliot RA, Stead DE (1987) Methods for the diagnosis of bacterial diseases of plants. Blackwell Scientific Publication Ltd., Oxford.
  • 29. Bachem CWB, Oomen R, Visser RGF (1998) Transcript imaging with cDNA-AFLP: A step-by-step protocol. Plant Mol Biol Rep 16: 157–173. [Google Scholar]
  • 30. Chen J, Wang H, Shen H, Chai M, Li J, et al. (2009) Genetic variation in tomato populations from four breeding programs revealed by single nucleotide polymorphism and simple sequence repeat markers. Sci Hortic 122: 6–16. [Google Scholar]
  • 31. Chen ZZ, Xue CH, Zhu S, Zhou FF, Ling XFB, et al. (2005) GoPipe: Streamlined Gene Ontology annotation for batch anonymous sequences with statistics. Prog Biochem Biophys 32: 187–190. [Google Scholar]
  • 32.Ye J, Fang L, Zheng H, Zhang Y, Chen J, et al.. (2006) WEGO: a web tool for plotting GO annotations. Nucleic Acids Res 34 (web service issue): 293–297. [DOI] [PMC free article] [PubMed]
  • 33. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C-T method. Nat Protoc 3: 1101–1108. [DOI] [PubMed] [Google Scholar]
  • 34. Sheng J, Mehdy MC (1993) Isolation and characterization of a cDNA clone encoding a small wound-inducible protein from Phaseolus vulgaris. Plant Physiol 101: 1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Balaji V, Mayrose M, Sherf O, Jacob-Hirsch J, Eichenlaub R, et al. (2008) Tomato transcriptional changes in response to Clavibacter michiganensis subsp. michiganensis reveal a role for ethylene in disease development. Plant Physiol 146: 1797–1809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Nicot N, Hausman JF, Hoffmann L, Evers D (2005) Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J Exp Bot 56: 2907–2914. [DOI] [PubMed] [Google Scholar]
  • 37. Orlowska E, Fiil A, Kirk H-G, Llorente B, Cvitanich C (2012) Differential gene induction in resistant and susceptible potato cultivars at early stages of infection by Phytophthora infestans . Plant Cell Rep 31: 187–203. [DOI] [PubMed] [Google Scholar]
  • 38. Thieme F, Koebnik R, Bekel T, Berger C, Boch J, et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J Bacteriol 187: 7254–7266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Potnis N, Krasileva K, Chow V, Almeida NF, Patil PB, et al.. (2011) Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper. BMC Genomics 12. [DOI] [PMC free article] [PubMed]
  • 40. Panstruga R, Parker JE, Schulze-Lefert P (2009) SnapShot: Plant immune response pathways. Cell 136: 978.e1–3. [DOI] [PubMed] [Google Scholar]
  • 41. Broekaert WF, Delaure SL, De Bolle MFC, Cammue BPA (2006) The role of ethylene in host-pathoven interactions. Annu Rev Phytopathol 44: 393–416. [DOI] [PubMed] [Google Scholar]
  • 42. Zhou JM, Tang XY, Martin GB (1997) The Pto kinase conferring resistance to tomato bacterial speck disease interacts with proteins that bind a cis-element of pathogenesis-related genes. EMBO J 16: 3207–3218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Abeles FB, Morgan PW, Saltveit ME Jr (1992) Ethylene in Plant Biology, Second edition. Academic Press, London.
  • 44. O'Donnell PJ, Schmelz EA, Moussatche P, Lund ST, Jones JB, et al. (2003) Susceptible to intolerance - a range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant J 33: 245–257. [DOI] [PubMed] [Google Scholar]
  • 45. Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang CM, et al. (2002) Tomato transcription factors Pti4, Pti5, and Pti6 activate defense responses when expressed in Arabidopsis. Plant Cell 14: 817–831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Gu YQ, Martin GB (1998) Molecular mechanisms involved in bacterial speck disease resistance of tomato. Philos Trans R Soc Lond B Biol Sci 353: 1455–1461. [Google Scholar]
  • 47. Gu YQ, Yang C, Thara VK, Zhou J, Martin GB (2000) Pti4 is induced by ethylene and salicylic acid, and its product is phosphorylated by the Pto kinase. Plant Cell 12: 771–785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Bent AF, Innes RW, Ecker JR, Staskawicz BJ (1992) Disease development in ethylene-insensitive arabidopsis-thaliana infected with virulent and avirulent Pseudomonas and Xanthomonas pathogens. Mol Plant Microbe In 5: 372–378. [DOI] [PubMed] [Google Scholar]
  • 49. Hoffman T, Schmidt JS, Zheng XY, Bent AF (1999) Isolation of ethylene-insensitive soybean mutants that are altered in pathogen susceptibility and gene-for-gene disease resistance. Plant Physiol 119: 935–949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Grant MR, Jones JDG (2009) Hormone (dis)harmony moulds plant health and disease. Science 324: 750–752. [DOI] [PubMed] [Google Scholar]
  • 51. Demianski AJ, Chung KM, Kunkel BN (2012) Analysis of Arabidopsis JAZ gene expression during Pseudomonas syringae pathogenesis. Mol Plant Pathol13: 46–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Froehlich JE, Itoh A, Howe GA (2001) Tomato allene oxide synthase and fatty acid hydroperoxide lyase, two cytochrome P450s involved in oxylipin metabolism, are targeted to different membranes of chloroplast envelope. Plant Physiol 125: 306–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Wasternack C (2007) Jasmonates: An update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann Bot 100: 681–697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Shi C, Chaudhary S, Yu K, Park SJ, Navabi A, et al. (2011) Identification of candidate genes associated with CBB resistance in common bean HR45 (Phaseolus vulgaris L.) using cDNA-AFLP. Mol Biol Rep 38: 75–81. [DOI] [PubMed] [Google Scholar]
  • 55. Chung HS, Howe GA (2009) A critical role for the TIFY motif in repression of Jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-Domain protein JAZ10 in Arabidopsis . Plant Cell 21: 131–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Chung HS, Cooke TF, DePew CL, Patel LC, Ogawa N, et al. (2010) Alternative splicing expands the repertoire of dominant JAZ repressors of jasmonate signaling. Plant J 63: 613–622. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES