Abstract
The tribe Hyoscyameae (Solanaceae) is restricted to Eurasia and includes the genera Archihyoscyamus, Anisodus, Atropa, Atropanthe, Hyoscyamus, Physochlaina, Przewalskia and Scopolia. Even though the monophyly of Hyoscyameae is strongly supported, the relationships of the taxa within the tribe remain unclear. Chloroplast markers have been widely used to elucidate plant relationships at low taxonomic levels. Identification of variable chloroplast intergenic regions has been developed based on comparative genomics of chloroplast genomes, but these regions have a narrow phylogenetic utility. In this study, we present the chloroplast genome sequence of Hyoscyamus niger and make comparisons to other solanaceous plastid genomes in terms of gene order, gene and intron content, editing sites, origins of replication, repeats, and hypothetical open reading frames. We developed and sequenced three variable plastid markers from eight species to elucidate relationships within the tribe Hyoscyameae. The presence of a horizontally transferred intron in the mitochondrial cox1 gene of some species of the tribe is considered here a likely synapomorphy uniting five genera of the Hyoscyameae. Alternatively, the cox1 intron could be a homoplasious character acquired twice within the tribe. A homoplasious inversion in the intergenic plastid spacer trnC-psbM was recognized as a source of bias and removed from the data set used in the phylogenetic analyses. Almost 12 kb of plastid sequence data were not sufficient to completely resolve relationships among genera of Hyoscyameae but some clades were identified. Two alternative hypotheses of the evolution of the genera within the tribe are proposed.
Introduction
The family Solanaceae consists of more than 2,700 species, including several economically important crops and ornamentals. The genus Hyoscyamus includes some of the most important medicinal plants belonging to the Solanaceae [1], [2]. Species of Hyoscyamus and related genera are well known as a natural source of tropane alkaloids such as hyoscyamine, scopolamine, and tropine, which have medicinal, hallucinogenic and poisonous properties [2], [3], [4]. The tribe Hyoscyameae is largely restricted to Eurasia and includes the genera Archihyoscyamus, Anisodus, Atropa, Atropanthe, Hyoscyamus, Physochlaina, Przewalskia and Scopolia [5], [6], [7], [8]. Albeit the delimitation of the tribe has been questioned based on secondary chemistry [1], [9], today the monophyly of the tribe Hyoscyameae is strongly supported based on molecular data [5], [10]. What remains unclear, however, are the relationships among the taxa of the tribe.
Morphological characters [1], alkaloid biosynthetic pathways [3], [4], cytological features [7], and a few molecular markers [5], [6], [10], [11] have been used to elucidate the phylogeny of the tribe Hyoscyameae. The resulting tree topologies based on different types of data are incongruent and the evolutionary relationships among the genera remain controversial to date. However, previous studies agreed on the monophyly of the genera Anisodus, Hyoscyamus, and Physochlaina, but disagreed on the monophyly of Scopolia [5], [10]. Archihyoscyamus, Atropanthe and Przewalskia are monotypic genera, each containing a single species. Phylogenetic studies based on plastid molecular markers showed that Physochlaina, Przewalskia and Scopolia formed a well-supported clade [5], [10], but the relationships of this clade with respect to Archihyoscyamus, Hyoscyamus, Anisodus and Atropanthe remain unresolved.
More than 260 chloroplast genomes are available from different species of land plants and ten of those belong to the angiosperm family Solanaceae: Atropa belladonna, Capsicum annuum, Datura stramonium, four species of Nicotiana, and three of Solanum [12], [13], [14], [15]. Within the tribe Hyoscyameae, only one chloroplast genome has been sequenced [16], belonging to Atropa belladonna. Chloroplast intergenic regions have been useful markers to explore phylogenetic relationships of plants and algae at different taxonomic levels [17], [18]. However, appropriate plastid regions cannot be developed without the chloroplast genome sequence of representative lineages of the group under study because different plant groups do not share the same variable plastid markers at low taxonomic levels [17], [18], [19], [20].
Here, we present the complete chloroplast genome sequence for Hyoscyamus niger and a phylogenetic study of the tribe Hyoscyameae based on novel plastid markers developed by comparative genomics. We also include a thorough comparison to other solanaceous plastid genomes. The goals of this study are: 1) to compare the chloroplast genomes of ten solanaceous species in terms of genome organization, gene and intron content, RNA editing pattern, and origin of replication, 2) to identify highly variable intergenic regions that would aid in understanding relationships of the genera within the tribe Hyoscyameae; and 3) to sequence these rapidly evolving plastid sequences from members of the tribe Hyoscyameae and test their usefulness to unveil phylogenetic relationships.
Materials and Methods
Plant material and DNA extraction
Seeds of Atropanthe sinensis (NBG944750119), Hyoscyamus niger (NBGA04750027), H. aureus (NBG914750063), H. turcomanicus (NBG904750014), H. muticus (NBG974750072), Physochlaina orientalis (NBG944750045), and P. physaloides (NBG924750021) were obtained from the Nijmegen Botanical Garden (The Netherlands). Total genomic DNA was extracted from leaves using a cetyl-trimethyl-ammonium-bromide (CTAB) DNA-extraction protocol [21]. In addition, DNA samples of Anisodus tanguticus (RGO2003-083b) and Przewalskia tangutica (RGO2003-090) were donated by Richard Olmstead (University of Washington).
Genome sequencing and assembly
Total genomic DNA from H. niger was sequenced at the Beijing Genomics Institute (BGI) with Illumina Hiseq2000 Sequencing Technology (Illumina Inc.). This produced about 6.86 Gbp (equivalent to 70 million reads) of clean paired-end reads of 80 bp. The DNA library had a mean size of 888 bp (SD = 2934 bp). Paired-end reads were assembled using the Velvet assembler 1.2.03 (Daniel Zerbino, European Bioinformatics Institute, UK). Based on the difference in read depth, nuclear (read depth <5), mitochondrial (read depth between 20 and 130), and chloroplast (read depth >150) contigs were separated. Genome assemblies and read-pair mapping patterns were visually inspected using Consed 16.0 [22]. Based on read-pair information, chloroplast contigs were connected into a single contig representing the circular map of the cpDNA. The resulting chloroplast genome was iteratively compared against all reads to identify errors until no errors remained, that is, until the high quality read depth and paired-end read depth was as expected at each base and the high quality mismatches were very low or zero.
Genome annotation
The chloroplast genome of H. niger was annotated using DOGMA [23]. Graphical genome maps were generated using OGDraw software [24]. The annotated plastid genome sequence of H. niger is available from GenBank (KF248009). Using the software ORF (MolGen, University of Groningen, Netherlands), we annotated ORFs (open reading frames) with unknown functions. Information on tandem repeats was obtained using the Tandem Repeats Finder program [25], with alignment parameters set as 2, 7, 7 for match, mismatch and indels, respectively. The maximum period size and minimum alignment score were 500 and 50, respectively. Sites of RNA editing in protein-coding genes of Hyoscyamus niger were predicted using PREP-Mt [26] with a cutoff value of 0.8.
Comparison to other solanaceous chloroplast genomes
Pairwise analyses between six solanaceous chloroplast genomes were done with mVISTA program [27] in Shuffle-LAGAN mode and with the BLAST from NCBI [28]. The whole genome identity between H. niger and each of the other solanaceous cpDNAs was calculated by VISTA. To compare predicted editing sites in each cpDNA, each known coding-gene was aligned using MacClade 4.07 [29] and analyzed individually.
Amplification and sequencing of selected chloroplast regions for phylogenetic studies
Based on pairwise comparisons of complete sequences of the chloroplast genomes from Hyoscyamus niger, Atropa belladonna, Capsicum annuum, Datura stramonium, Nicotiana tabacum and Solanum tuberosum we identified three rapidly-evolving intergenic regions that could be useful in resolving relationships within the tribe Hyoscyameae. We designed three primer pairs to amplify those regions by PCR from eight species of the tribe Hyoscyameae (Table S1). An intergenic region of 849–984 bp between the genes rps16 and trnQ was amplified with the primers Ncprps16 (5′ TGATGTATAAACACCATAATC 3′) and NcptrnQ (5′ TTCTCTACCTCCTAAATTAG 3′). Using the primer pair Ncpycf3 (5′ CATACTAATGTAGTAGTATAGG 3′) and Ncprps4 (5′ CTTAAACCTCAGACTGAAAC 3′), a region of 796–987 bp between the genes ycf3 and rps4 was amplified. To amplify the ∼650 bp region between the genes ndhF and rpl32, the primers NcpndhF (5′ ATTCACCGGATCTTACCTCT 3′) and Ncprpl32 (5′ AGCTAATAGTGTCCTCCTCAA 3′) were used. PCR conditions included initial denaturing at 94°C for 2 min; followed by 35 cycles of 94°C for 40 sec, 50°C for 45 sec, and 72°C for 1 min; followed by a final extension at 72°C for 8 min. PCR products were sequenced using an ABI 3730 (Applied Biosystems).
Sequence and phylogenetic analyses
Sequences were aligned manually with MacClade 4.0 [29]. Phylogenetic analyses were performed on individual and concatenated data sets of the three intergenic regions identified in this study (rps16-trnQ, ycf3-rps4, ndhF-rpl32) and seven previously reported regions (trnL-F, trnC-psbM, psbA-trnH, rps16-trnK, rbcL, ndhF and atpB) retrieved from GenBank. GenBank accession numbers of angiosperm sequences are listed in Table S1. Phylogenetic analyses were performed individually for each region and then all plastid markers where concatenated in a single data set. Maximum likelihood analyses were performed with Garli 0.951 [30] under the General Time Reversible model with parameters for invariable sites and gamma-distributed rate heterogeneity (GTR+I+Γ4; four rate categories). This substitution model was supported by hierarchical likelihood ratio tests performed using JModeltest [31]. Ten independent runs were conducted using either the automated stopping criterion or for up to 5,000,000 generations to ensure convergence to a similar topology and likelihood score. One hundred bootstrap (BS) replicates were performed. Bayesian inference using Mr. Bayes 3.1.2 [32] was run for 106 generations and the average standard deviation of split frequencies was 0.01. Posterior probabilities (PP) were obtained from the Bayesian analysis. In addition, maximum parsimony (MP) analyses were performed using PAUP* [33] with 1000 bootstrap replicates.
Alternative topology test
The approximately unbiased (AU) test [34] was used to evaluate whether a particular topology was significantly better than a specified (constrained) alternative topology. The CONSEL package [35] was used to calculate the probability value (p-value) of the AU test to assess the confidence in the comparison of unconstrained (best tree) and constrained trees. Constrained trees included: A) monophyly of intron-containing genera [Hyoscyamus (including Archihyoscyamus), Physochlaina, Przewalskia and Scopolia] and B) single occurrence of a 10 nt-inversion, i.e. monophyly of the genera Anisodus and Przewalskia. The most likely tree under each constraint was determined by searching for the best tree compatible with that constraint using PAUP* [33]. The site likelihoods for constrained and unconstrained trees were calculated with PAUP* and exported to CONSEL to run the AU test.
Results and Discussion
Hyoscyamus niger chloroplast genome
Next-generation sequencing, such as Illumina Hiseq2000 technology, proved to be a fast and efficient method to sequence the organellar genome of Hyoscyamus niger. The chloroplast genome of H. niger assembled into a single circular molecule of 155,720 bp in length and had a quadripartite structure similar to that of most land plant chloroplast genomes (Figure 1). The inverted repeat (IR) and large (LSC) and small single copy (SSC) regions were 25,876, 86,105 and 17,863 bp long, respectively. The global GC-content was 37.6% (LSC: 35.6%, SSC: 31.5% and IR: 42.9%). RNA genes showed a high GC-content (55.4%), probably necessary for appropriate folding of rRNAs and tRNAs.
The genome encodes 80 protein-coding genes and conserved hypothetical chloroplast reading frames (ycfs), 4 rRNA and 30 tRNA genes, not counting identical copies (Table 1). Five protein-coding genes, 4 rRNAs and seven tRNAs were duplicated in the IR. The gene infA, which codes for a translation initiation factor, is a pseudogene in H. niger, tobacco, tomato and Atropa [14], [16], [36]. The tRNA coding capacity of the H. niger cpDNA (30 tRNAs) may constitute the complete set for decoding all codons in protein-coding genes through extended wobbling or superwobbling [37]. Twelve protein-coding genes [atpF, clpP (2 introns), ndhA, ndhB, petB, petD, rpl16, rpl2, rpoC1, rps12 (2 introns), rps16 and ycf3 (2 introns)] and six tRNA genes (trnA-UGC, trnG-UCC, trnI-GAU, trnK-UUU, trnL-UAA, and trnV-UAC) contained introns. Nineteen of them were cis-spliced Group II introns, except for intron 1 in the rps12 gene, which was trans-spliced, and the intron found in trnL-UAA, which was a Group I intron. Two atypical start codons were predicted for plastid genes of H. niger; ACG in psbL and ndhD, and GTG in rps19. Previous studies [14], [16], [38] indicated that RNA editing modifies the start codon ACG to AUG in the chloroplast genes psbL and ndhD in Nicotiana tabacum and Atropa belladonna (Table 2).
Table 1. Genes identified in the chloroplast genome of Hyoscyamus niger.
Photosynthesis-related | |
Photosystem I | psaA, psaB, psaC, psaI, psaJ, ycf3 , ycf4 |
Photosystem II | psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ (ycf9) |
Cytochrome b6f complex | petA, petB , petD , petG, petL, petN (ycf6) |
NAD(P)H dehydrogenase | ndhA , ndhB , ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK |
ATP synthase | atpA, atpB, atpE, atpF , atpH, atpI |
Calvin cycle | rbcL |
Ribosomal proteins | |
Large subunit | rpl2 , rpl14, rpl16 , rpl20, rpl22, rpl23, rpl32, rpl33, rpl36 |
Small subunit | rps2, rps3, rps4, rps7, rps8, rps11, rps12 , rps14, rps15, rps16 , rps18, rps19 |
RNA polymerases | rpoA, rpoB, rpoC1 , rpoC2 |
Others | matK, clpP , accD, ccsA (ycf5), cemA (ycf10), sprA |
Hypothetical proteins | ycf1, ycf2, ycf15 |
ORFs | orf70A, orf73, orf115, orf131 |
rRNAs | rrn16, rrn23, rrn4.5, rrn5 |
tRNAs | trnA-UGC , trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC, trnG-UCC , trnH-GUG, trnI-CAU, trnI-GAU , trnK-UUU , trnL-CAA, trnL-UAA , trnL-UAG, trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG, trnR-ACG, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnT-UGU, trnV-GAC, trnV-UAC , trnW-CCA, trnY-GUA |
Note: Bold face for intron-containing genes.
Table 2. Editing sites in chloroplast genes of Solanaceae. Predicted editing sites in Hyoscyamus niger plastid genes and observed editing sites in Atropa belladonna and Nicotiana tabacum cpDNAs.
Gene | Codon number | Hyoscyamus niger (KF248009) | Atropa belladonna (NC_004561) | Nicotiana tabacum (NC_001879) | Codon in unedited mRNA (encoded amino acid) and edited codon in mRNA (encoded amino acid) |
atpA | 264 | T | T | C to U | cCc (Pro) to cUc (Leu) |
atpA | 265 | C | C to U | C to U | ucC (Ser) to ucU (Ser); synonymous edit |
atpF | 31 | C to U predicted | C to U | C to U | cCa (Pro) to cUa (Leu) |
ndhA | 114 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhA | 189 | C to U predicted | C to U | T | uCa (Ser) to uUa (Leu) |
ndhA | 358 | C to U predicted | C to U | C to U | uCc (Ser) to uUc (Phe) |
ndhB | 50 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhB | 156 | C to U predicted | C to U | C to U | cCa (Pro) to cUa (Leu) |
ndhB | 196 | C to U predicted | C to U | C to U | Cau (His) to Uau (Tyr) |
ndhB | 204 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhB | 246 | C to U predicted | C to U | C to U | cCa (Pro) to cUa (Leu) |
ndhB | 249 | C to U predicted | C to U | C to U | uCu (Ser) to uUu (Phe) |
ndhB | 277 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhB | 279 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhB | 494 | C to U predicted | C to U | C to U | cCa (Pro) to cUa (Leu) |
ndhD | 1 | C to U predicted | C to U | C to U | aCg (Thr) to aUg (Met); start codon |
ndhD | 128 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhD | 200 | T | T | C to U | uCa (Ser) to uUa (Leu) |
ndhD | 225 | T | T | C to U | uCg (Ser) to uUg (Leu) |
ndhD | 293 | C to U predicted | C to U | T | uCa (Ser) to uUa (Leu) |
ndhD | 433 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhD | 437 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhF | 97 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
ndhG | 17 | C to U predicted | C to U | C to U | uCg (Ser) to uUg (Leu) |
petB | 204 | C to U predicted | C to U | C to U | cCa (Pro) to cUa (Leu) |
psbE | 72 | C to U predicted | T | C to U | cCa (Pro) to cUa (Leu) |
psbL | 1 | C to U predicted | C to U | C to U | aCg (Thr) to aUg (Met); start codon |
rpl20 | 103 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoA | 277 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoC1 | 21 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoC2 | 1248 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoC2 | 767 | C to U predicted | C | C | probably incorrect prediction |
rpoB | 113 | C to U predicted | C to U | C to U | uCu (Ser) to uUu (Phe) |
rpoB | 158 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoB | 184 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rpoB | 667 | C to U predicted | C to U | C to U | uCu (Ser) to uUu (Phe) |
rpoB | 809 | C to U predicted | C to U | T | uCa (Ser) to uUa (Leu) |
rps2 | 45 | C to U predicted | C to U | C to U | aCa (Thr) to aUa (Ile) |
rps2 | 83 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rps14 | 27 | C to U predicted | C to U | C to U | uCa (Ser) to uUa (Leu) |
rps14 | 50 | T | T | C to U | cCa (Pro) to cUa (Leu) |
Total editing sites | 36 | 35 | 37 |
Note: T, the nucleotide thymine (T) is present at the DNA level and no editing is required; C, the nucleotide cytidine is present at the DNA level but no editing is observed or predicted; C to U, the cytidine found at the DNA level is edited to uridine in the mRNA. The genes that are no listed are not edited.
Four ORFs longer than 150 bp and with unknown functions were detected in H. niger cpDNA (ORF70A, ORF73, ORF115, ORF131; Table 1). All four ORFs were present in at least one other solanaceous chloroplast genome but showed frameshift mutations, suggesting that they are unlikely to encode functional proteins. Tandem Repeat Finder recognized 24 repeats of 9–34 nt long. The total length of tandem repeats in H. niger cpDNA was 1,416 bp, similar to that of tobacco and tomato chloroplast genomes [13].
Comparisons of cpDNAs in Solanaceae
Ten chloroplast genomes from five different genera within the Solanaceae have been sequenced [12], [13], [14], [15]. The chloroplast genome of H. niger was highly similar to others within the family, with 97.9%, 97.0%, 96.9%, 96.5%, and 96.1% identity to Atropa belladonna, Datura stramonium, Nicotiana tabacum, Solanum tuberosum, and Capsicum annuum, respectively. A detailed comparison between H. niger and A. belladonna plastid genomes indicated that the identity varied across the genome, showing 99.32% identity in the IR, and 98.78%, and 94.88% identity in coding and intergenic regions outside of the IR, respectively. Gene conversion is known to occur between the two IR [39], [40], which could be responsible for the lower mutation rate and higher GC-content in the IR.
The following features were highly conserved in plastid genomes across the family Solanaceae: genome organization, genome size (155,296–156,781 bp), gene content (80 protein-coding genes and 34 RNA genes), gene order, intron type and content (20 group II and 1 group I introns), intron locations, and overall GC-content (37–37.9%). In contrast, unknown ORFs identified in each chloroplast genome were not conserved across the Solanaceae. Two replication origins have been experimentally mapped to the inverted repeat in tobacco [41] and both features were highly similar in the chloroplast genomes of Petunia [41], Atropa [16] and H. niger (this study): 1) OriA, a 82 bp region encompassing 2 direct repeats followed by a stem-loop forming structure within the trnI-GAU intron, and 2) OriB, a 243 bp region including a stem-loop forming structure and direct repeats within the ycf1 gene.
RNA editing in chloroplast-encoded genes in Solanaceae
RNA editing in plastids is a posttranscriptional process that converts the identity of cytidines to uridines in specific sites of primary transcripts of some chloroplast genes [42]. RNA editing sites across cpDNAs of angiosperms are only poorly conserved as a result of independent losses and acquisitions of editing sites in unrelated [43] and sometimes closely related [16], [44] lineages. A total of 36 editing sites were predicted in silico for 16 chloroplast genes of H. niger (Table 2). A comparison of observed editing patterns of two Solanaceae (Atropa belladonna and Nicotiana tabacum) indicated that editing sites are relatively conserved [14], [16], [38], occurring at 17 plastid genes out of 80 different protein-coding genes (Table 2). Hyoscyamus niger shared 34 editing sites with A. belladonna and 32 with N. tabacum (Table 2), while the three taxa shared 30 editing sites with Solanum lycopersicum, suggesting its presence in their common ancestor [14]. No H. niger-specific editing sites were predicted.
Phylogenetic relationships within the tribe Hyoscyameae
Variable intergenic plastid regions with potential use in phylogenetics have been identified in several angiosperms [17], [18]. However, the phylogenetic applicability of non-coding plastid sequences are difficult to predict because the variability of each marker differs across related angiosperm clades [19]. A few variable non-coding regions (trnL-F, rps16-trnK, trnC-psbM, psbA-trnH) and plastid genes (rbcL. ndhF, atpB) have been previously sequenced from species of the tribe Hyoscyameae (Figure 2, empty boxes). Phylogenetic studies based on these markers with extensive taxon sampling showed that the genus Atropa was sister to the rest of the genera of the tribe [5], [10]. Furthermore, Anisodus, Hyoscyamus, and Physochlaina were monophyletic genera [5], [10], while Scopolia was monophyletic [10] or paraphyletic with respect to Przewalskia [5]. In addition, the genera Physochlaina, Przewalskia and Scopolia formed a well-supported clade [5], [10], but the relationships of this clade with the remaining genera of the tribe (Hyoscyamus, Archihyoscyamus, Anisodus and Atropanthe) were essentially unresolved due to low statistical support.
In this study, we identified three additional highly-variable plastid regions (rps16-trnQ, ycf3-rps4, ndhF-rpl32) for phylogenetic reconstruction within the tribe Hyoscyameae (Figure 2, filled boxes). Phylogenetic analyses based on individual (Figure S1) and concatenated plastid regions (Figure 3) were performed.
Trees based on individual plastid regions were not fully resolved due to the low phylogenetic signal of each molecular marker (Figure S1) and did not show strongly-supported conflicts among them (with one exception: trnC-psbM). Several genus-specific indels were found in the individual alignments, but none were shared by different genera; thus, they were not informative to elucidate relationships among genera of Hyoscyameae. The most variable regions for the tribe included trnC-psbM, rps16-trnQ, ycf3-rps4 and ndhF-rpl32 (Figure 2 and S1).
The plastid spacer trnC-psbM yielded a tree (Figure S1), where Przewalskia and Anisodus were sister taxa with strong bootstrap support (BS = 97%). After alignment screening, we detected a 10-nt polymorphic stretch shared by Przewalskia and Anisodus, which could be the result of a 10-nt inversion. We analyzed the surrounding sequence with Mfold [45] and detected a stem-loop forming structure with identical inverted repeats flanking the inversion and relatively high free energy (Figure S1). It is essential to recognize such microstructural changes because inversions like this can lead to robust but incorrect phylogenetic trees given its strong phylogenetic signal. The inversion event that took place within the plastid spacer trnC-psbM disrupted the site-wise homology across the 10 nt of the inversion. Thus, the dataset including the inversion violates the assumption of site-wise homology of a sequence alignment, yielding an incorrect phylogeny (Figure S1). The deletion of the 10-nt inversion significantly changed the topology of the trnC-psbM tree so that Anisodus and Przewalskia were no longer sister taxa (Figure S1). The inversion in the plastid spacer trnC-psbM (and its reversion) has occurred independently in several lineages within the Solanaceae [10], [46], [47]. The presence of the inversion in Lycianthes sp., Solanum chilense and S. pennellii and its absence in closely related taxa to the genus Lycianthes has been overlooked in an evolutionary study of the family Solanaceae, in which an incorrect plastid tree was found [10]. Recently, the inversion in the spacer trnC-psbM has been recognized through comparative genomic analysis in several species of the genus Solanum [46]. The 10-nt inversion is prone to homoplasy and should not be employed in phylogenetic studies. We removed the 10-nt inversion in all subsequent phylogenetic analyses.
We concatenated 10 plastid regions into a ∼11.6 kb data set (excluding the 10-nt inversion found in trnC-psbM) and analyzed it using a variety of phylogenetic approaches, including Maximum Likelihood (ML), Bayesian Inference and Maximum Parsimony (MP) (Figure 3). The data set consisted of 321 parsimony-informative sites. All three phylogenies were congruent and highly similar. Genera within the tribe were monophyletic with strong bootstrap support (Figure 3). A well-supported clade was formed by Physochlaina spp. + Przewalskia, which was sister to Scopolia spp. with strong support (BS>95; PP = 1.0). This grouping is also supported by seed characters [48], plastid markers [5], [10] and a nuclear gene [6]. The genus Atropa was sister to the remaining sampled Hyoscyameae, a relationship that was previously demonstrated by the presence of a retroposon in the nuclear gene GBSSI [6] and strong support in plastid phylogenies [5], [10]. The position of Atropanthe sinensis, as well as that of the genus Anisodus, was unresolved (Figure 3).
The eight species of Hyoscyamus analyzed were paraphyletic respect to Archihyoscyamus leptocalyx. A. leptocalyx, formerly known as H. leptocalyx, has been removed from the genus Hyoscyamus [8] based on flower and seed morphology, along with its unusual habitat in rock cliffs in western Asia [8], [48]. However, plastid molecular data (ndhF, trnL-F and the concatenated data set) showed that A. leptocalyx is embedded within a clade with species of Hyoscyamus [49] with strong bootstrap support (Figures 3 and S1). The taxonomic position of this species needs to be revisited using molecular data from the nuclear genome.
Based on the 11.6-kb plastid data set, we tested the possibility that the 10-nt inversion detected in the intergenic region trnC-psbM occurred independently in Przewalskia and Anisodus (as shown by the tree in Figure 3) or once in the common ancestor (in a constrained tree where Przewalskia and Anisodus were sister taxa). The AU test rejected (p = 7e-05) the sister relationship of Przewalskia and Anisodus, suggesting the parallel occurrence of this inversion (Figures 3–4) and showing it to be a homoplasious character.
Presence of the mobile cox1 intron and a proposed evolutionary scenario for Hyoscyameae
In a previous study, we detected the presence of a group I intron in the mitochondrial gene cox1 (cytochrome oxidase subunit 1) of all studied species of Hyoscyamus (9 species were analyzed), Physochlaina (3 species), Przewalskia (1 species) and Scopolia (1 species), while it was absent in the genera Anisodus (2 species), Atropa (3 species), and Atropanthe (1 species) [50] (Figure 3). Furthermore, intron-containing solanaceous taxa also had an 18 nt-signature in the flanking region of exon 2 (named the co-conversion tract - CCT), presumably obtained by gene conversion during the process of intron homing [50]. The cox1 intron is highly mobile [51], [52] and has been horizontally transferred between two solanaceous lineages, Mandragora and Hyoscyameae [50]. The lack of this signature and the intron in the cox1 gene in all the species of Atropa, Atropanthe and Anisodus analyzed (Figure 3) indicates that they never had the intron, instead of the unlikely alternative hypothesis suggesting the loss of both the intron and the signature [50]. Depending on the resolution of the phylogenetic position of Anisodus and Atropanthe within the tribe Hyoscyameae, one or two cox1 intron acquisitions (Figure 4) may be proposed to explain the intron pattern observed (Figure 3).
The phylogenetic hypothesis shown in Figure 4A suggests two independent intron acquisitions: one in the ancestor of the genus Hyoscyamus and the other in the ancestor of the clade formed by Przewalskia, Physochlaina and Scopolia. Given that the cox1 intron found in Hyoscyamus and the other Hyoscyameae are identical [50], one of the horizontal transfers of the intron may have occurred between members of the tribe; e.g. from Physochlaina to Hyoscyamus. Alternatively, based on the more parsimonious scenario of cox1 intron evolution, we propose a second possible evolutionary history of the genera within the tribe Hyoscyameae, where the cox1 intron was acquired once within the tribe (Figure 4B). Thus, the presence of the cox1 intron is considered here a synapomorphy uniting five genera of the Hyoscyameae. An AU test based on the 11.6-kb chloroplast data set did not reject (p>0.05) a tree where the intron-containing taxa (Hyoscyamus-including Archihyoscyamus-, Physochlaina, Przewalskia and Scopolia) formed a monophyletic group (Figure 4B). The hypothetical tree topology shown in Figure 4B has not been recovered or rejected by any other study based on chloroplast markers [5], [10], nuclear genes [6], cytological studies [7] or morphological characters [1], [7], [53] and it is a valid evolutionary hypothesis for the tribe Hyoscyameae. Under either evolutionary scenario, the presence of the cox1 intron and CCT is predicted for all species of Hyoscyamus, Archihyoscyamus, Physochlaina and Scopolia. In contrast, lack of the intron and CCT is expected for all species of Anisodus, Atropa and Atropanthe (Figure 4).
It is unclear why 11.6 kb of plastid sequence data were insufficient to completely resolve the relationships among genera of the tribe Hyoscyameae. The most likely explanation for the low phylogenetic resolution is a rapid diversification of the lineages within the tribe Hyoscyameae. If so, acquiring sufficient sequence data may help to resolve some of the polytomies [54], [55], [56]. It is possible that nuclear markers may aid in resolving evolutionary relationships, although the nuclear gene waxy [6] and the ribosomal spacers ITS1 and ITS2 [57] were not able to unravel the evolution of the tribe Hyoscyameae.
Supporting Information
Acknowledgments
We thank the Botanical Garden of Nijmegen for providing seeds and Dr. R. Olmstead for sharing DNA samples.
Funding Statement
This work was supported by grant PICT193 from ANCyPT to MVSP and NIH grant FIRCA-BB R03 TW008353-01. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Hoare A, Knapp S (1997) A phylogenetic conspectus of the tribe Hyoscyameae (Solanaceae). Bull Nat Hist Mus Lond 27: 11–29. [Google Scholar]
- 2. Xiao P, He L (1983) Ethnopharmacologic investgation on tropane-containing drugs in Chinese Solanaceous plants. J Ethnopharmacol 8: 1–18. [DOI] [PubMed] [Google Scholar]
- 3.Gemeinholzer B, Wink M (2001) Solanaceae: occurrence of secondary compounds versus molecular phylogeny. In: van den Berg R, Barendse G, Van der Weerden G, Mariani C, editors. Solanaceae V: Advances in Taxonomy and Utilization. Nijmegen: Nijmegen University Press. pp. 165–177.
- 4. Tetenyi (1987) A chemotaxonomic classification of the Solanaceae. Ann Missouri Bot Gard 74: 600–608. [Google Scholar]
- 5. Olmstead RG, Bohs L, Migid H, Santiago-Valentin E, Garcia V, et al. (2008) A molecular phylogeny of the Solanaceae. Taxon 57: 1159–1181. [Google Scholar]
- 6. Yuan Y-w, Zhang Z-y, Chen Z-d, Olmstead RG (2006) Tracking ancient polyploids: a retroposon insertion reveals an extinct diploid ancestor in the polyploid origin of Belladonna. Mol Biol Evol 23: 2263–2267. [DOI] [PubMed] [Google Scholar]
- 7. Tu T, Sun H, Gu Z-j, Yue J-P (2005) Cytological studies on the Sino-Himalayan endemic Anisodus and four related genera from the tribe Hyoscyameae (Solanaceae) and their systematic and evolutionary implications. Bot J Linnean Soc 147: 457–468. [Google Scholar]
- 8. Lu A-M (1997) Archihyoscyamus: a new genus of Solanaceae from Western Asia. Adansonia 19: 135–138. [Google Scholar]
- 9. D'Arcy W, Zhang Z-Y (1992) Notes on the Solanaceae of China and neighbouring areas. Novon 2: 124–128. [Google Scholar]
- 10. Tu T, Volis S, Dillon M, Sun H, Wen J (2010) Dispersals of Hyoscyameae and Mandragoreae (Solanaceae) from the New World to Eurasia in the early Miocene and their biogeographic diversification within Eurasia. Mol Phylogenet Evol 57: 1226–1237. [DOI] [PubMed] [Google Scholar]
- 11. Olmstead R, Sweere J (1994) Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Syst Biol 43: 467–481. [Google Scholar]
- 12. Chung H-J, Jung JD, Park H-W, Kim J-H, Cha HW, et al. (2006) The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp deletion in cultivated potato chloroplast DNA sequence. Plant Cell Rep 25: 1369–1379. [DOI] [PubMed] [Google Scholar]
- 13. Jo YD, Park JM, Kim J, Song W, Hur C-G, et al. (2011) Complete sequencing and comparative analyses of the pepper (Capsicum annuum L.) plastome revealed high frequency of tandem repeats and large insertions/deletions on pepper plastome. Plant Cell Rep 30: 217–229. [DOI] [PubMed] [Google Scholar]
- 14. Kahlau S, Aspinall S, Gray J, Bock R (2006) Sequence of the tomato chloroplast DNA and evolutionary comparison of solanaceous plastid genomes. J Mol Evol 63: 194–207. [DOI] [PubMed] [Google Scholar]
- 15. Yukawa Y, Tsudzuki J, Sugiura M (2006) The chloroplast genome of Nicotiana sylvestris and Nicotiana tomentosiformis: complete sequencing confirms that the Nicotiana sylvestris progenitor is the maternal genome donor of Nicotiana tabacum . Mol Gen Genet 275: 367–373. [DOI] [PubMed] [Google Scholar]
- 16. Schmitz-Linneweber C, Regel R, Du TG, Hupfer H, Herrmann RG, et al. (2002) The plastid chromosome of Atropa belladonna and its comparison with that of Nicotiana tabacum: the role of RNA editing in generating divergence in the process of plant speciation. Mol Biol Evol 19: 4602–1612. [DOI] [PubMed] [Google Scholar]
- 17. Shaw J, Lickey EB, Schilling EE, Small RL (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am J Bot 94: 275–288. [DOI] [PubMed] [Google Scholar]
- 18. Shaw J, Lickey EB, Beck JT, Farmer SB, Liu WS, et al. (2005) The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am J Bot 92: 142–166. [DOI] [PubMed] [Google Scholar]
- 19. Sarkinen T, George M (2013) Predicting plastid marker variation: can complete plastid genomes from closely related species help? PLoS One 8: e82266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Parks M, Cronn R, Liston A (2009) Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes. BMC Biology 7: 84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Doyle JJ, Doyle JL (1987) A rapid isolation procedure for small quantities of fresh leaf tissues. Phytochem Bull 19: 11–15. [Google Scholar]
- 22. Gordon D, Green P (2013) Consed: a graphical editor for next-generation sequencing. Bioinformatics 29: 2936–2937. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Wyman S, Jansen R, Boore J (2004) Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20: 3252–3255. [DOI] [PubMed] [Google Scholar]
- 24. Lohse M, Drechsel O, Bock R (2007) OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52: 267–274. [DOI] [PubMed] [Google Scholar]
- 25. Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res 27: 573–580. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Mower JP (2005) PREP-Mt: predictive RNA editor for plant mitochondrial genes. BMC Bioinformatics 6: 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Frazer K, Pachter L, Poliakov A, Rubin E, Dubchak I (2004) VISTA: computational tools for comparative genomics. Nucleic Acids Res 32.. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410. [DOI] [PubMed] [Google Scholar]
- 29.Maddison W, Maddison P (2000) MacClade version 4: analysis of phylogeny and character evolution. Sunderland, MA: Sinauer Associates.
- 30.Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. thesis. Austin: University of Texas.
- 31. Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25: 1253–1256. [DOI] [PubMed] [Google Scholar]
- 32. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17: 754–755. [DOI] [PubMed] [Google Scholar]
- 33.Swofford D, Olsen G, Waddell P, Hillis D (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4. Sunderland: Sinauer Associates.
- 34. Shimodaira H (2002) An approximately unbiased test of phylogenetic tree selection. Syst Biol 51: 492–508. [DOI] [PubMed] [Google Scholar]
- 35. Shimodaira H, Hasegawa M (2001) CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics 17: 1246–1247. [DOI] [PubMed] [Google Scholar]
- 36. Millen R, Olmstead RG, Adams KL, Palmer JD, Lao N, et al. (2001) Many parallel losses of infA from chloroplast DNA during angiosperm evolution with multiple independent transfers to the nucleus. Plant Cell 13: 645–658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Alkatib S, Scharff L, Rogalski M, Fleischmann T, Matthes A, et al. (2012) The contributions of wobbling and superwobbling to the reading of the genetic code. PloS Genet 8: e1003076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Sasaki T, Yukawa Y, Miyamoto T, Obokata J, Sugiura M (2003) Identification of RNA editing sites in chloroplast transcripts from the maternal and paternal progenitors of tobacco (Nicotiana tabacum): comparative analysis shows the involvement of distinct trans-factors for ndhB editing. Mol Biol Evol 20: 1028–1035. [DOI] [PubMed] [Google Scholar]
- 39. Khakhlova O, Bock R (2006) Elimination of deleterious mutations in plastid genomes by gene conversion. Plant J 46: 85–94. [DOI] [PubMed] [Google Scholar]
- 40. Wolfe KH, Li WH, Sharp PM (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc Natl Acad Sci USA 84: 9054–9058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Kunnimalaiyaan M, Nielsen BL (1997) Fine mapping of replication origins (oriA and oriB) in Nicotiana tabacum chloroplast DNA. Nucleic Acids Res 25: 3681–3686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Hirose T, Kusumegi T, Tsudzuki T, Sugiura M (1999) RNA editing sites in tobacco chloroplast transcripts: editing as a possible regulator of chloroplast RNA polymerase activity. Mol Gen Genet 262: 462–467. [DOI] [PubMed] [Google Scholar]
- 43. Freyer R, Kiefer-Meyer M, Kossel H (1997) Occurrence of plastid RNA editing in all major lineages of land plants. Proc Natl Acad Sci USA 94: 6285–6290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Freyer R, Lopez C, Maier RM, Martin M, Sabater B, et al. (1995) Editing of the chloroplast ndhB encoded transcript shows divergence between closely related members of the grass family (Poaceae). Plant Mol Biol 29: 679–684. [DOI] [PubMed] [Google Scholar]
- 45. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 3406–3415. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Gargano D, Scotti N, Vezzi A, Bilardi A, Valle G, et al. (2012) Genome-wide analysis of plastome sequence variation and development of plastidial CAPS markers in common potato and related Solanum species. Genet Resour Crop Evol 59: 419–430. [Google Scholar]
- 47. Tu T, Dillon M, Sun H, Wen J (2008) Phylogeny of Nolana (Solanaceae) of the Atacama and Peruvian deserts inferred from sequences of four plastid markers and the nuclear LEAFY second intron. Mol Phylogenet Evol 49: 561–573. [DOI] [PubMed] [Google Scholar]
- 48. Zhang Z-Y, Yang D-Z, Lu A-M, Knapp S (2005) Seed morphology of the tribe Hyoscyameae. Taxon 54: 71–83. [Google Scholar]
- 49. Sarkinen T, Bohs L, Olmstead RG, Knapp S (2013) A phylogenetic framework for evolutionary study of the nightshades (Solanaceae): a dated 1000-tip tree. BMC Evol Biol 13: 214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Sanchez-Puerta MV, Abbona C, Zhuo S, Tepe E, Bohs L, et al. (2011) Multiple recent horizontal transfers of the cox1 intron in Solanaceae and extended coconversion of flanking exons. BMC Evol Biol 11: 277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Cho Y, Qiu YL, Kuhlman P, Palmer JD (1998) Explosive invasion of plant mitochondria by a group I intron. Proc Natl Acad Sci USA 95: 14244–14249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Sanchez-Puerta MV, Cho Y, Mower JP, Alverson AJ, Palmer JD (2008) Frequent, phylogenetically local horizontal transfer of the cox1 group I intron in flowering plant mitochondria. Mol Biol Evol 25: 1762–1777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Yang D-Z, Zhang Z-Y, Lu A-M, Sun K, Liu J-Q (2002) Floral organogenesis and development of two taxa in the Tribe Hyoscyameae (Solanaceae)-Przewalskia tangutica and Hyoscyamus niger . Acta Bot Sinica 44: 889–894. [Google Scholar]
- 54. Soltis PS, Soltis DE (2004) The origin and diversification of angiosperms. Am J Bot 91: 1614–1626. [DOI] [PubMed] [Google Scholar]
- 55. Graybeal A (1998) Is it better to add taxa or characters to a difficult phylogenetic problem? Syst Biol 47: 9–17. [DOI] [PubMed] [Google Scholar]
- 56. Bremer B, Manen JF (2000) Phylogeny and classification of the subfamily Rubioideae (Rubiaceae). Plant Syst Evol 225: 43–72. [Google Scholar]
- 57.Uhink CH (2009) Biogeographische Beziehungen zwischen den Alpen, dem Kaukasus und den asiatischen Hochgebirgen. Ph.D. thesis. Mainz: Der Johannes Gutenberg-Universitat Mainz.
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.