Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 1.
Published in final edited form as: Mol Phylogenet Evol. 2014 Jan 31;75:245–251. doi: 10.1016/j.ympev.2014.01.012

The secret of the mermaid’s purse: Phylogenetic affinities within the Rajidae and the evolution of a novel reproductive strategy in skates

Kelcie L Chiquillo 1, David A Ebert 2, Christina J Slager 3, Karen D Crow 1
PMCID: PMC4036632  NIHMSID: NIHMS562603  PMID: 24486989

Abstract

The systematics of the skates in the family Rajidae have been contentious for over 250 years, with most studies inferring relationships among geographically clustered species, and non-overlapping taxa and data sets. Rajid skates are oviparous, and lay egg capsules with a single embryo. However, two species exhibit a derived form of egg laying, with multiple embryos per egg capsule. We provide a molecular assessment of the phylogenetic relationships of skates within the family Rajidae based on three mitochondrial genes. The resulting topology supports monophyly the family. However the genus Raja is polyphyletic, and several species assemblages need to be revised. We proposed a new assemblage as the Rostrorajini, which organizes rajid species into three well-supported tribal lineages for the first time. Further, these data provide an independent assessment of monophyly for the two species exhibiting multiple embryos per egg capsule, supporting their status as the unique genus Beringraja. In addition, we find that among the different size classes of egg capsules, ranging from 1–8 embryos per capsule in this genus, there is variation in frequency and survivorship. In Beringraja binoculata, the strategy of having two embryos per egg capsule occurs in the highest frequency and has the highest survivorship.

Keywords: Rajidae, Raja, skates, multiple embryos, mitochondrial DNA

1. INTRODUCTION

The batoids (Superorder Batomorphii) are generally regarded as a monophyletic group of cartilaginous fishes based on morphological characteristics, which is now supported independently by molecular characters (Aschliman et al., 2012). The batoids are distinguished from typical “shark”-like fishes by their dorso-ventrally flattened bodies, and expanded pectoral fins that extend forward and are fused to the head. This group consists of the skates, thornback rays, electric rays, sawfishes, guitarfishes, and stingrays. Several opposing hypotheses have inferred the interrelationships within this group with varying degrees of resolution. However, a recent molecular phylogeny, based on the mitochondrial genome and two nuclear genes, has provided a well-resolved phylogeny of the batoids; indicating that batoids and sharks are reciprocally monophyletic, and further, that skates are the ancestral batoid group (Aschliman et al., 2012).

Both batoids and sharks exhibit multiple reproductive modes, including oviparity and viviparity. Several studies have made inferences about which of these reproductive modes is ancestral in elasmobranchs from topologies based on morphological and molecular characters (Dulvy and Reynolds, 1997; Musick and Ellis, 2005). Due to expanding data sets and different analytical algorithms used for phylogenetic analysis, the consensus on the ancestral condition in cartilaginous fishes and elasmobranchs has changed several times in the last three decades (Dulvy & Reynolds 1997; Music and Ellis 2005; Long et al 2008 and Wourms 1977). As the ancestral batoid taxon (Aschliman et al., 2012; Naylor et al., 2005); this topology does not clarify the issue. Rather the ancestral condition in elasmobranchs, and even the jawed vertebrates, remains equivocal. However, it is clear that viviparity arose early in the evolution of jawed vertebrates, based on recent evidence supportng viviparity in the Placoderm, Ptyctontida (Long et al., 2008); and an extinct holocephalan (Grogan and Lund, 2011). But because these groups are extinct, it is difficult to assess topologies based on different characters for inference of ancestral states. This demonstrates the importance of having the most reliable phylogenetic context possible to infer ancestral states and the evolution of derived traits.

Skates of the family Rajidae are oviparous, and lay egg capsules with a single embryo. However, two species exhibit a derived form of egg laying, with multiple embryos per egg capsule. These have recently been proposed as sister taxa based on this unique reproductive character and aspects of clasper morphology. Here, we independently assess the phylogenetic relationships of skates within the family Rajidae, and determine when this novel mode of oviparity arose in evolution.

1.1 Systematics and Phylogenetic affinities of skates in the family Rajidae

Skates are the most diverse order of cartilaginous fishes and are composed of 287 (Ebert and Winton, 2010) of the 1221 species (Naylor et al., 2012). The sub-order Rajoidei is divided into three families-the Rajidae, the Arhynchobatidae and Anacanthobatidae (Ebert and Compagno, 2007). The family Rajidae is considered monophyletic based on skeletal elements, appendage morphology, and electric organogenesis (McEachran and Dunn, 1998). Within the Rajidae, several “tribes” and species assemblages have been described (Table 1, Ebert and Compagno, 2007; McEachran and Dunn, 1998).

Table 1.

Inventory of taxonomic sampling used in this study, including 35 taxa for 12S, 38 for 16S and 42 for COI.

Lineage No. of Genera No. of species No. of species included Scientific name 12S 16S CO1 CONCAT Common name
Squaliformes Squalus Acanthias AY830766.1 EF119335.1 EF539290 √ Spiny Dogfish
Myliobatiformes Myliobatis californica KF317712 KF317716 KF317725 √ Bat Ray
Rajiformes
 Arhynchobatidae 12 89 1 Bathyraja kincaidii KF317713 KF317717 KF317726 √ Sandpaper skate
 Anacanthobatidae 2 18 0
 Rajidae 15 133 53
  Amblyrajini *1 Amblyraja 10 4 Amblyraja badia FJ164276 Broad skate
Amblyraja doellojuradoi EU074312.1 Southern thorny skate
Amblyraja hyperborea EF100184.1 EF100184 JF895009 √ Arctic skate
Amblyraja radiata AF448012 AF106038 JF894832 √ Thorny skate
Rajella 15 3 Rajella bigelowi EU148301.1 Bigelow’s skate
Rajella fyllae EF100182 EF100182 JF894978 √ Round skate
Rajella kukujevi EF100183 EF100183 Mid atlantic skate
Leucoraja 12 4 Leucoraja circularis EF100180 EF100180 Sandy skate
Leucoraja erinacea KCh22712 KCh22712 KCh22712 √ Little skate
Leucoraja fullonica EF100179 HM140439 Shagreen skate
Leucoraja naevus EF100181 EF100181 HM043212 √ Cuckoo skate
  Gurgesiellini *1 Malacoraja 4 1 Malacoraja kreffti EF081262 EF081262 Krefft’s skate
Neoraja 4 1 Neoraja caerulea EF100178 EF100178 Blue skate
  Rajini *1 6 to 7 see Rostroraja below
Okamejei 12 4 Okamejei acutispina AF448009 EF100189 EU334813.1 √ Sharpspine skate
Okamejei kenojei AY525783 AY525783 EU310804.1 √ Ocellate spot skate
Okamejei koreana EU339351.1 Korean skate
Okamejei meerdervoortii EU334814.1 Bigeye skate
Dipturus 30 16 Dipturus batis EF081278.1 EF081275 JQ774529 √ Blue skate
Dipturus canutus EU398776 Grey skate
Dipturus cerva DQ108189.1 White-spotted skate
Dipturus confusus EU398772 Longnose skate
Dipturus pullopunctatus GU805679 Slime skate
Dipturus cambpelli GU804912 Blackspot skate
Dipturus gudgeri EU398764.1 Bight skate
Dipturus kwangtungensis AF448010 EU339346.1 Kwangtung skate
Dipturus macrocauda AF448011 Bigtail skate
Dipturus australis DQ108187.1 Sydney skate
Dipturus argentinensis EU074407 Argentine skate
Dipturus nidarosiensis EF081266 EF081268 Norwegian skate
Dipturus oxyrinchus EF081270 EU476893 GU805810.1 √ Long-nosed skate
Dipturus tengu EF081265.1 EF081265 Acutenose skate
Dipturus springeri GU805029 Roughbelly skate
Dipturus laevis GU805788 Barndoor skate
formerly Dipturus 3 1 Zearaja chilensis *3 EUO74404 Yellownose skate
formerly Dipturus 1 1 Spiniraja whitleyi *4 DQ108181 Melbourne skate
formerly Dipturus 2 1 Dentiraja lemprieri *4 EU848453 Thornback skate
  True Raja Assemblage*1,2
  TRA 13 9 Raja asterias GU597962 Starry skate
Raja brachyura EF081263 EF081263 HM043202.1 √ Blonde skate
Raja clavata EF100186 EU476888 HM043195.1 √ Thornback ray
Raja microocellata EF081264.1 EF081264 HM043199 √ Small-eyed skate
Raja miraletus EU476885 HM043183 Twineyed skate
Raja montagui EF100188 EF100188 HM043209 √ Spotted skate
Raja polystigma EF100185 EF100185 GU805539 √ Speckled skate
Raja radula EU476896 Rough skate
Raja undulata EF100187 EF100187 HM043221 √ Undulate skate
  North Pacific Assemblage*1,2
  NPA 1 6 5 Raja inornata KF317707 KF317720 KF317729 √ California skate
Raja rhina KF317708 KF317722 KF317731 √ longnose skate
Raja stellulata KF317709 KF317723 KF317732 √ Starry skate
Beringraja binoculata *5 KF317710 KF317718 KF317727 √ Big skate
formerly Raja Beringraja pulchra *5 KF317711 KF317721 KF317730 √ Mottled skate
formerly Raja
  Amphi-American Assemblage*1,2
  AAA - Rostrorajini *6 1 7 2 Raja eglanteria KF317714 KF317719 KF317728 √ Clearnose skate
Raja texana KF317715 KF317724 KF317733 √ Roundel skate
  Rostorajini *6 Formerly Rajini 1 1 Rostroraja alba EF081261 EF081261 HM043192 √ Spearnose skate

Bold indicates 30 original sequences produced for this study. Nomenclature described by: *1 McEachran and Dunn 1998, *2 Ebert and Compagno 2007, *3 Last and Gledhill 2007, *4 Last and Yearsley 2002, *5 Ishihara et al 2012, *6 this study.

Rajid genera have been defined primarily by morphological characters (Last and Gledhill, 2007; Last and Yearsley, 2002; McEachran and Aschliman, 2004) including features associated with egg capsules as a unique tool for inferring phylogenetic relationships (Ebert and Davis, 2007; Ishihara et al., 2012). Species assemblages have been proposed based on geographic region (Ebert and Compagno, 2007; Ebert and Winton, 2010). Most studies that evaluate the interrelationships within the family and generic level have been limited in taxonomic representation and geographic scale. Several studies call for a reliable phylogenetic hypothesis of the skates (Hyun Kyu Yoon, 2009), as well as members of the genus Raja (Tinti et al., 2003). While the family Rajidae is widely accepted as monophyletic, we know of no previous study that evaluates monophyly of the genus Raja, nor relationships within the Rajidae, based on molecular data. To date, two studies have proposed relevant phylogenetic hypotheses with representation of some rajid taxa: the first is based on a small number of taxa using one mitochrondrial locus (16S, Turan, 2008), while a second employs a larger data set to evaluate higher level relationships within the Batoidea (Aschliman et al., 2012). While both of these studies included some rajid species, neither have the requisite taxonomic representation to address the phylogenetic affinities within the Rajidae. Collectively, these studies have proposed various topologies representing non-overlapping taxa. Most studies have focused on relationships within regional groups. Therefore, broad phylogenetic inferences have been hampered by sampling bias, historical, and geographic constraints. In this study, we use molecular markers to infer the phylogenetic affinities of rajid taxa from multiple geographic locations including Eastern/ Western Pacific, Eastern/Western Atlantic, and the Mediterranean and Black Seas.

In this study, we focus on the hardnose skates (family Rajidae). This study includes 13 of the 17 genera within the Rajidae-Okamejei, Dipturus, Raja, Beringraja, Ambylraja, Leucoraja, Rajella, Rostroraja, Zearaja, Breviraja, Dactylobatus, Fenestraraja, Gurgesiella, Spiniraja, Dentiraja, Malacoraja, Neoraja (see Ishihara et al., 2012; Last and Yearsley, 2002)-- and evaluates the relationships of three species assemblages (with the generic name of Raja) proposed by McEachran and Dunn (1998) and Ebert and Compagno (2007, Table 1). The genus Raja has been confounded for over 250 years, when Linneaus assigned every batoid to the genus Raja (see Linnaeus, 1758) and the genus is likely polyphyletic.

1.2 A novel reproductive tactic exhibited by the big skate and mottled skate

Rajid skates lay single or paired egg capsules, known colloquially as “mermaids purses”, which contain a single embryo, and exhibit protracted incubation times ranging from four to 15 months (Serra-Pereira et al., 2011). Egg capsules require a large maternal investment that is putatively associated with increased fitness-particularly in species exhibiting smaller body sizes (Musick and Ellis, 2005). However, the mottled skate and the big skate share a unique reproductive tactic of depositing multiple embryos per egg capsule: ranging from one to five embryos for mottled skate (Beringraja pulchra) and on to eight per capsule for big skate (B. binoculata) species (Ebert, 2003; Hitz, 1964; Ishiyama, 1958). Fitness advantages or tradeoffs of this tactic are currently unknown. However, captive big skate females can deposit over 350 capsules annually (Ebert et al., 2008), and up to 6000 over a reproductive life span. This implies that the big skate may be the most fecund of any extant elasmobranch species (Ebert et al., 2008). However, survivorship among classes of embryo density has not been previously characterized.

1.3 Phylogenetic affinities of the big skate and the mottled skate

Two species—big skate (B. binoculata) and the mottled skate (B. pulchra)--share a unique reproductive strategy (Ebert and Davis, 2007; Ebert et al., 2008), as well as a distinct clasper morphology (Ishihara et al., 2012). Based on these synapomorphies, Ishihara et al (2012) assigned these species, to the new genus-Beringraja (formerly Raja). The mottled skate is endemic to the western North Pacific occurring around Japan, Korea and China at depths up to 850m, while the big skate is endemic to the eastern North Pacific occurring from Baja California to the eastern Bering Sea at depths up to 800m, albeit more commonly at depths less than 200m (Ebert et al., 2008; Ishiyama, 1958). In this study we independently evaluate the validity of the genus Beringraja, and infer whether this unique reproductive tactic shares a single evolutionary origin.

1.4 The objectives of this study are

  1. Propose a phylogenetic framework, based on molecular data, of the family Rajidae for comparison with species assemblages defined by morphological characters

  2. Independently evaluate the phylogenetic relationship between B. binoculata and B. pulchra to determine whether the unique characteristic of multiple embryos per egg capsule arose once in evolution, or twice independently.

  3. Evaluate differential survivorship among egg capsule size classes to understand potential fitness tradeoffs.

2. MATERIALS AND METHODS

2.1 Samples and Data mining

Our study includes 53 species, topologies are based on individual loci (Table 1), but we did not have a uniform taxonomic representation. Tissue samples from ten species were sampled directly or obtained from aquarium or museum collections and we provide 30 new sequences. 42 additional taxa were used for verification of sequences downloaded from public databases (National Center for Biotechnological Information, Table 1). This is the first molecular study to include both B. pulchra and B. binoculata and we sequenced three individuals for each of these species. For all other taxa we included sequences from a single individual.

2.2. DNA Extraction and PCR amplification

Muscle or fin tissues were preserved in ethanol for DNA extraction. Total genomic DNA was extracted using Qiagen DNEasy blood and tissue kit (Qiagen Inc., Valencia, CA). We constructed a molecular phylogeny based on three mitochondrial loci: (12S, 16S, CO1). Sequences were amplified using primers constructed from published primers according to (Tinti et al., 2003)and (Spies et al., 2006) (Table 2). Amplifications were performed in 25 μl reactions consisting of 8.5 μl of deionized water, 12.5 μl of 1.1xTaq Reddy Mix (Thermo Scientific, Foster City, CA), 1 μl for each of the forward and reverse primer (20μM), and 2 μl of DNA. PCR amplifications occurred under the following conditions: 35 cycles of 95° C for 1 min, 53°C (12S and 16S) or 56°C (COI) for 30 s, and 72° C for 1 min. PCR products were visualized on a 1% agarose gel, stained with ethidium bromide and visualized under UV light. The PCR product appeared as a single band and was purified using Qiagen PCR purification kit following the manufacture protocols. Sequences were deposited in GenBank under the following accession numbers (KF317707-KF317733, Table 1).

Table 2.

Summary of characters analyzed and likelihood parameters for model selection with primers for three mitochondrial loci.

12s 16s COI Concatenated
Number bp alignment informative sites 395 497 606 1498
Forward primer
5′-3′ AAACTGGGATTAGA CGCCTGTTTATCAAAAACAT CCGCTTAACTCTCAGCCATC √
Reverse primer
5′-3′ GAGGGTGACGGGCG CCGGTCTGAACTCAGATCACG TCAGGGTGACCAAAGAATCA √
Source Tinti 2003 Tinti 2003 Spies et al. 2006
MrModeltest
hLRT-1 TrN+G TrN+I+G HKY+I+G TrN+I+G
AIC GTR+G GTR+I+G TrN+I+G GTR+I+G
Model selected
A 0.3341 0.3638 0.3171 0.3167
C 0.2371 0.2019 0.2658 0.2447
G 0.1874 0.1547 0.1439 0.1504
T 0.2414 0.2796 0.2732 0.2882
Ts/Tv
pINVAR 0 0.2956 0.5736 0.5341
Gamma 0.1874 0.4351 0.9902 0.64

Bold represents the model selected based on the AIC in MrModeltest. ffff

2.3 Sequence Alignment and Phylogenetic Analyses

Sequences were aligned using Sequencher 4.1.2 (GeneCodes Corp., Ann Arbor, MI), and Se-Al (v. 2.0a11 (Rambaut, 2002). Gene trees were constructed using Maximum parsimony (MP), and Neighbor joining (NJ) algorithms using in PAUP (Swofford, 2002). Bootstrap support for all nodes in NJ and MP was based on 2000 replicates. Bayesian inferences were performed in MrBayes 3.1.2 (Huelsenbeck, 2001) with model selection determined by the Akaike Information Criteria (AIC, see Table 2), as implemented in Model Test 3.7 (Posada and Crandall, 1998). Bayesian posterier probabilities (BPP) were estimated for 100,000 generations, and Log-likelihood scores were plotted to determine when stationarity was achieved. All trees preceeding stationarity were discarded, and multiple runs were executed from random trees to ensure that the optimum tree space had been explored, resulting in identical topologies. The Shimodaira–Hasegawa was used to test for congruence between datasets (implemented in PAUP), which indicated that 16s ad COI were congruent but 12S was not. However the 12S topology was not significantly different using the T_TPT test. Further, the topology based on the combined data set was more resolved with consistently higher support values. Therefore, we present a topology based on the concatenated data set. Finally, individual gene trees were often poorly resolved but were generally consistent with the tree from the concatenated analysis. There were no supported clades in any individual gene trees that disrupted any supported nodes in the topology inferred from the concatenated data set (see supplemental figures S1–S3).

2.4 Estimating survivorship of egg capsules in an Aquarium setting

Beringraja binoculata egg capsules were collected and tagged at Aquarium of Bay (Pier 39, San Francisco, CA). A total of 103 egg capsules randomly incubated in assigned bins with respect to the date they were laid. The bins were exposed to common garden conditions with recirculating filtered seawater, light regime and water temperature over the course of one year (from January 2012–January 2013). Temperatures varied according to ambient conditions in San Francisco Bay (for example 11°C in January 2012, 13°C in March, 15–16°C in August 2012, etc.). Egg capsules were checked weekly using an LED light to quantify the number of embryos per egg capsule.

3. RESULTS

3.1 Phylogenetic affinities within the Rajidae

Phylogenetic inferences from the concatenated data set were based on 1498 bp from three-mitochondrial loci-12S, 16S, and COI (Table 1–2). Of the three outgroup taxa, Bathyraja kincaidii (Arhynchobatidae) was the most closely related to the Rajidae, as expected. The family Rajidae is monophyletic in all analyses (100/99/100) for NJ/MP/BPP, as is the Amblyrajini, (100/94/100, following (McEachran and Dunn, 1998). However, the Rajini, which includes the genera Raja, Okamejei, Dipturus (plus three genera that were formerly associated with this genus, Table 1), and Rostroraja, according to McEachran and Dunn (1998), is not monophyletic. Rostroraja alba is not associated with the remaining Rajini, but consistently groups with two Raja species-R. texana and R. eglanteria formerly described as part of the (AAA) Amphi-American assemblage (100/84/100, Figure 1). Interestingly, this clade is not closely associated with the remaining Rajini genera, but is interrupted by the Amblyrajini + Rajini clade (82/64/100).

Figure 1.

Figure 1

Phylogenetic hypothesis of skates in the family Rajidae based on a concatenated data set from three mitochondrial genes (12s, 16s, COI, 1496 bp total). Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represents lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule. The bars on the right reflect distinct tribes within the Rajidae–black represents Amblyrajini; gray represents Rajini and brown represents the Rostorajini

These data clearly indicate that the AAA are not associated with the genus Raja, and should be renamed. And, we propose that Rostroraja alba plus the seven AAA species are part of a unique assemblage that we refer to as the Rostrorajini.

The (TRA) true Raja species assemblage group together with high support (99/76/100). The genera Okamejei and Dipturus are closely associated with the TRA (__/__/96, Figure 1). These genera are within the Rajini, following McEachran and Dunn (1998). The NPA, following Ebert and Compagno (2007), was not formally included in the Rajini, however we found a close association between Okamejei + Dipturus + Raja (100/88/100, Figure 1). Therefore we propose that the NPA should be considered part of the Rajini. Interestingly, the NPA was not recovered as a monophyletic clade in our analyses, but formed two distinct lineages. Importantly, Beringraja binoculata and B. pulchra are sister taxa (formerly Raja and NPA), supporting the new generic designation from molecular data for the first time, as an independent test of phylogenetic relationships.

3.2 Fitness advantages-Hatching frequency reveals an optimal strategy

The monophyly of the two Beringraja species indicates that the reproductive tactic of multiple embryos per egg capsule arose once in the skates. To understand fitness advantages associated with this reproductive strategy, we monitored 103 egg capsules of the big skate, Beringraja binoculata, deposited throughout a single observation year. Nine of these were non-fertile and were omitted from the study. Of the 95 remaining egg capsules, 21 hatched, 27 were still incubating at end of observation period, and 47 died. Egg capsules contain a range of 1–5 embyros. Egg capsules with two embryos occur with the highest frequency (56%), and one embryo per egg capsule is the second most common strategy (34%, Figure 2). Egg capsules with 3–5 embryos are rare (Figure 2). The average incubation is 172 days (~6 months). The incubation period for egg capsules with single embryos is the most variable, ranging between 138–207 days. Egg capsules with two embryos range from 164–187 days. The embryos in the egg capsule with five embryos emerged on two separate dates-ten days apart. Two emerged on day 155 and three emerged on day 166. Egg capsules with three and four embryos did not survive past 102 days.

Figure 2.

Figure 2

Observed survivorship for 95 B. binoculata egg capsules deposited within a single year, in an aquarium setting. There were five size classes of egg capsules with 1–5 embryos each. Green represents the proporation of egg capsules that hatched within each size class; blue indicates the proportion of capsules that were still incubating at the end of the observational period; and red indicates the percent that failed to hatch (i.e. died). Egg capsule size class with the highest frequency was two embryos per egg capsule. Egg capsule size class with a single embryo exhibited the second highest frequency. Sample sizes with 3–5 embryos were rare.

Mortality was high in all egg capsule size classes. Interestingly, the size class with the lowest mortality during our observation period (42%, n=53), was the one that occurred with the highest frequency-two embryos per egg capsule. While the estimate of mortality for the three per capsule size class was close (43%, n=7), we had a much smaller sample size. Surprisingly, egg capsules with a single embryo exhibited the highest mortality (59%, n=32). Sample sizes for egg capsule size classes with three or more embryos were too small to estimate mortality (see supplemental figure-S4).

4. DISCUSSION

The genus Raja has been historically confounded and remains so to date. Phylogenetic affinities based on morphological characters have historically been confined to taxa that occur in specific geographic regions, making inferences of monophyly problematic. To our knowledge, this is the first attempt at inferring the phylogenetic affinities of “Raja” species based on molecular data with a sampling regime focused on the Rajidae. The genus Raja is clearly polyphyletic, and several taxa need revision.

According to McEachran and Dunn (1998) the Rajini tribe (Table 1) is defined by two morphological characteristics – (1) disc free of denticles, and (2) alar crowns with barbs. Our analyses support a monophyletic clade of four genera that share these characters-Raja (TRA+NPA, sensu Ebert and Compagno 2007), Okameiji, and Dipturus. However, neither Rostroraja alba nor the AAA are associated with this group, therefore these characters may have arisen convergently. We propose a revised Rajini tribe that excludes these taxa; and a new tribe, the Rostrorajini that joins them, resulting in a subdivision of rajid species into three well-supported tribal lineages for the first time.

We found no evidence to disrupt Okamejei or Dipturus as monophyletic assemblages. The TRA is monophyletic and excludes the “Raja” species associated with the NPA and the AAA. Our topology did not recover TRA and Dipturus as sister taxa, but phylogeographically they co-occur in the Meditteranean and Black sea. The close relationship between Okamejei + Dipturus +TRA indicates that all remaining taxa with the generic designation of “Raja” (not associated this clade) must be renamed. For example, species of the AAA are closely associated with the monotypic Rostroraja alba, and are not associated with the genus Raja, and this is consistent with the findings of Naylor et al. (2012). Together, we define these (formerly AAA + Rostroraja) as the Rostrorajini tribe. Likewise, the species that were formerly described as the NPA are not associated with the genus Raja, and need to be renamed as well. Our phylogenetic analysis supports the status of two species as Beringraja (Ishihara et al., 2012), and we note that the generic affinities of the remaining NPA species (Ebert and Compagno, 2007) need to be revised.

The “secret of the mermaid’s purse” reveals that the reproductive tactic of depositing multiple embryos per egg capsule arose once during the evolution of skates. This strategy is exhibited by only two species in the genus Beringraja, with two embryos per egg capsule as the most frequent, and optimal strategy. Because there is variation in fitness among the egg capsule size classes, the fecundity of B. binoculata is not necessarily equivalent to the number of embryos produced because mortality is high across all egg capsule size classes before hatching. Little is known about the total fecundity of Beringraja skates relative to other skates that lay a single embryo per egg capsule.

Both sharks and batoids exhibit various modes of reproduction including multiple conditions of maternally derived nutrition ranging from yolk-sac viviparity, histotrophy, to oophagy, to placentally derived nutrition. While a variety of viviparous conditions occur, the oviparous tactic is generally represented by a single embryo per egg capsule. Multiple embryos per egg capsule is a tactic that occurs in only two species within the Rajidae-the only batoid family that exhibits oviparity. Oviparity is a common strategy among vertebrates, but the character of multiple embryos per egg capsule appears to be quite rare, and is therefore novel. While there have been reported cases of twin embryos in chicken eggs (Jeffrey et al., 1953), some reptiles (Marion, 1980), their frequency and survivorship is extremely low (eg. <1% survivorship, Jeffrey et al., 1953), and therefore could not be considered a reproductive strategy, nor a shared tactic within a lineage. It is unclear whether siblings within a capsule are clone mates, being derived from a single egg and sperm, or even if they are full siblings (i.e. with multiple sires). Regardless, cartilaginous fishes have captured the interest of evolutionary biologists, not only because they represent an ancestral vertebrate condition, but also because they exhibit many derived forms including a striking disparity of body plans and plasticity in reproductive modes. Understanding the evolution of such complex traits requires a robust phylogenetic context.

Supplementary Material

01

Supplemental Figure 1: 12S mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

02

Supplemental figure 2: 16S mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

03

Supplemental figure 3: COI mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

04

Supplemental Figure 4: Observed mortality of B. binoculata egg capsules deposited throughout a single year in an aquarium setting. There are five size classes of egg capsules with 1–5 embryos each. The egg capsule size class with a single embryo exhibited the highest mortality, with 19 of 32 egg capsules failing to hatch (i.e. died and rotted) during the observation period. Egg capsules with 2 embryos had the lowest observed mortality with only 24 of 53 failing to hatch. Sample sizes were to low to characterize mortality in egg capsules with embryos ranging from 3–5. For example, a single egg capsule with five embryos hatched, and therefore had zero mortality during this observation period.

Highlights.

  • We propose a more inclusive Rajini tribe that includes the NPA, Okamejei, Raja (TRA), and Dipturus; and a new tribe, the Rostrorajini, that results in a subdivision of Rajid species into three well-supported tribal lineages

  • Reproductive tactic of depositing multiple embryos per egg capsule arose once during the evolution of skates.

  • This strategy is exhibited by only two species in the genus Beringraja, with two embryos per egg capsule as the most frequent, and optimal strategy.

Acknowledgments

We thank Kansas University and the California Academy of Sciences for donation of tissue samples. We thank collaborators at the Korea Ocean Research and Development Institution and Woods Hole Oceanography Institution for tissue samples as well. We thank Nereida Bravo for help with acquiring museum specimens, and database organization. We thank the Aquarium of Bay staff Jake Lavinghouse, Michael Grassmann, Kevin McElliot, Anndora Lee and Mike Mathis for help in collecting, tagging and monitoring egg capsules. We thank the National Science Foundation (NSF)-Research Experiences for Undergraduates (REU) and the National Institute of Health (NIH)-Minorities Access to Research Careers (MARC) for funding this project. Lastly, I would like to thank friends, family and my parents for all their support.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Aschliman NC, Nishida M, Miya M, Inoue GJ, Rosana KM, Naylor GJP. Body plan convergence in the evolution of skates and rays (Chondrichthyes: Batoidea) Molecular Phylogenetics and Evolution. 2012;63:28–42. doi: 10.1016/j.ympev.2011.12.012. [DOI] [PubMed] [Google Scholar]
  2. Dulvy NK, Reynolds JD. Evolutionary transitions among egg-laying, live-bearing and maternal inputs in sharks and rays. Proceedings of the Royal Society of London Series B. 1997;264:1309–1315. [Google Scholar]
  3. Ebert D, Compagno L. Biodiversity and systematics of skates (Chondrichthyes: Rajiformes: Rajoidei) Environmental Biology of Fishes. 2007;80:111–124. [Google Scholar]
  4. Ebert DA. Sharks, Rays, and Chimaeras of California. University of California Press; Berkeley: 2003. [Google Scholar]
  5. Ebert DA, Davis CD. Descriptions of skate egg cases (Chondrichthyes: Rajiformes: Rajoidei) from the eastern North Pacific. Zootaxa. 2007;1393:1–18. [Google Scholar]
  6. Ebert DA, Smith WD, Cailliet GM. Reproductive biology of two commercially exploited skates, Raja binoculata and R. rhina in the western Gulf of Alaska. Fisheries Research. 2008;94:48–57. [Google Scholar]
  7. Ebert DA, Winton MV. Chondrichthyans of High Latitude Seas. In: Carrier JC, Musick JA, Heithaus MJ, editors. Sharks and their Relatives II-Biodiversity, Adaptive Physiology and Consevation. CRC Press; Boca Raton: 2010. pp. 116–158. [Google Scholar]
  8. Grogan ED, Lund R. Superfoetative viviparity in a Carboniferous chondrichthyan and reproduction in early gnathostomes. Zoological Journal of the Linnean Society. 2011;161:587–594. [Google Scholar]
  9. Hitz CR. Observations on egg cases of the big skate (Raja binoculata Girard) found in Oregon coastal waters. Journal of the Fisheries Board of Canada. 1964;21:851–854. [Google Scholar]
  10. Huelsenbeck JP, Fredrik Ronquist. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  11. Hyun Kyu Yoon DJ, Chung Inhyuk, Jung Jin Wook, Kim Moon Ju Oh Sung, Lee Youn-Ho, Kim Choong-Gon, Hwang Seung Yong. Rapid Species Identification of Elasmobranch Fish (Skates and Rays) using Oligonucleotide Microarray. Biochip Journal. 2009;3:87–96. [Google Scholar]
  12. Ishihara H, Treloar M, Bor P, Senou H, Jeong C. The comparative morphology of skate egg capsules (Chondrichthyes: Elasmobranchii: Rajiformes) Bull Kanagawa Prefect Mus (Nat Sci) 2012;41:9–25. [Google Scholar]
  13. Ishiyama R. Observations on the egg-capsules of skates of the family Rajidae, found in Japan and its adjacent waters. Bulletin of The Museum of Comparitive Zoology at Harvard College 1958 [Google Scholar]
  14. Jeffrey FP, Fox TW, Smyth JR. Observations on double-yolked eggs from the domestic fowl. J Hered. 1953;44:213–216. [Google Scholar]
  15. Last PR, Yearsley GK. Zoogeography and relationships of Australasian skates (Chondrichthyes: Rajidae) Journal of Biogeography. 2002;29:1627–1641. [Google Scholar]
  16. Linnaeus C. Systema Naturae. 10. Holmiae, Salvii: 1758. [Google Scholar]
  17. Long JA, Trinajstic K, Young GC, Senden T. Live birth in the Devonian period. Nature. 2008;453:650–652. doi: 10.1038/nature06966. [DOI] [PubMed] [Google Scholar]
  18. Marion KR. One-egg twins in a snake, Elaphe guttata guttata. Transactions of the Kansas Academy of Science (1903-) 1980;83:98–100. [Google Scholar]
  19. McEachran JD, Dunn KA. Phylogenetic analysis of skates, a morphologically conservative clade of elasmobranchs (Chondrichthyes : Rajidae) Copeia. 1998:271–290. [Google Scholar]
  20. Musick JA, Ellis JK. Reproductive evolution of chondrichthyans. In: Hamlett WC, editor. Reproductive Biology and Phylogeny of Chondrichthyes: Sharks, Batoids and Chimaeras. Science Publishers, Inc; Enfield, NH: 2005. pp. 45–79. [Google Scholar]
  21. Naylor GJ, Caira JN, Jensen K, Rosana K, White WT, Last P. A DNA sequence-based approach to the identification of shark and ray species and its implications for global elasmobranch diversity and parasitology. Bulletin of the American Museum of Natural History. 2012:1–262. [Google Scholar]
  22. Naylor GJ, Ryburn J, Fedrigo O, Lopez J. Phylogenetic relationships among the major lineages of modern elasmobranchs. Reproductive Biology and Phylogeny. 2005;3:25. [Google Scholar]
  23. Posada D, Crandall KA. MODELTEST: testing the model of DNA substitution. Bioinformatics. 1998;14:817–818. doi: 10.1093/bioinformatics/14.9.817. [DOI] [PubMed] [Google Scholar]
  24. Rambaut A. SE-AL v. 2.0a11: sequence alignment program. 2002 ( http://tree.bio.ed.ac.uk/software/seal/)
  25. Serra-Pereira B, Figueiredo I, Gordo LS. Maturation of the gonads and reproductive tracts of the thornback ray Raja clavata, with comments on the development of a standardized reproductive terminology for oviparous elasmobranchs. Marine and Coastal Fisheries. 2011;3:160–175. [Google Scholar]
  26. Spies IB, Gaichas S, Stevenson DE, Orr JW, Canino MF. DNA-based identification of Alaska skates (Amblyraja, Bathyraja and Raja : Rajidae) using cytochrome c oxidase subunit I (coI) variation. J Fish Biol. 2006;69:283–292. [Google Scholar]
  27. Swofford DL. Phylogenetic Analysis Using Parsimony (* and other methods) Sunderland MA: 2002. [Google Scholar]
  28. Tinti F, Ungaro N, Pasolini P, De Panfilis M, Garoia F, Guarniero I, Sabelli B, Marano G, Piccinetti C. Development of molecular and morphological markers to improve species-specific monitoring and systematics of Northeast Atlantic and Mediterranean skates (Rajiformes) Journal of Experimental Marine Biology and Ecology. 2003;288:149–165. [Google Scholar]
  29. Turan C. Molecular systematic analyses of Mediterranean skates (Rajiformes) Turkish Journal of Zoology. 2008;32:437–442. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplemental Figure 1: 12S mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

02

Supplemental figure 2: 16S mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

03

Supplemental figure 3: COI mitochondrial gene tree with increased taxonomic sampling of skates from the family Rajidae. Support on nodes reflects NJ/MP/BPP that are greater than 50%. Black arrow indicates the family Rajidae. Blue lineage reflects a species assemblage previously described as the North Pacific Assemblage (NPA), and brown reflects the Amphi-American Assemblage (AAA). Gray clades highlight genera that interrupt the genus Raja. Black, gray, and red indicate clades where no nominal change is recommended. Blue and brown represent lineages in need of nominal revision. Stars indicate species that exhibit the character of multiple embryos per egg capsule.

04

Supplemental Figure 4: Observed mortality of B. binoculata egg capsules deposited throughout a single year in an aquarium setting. There are five size classes of egg capsules with 1–5 embryos each. The egg capsule size class with a single embryo exhibited the highest mortality, with 19 of 32 egg capsules failing to hatch (i.e. died and rotted) during the observation period. Egg capsules with 2 embryos had the lowest observed mortality with only 24 of 53 failing to hatch. Sample sizes were to low to characterize mortality in egg capsules with embryos ranging from 3–5. For example, a single egg capsule with five embryos hatched, and therefore had zero mortality during this observation period.

RESOURCES