Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2014 Apr 3;2014:135218. doi: 10.1155/2014/135218

Phylogenetic Analysis of Entomoparasitic Nematodes, Potential Control Agents of Flea Populations in Natural Foci of Plague

E I Koshel 1,*, V V Aleshin 2,3,4, G A Eroshenko 1, V V Kutyrev 1
PMCID: PMC3996313  PMID: 24804197

Abstract

Entomoparasitic nematodes are natural control agents for many insect pests, including fleas that transmit Yersinia pestis, a causative agent of plague, in the natural foci of this extremely dangerous zoonosis. We examined the flea samples from the Volga-Ural natural focus of plague for their infestation with nematodes. Among the six flea species feeding on different rodent hosts (Citellus pygmaeus, Microtus socialis, and Allactaga major), the rate of infestation varied from 0 to 21%. The propagation rate of parasitic nematodes in the haemocoel of infected fleas was very high; in some cases, we observed up to 1,000 juveniles per flea specimen. Our study of morphology, life cycle, and rDNA sequences of these parasites revealed that they belong to three distinct species differing in the host specificity. On SSU and LSU rRNA phylogenies, these species representing three genera (Rubzovinema, Psyllotylenchus, and Spilotylenchus), constitute a monophyletic group close to Allantonema and Parasitylenchus, the type genera of the families Allantonematidae and Parasitylenchidae (Nematoda: Tylenchida). We discuss the SSU-ITS1-5.8S-LSU rDNA phylogeny of the Tylenchida with a special emphasis on the suborder Hexatylina.

1. Introduction

More than 150 species of fleas feeding on different mammalian hosts, primarily rodents, are vectors of the bacterium Yersinia pestis, a causative agent of plague [1, 2]. In natural foci of plague, the dynamics of flea populations are among the main factors controlling the incidence of epizootics that pose a threat to humans inhabiting the areas [3–5]. Entomoparasitic nematodes of the order Tylenchida are known to control populations of various insect hosts [6–9]. The rate of tylenchid infestation in fleas reaches 50–60% in some cases [10, 11], when the nematodes cause castration and early death of the flea hosts [9, 12, 13].

Despite high importance of the Tylenchida as a nematode order harboring entomoparasites and notorious crop pests, their reliable phylogeny is still a challenge. Tylenchid nematodes differ widely in life cycle, parasitic strategies, and the host range that spans plants, fungi, and invertebrates. Phylogenies obtained from SSU and partial LSU rDNA data often disagree with classifications based on morphology and life cycle [14–21]. Phylogenetic resolution inside the order is far from being clear, which in many respects results from the insufficiency of data available to adequately describe its diversity. As for tylenchid parasites of fleas, only 31 species are described to date [9, 22–31], with no molecular vouchering. Here we present a study of parasitic nematodes isolated from fleas sampled from different rodent hosts in a natural focus of plague.

2. Materials and Methods

2.1. Collection of Samples

Samples were collected in 2012 (spring and autumn) and 2013 (spring) in the Volga-Ural natural focus of plague (Figure 1). The sampled rodents included sousliks (Citellus pygmaeus), mouse-like rodents (Microtus socialis and Apodemus uralensis), and jerboas (Allactaga major). Three flea species (Citellophilus tesquorum, Neopsylla setosa, and Frontopsylla semura) were sampled on sousliks; two species (Amphipsylla rossica and Ctenophthalmus secundus) were on M. socialis voles; and one species (Mesopsylla hebes) was on jerboas. Fleas were examined for nematode infestation (Table 1). Examination and dissection of fleas were carried out using the dissecting microscope MBS-2 (LOMO, Russia). A half of parasitic nematodes sampled from each flea was preserved for subsequent DNA extraction, and another half was used for morphological analysis. Live fleas infected with nematodes were placed in glass flasks with river sand to obtain free-living forms. Insects were kept in a KBF 720 (E5.2) climate chamber (Binder, Germany) at 26°C and 80% humidity.

Figure 1.

Figure 1

The sampling region on the map of Europe.

Table 1.

Number of fleas studied and the percentage of fleas infected with nematodes.

Time of sampling Host rodent species Flea species Number of collected fleas Number of infected fleas Percentage of infected fleas
April 2012 Citellus pygmaeus Citellophilus tesquorum 41 7 17.1%
Neopsylla setosa 73 5 6.8%
Frontopsylla semura 54 7 13%

October 2012 Microtus socialis Amphipsylla rossica 135 9 6.7%
Ctenophthalmus secundus 88 1 1.1%

April 2013 Citellus pygmaeus Citellophilus tesquorum 34 0 0
Neopsylla setosa 271 22 8.1%
Frontopsylla semura 19 4 21%
Microtus socialis and Apodemus uralensis Amphipsylla rossica 6 0 0
Ctenophthalmus secundus 52 0 0
Allactaga major Mesopsylla hebes 34 2 5.9%

2.2. Morphological Analysis

Fixation and clarification of nematode preparations were performed using standard techniques described by De Grisse [32]. Material was mounted on slides in a drop of glycerin, bound by a paraffin circlet (http://pest.cabweb.org). Color staining of preparations was not performed. Morphometric analysis was conducted using the light microscope “Leica DM 1000” (Leica, Germany) with an eyepiece micrometer. Pictures of nematodes were taken with the microscope “DFC 425” (Leica, Germany). Published data on morphometrics [23, 25, 26] were used for comparison.

2.3. DNA Extraction, PCR, and Sequencing

DNA samples were extracted with a Diatom DNA Prep (IsoGen Lab, Russia). rDNA fragments were amplified using an Encyclo PCR kit (Evrogen, Russia) and primers given in Table 2. The amplified rDNA fragments were sequenced using an Applied Biosystems 3500xL DNA analyzer. Sequence reads were assembled with the CAP contig assembly program [33] and proofread with the BioEdit software [34]. For three isolates, almost complete sequences of 18S and 28S rRNA and complete sequences of 5.8 rRNA, internal transcribed spacers ITS1 and ITS2 were assembled. The sequences were submitted to GenBank under accession nos. KF155281–KF155283. For the rest of isolates, partial (750–800 bp) sequences of 18S and 28S rRNA genes were submitted to GenBank under accession nos. KF373731–KF373740.

Table 2.

Nucleotide sequences of primers used in this study.

Primer Sequence Orientation References
Nik22 tmycygrttgatyctgyc F This study
A gtatctggttgatcctgccagt F [35]
Q5nemCh gccgcgaayggctcattayaac F This study
G18SU gcttgtctcaaagattaagcc F [36]
Ves18-d9 gtcgtaacaaggtatccgtaggtgaac F This study
R18Tyl1 ggtccaagaatttcacctctc R [36]
B gtaggtgaacctgcagaaggatca R [35]
Q39nem gaaaccttgttacgacttttrcbygg R This study
58d1 rcatcgatgaagaacgywg F [37]
58r nem gcwgcgttcttcatcgacyc R This study
28d3 gtcttgaaacacggaccaagg F [37]
28d6 ggtyagtcgrtcctrag F [37]
D2A acaagtaccgtgagggaaagttg F [38]
28r4 gctatcctgagggaaacttcgg R [37]
28r2nem cggtacttgttcgctatcg R This study
28r7 agccaatccttwtcccgaagttac R [37]
28r12 ttctgacttagaggcgttcag R [37]
D3B tcggaaggaaccagctacta R [38]

2.4. Phylogenetic Analysis

The newly obtained rDNA sequences of tylenchid parasites of fleas were aligned with a selected set of other tylenchid sequences obtained from the GenBank. The main selection criterion was to sample representatives of all clades that occur in published SSU and LSU rDNA phylogenies of the Tylenchida [16–21, 39]. Apart from the D2-D3 LSU rDNA expansion segment commonly used in previous studies, we included all LSU rDNA sequence data available for the Tylenchida, with the exception of Basiria sp. SAN-2005 (accession nos. DQ145619, DQ145667) that in our preliminary analyses (data not shown) demonstrated a disputable affinity to the Tylenchida. For the species Anguina tritici, Globodera pallida, Heterodera glycines, Pratylenchus vulnus, and Radopholus similes the nearly complete rDNA sequences were assembled with appropriate cDNA fragments identified with BLAST [40]. Partial LSU rDNA sequence of Ditylenchus dipsaci was combined with the soil environmental clone NTS_28S_061A_2_b4 (accession no. KC558346), as the clone sequence appeared to represent a close tylenchid relative of D. dipsaci. Chimeric sequences were also created in some cases when closely related partial rDNA sequences were found in the database. All sequences and their accession numbers are listed in Table 3. Cephalobidae and Chambersiellidae were chosen as the outgroup. Alignments were constructed with the MUSCLE program [41] and refined manually using the MEGA 5.0 software package [42]. Three alignments were generated: (1) SSU rDNA, (2) D3 region of LSU rDNA, and (3) concatenated rDNA data including SSU, LSU, 5.8S rDNA, and highly conserved regions of ITS1. After discarding ambiguously aligned positions, the alignments length was 1,723, 592, and 4,930 positions, respectively. Bayesian reconstruction of phylogeny was done with the PhyloBayes software, version 3.2 [43] under the GTR + CAT + DP model [44]. Eight independent runs were performed with 4,000,000 cycles each; the first 3,000,000 cycles were discarded. A consensus tree with Bayesian posterior probabilities was constructed for the remained tree sample. Bayesian reconstruction was also performed using the MrBayes software [45] under the GTR + G8 + I model [46] in two independent runs, each with four Markov chains. The chains were run for 5,000,000 generations, with trees sampling every 1,000th generation. The consensus posterior probabilities were calculated after discarding the first 3,000,000 generations. Partitioning “by genes” was used for the concatenated alignment with all parameters unlinked, except for the topology and branch lengths. In addition, node support was estimated with maximum likelihood bootstrap as implemented in the RAxML software, version 7.2.6 [47], under the GTR + G + I model with 1,000 bootstrap replicates. Alternative topologies were tested using the approximately unbiased (AU) [48] and Kishino and Hasegawa [49] tests implemented in the CONSEL software [50] and the expected likelihood weight test [51] implemented in the TREE-PUZZLE software [52]. TREEVIEW [53] was used as the tree viewer and editor, and site-wise log-likelihoods were computed with TREE-PUZZLE under the GTR + G8 + I model with substitution matrix parameters estimated by MrBayes.

Table 3.

List of OTUs and accession numbers of sequences.

Name 18S rRNA ITS1-5.8S 
rRNA
28S rRNA %, SSU-ITS1- 
5.8S-LSU/D3
Reference Family by [8]
Chambersiellidae∗
Fescia grossa KC242218 — DQ145636 DQ145684 87.1/— [54]
[55]
Chambersiellidae
Geraldius sp. SAN-2010a — — GU062821 17.8/— [56] Chambersiellidae

Cephalobidae
Acrobeloides maximus EU196016 JX026706 EU195987 94.8/— [57]
[58]
[57]
Cephalobidae
Cephalobus cubaensis AF202161 AF202161 EU253570 89.8/— [59]
[57]
Panagrolobus sp. SN-2010 — — HM439771 51.9/— [60]
Cephalobidae Gen. sp.
MHMH-2008
FJ040406 — — Holterman et al., 2008, unpublished.
Zeldia punctata — DQ146426 EU195988 96.6/— [61]
[57]
Zeldia sp. AY284675 — —  

Aphelenchidae
Aphelenchus avenae JQ348399 AF119048 — 96.9/— [62]
[63]
Aphelenchidae
Aphelenchus sp. — — DQ145664 DQ145714 [55]
Paraphelenchus acontioides — — HQ218322 45.5/— [64]
Paraphelenchus sp. AY284642 — — [18]

Hexatylina + “Anguinata (part)”: Iotonchioidae
Allantonema mirable — — JX291132 10.6/85.8 [39] Allantonematidae
Bradynema listronoti DQ915805   DQ915804 45.6/96.8 [65]
Bradynema rigidum     DQ328730 10.4/86.3 [20]
Contortylenchus sp. — — DQ328731 —/85.4 [20]
Deladenus durus JQ957898 — — 34.0/— [66] Neotylenchidae
Deladenus proximus JF304744 JF304744 — 35.2/— [67]
Deladenus siricidicola isolate 354 AY633447   AY633444 45.8/98.1 [68]
Deladenus siricidicola isolate 466 FJ004890 FJ004890 — 41.7/— [69]
Deladenus siricidicola isolate 1093 FJ004889 FJ004889 — 42.0/— [69]
Fergusobia camaldulensae AY589294 — AY589346 45.7/98.0 [68]
Fergusobia sp. 444 EF011667 — EF011675 45.7/97.3 [68]
Fergusobia sp. SBG FJ393270 — FJ386996 45.7/98.3 [70]
cf. Gymnotylenchus sp. TSH-2005 AY912040 — — 12.9/— Powers et al., unpublished.
Howardula aoronymphium AY589304 AY589304 AY589395 49.7/96.1 [68] Allantonematidae
Howardula dominicki AF519234 AF519234 — 37.4/— [71]
Howardula neocosmis AF519226 AF519226 — 38.2/— [71]
Howardula phyllotretae JX291137 — DQ328728 41.9/86.1 [39]
[20]
Howardula sp. CD353 — — JX291131 —/93.9 [39]
Howardula sp. SP-A AF519232 AF519232 — 37.7/— [71]
Howardula sp. SP-F AF519222 AF519222 — 38.2/— [71]
Howardula sp. SP-MA AF519233 AF519233 — 38.1/— [71]
Howardula sp. SP-PS AF519231 AF519231 — 38.1/— [71]
Parasitylenchus  bifurcatus KC875397 —   44.0/85.3 [72]  
Parasitylenchus sp. — — DQ328729 [20]  
Psyllotylenchus sp. ex Frontopsylla semura KF373734 — KF373739 27.1/93.7 This study Parasitylenchidae
Psyllotylenchus sp. ex Neopsylla setosa KF373733 — KF373738 27.1/93.7 This study
Rubzovinema sp. ex Amphipsylla rossica KF155281 KF155281 KF155281 90.0/100.0 This study Neotylenchidae
Rubzovinema sp. ex Ctenophthalmus cecundus KF155282 KF155282 KF155282 89.8/100.0 This study
Rubzovinema sp. ex Citellophilus tesquorum KF155283 KF155283 KF155283 93.2/100.0 This study
Rubzovinema sp. ex Frontopsylla semura KF373732 — KF373737 27.1/93.7 This study
Rubzovinema sp. ex Neopsylla setosa KF373731 — KF373736 27.1/93.7 This study
Skarbilovinema laumondi — — JX291136 10.9/91.0 [39] Iotonchioidea
Skarbilovinema lyoni JX291138 — DQ328733 41.8/86.3 [39]
[20]
Spilotylenchus sp. ex Mesopsylla hebes KF373735 — KF373740 27.1/93.4 This study Parasitylenchidae
cf. Sychnotylenchus sp. CSP1-09 DQ080531 — — 12.9/— Powers et al., unpublished. Sychnotylenchidae
Wachekitylenchus bovieni — — DQ328732 —/85.9 [20] Parasitylenchidae
Unidentified Allantonematidae HaMW JQ941710 — — 18.5/— Rhule, unpublished. Allantonematidae
Unidentified Allantonematidae NK2011_2 AB663183 — — 12.0/— [73]
Unidentified Allantonematidae NK2011_3 AB663184 — — 12.0/— [73]
Unidentified nematode 804U-025 EU880149 — — 12.0/— [74]
Unidentified nematode CD289 — — JX291133 —/84.1 [39]  
Unidentified nematode RGD591T12 AB455970 — — 12.0/— [73]  
Unidentified nematode WY2009_BAR-1 — — FJ661075 —/96.3 [75]  
Unidentified parasite ex Chrysobothris affinis — — DQ202658 —/51.0 Hunt et al., unpublished.  

Hexatylina + “Anguinata (part)”: Sphaerularioidea
Deladenus sp. PDL-2005 AJ966481 — — 35.0/— [16] Neotylenchidae
cf. Helionema sp. MHMH-2008 EU669913 — — 34.0/— [19] Parasitylenchidae (genera dubia in Hexatylina)
cf. Hexatylus sp. Westplace AY912050 — — 12.9/— Powers et al., unpublished. Neotylenchidae
Nothotylenchus acris AY593914 — — 34.0/— [76] Anguinidae
Sphaerularia bombi AB250212 — DQ328726 56.7/100.0 Takahashi, unpublished.
[20]
Sphaerulariidae
Sphaerularia vespae AB300595 AB300595 AB300596 54.7/100.0 [77]
Unidentified nematode 801L-022 EU880129 — — 12.1/— [74]  

Anguinata
Anguina tritici AY593913 JF826515 HO058555 DQ328723 57.6/92.9 Holterman et al., unpublished.
Rao and Rao, unpublished.
Rao et al., unpublished.
[20]
Anguinidae
Ditylenchus adasi EU669909 — — 34.6/— [19]
Ditylenchus angustus AJ966483 — — 34.6/— [16]
Ditylenchus destructor   JX162205   50.0/99.5 [78]
Ditylenchus dipsaci AY593911 AY593911 JF327759 60.9/100.0 [76]
Zhao 2011, unpublished.
clone NTS_28S_061A_2_b4     KC558346 [79]
Ditylenchus drepanocercus JQ429768 JQ429774 JQ429772 48.7/89.3 [80]
Ditylenchus halictus AY589297     52.8/97.3 [68]
Ficotylus congestae EU018049     45.6/97.5 [81]
Halenchus fucicola EU669912 — — 34.6/— [19]
Pseudhalenchus minutus AY284638     34.6/— [19]
Unidentified entomoparasitic nematode SAS-2006 “Neotylenchus” sp. — — DQ328725 —/85.6 [20]

“Tylenchina”: Tylenchidae
Aglenchus agricola FJ969113 — — 46.0/— van Megen et al., unpublished. Tylenchidae
Aglenchus sp. — — JQ004996 [82]
Coslenchus costatus AY284581 — — 45.5/—  [18]
Coslenchus sp. — — JQ005007 [82]
Filenchus annulatus JQ814880 — JQ005017 46.4/— [82]
Tylenchus davainei AY284588 — — 33.9/— [18]

“Tylenchina”: Tylodoridae
Eutylenchus excretorius EU915487 EU915500 EU915490 35.8/— [83] Atylenchidae
Cephalenchus hexalineatus AY284594 — — 44.1/— [18] Tylodoridae

“Tylenchina”: Boleodoridae
Basiria gracilis EU130839 — DQ328717 44.6/— [84]
[20]
Tylenchidae
Basiria sp. 3 TJP-2012 — — JQ004998 12.0/— [82]
Boleodorus thylactus AY993976 — — 46.7/—  [16]
Boleodorus sp. — — JQ005001 [18]
Neopsilenchus magnidens AY284585 — — 45.6/—  [18]
Neopsilenchus sp. 3 TJP-2012 — — JQ005020 [82]
Neopsilenchus sp. 1 TJP-2012 — — JQ005018 11.9/— [82]

“Hoplolaimina”: Merliniidae
Nagelus leptus — — DQ328715 45.2/—  [20] Telotylenchidae
Nagelus obscurus EU306350 — — [17]
Pratylenchoides ritteri AJ966497 — JX261964 48.7/—  [16]
[85]
Pratylenchidae
Psilenchus cf. hilarulus AY284593 — EU915489 44.1/— [18]
[83]
Psilenchidae
Scutylenchus quadrifer AY284599 — — 41.5/—  [18] Telotylenchidae
Scutylenchus sp. — JQ069956 — [86]

“Tylenchina”: Ecphyadophoridae
Ecphyadophora sp. JH-2004 AY593917 — — 33.7/— [76] Ecphyadophoridae
“Ditylenchus” brevicauda AY284635 — — 33.9/— [18] Anguinidae
Malenchus andrassyi AY284587 — — 32.3/— [18] Tylenchidae
Ottolenchus discrepans AY284590 — — 33.7/— [18]

Criconematina
Hemicriconemoides gaddi — KC520471 KC520470 55.6/—  [87] Criconematidae
Hemicriconemoides pseudobrachyurus AY284622 — — [18]
Hemicycliophora lutosa — GQ406237 GQ406240 53.2/—  [88] Hemicycliophoridae
Hemicycliophora thienemanni AY284628 — — [18]
Meloidoderita kirjanovae — DQ768427 DQ768428 50.8/— [89] Sphaeronematidae
Sphaeronema alni FJ969127 — — van Megen, unpublished.
Meloidoderita sp. GU253916 GU253917 JQ771954 50.8/— [90]
Cudejkova and Cermak, unpublished.
Tylenchulus semipenetrans AJ966511 FJ588909 FJ969710 57.5/— [16] 
[91] 
[92]
Tylenchulidae

“Hoplolaimina”: Belonolaimidae
Belonolaimus longicaudatus AY633449 DQ672366 GQ896548 55.8/— [68]
[93]
[94]
Belonolaimidae
Ibipora lolii JQ771535 — — 30.9/— [95]

“Hoplolaimina”: Hoplolaimidae
Carphodorus sp. JQ771538 — JQ771550 41.3/— [95]
Globodera pallida EU855119 EU85511 BM415342
BM415248
CV577211
CV577977
CV579301E
U85511
93.6/— Nowaczyk et al., unpublished.
Opperman, unpublished 
[96].
Heteroderidae
Heterodera glycines AF216579
BI704127
BI748392
CA940548
CB379240
CB379263
CB379850
CB380242
CB825296
CB825409
CB825970
CB935610
CK348871
CK348904
CK349175
CK352112
AF216579 AF133304
AF216579
BI704144
BI704144
BI749520
CA940190
CA940212
CA940243
CA940406
CA940424
CA940429
CA940589
CB238697
CB279977
CB299455
CB373844
CB373981
CB379125
CB379140
CB379219
CB379312
CB379439
CB379505 
CB379696
CB379707
CB379996
CB380091
CB380241
CB824788
CB824878
CB825995
CB934877
CB934931
CB934950
CB934954
CK348525
CO036619
HM560850
JN684906
98.3/— [97] 
[96].
[98] 
Yan and Davis, unpublished.
[99]
Ye et al., unpublished.
Wei et al.,
unpublished.
Morulaimus sp. JQ771540 — — 31.5/— [95] Belonolaimidae
Radopholus similis AJ966502
AY912509
EF384224
EY190988
EY191076
EY191697
EY191883
EY192786
EY192788
EY193123
EY193253
EY194340
EY194464
EY194646
EY195472
FJ040398
AY912509 
EF384224
EU555409
EY189839
EY190550
EY190620
EY190961
EY191066
EY191073
EY191135
EY191160
EY191173
EY191237
EY192021
EY192028
EY192080
EY192091
EY192247
EY192381
EY192472
EY192501
EY192526
EY192892
EY192907
EY193005
EY193037
EY193249
EY193314
EY193798
EY193897
EY193971
EY194395
EY194454
EY194530
EY195146
EY195204
97.5/— [16]
[100]
Long et al., unpublished.
[101] 
Holterman et al., unpublished.
[102] 
[100]
Zhao unpublished.
[86]
Pratylenchidae
EY195406
EY195408
EY195580
EY195889
EY195943
GQ281471
JN091962
JQ782249
Rotylenchulus reniformis JX406356 FJ374686 HM131884
FJ906072
59.4/— [103]
Rahman et al., unpublished.
[104]
Rotylenchulidae

“Hoplolaimina”: Pratylenchidae
Dolichodorus sp. WY-2006 DQ912918 — — 33.9/— [105] Dolichodoridae
Hirschmanniella loofi EU306353 EU620472 EU620469 51.6/— [17]
[106]
Pratylenchidae
Macrotrophurus arbusticola AY284595 —   33.9/— [18] Telotylenchidae
Meloidogyne arenaria U42342 U42342 U42342
AF023855
AF023856
99.2/— Georgi and Abbott, unpublished. Meloidogynidae
Meloidogyne artiellia AF248477 AF248477 AF248477 99.2/— [107]
Nacobbus aberrans AJ966494 DQ017473 U47557 49.0/— [16]
[108]
[109]
Pratylenchidae
Pratylenchus vulnus EU669955 JQ966892 BQ580554
CV198923
CV198995
CV199233
CV199349
CV199490
CV200136
CV200423
CV200464
CV200467
CV200471
CV200530
CV200687
CV200896
CV201004
CV201135
EL887566
EL887705
EL888035
EL888060
EL888174
EL888269
EL888739
EL888778
EL889241
EL889472
EL889797
EL889934
EL889934
EL889977
EL889994
EL890380
EL890701
JQ003993
JQ003994
JX047008
100.0/— [19]
[110] 
[96] 
[96]
[111]
Zhao, unpublished.
[112]
Tylenchorhynchus dubius EU306352 — DQ328707 53.2/— [17]
[20]
Telotylenchidae
Tylenchorhynchus zeae — EF519711 — [113]

*Clades of the tree, marked by boldface.

3. Results

3.1. Infestation of Fleas with Nematodes

The infestation rate is shown in Table 1 (in total, 807 flea specimens were studied). Among the six flea species studied, the population size and the percentage of infected fleas varied depending on the season. Three flea species sampled on sousliks (Citellophilus tesquorum, Neopsylla setosa, and Frontopsylla semura) exhibited a stable population density. In the two species, N. setosa and F. semura, the infestation rate was moderate to high in the spring seasons of 2012 and 2013. In C. tesquorum, no infected fleas were detected in spring 2013, whereas in spring 2012 the fleas were highly infested (17.1%). The vole flea Amphipsylla rossica was abundant and moderately infested in autumn, whereas being less abundant in spring, which may explain the absence of infected fleas in the spring sample. Another vole flea, Ctenophthalmus secundus, exhibited a consistently high population density and low infestation rate in both spring and autumn samples.

Adult parasitic females and their progeny were found in the haemocoel of infected fleas. In the infected fleas C. tesquorum, A. rossica, C. secundus, and Mesopsylla hebes, only one generation of parasitic females was observed. Their amount in a flea specimen is determined by the number of free-living infective females that penetrate into the flea larva. We observed 1 to 2 or 1 to 4 adult parasitic females per flea specimen in spring and autumn, respectively. An additional parthenogenetic generation of parasitic females was found in some fleas of N. setosa and F. semura, where up to 16 specimens per flea were observed. As in other entomoparasitic nematodes, the propagation rate depends on the host age. Thus, in young fleas up to 10 juveniles was found per flea specimen, whereas up to 1,000 juveniles of different stages were contained in some old fleas (Figure 2). After the 2nd molt the number of juveniles is maximal, and 3rd stage juveniles massively migrate to the rectal section of the flea intestine for exit to the environment. In some cases, the observed infestation level was so high that nematodes penetrated distal segments of the flea legs, from where they have no way to the environment.

Figure 2.

Figure 2

Numerous juveniles of Rubzovinema sp. extracted from the dissected body of a Citellophilus tesquorum flea.

3.2. Morphological Analysis of Entomoparasitic Stages in Nematode Isolates and Their Taxonomic Identification

Analysis of morphology of entomoparasitic stages suggests that the studied nematode isolates from three distinct groups. A single generation of parasitic females was observed in the first two groups and an additional parthenogenetic generation—in the third group. According to morphometric data on adult parasitic females (Tables 4–6), the first two groups belong to the genera Rubzovinema or Spilotylenchus and the third group to the genus Psyllotylenchus. Photographs of parasitic females of Rubzovinema sp., Spilotylenchus sp., and Psyllotylenchus sp. are depicted in Figure 3. Figure 4 shows their distribution among flea samples studied.

Table 4.

Comparison of morphometrics in parasitic females of Rubzovinema sp. and Rubzovinema  ceratophylla.

Character Rubzovinema sp. (this study) Rubzovinema ceratophylla [26]
N 29 27
L 1278,6 (840–1570) 1265,1 (810–1840)
D 120,8 (85–145) 137,3 (62–200)
A 11,19 (7,9–16,1) 9,51 (6,4–16,8)
C 65,4 (31,4–100) 44,10 (10–86,4)
V% 96,4 (93,1–97,9) 95,44 (92–98,9)
Total length of stylet (St) 18,5 (14–22) 19,5 (18–21)
Length of distal edge of stylet 7,2 (5–8,7) —
Distance between anterior end and excretory pore (Ex) 20,7 (10–31) —
Distance between anterior end and nerve ring 61,2 (50–74,5)  
Total length of tail (Cd) 21,9 (10–42) 26,35 (14–47,5)
Distance between vulva and tail end 46,1 (23–75) —
Distance between vulva and anus (V–A) 26,9 (13–40) —

All measurements are in μm and in the form mean (range).

Table 6.

Comparison of morphometrics of parasitic females in Psyllotylenchus sp. and Psyllotylenchus viviparous.

Character Psyllotylenchus sp. (this study) Psyllotylenchus viviparous [25]
Gamogenetic Parthenogenetic Gamogenetic Parthenogenetic
N 3 7 8 10
L 1,016.7 (900–1,100) 446 (420–500) 1,000 (840–1,480) 500 (360–840)
D 81.3 (79–84) 70 (60–80) 77 (62–115) 60 (54–100)
A 12.5 (11.1–13.3) 6.25 (5.6–7) — —
C 64.3 (60–68.2) 40.15 (37.1–43.5) — —
V% 95.1 (95–95.4) 93.3 (90–95.3) — —
Total length of stylet (St) 17.5 (17–18,5) 5.25 (4–6) 17 (15–20) 7 (5–8)
Length of the distal edge of stylet 8.6 (8-9) — — —
Distance between anterior end and excretory pore 26.5 (25–31.5) 17.5 (15–19.5) 23 (13–33) 22 (14–46)
Distance between anterior end and nerve ring — 51.7 (50–55) — —
Total length of tail (Cd) 15.8 (15–17) 11.1 (10.5–11.5) 25 (17–35) 9 (1–17)
Distance between vulva and tail end 48 (45–51) 30.5 (19.7–55) 56 (37–71) 52 (40–104)
Distance between vulva and anus (V–A) 30.8 (29–31.5) 13.5 (11.7–21.6) — —

All measurements are in μm and in the form mean (range).

Figure 3.

Figure 3

Parasitic females of the studied nematode species. (a) Rubzovinema sp., heterogeneous female; (b) Spilotylenchus sp., heterogeneous female; (c) Psillotylenchus sp., heterogeneous female of the first generation; (d) (c): Psillotylenchus sp., parthenogenetic female of the second generation. Scale bar—200 μm.

Figure 4.

Figure 4

Distribution of the studied nematode species among the flea species studied, whose rodent hosts are given below. The vertical axis shows the numbers of infected fleas.

According to morphometric evidence, parasitic females and juveniles of the genera Rubzovinema and Spilotylenchus are very similar. However, in the first two groups of isolates we found characters bearing discriminative and identificational value. In particular, the oesophageal glands in juveniles III of the first group are poorly developed. This is a distinctive feature of the genus Rubzovinema, where males and females have shortened oesophageal glands located close to the nerve ring. In the second group of isolates, oesophageal glands are well developed and elongated, which is characteristic of the genus Spilotylenchus. In the first group, the stylet possesses a heavily sclerotized distal spear with a length of approximately half the total stylet length and has a stem with a weaker sclerotization and widening to the base. This stylet structure is characteristic of the genus Rubzovinema, and stylet length (18.5 (14–22) μm) is in accordance with morphometrics given in the description of this genus [26]. In the genus Spilotylenchus, the stylet varies in shape but always possesses a shortened conical distal spear. In the second group of isolates, the stylet structure was similar to that of Spilotylenchus. Also, the vulval lips of the first group are more protruded than in Spilotylenchus. Other features, including the morphometrics, vary widely in both genera, which hampers taxonomic identification. Nevertheless, based on distinctive traits, we identified the first and second group of isolates as Rubzovinema sp. and Spilotylenchus sp., respectively.

In the genus Rubzovinema, the single species described to date is Rubzovinema ceratophylla [26]. This species is known to parasitize exclusively the flea Citellophilus tesquorum that feeds on sousliks. The specimens of Rubzovinema studied in this work were isolated from five flea species, C. tesquorum, Neopsylla setosa, Frontopsylla semura, Amphipsylla rossica, and Ctenophthalmus secundus, of which the latter two were sampled on mouse-like rodents. Also, the parasitic females of Rubzovinema sp. differed from R. ceratophylla by morphology; they have a shorter tail and more protruded vulval lips. A morphometric comparison of Rubzovinema sp. and R. ceratophylla is given in Table 4.

The parasitic females of Spilotylenchus sp. were isolated from the flea Mesopsylla hebes associated with jerboas. The females were not identified to the species level because of a small number of available specimens and the lack of a free-living stage. A morphometric comparison of Spilotylenchus sp. and the morphologically closest species Spilotylenchus maisonabei [23] is given in Table 5.

Table 5.

Comparison of morphometrics of parasitic females in Spilotylenchus sp. and Spilotylenchus maisonabei.

Characters Spilotylenchus sp. (this study) Spilotylenchus maisonabei [23]
N 2 6
L 1,600–1,840 1,244 (1,200–1,320)
D 155–160 125 (107–160)
A 10.3–11.5 10.3 (7.5–12)
C 167.3–177.8 84.4 (64.5–121)
V% 97.4–97.7 96.2 (95.8–96.5)
Total length of stylet (St) 9.5–9.8 9-10
Distance between anterior end and excretory pore 1.5–15.5 23.3 (20–28)
Distance between anterior end and nerve ring — 52–54
Total length of tail (Cd) 9–11 15.4 (10–19)
Distance between vulva and tail end 41.5–43 47 (42–52)
Distance between vulva and anus (V–A) 32-33 —

All measurements are in μm and in the form mean (range).

In the genus Psyllotylenchus, descriptions of most species are fragmentary and incomplete, which precluded the species identification of the Psyllotylenchus isolates from the fleas N. setosa and F. semura feeding on sousliks. A morphometric comparison of Psyllotylenchus sp. and the type species of this genus, Psyllotylenchus viviparous [25], is given in Table 6.

The 18S and 28S rDNA sequences of Rubzovinema sp. specimens from A. rossica and C. secundus were 100% identical, which indicates that the isolates belong to the same species. The sequences of Rubzovinema sp. ex C. tesquorum, Rubzovinema sp. ex N. setosa, and Rubzovinema sp. ex F. semura diverged from one another and from the gene sequences of Rubzovinema sp. ex A. rossica and Rubzovinema sp. ex C. secundus by 0.4–0.7%, which corresponds to the levels of intraspecific variation [14, 114–119]. The 18S and 28S rDNA sequences of Psyllotylenchus sp. ex N. setosa and Psyllotylenchus sp. ex F. semura were 100% identical, indicating that they belong to the same species. The 18S and 28S rDNA sequences of Rubzovinema sp. and Psyllotylenchus sp. diverge by 1.2% and 1.9%, respectively. Those of Spilotylenchus sp. ex M. hebes were found to be more divergent. The degree of divergence of the 18S rDNA sequence of Spilotylenchus sp. ex M. hebes from those of either Rubzovinema sp. or Psyllotylenchus sp. was 2.4%; the D3 expansion segment of 28S rDNA diverged by 13.1% and 12.0%, respectively. The observed divergence rate of rDNA sequences agrees well with published evidence on entomoparasitic nematodes [14, 114–118]. Thus, intraspecific divergence of 18S rDNA in Deladenus siricidicola is 1% [120], of D2 and D3 expansion segments in the phytoparasite Bursaphelenchus xylophilus is from 0% to 0.6%, and the interspecific variation between the phytoparasites B. xylophilus and Bursaphelenchus mucronatus is from 1.7% to 3.7%. The spacers ITS1 and ITS2 are generally more diverged; the intra- and interspecific variation for these species is from 0 to 3.1% and 11.2 to 13.4%, respectively [121–123].

Molecular vouchering is proved to efficiently complement morphological species identification in nematodes [73, 122, 124–128]. Combining the rDNA and morphological data confirms the species identity within each of the three studied groups of isolates.

3.3. Phylogenetic Analysis

In phylogenetic analyses of rDNA we used a dataset with extensive species and gene sampling (SSU-ITS1-5.8S-LSU) compared to earlier published tylenchid phylogenies, most of which were based on SSU rDNA or D2-D3 expansion segments [17, 19–21, 39, 129]. The SSU-ITS1-5.8S-LSU rDNA tree topology (Figure 5) is highly similar to other published phylogenies of tylenchids. In this tree, tylenchomorphs are represented by the sister groups Aphelenchidae and Tylenchida. Most of the tylenchid clades occur in published trees but often contradict classifications based on morphology, as it was also noted by other authors [17, 19–21, 39, 129]. The three robust major branches in the SSU-ITS1-5.8S-LSU rDNA tree (Bayesian posterior probabilities of 0.99–1.0) are (1) the clade includes representatives of the suborders Hoplolaimina, Criconematina, and Tylenchina (excluding Anguinoidea); (2) the majority of classic Anguinata; (3) the suborder Hexatylina. The studied parasites of fleas form a monophyletic group (bootstrap support of 100%) within the Hexatylina.

Figure 5.

Figure 5

Phylogenetic tree of Tylenchida, inferred from SSU-ITS1-5.8S-LSU rDNA sequences. Topology was inferred using the PhyloBayes software (maxdiff = 0.36). Node support values are shown as follows: the first two values are Bayesian posterior probability assessed using the PhyloBayes and MrBayes software, respectively, and the third is bootstrap support assessed by the ML method. Thick lines lead to the nodes, in which at least one support value of posterior probability is 0.95 and higher. Names of clades (framed) are mainly given by type genera included in them (with the exception of Iotonchioidea). Formal taxonomic position (family by [8]) is shown on the right to the color bar. Colors indicate the ecologies (see the legend). Names of the species of Hexatylina that have a mycetophagous stage in their life cycle are shown in blue. The three robust major branches of Tylenchida are marked by gradient.

The nonredundant rDNA data on the Hexatylina in GenBank mostly represents the D2-D3 expansion segments of LSU rDNA. To maximize species sampling of the Hexatylina, we chose the D3 expansion segment as the molecular marker. The phylogenetic tree with the Anguinoidea as an outgroup is shown in Figure 6. In this tree, the suborder Hexatylina consists of two well-supported clades, in accordance with previously published D2-D3 rDNA phylogenies [19, 20, 39]. The clade of the studied flea parasites is placed within the largest branch of the Hexatylina, similarly to the result of the concatenated rDNA analysis.

Figure 6.

Figure 6

Phylogenetic tree of Hexatylina, inferred from D3 expansion segment of LSU rDNA. Topology was inferred using the PhyloBayes software. Node support values are shown as follows: Bayesian posterior probability/bootstrap support assessed by the ML method. Thick lines indicate the nodes supported at the level of 0.95 and higher. Color of lines indicates the ecologies (see the legend). Names of species were shown in different colors indicating their taxonomic position. Three families that include their type genera (shown as circles) are marked by gradient.

The three alternative relationships between the three major branches of Tylenchida (Figure 5) are not discriminated by the AU and Kishino and Hasegawa tests, and only the basal position of the Hexatylina is rejected by the expected-likelihood weights test (Table 7). All three tests do not discriminate between the alternative placement of the flea parasites as closest to the Allantonema, Parasitylenchus, or Deladenus branches; however, its positioning outside this grouping is not rejected only by a less conservative Shimodaira-Hasegawa test [50].

Table 7.

Results of tree topology tests for alternative hypotheses on (1) the initial divergence of Tylenchida (Figure 4) and on (2) the relationships within the monophyletic branch that includes the studied group of nematodes parasitizing fleas (designated by asterisk).

Topology Rank obs au np bp pp kh sh c-ELW
1
(((H,An),T),o) 1 −1.8 0.787 0.415 0.402 0.804 0.663 0.969 0.4197
((An,(H,T)),o) 2 4.1 0.326 0.198 0.205 0.013 0.254 0.623 0.1848
((H,(An,T)),o) 3 6.9 0.061 0.013 0.014 0.001 0.101 0.492 0.0186

2
((((∗,Al),P),Ds),o) 1 −1.8 0.787 0.415 0.402 0.804 0.663 0.969 0.4197
((((∗,P),Al),Ds),o) 2 1.8 0.495 0.242 0.247 0.130 0.337 0.813 0.2249
(((∗,(Al,P)),Ds),o) 3 2.7 0.371 0.110 0.105 0.052 0.243 0.824 0.1209
((∗,((Al,P),Ds)),o) 6 15.7 0.063 0.024 0.025 1e − 007 0.053 0.153 0.0272
(((∗,Ds),(Al,P)),o) 7 18.3 0.013 0.002 0.002 9e − 009 0.020 0.096 0.0028

Al: Allantonematidae, An: Anguinata, Ds: Deladenus siricidicola—D. proximus group, H: Hexatylina, P: Parasitylenchidae, T: Tylenchina, o: outgroup.

4. Discussion

4.1. Ribosomal DNA Phylogeny of the Tylenchida and Relationships within the Suborder Hexatylina

Phylogenetic analyses of SSU [16, 17, 19, 39] and D2-D3 [20, 39] rDNA data using various methods and species sampling generally agree on the monophyly of most tylenchid clades and contradict classic morphology based classifications. In the SSU-ITS1-5.8S-LSU tree (Figure 5), the monophyletic Tylenchida consists of three major robust clades. The first clade diverges into six groups: (1) the “Tylenchidae (part 2)” (by [17]), (2) the Tylodoridae (represented by the two genera, Cephalenchus and Eutylenchus [83]), (3) Boleodorinae + “Tylenchidae (part 1)” (by [Bert]), (4) the Merliniidae [130], (5) Criconematina + Sphaeronematidae + selected Tylenchina, and (6) Belonolaimidae + “Hoplolaimina.” The Merliniidae group corresponds to Clade C in [19] and includes partially the polyphyletic “Telotylenchinae” [131], “Pratylenchidae”, and “Hoplolaimina” (Psilenchus cf. hilarulus). Group (5) corresponds to Clade 12A in [129], where Sphaeronematidae (Sphaeronema and Meloidoderita) were earlier shown to be closely related to Criconematina [20, 89], and selected Ecphyadophoridae + Ottolenchus + Malenchus were found to represent a monophyletic clade within the paraphyletic Tylenchina likely to be related to the Criconematina [18, 82]. Group (6) corresponds to Clade VII in [20], Clade 12B in [129], and Clade A + Clade B in [19]. Belonolaimidae (the genera Belonolaimus and Ibipora) tend to occupy the basal position. Clade A in [19] contains a “long branch” of the burrowing nematode Radopholus similes (“Pratylenchidae”) in sister position to the Hoplolaimidae [17, 19]. This nematode occupies a similar position relative to the Hoplolaimidae in the SSU-ITS1-5.8S-LSU tree, and we consider this unlikely to be an LBA artefact. Similarly to [95], Carphodorus and Morulaimus that belong to the classic Belonolaimidae comprise the basal branch of Clade A sensu [19]. The clade corresponding to Clade B in [19] contains Meloidogynidae, Dolichodoridae, paraphyletic Pratylenchidae, and a part of Telotylenchidae.

The second major clade of the Tylenchida includes representatives of the classic infraorder Anguinata, with a well-supported monophyletic origin, except for a few species. They belong outside the second clade and may initially have been wrongly identified.

The third major clade includes representatives of the classic suborder Hexatylina and consists of two groups. The smaller one unites the three species of Sphaerularia, Helionema sp., cf. Hexatylus sp., Deladenus sp. PDL-2005, and Nothotylenchus acris (Anguinata: Nothotylenchidae). It is further referred to as the Sphaerularioidea according to the type genus. The larger group contains the clade of studied flea parasites and members of the superfamilies Iotonchioidea (Skarbilovinema spp., Parasitylenchus spp., and Wachekitylenchus bovieni) and Sphaerularioidea (Allantonema mirable, Bradynema spp., Howardula spp., and Contortylenchus sp. (fam. Allantonematidae); Deladenus durus, Deladenus proximus, Deladenus siricidicola, Fergusobia spp., and Gymnotylenchus sp. (fam. Neotylenchidae)). One species of the Anguinata, Sychnotylenchus sp., also joins the larger group. Our study renders the genera Howardula and Deladenus paraphyletic, as was earlier shown in [19, 39, 71, 119].

The genus Howardula is paraphyletic in published rDNA and mitochondrial COI phylogenies [71]. Such characters of Howardula as the degeneration of oesophagus, tail shape, and the absence of stylet in males seem to have evolved independently by convergence. The paraphyletic genus Deladenus is more closely related to either ancestral forms of the Hexatylina or forms typical to the Anguinata. The infraorder Anguinata includes soil-dwelling nematodes, mostly mycetophagous or parasitizing various parts of plants. However, an unidentified entomoparasitic nematode was also grouped within the Anguinoidea [39]. The life cycle of Deladenus spp. is an irregular alternation of free-living and entomoparasitic forms. The nematode D. siricidicola is able of producing an unlimited number of free-living generations in the absence of the host larvae of siricid pine-killing wood wasps [132]. Like in Anguinata, the free-living forms of Deladenus spp. are fungal feeding. Such characters of Deladenus asthe mycetophagy, enlargement of subventral glands in entomoparasitic females versus their reduction in free-living forms, the hypertrophy of dorsal glands, and stylet reduction in free-living forms seem to be symplesiomorphic. Resemblance with the Anguinata is also typical of other mycetophagous free-living forms: Hexatylus (Neotylenchidae), Rubzovinema (Neotylenchidae), Prothallonema (Sphaerularioidae) Helionema (Hexatylina dubia), and Paurodontidae. For the latter, the entomoparasitic stage is expected but has never been observed. The relationship between the Hexatylina and Anguinata was earlier hypothesized based on morphology [7, 8, 130, 133, 134]. On rDNA phylogenies of tylenchids, the monophyly of the Hexatylina + Anguinata is either supported [19] or not rejected [20]. In the SSU-ITS1-5.8S-LSUrDNA tree obtained in this study, the monophyly of the Hexatylina + Anguinata has the Bayesian posterior probability of 0.91, but the maximum-likelihood bootstrap support is low; the AU and Kishino and Hasegawa tests did not discriminate between alternative hypotheses.

According to our SSU-ITS1-5.8S-LSU rDNA phylogeny (Figure 5), the major robust branches of the Tylenchida are incongruent with morphology-based classifications suggesting three rather than four suborders (the rank is adopted from morphological systems of tylenchids). Among them, the Hexatylina and Anguinata (both are monophyletic) are likely to be sister groups. The third emerged suborder includes representatives of three classic suborders: Tylenchina, Hoplolaimina, and Criconematina, among which only the latter does not contradict morphology-based classifications.

Considering ecological traits coded in Figure 5, the mycetophagy and/or facultative ectophytoparasitism are likely to be ancestral in the Tylenchida. Sedentary phytoparasites (root-knot species of Meloidogyne, the false root-knot genus Nacobbus, and cyst-forming Heterodera and Globodera) and other obligate endoparasites of plants evolved several times from free-living or facultative sedentary forms, as it was previously hypothesized in accordance with the concept of evolutionary trend to endoparasitism in phytonematodes [135]. Similarly, obligate endoparasites of insects from the Hexatylina are likely to have evolved from mycetophagous forms, with some species retaining the ancestral mycetophageous stage in the life cycle (e.g., species of the paraphyletic genus Deladenus and flea nematodes of the genus Rubzovinema). An interesting specific case in the Hexatylina is the genus Fergusobia that includes plant parasites associated with insects [68, 70], which may have transited to plant parasitism via entomoparasitism [39].

4.2. Ribosomal DNA Phylogeny of the Flea Nematodes and Their Classification

The nematodes of fleas do not group with the families known as their relatives in morphology-based systems, as these families do not form monophyletic groups in the tree. However, they do group with both type genera of the families Parasitylenchidae and Allantonematidae (Parasitylenchus and Allantonema, resp.). This grouping is preceded by a successive divergence of Deladenus durus and Deladenus siricidicola (Figure 5). As mentioned above, the pronounced free-living form in Deladenus seems to be ancestral to this group.

Only 31 tylenchid species that parasitize in fleas have been described to date. They differ by morphology, life cycle, and the host specificity, and belong to the five genera: Spilotylenchus (8 species), Psyllotylenchus (20 species), Incurvinema (1 species) Kurochkinitylenchus (1 species), and Rubzovinema (1 species). According to the classification of Siddiqi [8], the genera Spilotylenchus and Psyllotylenchus belong to the family Parasitylenchidae, whereas the genus Rubzovinema is a member of the Neotylenchidae. The two families represent two superfamilies, Iotonchioidea and Sphaerularioidea, respectively. All rDNA phylogenies published to date suggest that these superfamilies are paraphyletic [19, 20, 39], which is also inferred in our study with an extensive gene and taxon sampling.

A high degree of rDNA similarity in the three studied species suggests a closer relationship of these species than that assumed by the accepted system of classification. Earlier, Slobodyanyuk proposed to unite all known flea parasites into one family, the Spilotylenchidae. Its four subfamilies, Spilotylenchinae, Rubzovinematinae, Psyllotylenchinae, and Kurochkinitylenchinae, are discriminated based on the life cycle features [28]. In Spilotylenchinae and Rubzovinematinae, the entomoparasitic stage is represented by parasitic females of one heterosexual generation. In Psyllotylenchinae, in addition to the heterosexual generation, a parthenogenetic generation occurs in the flea haemocoel. In Kurochkinitylenchinae, two heterosexual generations exist in the haemocoel: the first generation produces parasitic females and the second generation produces both females and males [28]. Siddiqi also considered the unification of all flea tylenchids into one family but observed the need for further evidence in support [8].

Our results strongly suggest the inclusion of the three genera, Rubzovinema, Psyllotylenchus, and Spilotylenchus, in one family, the Spilotylenchidae [28]. The ribosomal DNA genetic distance within the family Spilotylenchidae is much smaller than that of certain tylenchid genera, for example, Meloidogyne (Figure 4) or Pratylenchus [19, 84].

4.3. Host Specificity of Flea Nematodes

The majority of tylenchid nematodes are monoxenous or oligoxenous; in particular, flea parasites were thought to be strictly host specific. Earlier papers suggested the lack of strict host specificity in Psyllotylenchus pawlowskyi and Psyllotylenchus viviparous [13, 25]. However, later these species were found to be heterogeneous and sustained revision [9, 27–29]. Spilotylenchus pawlowskyi and Spilotylenchus caspius were referred to as single-host parasites of the flea Coptopsylla lamellifer [27, 136]. Kurochkinitylenchus laevicepsi and Spilotylenchus ivashkini also share the same flea host, Nosopsyllus laeviceps [28, 29]. Before our study, the genus Rubzovinema was known to contain a single species, Rubzovinema ceratophylla, which parasitizes exclusively the flea Citellophilus tesquorum.

We found that at least two out of the three studied species are not single-host parasites. Psyllotylenchus sp. was shown to parasitize two flea species feeding on sousliks, Frontopsylla semura and Neopsylla setosa. Rubzovinema sp. was found on five flea species feeding on different rodent hosts: C. tesquorum, F. semura, N. setosa (all sampled from sousliks), Ctenophtalamus secundus, and Amphipsylla rossica (all sampled from voles). A. rossica, F. semura, and C. tesquorum belong to different families of the superfamily Ceratophylloidea (Leptopsyllidae and Ceratophyllidae), whereas C. secundus and N. setosa belong to the superfamily Hystrichopsylloidea. Unlike the host-specific R. ceratophylla, the studied Rubzovinema sp. parasitizes taxonomically distant fleas feeding on different rodents. Thus, the common opinion that flea nematodes are strictly host specific should be revisited.

As the two species of Rubzovinema demonstrate, even closely related parasites may exhibit different host range size. Among other known examples are the entomoparasitic nematodes of the genus Howardula parasitizing various beetles and flies [71, 137, 138], many phytonematodes [8], sibling species of parasitoid flies [128], and herbivorous insects [139]. The host range of parasites is an indicator of their evolutionary strategy in the ecosystem. Multihost parasites can be considered ecological generalists, in contrast to specialists that coevolve with a particular host. Generalists and specialists play different roles in the ecosystem [140], where they keep in balance, taking advantages and disadvantages of the two strategies. The advantages of generalization are yet to be explained by evolutionary biologists, whereas advantages of specialization are obvious, and it is generally accepted that evolution favors specialism [141, 142]. In the flea parasites, this trend is demonstrated by a greater species diversity of ecological specialists, the genera Spilotylenchus and Psyllotylenchus.

Nevertheless, the generalist Rubzovinema sp. was most abundant in the studied samples, which indicates that extending the host range may be evolutionarily successful. Besides the need to combat the immune response of several hosts, which is a requirement to widen the hosts range [143], the free-living stage of Rubzovinema sp. is to adapt to diverse microbioclimatic conditions of complex environments of rodent habitats. Multihost parasites pay a cost of adapting to alternative conditions [141, 144] compensated by stable survival of the species. Considering the spatial and temporal dynamics of flea populations feeding on a particular rodent host (one or two flea species usually dominate over a sampling season), multihost nematode parasites gain an advantage of their relative independence of population waves of either flea hosts or their rodent hosts. A higher infestation rate observed for Rubzovinema sp., compared to the two other studied species, may be an indicator of a greater ecological plasticity of this multihost parasite.

4.4. Entomoparasitic Nematodes in Natural Foci of Plague

In natural foci of plague, the epizootic dynamics are influenced by numerous climatic and biotic factors. The spatial and temporal population dynamics of the plague agent, Y. pestis, affect the population dynamics of the flea vectors and their mammalian hosts. Members of the transmission route of the plague agent also closely interact with other living organisms. For example, parasites of fleas that in turn feed on rodents are hyperparasites that play the role of high-level control agents on the ecosystem level, the role that entomoparasitic nematodes share with the bacterial plague agent. High-level control agents render the epidemiological state of a natural focus of disease less predictable. On the one hand, a lower density of the flea vector population reduces the plaque transmission rate; on the other, its growth causes an exponential decay of the host rodent population [145] below its epidemiological threshold, above which there is a threat of spillover of plague infection into human population [145]. Hypothetically, nematode-induced decrease of flea population is able to increase the number of rodents above the threshold and thus trigger an epidemic. The dual effect of high-level control agents is well exemplified by cases, when during plague episodes the extermination of rodents by humans causes the return of infection through stimulating the migration of fleas, the plaque vectors [5].

The studied entomoparasitic nematodes possess high potential as control agents of the flea vectors of plague owing to their high propagation rate within the flea host (Figure 2) and high infestation level (up to 21% observed in this study and from 50 to 60%, as estimated by other authors [10, 11]). One of the studied nematode species, Rubzovinema sp., is a multihost parasite. Host-specific parasites reach the optimal level of pathogenicity by maintaining the trade-off between pathogenicity and transmissibility. Adding of a new host to a multihost system makes the model more complicated [141]. The multihost parasite Rubzovinema sp. is expected to exhibit different levels of pathogenicity with respect to different flea hosts which, in turn, play different roles in the transmission of plague. Epizootics cause sporadic mortality in local populations of all members involved in the interaction with the plague agent, and their survival is contingent on migrations within a metapopulation. It is the case when the Cope's law [139, 146] governs the extinction of specialists on a shorter time scale rather than a geological period, and evolution may favor the ecological generalists, such as Rubzovinema sp.

Some authors surmised the involvement of entomoparasitic nematodes in the transmission of the plague agent [4], as it was observed that biofilms of Yersinia pestis adhere to cuticle receptors of Caenorhabditis elegans [147–149]. In this perspective, nematodes parasitizing fleas in natural foci of plague take on greater importance, as they may provide for the transmission route that does not include a mammal [4]. Further studies will clarify the role of flea nematodes in the transmission of plague infection.

Acknowledgments

The authors thank G. S. Mirzaeva for help with PCR amplification and rDNA fragment analysis, N. V. Popov and the staff of the Laboratory of Epizootics Monitoring for advice and assistance in collecting and processing rodent samples, and, particularly, A. N. Porshakov for help in identification of flea specimens. They also thank O. V. Slobodyanyuk for helpful discussions of results, S. E. Spiridonov for advice on cultivation of entomoparasitic nematodes, S. A. Subbotin for valuable comments on the earlier version of the paper, and E. Yu. Talanova and L. Yu. Rusin for discussions of its final version, and E. A. Musatkina for assistance with the manuscript preparation. They are grateful to the Supercomputer Center of Moscow State University (http://parallel.ru/cluster) and the Bioportal of the University of Oslo (http://www.bioportal.uio.no) for providing computing resources.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Bacot AW, Martin CJ. Observations on the mechanism of the transmission of plague by fleas. The Journal of Hygiene. 1914;13(supplement 3):423–439. [PMC free article] [PubMed] [Google Scholar]
  • 2.Kutyrev VV, Eroshenko GA, Popov NV, Vidyaeva NA, Konnov NP. Molecular mechanisms of interaction of the plague agent with invertebrates. Molecular Genetics, Microbiology and Virology. 2009;24(4):7–12. [PubMed] [Google Scholar]
  • 3.Pavlovsky EN. Natural Focality of Transmissive Diseases in Connection with Landscape Epidemiology of Zooanthroponoses. Moscow, Russia: 1964. [Google Scholar]
  • 4.Popov NV, Koshel EI, Eroshenko GA, Kutyrev VV. Formation of modern concepts on the mechanism of plague enzooty. Problems of Particularly Dangerous Infections. 2011;3(109):5–8. [Google Scholar]
  • 5.Keeling MJ, Gilligan CA. Bubonic plague: a metapopulation model of a zoonosis. Proceedings of the Royal Society B. 2000;267(1458):2219–2230. doi: 10.1098/rspb.2000.1272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bedding RA, Akhurst RJ, Kaya HK. Nematodes and the Biological Control of Insect Pests. Melbourne, Australia: CSIRO Press; 1993. [Google Scholar]
  • 7.Siddiqi MR. Tylenchida Parasites of Plants and Insects. Vol. 645. Slough, UK: Farnham Royal; 1986. (Commonwealth Agricultural Bureaux). [Google Scholar]
  • 8.Siddiqi MR. Tylenchida: Parasites of Plants and Insects. 2nd edition. Wallingford, UK: CABI; 2000. [Google Scholar]
  • 9.Rubtsov IA. Parasites and Enemies of Fleas. Leningrad, Russia: Nauka; 1981. [Google Scholar]
  • 10.Morozov YA. About infestation with fleas great gerbils different ages. Proceedings of the Conference Anti-Plague Facilities in Central Asia and Kazakhstan; 1974; Alma-Ata; pp. 337–338. [Google Scholar]
  • 11.Morozov YA. Effect of infestation of nematode on reproduction of fleas gerbils in Muyunkum. Proceedings of the Conference Anti-Plague Facilities in Central Asia and Kazakhstan; 1974; Alma-Ata; pp. 338–340. [Google Scholar]
  • 12.Deunff J. Parasites de Siphonaptères. Étude de la systématique, de la biologie et du pouvoir pathogène des Tylenchides (Nematodea) dans une perspective de lutte biologique [Ph.D. thesis] Rennes, France: Etat Sc. Pham; 1984. [Google Scholar]
  • 13.Kurochhkin YV. The nematode Heterotylenchus pawlowskyi sp. n., castrating flea-vectors of plague. Doklady Akademyi Nauk SSSR. 1960;135:1281–1284. [Google Scholar]
  • 14.Blaxter ML, De Ley P, Garey JR, et al. A molecular evolutionary framework for the phylum Nematoda. Nature. 1998;392(6671):71–75. doi: 10.1038/32160. [DOI] [PubMed] [Google Scholar]
  • 15.De Ley P, Blaxter ML. Systematic Position and Phylogeny. In: Lee DL, editor. The Biology of Nematodes. London, UK: Taylor & Francis; 2002. [Google Scholar]
  • 16.Meldal BHM, Debenham NJ, De Ley P, et al. An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Molecular Phylogenetics and Evolution. 2007;42(3):622–636. doi: 10.1016/j.ympev.2006.08.025. [DOI] [PubMed] [Google Scholar]
  • 17.Bert W, Leliaert F, Vierstraete AR, Vanfleteren JR, Borgonie G. Molecular phylogeny of the Tylenchina and evolution of the female gonoduct (Nematoda: Rhabditida) Molecular Phylogenetics and Evolution. 2008;48(2):728–744. doi: 10.1016/j.ympev.2008.04.011. [DOI] [PubMed] [Google Scholar]
  • 18.Holterman M, Van Der Wurff A, Van Den Elsen S, et al. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution. 2006;23(9):1792–1800. doi: 10.1093/molbev/msl044. [DOI] [PubMed] [Google Scholar]
  • 19.Holterman M, Karssen G, Van Den Elsen S, Van Megen H, Bakker J, Helder J. Small subunit rDNA-based phylogeny of the tylenchida sheds light on relationships among some high-impact plant-parasitic nematodes and the evolution of plant feeding. Phytopathology. 2009;99(3):227–235. doi: 10.1094/PHYTO-99-3-0227. [DOI] [PubMed] [Google Scholar]
  • 20.Subbotin SA, Sturhan D, Chizhov VN, Vovlas N, Baldwin JG. Phylogenetic analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragments of the 28S rRNA gene sequences. Nematology. 2006;8(3):455–474. [Google Scholar]
  • 21.Subbotin SA, Sturhan D, Adams BJ, et al. Molecular phylogeny of the order Tylenchida: analysis of nuclear ribosomal RNA genes. Journal of Nematology. 2006;38(2):296–296. [Google Scholar]
  • 22.Launay H, Deunff J, Bain O. Spilotylenchus arthuri, gen. n., sp. n. (Nematodea, Tylenchida: Allantonematidae), parasite of Spilopsyllus cuniculi (Dale, 1878) (Siphonaptera: Pulicidae) Annales de Parasitologie Humaine et Comparee. 1983;58(2):141–150. doi: 10.1051/parasite/1983582141. [DOI] [PubMed] [Google Scholar]
  • 23.Launay H, Deunff J. Spilotylenchus maisonabei n. sp. (Nematoda: Allantonematidae) parasite of the European rabbit flea Spilopsyllus cuniculi (Dale, 1878) (Siphonaptera: Pulicidae) Annales de Parasitologie Humaine et Comparee. 1990;13:293–296. doi: 10.1051/parasite/1983582141. [DOI] [PubMed] [Google Scholar]
  • 24.Laumond C, Beaucournu JC. Neoparasitylenchus megabothridis n. sp. (Tylenchida: Allantonematidae) parasite of Megabothris tubidus (Siphonaptera: Ceratophyllidae); observations on fleas tylenchides in the S.W. of Europa (author’s transl) Annales de Parasitologie Humaine et Comparee. 1978;53(3):291–302. doi: 10.1051/parasite/1978533291. [DOI] [PubMed] [Google Scholar]
  • 25.Poinar GO, Jr., Nelson BC. Psyllotylenchus viviparus, n. gen., n. sp. (Nematodea: Tylenchida: Allantonematidae) parasitizing fleas (Siphonaptera) in California. Journal of Medical Entomology. 1973;10(4):349–354. doi: 10.1093/jmedent/10.4.349. [DOI] [PubMed] [Google Scholar]
  • 26.Slobodyanyuk VO. Validation of genus Rubzovinema gen.n. (Sphaerularioidea) and redescription of species Rubzovinema ceratophylla comb.n. parasite of fleas Citellophillus tesquorum . Zoological Journal. 1991;70(9):33–43. [Google Scholar]
  • 27.Slobodyanyuk OV. Revision of the species Psyllotylenchus pawlowskyi (Kurochkin, 1960) Poinar & Nelson, 1973. I. Redescription of Spilotylenchus pawlowskyi (sensu stricto) comb. n. (Tylenchida: Allantonematidae) Russian Journal of Nematology. 1997;5(2):103–112. [Google Scholar]
  • 28.Slobodyanyuk OV. Revision of the species Psyllotylenchus pawlowskyi (Kurochkin, 1960) Poinar & Nelson, 1973. II. Description of Kurochkinitylenchus laevicepsi gen. n., sp. n. and Spilotylenchidae fam. n. Russian Journal of Nematology. 1999;7(1):1–18. [Google Scholar]
  • 29.Slobodyanyuk OV. Revision of the species Psyllotylenchus pawlowskyi (Kurochkin, 1960) Poinar & Nelson, 1973. III. Description of Spilotylenchus ivashkini sp. n. Russian Journal of Nematology. 2000;8(1):45–55. [Google Scholar]
  • 30.Deunff J, Launay H. Psyllotylenchus chabaudi, n. sp. (Nematodea, Tylenchida: Allantonematidae), a parasite of Nosopsyllus fasciatus (Bosc) (Siphonaptera: Ceratophyllidae) Annales de Parasitologie Humaine et Comparee. 1984;59(3):263–270. doi: 10.1051/parasite/1984593263. [DOI] [PubMed] [Google Scholar]
  • 31.Deunff J, Launay H, Beaucournu JC. Incurvinema helicoides n. gen., n. sp. Nematodea, Tylenchida: allantonematidae parasite de Rhadinopsylla pentacantha (Rothschild, 1897) (Siphonaptera : Hystrichopsyllidae) Annales de Parasitologie Humaine Et Comparée. 1985;60:739–746. [Google Scholar]
  • 32.De Grisse AT. Redescriptions ou modifications de quelques techniques utilisées dans l'étude des nématodes phytoparasites. Mededelingen Rijksfakulteit Landbouwwetenschappen Gent. 1969;34:351–369. [Google Scholar]
  • 33.Huang X. A contig assembly program based on sensitive detection of fragment overlaps. Genomics. 1992;14(1):18–25. doi: 10.1016/s0888-7543(05)80277-0. [DOI] [PubMed] [Google Scholar]
  • 34.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999;41:95–98. [Google Scholar]
  • 35.Medlin L, Elwood HJ, Stickel S, Sogin ML. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene. 1988;71(2):491–499. doi: 10.1016/0378-1119(88)90066-2. [DOI] [PubMed] [Google Scholar]
  • 36.Chizhov VN, Chumakova OA, Subbotin SA, Baldwin JG. Morphological and molecular characterization of foliar nematodes of the genus Aphelenchoides: A. fragariae and A. ritzemabosi (Nematoda: Aphelenchoididae) from the Main Botanical Garden of the Russian Academy of Sciences, Moscow. Russian Journal of Nematology. 2006;14(2):179–184. [Google Scholar]
  • 37.Van der Auwera G, Chapelle S, De Wächter R. Structure of the large ribosomal subunit RNA of Phytophthora megasperma, and phylogeny of the oomycetes. FEBS Letters. 1994;338(2):133–136. doi: 10.1016/0014-5793(94)80350-1. [DOI] [PubMed] [Google Scholar]
  • 38.Subbotin SA, Vovlas N, Crozzoli R, et al. Phylogeny of Criconematina Siddiqi, 1980 (Nematoda: Tylenchida) based on morphology and D2-D3 expansion segments of the 28S rDNA gene sequences with application of a secondary structure model. Nematology. 2005;7:927–944. [Google Scholar]
  • 39.Chizhov VN, Butorina NN, Subbotin SA. Entomoparasitic nematodes of the genus Skarbilovinema: S. laumondi and S. lyoni (Nematoda: Tylenchida), parasites of the flies of the family Syrphidae (Diptera), with phylogeny of the suborder Hexatylina. Russian Journal of Nematology. 2012;20(2):141–155. [Google Scholar]
  • 40.Altschul SF, Madden TL, Schäffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research. 1997;25(17):3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research. 2004;32(5):1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nei M, Kumar S. Molecular Evolution and Phylogenetics. Oxford, UK: Oxford University Press; 2000. [Google Scholar]
  • 43.Lartillot N, Lepage T, Blanquart S. PhyloBayes 3: a Bayesian software package for phylogenetic reconstruction and molecular dating. Bioinformatics. 2009;25(17):2286–2288. doi: 10.1093/bioinformatics/btp368. [DOI] [PubMed] [Google Scholar]
  • 44.Lartillot N, Philippe H. A Bayesian mixture model for across-site heterogeneities in the amino-acid replacement process. Molecular Biology and Evolution. 2004;21(6):1095–1109. doi: 10.1093/molbev/msh112. [DOI] [PubMed] [Google Scholar]
  • 45.Huelsenbeck JP, Ronquist F. MRBAYES: bayesian inference of phylogenetic trees. Bioinformatics. 2001;17(8):754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 46.Lanave C, Preparata G, Saccone C, Serio G. A new method for calculating evolutionary substitution rates. Journal of Molecular Evolution. 1984;20(1):86–93. doi: 10.1007/BF02101990. [DOI] [PubMed] [Google Scholar]
  • 47.Stamatakis A. Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22:2688–2690. doi: 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
  • 48.Shimodaira H. An approximately unbiased test of phylogenetic tree selection. Systematic Biology. 2002;51(3):492–508. doi: 10.1080/10635150290069913. [DOI] [PubMed] [Google Scholar]
  • 49.Kishino H, Hasegawa M. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoide. Journal of Molecular Evolution. 1989;29(2):170–179. doi: 10.1007/BF02100115. [DOI] [PubMed] [Google Scholar]
  • 50.Shimodaira H, Hasegawa M. CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics. 2002;17(12):1246–1247. doi: 10.1093/bioinformatics/17.12.1246. [DOI] [PubMed] [Google Scholar]
  • 51.Strimmer K, Rambaut A. Inferring confidence sets of possibly misspecified gene trees. Proceedings of the Royal Society B. 2002;269(1487):137–142. doi: 10.1098/rspb.2001.1862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Schmidt HA, Strimmer K, Vingron M, Von Haeseler A. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics. 2002;18(3):502–504. doi: 10.1093/bioinformatics/18.3.502. [DOI] [PubMed] [Google Scholar]
  • 53.Page RDM. TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences. 1996;12(4):357–358. doi: 10.1093/bioinformatics/12.4.357. [DOI] [PubMed] [Google Scholar]
  • 54.Holovachov O, Bostrom S, De Ley IT, et al. Morphology, molecular characterisation and systematic position of the genus Cynura Cobb, 1920 (Nematoda: Plectida) Nematology. 2013;15:611–627. [Google Scholar]
  • 55.Nadler SA, De Ley P, Mundo-Ocampo M, et al. Phylogeny of Cephalobina (Nematoda): molecular evidence for recurrent evolution of probolae and incongruence with traditional classifications. Molecular Phylogenetics and Evolution. 2006;40(3):696–711. doi: 10.1016/j.ympev.2006.04.005. [DOI] [PubMed] [Google Scholar]
  • 56.Holovachov O, Bostrom S, Nadler SA, De Ley P. Systematics and phylogenetic position of the genus Tricirronema Siddiqi, 1993 (Cephalobomorpha) Journal of Nematode Morphology and Systematics. 2009;12(2) [Google Scholar]
  • 57.Kiontke K, Barrière A, Kolotuev I, et al. Trends, stasis, and drift in the evolution of nematode vulva development. Current Biology. 2007;17(22):1925–1937. doi: 10.1016/j.cub.2007.10.061. [DOI] [PubMed] [Google Scholar]
  • 58.Campos-Herrera R, El-Borai FE, Duncan LW. Wide interguild relationships among entomopathogenic and free-living nematodes in soil as measured by real time qPCR. Journal of Invertebrate Pathology. 2012;111(2):126–135. doi: 10.1016/j.jip.2012.07.006. [DOI] [PubMed] [Google Scholar]
  • 59.Félix M-A, De Ley P, Sommer RJ, et al. Evolution of vulva development in the Cephalobina (Nematoda) Developmental Biology. 2000;221(1):68–86. doi: 10.1006/dbio.2000.9665. [DOI] [PubMed] [Google Scholar]
  • 60.Boström S, Holovachov O, Nadler SA. Description of Scottnema lindsayae Timm, 1971 (Rhabditida: Cephalobidae) from Taylor Valley, Antarctica and its phylogenetic relationship. Polar Biology. 2011;34(1):1–12. [Google Scholar]
  • 61.Waceke JW, Bumbarger DJ, Mundo-Ocampo M, Subbotin SA, Baldwin JG. Zeldia spannata n. sp. (Nematoda: Cephalobidae) from the Mojave Desert, California. Journal of Nematode Morphology and Systematics. 2005;8(1):57–67. [Google Scholar]
  • 62.Kumari S. Aphelenchus avenae (Nematoda: Aphelenchidae) under the rhizosphere of Brassica napus . Helminthologia. 2012;49(1):57–59. [Google Scholar]
  • 63.Iwahori H, Tsuda K, Kanzaki N, Izui K, Futai K. PCR-RFLP and sequencing analysis of ribosomal DNA of Bursaphelenchus nematodes related to pine wilt disease. Fundamental and Applied Nematology. 1998;21(6):655–666. [Google Scholar]
  • 64.Carta LK, Skantar AM, Handoo ZA, Baynes MA. Supplemental description of Paraphelenchus acontioides (Tylenchida: Aphelenchidae, Paraphelenchinae), with ribosomal DNA trees and a morphometric compendium of female Paraphelenchus . Nematology. 2011;13(8):887–899. [Google Scholar]
  • 65.Zeng Y, Giblin-Davis RM, Weimin Y, Bélair G, Boivin G, Thomas KW. Bradynema listronoti n. sp. (Nematoda: Allantonematidae), a parasite of the carrot weevil Listronotus oregonensis (Coleoptera: Curculionidae) in Quebec, Canada. Nematology. 2007;9(5):609–623. [Google Scholar]
  • 66.Rybarczyk-Mydłowska K, Mooyman P, van Megen H, Setal Small subunit ribosomal DNA-based phylogenetic analysis of foliar nematodes (Aphelenchoides spp.) and their quantitative detection in complex DNA backgrounds. Phytopathology. 2012;102(12):1153–1160. doi: 10.1094/PHYTO-05-12-0114-R. [DOI] [PubMed] [Google Scholar]
  • 67.Yu Q, de Groot P, Leal I, Davis C, Ye W, Foord B. First report and characterization of Deladenus proximus (Nematoda: Neotylenchidae) associated with Sirex nigricornis (Hymenoptera: Siricidae) in Canada. International Journal of Nematology. 2012;21(2):139–146. [Google Scholar]
  • 68.Ye W, Giblin-Davis RM, Davies KA, et al. Molecular phylogenetics and the evolution of host plant associations in the nematode genus Fergusobia (Tylenchida: Fergusobiinae) Molecular Phylogenetics and Evolution. 2007;45(1):123–141. doi: 10.1016/j.ympev.2007.02.027. [DOI] [PubMed] [Google Scholar]
  • 69.Leal I, Foord B, Davis C, de Groot P, Mlonyeni XO, Slippers B. Distinguishing isolates of Deladenus siricidicola ,a biological control agent of Sirex noctilio, from North America and the Southern Hemisphere using PCR- RFLP. Canadian Journal of Forest Research. 2012;42:1173–1177. [Google Scholar]
  • 70.Davies KA, Ye W, Giblin-Davis RM, Taylor GS, Scheffer S, Thomas WK. The nematode genus Fergusobia (Nematoda: Neotylenchidae): molecular hylogeny, descriptions of clades and associated galls, host plants and Fergusonina fly larvae. Zootaxa. 2010;(2633):1–66. [Google Scholar]
  • 71.Perlman SJ, Spicer GS, Dewayne Shoemaker D, Jaenike J. Associations between mycophagous Drosophila and their Howardula nematode parasites: a worldwide phylogenetic shuffle. Molecular Ecology. 2003;12(1):237–249. doi: 10.1046/j.1365-294x.2003.01721.x. [DOI] [PubMed] [Google Scholar]
  • 72.Raak-van den Berg CL, van Wielink PS, de Jong PW, et al. Invasive alien species under attack: natural enemies of Harmonia axyridis in the Netherlands. BioControl. In press. [Google Scholar]
  • 73.Kanzaki N, Giblin-Davis RM, Scheffrahn RH, et al. Reverse taxonomy for elucidating diversity of insect-associated nematodes: a case study with termites. PLoS ONE. 2012;7(8) doi: 10.1371/journal.pone.0043865.e43865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Powers TO, Neher DA, Mullin P, et al. Tropical nematode diversity: vertical stratification of nematode communities in a Costa Rican humid lowland rainforest. Molecular Ecology. 2009;18(5):985–996. doi: 10.1111/j.1365-294X.2008.04075.x. [DOI] [PubMed] [Google Scholar]
  • 75.Hazir C, Giblin-Davis RM, Keskin N, et al. Diversity and distribution of nematodes associated with wild bees in Turkey. Nematology. 2010;12(1):65–80. [Google Scholar]
  • 76.Holterman M, van den Elsen S, van Megen H, et al. Evolutionary relationships between members of the phylum Nematoda based on small subunit ribosomal DNA sequences. 2004 [Google Scholar]
  • 77.Kanzaki N, Kosaka H, Sayama K, Takahashi J-I, Makino S. Sphaerularia vespae sp. nov. (Nematoda, Tylenchomorpha, Sphaerularioidea), an endoparasite of a common Japanese hornet, Vespa simillima Smith (Insecta, Hymenoptera, Vespidae) Zoological Science. 2007;24(11):1134–1142. doi: 10.2108/zsj.24.1134. [DOI] [PubMed] [Google Scholar]
  • 78.Yu Q. Ditylenchus destructor Thorne, 1945 (Tylenchida: Anguinidae) in Canada. Journal of Nematology. 2012;44(4):500–500. [Google Scholar]
  • 79.Steven B, Gallegos-Graves LV, Yeager C, Belnap J, Kuske CR. Common and distinguishing features of the bacterial and fungal communities in biological soil crusts and shrub root zone soils. Soil Biology and Biochemistry. 2014;69:302–312. [Google Scholar]
  • 80.Oliveira RDL, Santin AM, Seni DJ, et al. Ditylenchus gallaeformans sp. n. (Tylenchida: Anguinidae)—a neotropical gall forming nematode with biocontrol potential against weedy Malastomataceae. Nematology. 2013;15(2):179–196. [Google Scholar]
  • 81.Davies KA, Ye W, Giblin-Davis RM, Thomas KW. Ficotylus congestae gen. n., sp. n. (Anguinata), from ficus congesta (moraceae) sycones in Australia. Nematology. 2009;11(1):63–75. [Google Scholar]
  • 82.Atighi MR, Pourajam E, Pereira TJ, et al. Redescription of Filenchus annulatus (Siddiqui & Khan, 1983) Siddiqi, 1986 based on specimens from Iran with contributions to the molecular phylogeny of the Tylenchida. Nematology. 2013;15(2):129–141. [Google Scholar]
  • 83.Palomares-Rius JE, Subbotin SA, Liébanas G, Landa BB, Castillo P. Eutylenchus excretorius Ebsary & Eveleigh, 1981 Nematoda: Tylodorinae) from Spain with approaches to olecular phylogeny of related genera. Nematology. 2009;11(3):343–354. [Google Scholar]
  • 84.Subbotin SA, Ragsdale EJ, Mullens T, Roberts PA, Mundo-Ocampo M, Baldwin JG. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters. Molecular Phylogenetics and Evolution. 2008;48(2):491–505. doi: 10.1016/j.ympev.2008.04.028. [DOI] [PubMed] [Google Scholar]
  • 85.Majd Taheri Z, Tanha Maafi Z, Subbotin SA, Pourjam E, Eskandari A. Molecular and phylogenetic studies on Pratylenchidae from Iran with additional data on Pratylenchus delattrei, Pratylenchoides alkani and two unknown species of Hirschmanniella and Pratylenchus . Nematology. 2013;15:633–651. [Google Scholar]
  • 86.Xu C, Xie H, Zhao C, Zhang S, Su X. Review of the genus Scutylenchus Jairajpuri, 1971 (Nematoda: Tylenchida), with description of Scutylenchus dongtingensis n. sp. from rhizosphere soil of grass in China. Zootaxa. 3437:32–42. [Google Scholar]
  • 87.Yang Y, Zhang S. Identification of Hemicriconemoides gaddi from the Rhizosphere of Longan. Chinese Journal of Tropical Crops. 2013;5:935–941. [Google Scholar]
  • 88.Van den Berg E, Subbotin SA, Tiedt LR. Morphological and molecular characterisation of Hemicycliophora lutosa Loof & Heyns, 1969 and H. typica de Man, 1921 from South Africa (Nematoda: Hemicycliophoridae) Nematology. 2010;12(2):303–308. [Google Scholar]
  • 89.Vovlas N, Landa BB, Liébanas G, Handoo ZA, Subbotin SA, Castillo P. Characterization of the cystoid nematode Meloidoderita kirjanovae (Nemata: Sphaeronematidae) from Southern Italy. Journal of Nematology. 2006;38(3):376–382. [PMC free article] [PubMed] [Google Scholar]
  • 90.Palomares-Rius JE, Vovlas N, Subbotin SA, et al. Molecular and morphological characterisation of Sphaeronema alni Turkina & Chizhov, 1986 (Nematoda: Sphaeronematidae) from Spain compared with a topotype population from Russia. Nematology. 2010;12(4):649–659. [Google Scholar]
  • 91.Liu G, Chen J, Xiao S, Pan D, Zhang S. Intraspecific variability of Tylenchulus semipenetrans populations on citrus and Chinese fir. Scientia Agricultura Sinica. 2011;9 [Google Scholar]
  • 92.Park BY, Park SN, Lee JK, Bae CH. Morphometric and genetic variability among Tylenchulus semipenetrans populations from citrus growing area in Korea. Plant Pathology Journal. 2009;25(3):236–240. [Google Scholar]
  • 93.Gozel U, Adams BJ, Nguyen KB, Inserra RN, Giblin-Davis RM, Duncan LW. A phylogeny of Belonolaimus populations in Florida inferred from DNA sequences. Nematropica. 2006;36(2):155–171. [Google Scholar]
  • 94.Handoo ZA, Skantar AM, Mulrooney P. First report of the sting nematode Belonolaimus longicaudatus on soybean in Delaware. Plant Disease. 2010;94(1):p. 133. doi: 10.1094/PDIS-94-1-0133B. [DOI] [PubMed] [Google Scholar]
  • 95.Stirling GR, Stirling AM, Giblin-Davis RM, et al. Distribution of southern sting nematode, Ibipora lolii (Nematoda: Belonolaimidae), on turfgrass in Australia and its taxonomic relationship to other belonolaimids. Nematology. 2013;15:401–415. [Google Scholar]
  • 96.Parkinson J, Mitreva M, Hall N, Blaxter M, McCarter JP. 400000 nematode ESTs on the Net. Trends in Parasitology. 2003;19(7):283–286. doi: 10.1016/s1471-4922(03)00132-6. [DOI] [PubMed] [Google Scholar]
  • 97.Sui DD, Atibalentja N, Noel GR, Domier LL. Genetic diversity of the rDNA locus among 27 populations and 8 races of Heterodera glycines from China, Japan, and the United States, as revealed by PCR-RFLP. Journal of Nematology. In press. [Google Scholar]
  • 98.Gao B, Allen R, Maier T, Davis EL, Baum TJ, Hussey RS. Identification of putative parasitism genes expressed in the esophageal gland cells of the soybean cyst nematode Heterodera glycines . Molecular Plant-Microbe Interactions. 2001;14(10):1247–1254. doi: 10.1094/MPMI.2001.14.10.1247. [DOI] [PubMed] [Google Scholar]
  • 99.Puthoff DP, Ehrenfried ML, Vinyard BT, Tucker ML. GeneChip profiling of transcriptional responses to soybean cyst nematode, Heterodera glycines, colonization of soybean roots. Journal of Experimental Botany. 2007;58(12):3407–3418. doi: 10.1093/jxb/erm211. [DOI] [PubMed] [Google Scholar]
  • 100.Múnera Uribe GE, Bert W, Vierstraete AR, de la Peña E, Moens M, Decraemer W. Burrowing nematodes from Colombia and their relationship with Radopholus similis populations, R. arabocoffeae and R. duriophilus. Nematology. 2010;12:619–629. [Google Scholar]
  • 101.Jacob J, Mitreva M, Vanholme B, Gheysen G. Exploring the transcriptome of the burrowing nematode Radopholus similis . Molecular Genetics and Genomics. 2008;280(1):1–17. doi: 10.1007/s00438-008-0340-7. [DOI] [PubMed] [Google Scholar]
  • 102.Li J, Peng D, Huang W. Phylogentic analysis of Radopholus similis from D2 and D3 fragments of the 28S rRNA gene sequences. Journal of Huazhong Agricultural University. 2008;5 [Google Scholar]
  • 103.Nyaku ST, Sripathi VR, Kantety RV, Gu YQ, Lawrence K, Sharma GC. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis . PLoS ONE. 2013;8(4) doi: 10.1371/journal.pone.0060891.E60891 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Zhan Y, Matafeo A, Shi H, Zheng J. Morphological and molecular characterization and host range of Rotylenchulus reniformis population occurring in Hangzhou, Zhejiang, China. Acta Phytopathologica Sinica. 2011;41(1):37–43. [Google Scholar]
  • 105.Zeng Y, Giblin-Davis RM, Ye W. Two new species of Schistonchus (Nematoda: Aphelenchoididae) associated with Ficus hispida in China. Nematology. 2007;9(2):169–187. [Google Scholar]
  • 106.Van Den Berg E, Subbotin SA, Handoo ZA, Tiedt LR. Hirschmanniella kwazuna sp. n. from South Africa with notes on a new record of H. spinicaudata (Schuurmans Stekhoven, 1944) Luc & goodey, 1964 (nematoda: Pratylenchidae) and on the molecular phylogeny of Hirschmanniella Luc & goodey, 1964. Nematology. 2009;11(4):523–540. [Google Scholar]
  • 107.Giorgi CD, Veronico P, Luca FD, Natilla A, Lanave C, Pesole G. Structural and evolutionary analysis of the ribosomal genes of the parasitic nematode Meloidogyne artiellia suggests its ancient origin. Molecular and Biochemical Parasitology. 2002;124(1-2):91–94. doi: 10.1016/s0166-6851(02)00161-5. [DOI] [PubMed] [Google Scholar]
  • 108.Anthoine G, Mugniéry D. Variability of the ITS rDNA and identification of Nacobbus aberrans (Thorne, 1935) Thorne & Allen, 1944 (Nematoda: Pratylenchidae) by rDNA amplification. Nematology. 2005;7(4):503–516. [Google Scholar]
  • 109.Al-Banna L, Williamson V, Gardner SL. Phylogenetic analysis of nematodes of the genus Pratylenchus using nuclear 26S rDNA. Molecular Phylogenetics and Evolution. 1997;7(1):94–102. doi: 10.1006/mpev.1996.0381. [DOI] [PubMed] [Google Scholar]
  • 110.Li X, Zheng J. Identification of four Pratylenchus species based on morphology and PCR-RFLP of rDNA-ITS. Acta Phytopathologica Sinica. 2013;43(4):444–448. [Google Scholar]
  • 111.Britton MT, Leslie CA, McGranahan GH, Dandekar AM. Walnut Research Reports 2009. California Walnut Board; 2010. Functional genomic analysis of walnut-nematode interactions. [Google Scholar]
  • 112.Wang JC, Huang GM, Wei YD, et al. Phylogenetic analysis of Pratylenchus (Nematoda: Pratylenchidae based on ribosomal internal transcribed spacers (ITS) and D2/D3 expansion segments of 28S rRNA gene. Acta Zootaxonomica Sinica. 2012;4:687–693. [Google Scholar]
  • 113.Chen DY, Ni HF, Tsay TT. Identification of a new recorded stunt nematode Tylenchorhynchus zeae (Nematoda: Belonolaimidae) in Taiwan. Plant Pathology Bulletin. 2007;16(2):79–86. [Google Scholar]
  • 114.Liu J, Berry RE, Moldenke AF. Phylogenetic relationships of entomopathogenic nematodes (Heterorhabditidae and Steinernematidae) inferred from partial 18S rRNA gene sequences. Journal of Invertebrate Pathology. 1997;69(3):246–252. doi: 10.1006/jipa.1997.4657. [DOI] [PubMed] [Google Scholar]
  • 115.Blanco MV, Lax P, Rondan Dueñas JC, Gardenal CN, Douc ME. Morphological and molecular characterization of the entomoparasitic nematode Hammerschmidtiella diesingi (Nematoda, Oxyurida, Thelastomatidae) Acta Parasitologica. 2012;57(3):302–310. doi: 10.2478/s11686-012-0029-2. [DOI] [PubMed] [Google Scholar]
  • 116.Nadler SA, Bolotin E, Stock SP. Phylogenetic relationships of Steinernema Travassos, 1927 (Nematoda: Cephalobina: Steinernematidae) based on nuclear, mitochondrial and morphological data. Systematic Parasitology. 2006;63(3):161–181. doi: 10.1007/s11230-005-9009-3. [DOI] [PubMed] [Google Scholar]
  • 117.Douda O, Zouhar M, Nováková E, Mazáková J, Ryšánek P. Variability of D2/D3 segment sequences of several populations and pathotypes of potato cyst nematodes (Globodera rostochiensis, Globodera pallida) Plant Protection Science. 2010;46(4):171–180. [Google Scholar]
  • 118.Stock SP, Campbell JF, Nadler SA. Phylogeny of Steinernema travassos, 1927 (Cephalobina: Steinernematidae) inferred from ribosomal DNA sequences and morphological characters. Journal of Parasitology. 2001;87(4):877–889. doi: 10.1645/0022-3395(2001)087[0877:POSTCS]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  • 119.Morris EE, Kepler RM, Long SJ, Williams DW, Hajek AE. Phylogenetic analysis of Deladenus nematodes parasitizing northeastern North American Sirex species. Journal of Invertebrate Pathology. 2013;113:177–183. doi: 10.1016/j.jip.2013.03.003. [DOI] [PubMed] [Google Scholar]
  • 120.Yu Q, de Groot P, Leal I, Davis C, Ye W, Foord B. Characterization of Deladenus siricidicola (Tylenchida: Neotylenchidae) ssociated with Sirex noctilio (Hymenoptera: Siricidae) in Canada. Intemational Joumal of Nematology. 2009;19(1):23–32. [Google Scholar]
  • 121.Zhang K, Liu H, Sun J, et al. Molecular phytogeny of geographical isolates of Bursaphelenchus xylophilus: implications on the origin and spread of this species in China and worldwide. Journal of Nematology. 2008;40(2):127–137. [PMC free article] [PubMed] [Google Scholar]
  • 122.Gasser RB, Hoste H. Genetic markers for closely-related parasitic nematodes. Molecular and Cellular Probes. 1995;9(5):315–319. doi: 10.1016/s0890-8508(95)91588-5. [DOI] [PubMed] [Google Scholar]
  • 123.Powers TO, Todd TC, Burnell AM, et al. The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. Journal of Nematology. 1997;29(4):441–450. [PMC free article] [PubMed] [Google Scholar]
  • 124.Floyd R, Abebe E, Papert A, Blaxter M. Molecular barcodes for soil nematode identification. Molecular Ecology. 2002;11(4):839–850. doi: 10.1046/j.1365-294x.2002.01485.x. [DOI] [PubMed] [Google Scholar]
  • 125.Eyualem A, Blaxter M. Comparison of biological, molecular, and morphological methods of species identification in a set of cultured Panagrolaimus isolates . Journal of Nematology. 2003;35(1):119–128. [PMC free article] [PubMed] [Google Scholar]
  • 126.De Ley P, De Ley IT, Morris K, et al. An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding. Philosophical Transactions of the Royal Society B. 2005;360(1462):1945–1958. doi: 10.1098/rstb.2005.1726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Da Silva NRR, Da Silva MC, Genevois VF, et al. Marine nematode taxonomy in the age of DNA: the present and future of molecular tools to assess their biodiversity. Nematology. 2010;12(5):661–672. [Google Scholar]
  • 128.Smith MA, Wood DM, Janzen DH, Hallwachs W, Hebert PDN. DNA barcodes affirm that 16 species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are not all generalists. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(12):4967–4972. doi: 10.1073/pnas.0700050104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.van Megen H, van den Elsen S, Holterman M, et al. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology. 2009;11(6):927–950. [Google Scholar]
  • 130.Ryss AYu. Phylogeny of the order Tylenchida (Nematoda) Russian Journal of Nematology. 1993;1(2):74–95. [Google Scholar]
  • 131.Carta LK, Skantar AM, Handoo ZA. Molecular rDNA phylogeny of telotylenchidae siddiqi, 1960 and evaluation of tail termini. Journal of Nematology. 2010;42(4):359–369. [PMC free article] [PubMed] [Google Scholar]
  • 132.Bedding RA. Controlling the pine-killing woodwasp, Sirex noctilio, with nematodes. In: Hajek AE, Glare TR, O’Callaghan M, editors. Use of Microbes For Control of Invasive Arthropods. Amsterdam, The Netherlands: Springer; 2009. pp. 213–235. [Google Scholar]
  • 133.Maggenti AR, Luc M, Raski DJ, Fortuner R, Geraert E. A reappraisal of Tylenchina (Nemata). 2. Classification of the suborder Tylenchina (Nemata: Diplogasteria) Revue De Nématologie. 1987;10(2):135–142. [Google Scholar]
  • 134.Chizhov VN, Kruchina SN. Phylogeny of the nematode order Tylenchida (Nematoda) Zoologichesky Zhurnal. 1988;67(9):1282–1293. [Google Scholar]
  • 135.Luc M, Maggenti AR, Fortuner R, Raski DJ, Geraert E. A Reappraisal of Tylenchina (Nemata) 1. For a New Approach to the Taxonomy of Tylenchina. Revue De Nématologie. 1987;10(2):127–134. [Google Scholar]
  • 136.Slobodyanyuk OV. Host specificity in tylenchids of fleas. Abstracts of Papers Presented at the Russian Society of Nematologists 1st English Language International Symposium; 1995; Zoological Institute of the Russian Academy of Sciences; pp. 102–103. [Google Scholar]
  • 137.Elsey KD. Parasitism of some economically important species of chrysomelidae by nematodes of the genus howardula. Journal of Invertebrate Pathology. 1977;29(3):384–385. [Google Scholar]
  • 138.Poinar GO, Jr., Jaenike J, Shoemaker DD. Howardula neocosmis sp.n. parasitizing North American Drosophila (Diptera: Drosophilidae) with a listing of the species of Howardula Cobb, 1921 (Tylenchida: Allantonematidae) Fundamental and Applied Nematology. 1998;21(5):547–552. [Google Scholar]
  • 139.Dennis RLH, Dapporto L, Fattorini S, Cook LM. The generalism-specialism debate: the role of generalists in the life and death of species. Biological Journal of the Linnean Society. 2011;104:725–737. [Google Scholar]
  • 140.Richmond CE, Breitburg DL, Rose KA. The role of environmental generalist species in ecosystem function. Ecological Modelling. 2005;188(2-4):279–295. [Google Scholar]
  • 141.Woolhouse MEJ, Taylor LH, Haydon DT. Population biology of multihost pathogens. Science. 2001;292(5519):1109–1112. doi: 10.1126/science.1059026. [DOI] [PubMed] [Google Scholar]
  • 142.Loxdale HD, Lushai G, Harvey JA. The evolutionary improbability of “generalism” in nature, with special reference to insects. Biological Journal of the Linnean Society. 2011;103(1):1–18. [Google Scholar]
  • 143.Castillo JC, Reynolds SE, Eleftherianos I. Insect immune responses to nematode parasites. Trends in Parasitology. 2011;27(12):537–547. doi: 10.1016/j.pt.2011.09.001. [DOI] [PubMed] [Google Scholar]
  • 144.Kassen R. The experimental evolution of specialists, generalists, and the maintenance of diversity. Journal of Evolutionary Biology. 2002;15(2):173–190. [Google Scholar]
  • 145.Samia NI, Kausrud KL, Heesterbeek H, et al. Dynamics of the plague-wildlife-human system in Central Asia are controlled by two epidemiological thresholds. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(35):14527–14532. doi: 10.1073/pnas.1015946108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146.Kaiser HE, Boucot AJ. Specialisation and extinction: cope’s law revisited. Historical Biology. 1996;11(1–4):247–265. [Google Scholar]
  • 147.Darby C, Chakraborti A, Politz SM, Daniels CC, Tan L, Drace K. Caenorhabditis elegans mutants resistant to attachment of Yersinia biofilms. Genetics. 2007;176(1):221–230. doi: 10.1534/genetics.106.067496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 148.Eroshenko GA, Vidyaeva NA, Kutyrev VV. Comparative analysis of biofilm formation by main and nonmain subspecies Yersinia pestis strains. FEMS Immunology and Medical Microbiology. 2010;59(3):513–520. doi: 10.1111/j.1574-695X.2010.00719.x. [DOI] [PubMed] [Google Scholar]
  • 149.Eroshenko GA, Vidyaeva NA, Kukleva LM, et al. Studies of biofilm formation in non-pigmented and plasmid-deprived mutants of Yersinia pestis on biotic surfaces, in vivo and in vitro conditions. Problems of Particularliy Dangerous Infections. 2012;113:45–49. [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES