Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jun 5.
Published in final edited form as: Am J Transplant. 2014 Mar 4;14(4):820–830. doi: 10.1111/ajt.12642

Perivascular Stromal Cells as a Potential Reservoir of Human Cytomegalovirus

M A Soland 1,†, L R Keyes 2,†,§, R Bayne 1, J Moon 1,‡, C D Porada 1, S St Jeor 2, G Almeida-Porada 1,*
PMCID: PMC4046334  NIHMSID: NIHMS578887  PMID: 24592822

Abstract

Human cytomegalovirus (HCMV) infection is an important cause of morbidity and mortality among both solid organ and hematopoietic stem cell transplant recipients. Identification of cells throughout the body that can potentially serve as a viral reservoir is essential to dissect mechanisms of cell tropism and latency and to develop novel therapies. Here, we tested and compared the permissivity of liver-, brain-, lung (LNG)- and bone marrow (BM)-derived perivascular mesenchymal stromal cells (MSC) to HCMV infection and their ability to propagate and produce infectious virus. Perivascular MSC isolated from the different organs have in common the expression of CD146 and Stro-1. While all these cells were permissive to HCMV infection, the highest rate of HCMV infection was seen with LNG-MSC, as determined by viral copy number and production of viral particles by these cells. In addition, we showed that, although the supernatants from each of the HCMV-infected cultures contained infectious virus, the viral copy number and the quantity and timing of virus production varied among the various organ-specific MSC. Furthermore, using quantitative polymerase chain reaction, we were able to detect HCMV DNA in BM-MSC isolated from 7 out of 19 healthy, HCMV-seropositive adults, suggesting that BM-derived perivascular stromal cells may constitute an unrecognized natural HCMV reservoir.

Keywords: Cytomegalovirus, HCMV, hematopoietic, niche, pericytes, transplantation

Introduction

Human cytomegalovirus (HCMV) infection is an important cause of morbidity and mortality among both solid organ transplant and hematopoietic stem cell (HSC) transplant recipients (1,2), causing pneumonia, gastroenteritis, retinitis, hepatitis and encephalitis, and contributing to graft failure (3). Although the use of antiviral drugs and preemptive therapy has decreased the incidence, morbidity and mortality of HCMV disease in transplant recipients, still, persistent low levels of HCMV infection have been associated with deleterious consequences (4). Therefore, identification of cells serving as the reservoir and/or that are responsible for reactivation of the disease could potentially lead to the development of novel targeted therapies.

Although several cell types, including fibroblasts, myofibroblasts, endothelial cells, smooth muscle cells, epithelial cells, neuronal cells and brain (BRN)-derived pericytes, have been shown to be susceptible to HCMV infection (5–9), hematopoietic cells, particularly myeloid progenitors, have been implicated as the major culprit in HCMV reactivation, as they have been shown to serve as a latent reservoir of this virus (10–14). In addition, studies using biopsy samples (15) and cultures of either mixed populations of bone marrow (BM) (16–18) or marrow stromal cells purified based on plastic adherence (19–21), demonstrated that HCMV was able to infect, and actively replicate in, these cell layers.

Perivascular mesenchymal stromal cells (MSC) in the BM are part of the hematopoietic microenvironmental niche and play a role in HSC maintenance and differentiation (22,23). Perivascular MSC in other organs (24,25) encircle capillaries and vessels, and are in intimate contact with circulating blood cells when they extravasate across their walls into inflamed tissues (26). In similarity to their BM counterpart, these perivascular MSC express Stro-1+ (27) and CD146+ (23,24). Moreover, all these perivascular cells express molecules for HCMV binding such as integrins beta 1 and beta 3 (28,29). We therefore hypothesized that, if these cells were susceptible to HCMV infection, they could potentially serve as a HCMV reservoir in transplantation patients. Here we show that MSC isolated based on Stro-1 positivity, from BM, liver (LVR), BRN and lung (LNG) (30), are susceptible to HCMV infection, and that the virus is able to establish a productive infection and propagate within these cells. Therefore, organ-derived perivascular MSC could play a role in HCMV infection that has thus far been overlooked.

Materials and Methods

Cell lines

Human foreskin fibroblasts (HF; kindly provided by Dr. Gregory Pari) were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA). Human BM cells were harvested from healthy adult donors after informed consent according to guidelines from the Office of Human Research Protection at the University of Nevada at Reno. Donors were determined in a commercial laboratory to be CMV-seronegative or -seropositive by testing for antibodies to CMV. Low-density BM mononuclear cells were separated using a Ficoll-Hypaque density gradient (1.077 g/mL; Sigma, St. Louis, MO) washed twice in Iscove’s modified Dulbecco’s media (Invitrogen) with penicillin (100 U/mL), streptomycin (100 mg/mL) and amphotericin B (0.25 mg/mL; Gibco Laboratories, Grand Island, NY). Stro-1+ cells were selected by magnetic cell sorting (Miltenyi Biotec, Inc., Auburn, CA) using a Stro-1 antibody (R&D Systems, Minneapolis, MN) as previously described (31). Human fetal LVR, BRN and LNG (18–22 weeks gestational age) were purchased from Advanced Bioscience Resources (Alameda, CA) and sorted using Stro-1 antibody (R&D Systems) as previously described (30,31). The purity of the sorted cells exceeded 95% and in addition to CD29+, CD44+, CD73+, CD90+, CD146+, NG2+ cells maintained Stro-1, throughout culture.

Viruses

HCMV strains FIX(VR1814)-bacterial artificial chromosome (BAC) (32) (kindly provided by Dr. Gregory Pari) and Davis (ATCC, Manassas, VA) were propagated in HF cultures and viral titers were determined using standard plaque assays (12). The FIX-BAC virus was created from the VR1814 clinical HCMV isolate, by substituting BAC DNA for the US2–US6 region (32,33). In the original FIX-BAC virus, a cassette encoding the Escherichia coli guanine phosphoribosyltransferase (gpt) gene was included within the BAC fragment to allow for selection of recombinant viral genomes (34–37). In the present study, we employed a derivative of this original virus in which the gpt gene was replaced by the green fluorescence protein (GFP) gene (38), allowing us to track and quantitate infection in real-time in living cells by visualizing green fluorescence. In this virus, expression of the GFP reporter is driven by the constitutively active HSV-TK promoter. The different stromal cell populations and control HF were infected with either strain at a multiplicity of infection (MOI) of 3 for 1 h under normal growing conditions, after which the stromal layers were washed twice with sterile phosphate-buffered saline (PBS; Sigma) to eliminate any remaining unbound viral particles, and new media was added.

DNA extraction and polymerase chain reaction

BM-MSC, BRN-MSC, LVR-MSC and LNG-MSC samples were infected with Davis strain at an MOI of 3 as described above. HF cells were also infected and used as a positive control PC. DNA was extracted from cells, prior to and after HCMV infection, using the DNeasy Blood and Tissue kit (Qiagen, Valencia, CA). The polymerase chain reaction (PCR) consisted of 1.5 mM MgCl2, 20 mM Tris–HCl (pH 8.3), 50 mM KCl, 0.2 mM dNTP mixture, 0.02U of recombinant Taq DNA polymerase (Invitrogen), 0.004 µg/µl (final concentration) of each primer (IE2A:ATGGAGTCCTCTGCCAAGAGAAAGATGGAC and IE4B:CAATACACTTCATCTC CTCGAA, which amplify a region of the HCMV unique long [UL]123 gene) and 100 ng of template DNA. The amplification conditions were: initial denaturation at 94°C (3 min), followed by 35 cycles of denaturation at 94°C (45 s), annealing at 55°C (30 s), extension at 72°C (1 min 30 s) and a final extension of 10 min at 72°C. Amplification with primers specific to β-actin served as a control for DNA integrity. β-Actin and UL123 amplification products were electrophoresed on a 1% agarose gel in 1× Tris–acetate–EDTA buffer, visualized by UV transillumination (Biospectrum, Upland, CA) and recorded using vision-WorksLS software (UVP LLC, Upland, CA). PCR controls were performed in the absence of template negative control (NC) or in the presence of viralDNA positive control (PC).

RNA extraction, DNase treatment and reverse transcriptase PCR

Total RNA was purified from each cell population before and after HCMV infection, using TRIzol® Reagent with the PureLink™ RNA Micro Kit (Invitrogen) and DNase-treated with RQ1 RNase-Free DNase (Promega, Madison, WI). To analyze presence/absence of UL123 (transcript that expresses immediate early [IE] protein) or UL83 (transcript that expresses pp65 protein), 100 ng of each RNA sample was used for cDNA synthesis using the SuperScript III first-strand synthesis system and random hexamer primers (Invitrogen). Reverse transcriptase PCR (RT-PCR) conditions were similar to those above except that the annealing temperature was raised to 57°C and primers for UL83 were UL83F: GGTATCCACGTACGCG TGAG and UL83R: CATGATGTGCGAGATCTTGC.

Negative controls (NCs) and PCs included PCR reactions in the absence of template, and in the presence of viral DNA, respectively. In addition, for each RNA sample, RT-PCR was performed in the absence of reverse transcriptase enzyme.

Microscopy

Transmitted light and fluorescence images of cell populations infected with FIX-BAC strain were captured with an Olympus IX-71 (Olympus America, Inc., Center Valley, PA) microscope with a 10× objective using bright field and/or a Fluorescein isothiocyanate (FITC) filter.

Calculation of infectious units

BM-MSC, BRN-MSC, LVR-MSC and LNG-MSC were infected with Davis at MOI of 3. After 3 h, 1, 3, 5 and 7 day postinfection (dpi), supernatants collected from infected cells were used to determine the number of infectious units (IU). To this end, HF cells were incubated for 1 h with serial 10-fold dilutions prepared from each of the MSC supernatants collected at the different time points. HF were washed twice with PBS, after which fresh media was added. HF layers were stained after 24 h for the presence of IE protein as described in the Supplementary Materials and Methods and as previously described (39–41).

Quantitative PCR

Total DNA was extracted from the different cell populations by using the DNeasy Blood and tissue kit (Qiagen) following the manufacturer’s instructions. DNA was eluted into 100 µL nuclease-free water and quantified using a NanoDrop (Thermo Fisher Scientific, Inc., Wilmington, DE). The amount of viral DNA present in the samples was determined by absolute amplification of the US6 HCMV gene in a quantitative PCR (qPCR) reaction as detailed in the Supplementary Materials and Methods using the following US6 primers: sense: AACGATACAGGGGACTGCAC; antisense: ACGGGATTTGTGCGTTTTAG. To perform the calibration curve for qPCR, we purified and performed serial 10-fold dilutions of the US6 HCMV recombinant DNA vector (42) containing known viral copies per microliter (from 1 × 108 to 1 × 102 viral copies per reaction) that were amplified simultaneously and under the same conditions as the MSC samples. The Ct values obtained from each standard dilution were plotted against the viral copy number to construct the standard curve. Each Ct value, obtained from US6 DNA amplification for each sample, was used to extrapolate, from the standard curve, the absolute viral copy number for that sample. Finally, the viral copy numbers for each sample were statistically compared to the numbers obtained for the HCMV negative samples. The amplification results were validated based on the quality of dissociation curves and high amplification efficiency of the primers. Each sample was analyzed at least in triplicate, along with no-template controls, serial dilutions of the solution containing known viral copies per microliter and mock infected samples.

Nested qPCR

The amount of viral DNA present in naturally infected stromal cells was determined by absolute amplification of the US6 HCMV gene in a nested qPCR reaction. Briefly, DNA purified from each sample was first amplified in the same conditions as the qPCR reaction previously described, but for 30 cycles using the following outer primers: US6 sense: GACCCGAAAACCCTTCTCTC; antisense: ACGGGATTTGTGCGTTTTAG. After the first round of qPCR, a second 25 µL mix of the same composition was added to each reaction substituting inner (nested) primers instead of outer primers, and the first round amplicon serving as template. PCR cycling conditions were the same as before but for only 20 cycles. The sequences of US6 inner primers were as follows: US6 sense: GACCCGAAAACCCTTCTCTC; antisense: GTGCAGTCCCCTGTATCGTT. The standard calibration curve for absolute qPCR was performed as described in the previous section, but the dilutions of the vector solution ranged from 1 × 104 to 1 × 102 viral copies per reaction. Each Ct value, obtained from the second round of US6 DNA amplification for each sample, was used to extrapolate from the standard curve the absolute viral copy number for that sample. Finally, the viral copy numbers for each sample were statistically compared to the values obtained for the HCMV negative samples. Each sample was analyzed at least in triplicate, along with no-template controls, serial dilutions of the solution containing known viral copies per microliter and HCMV negative samples.

Statistical analysis

Experiments were independently repeated at least three times. Results are presented as mean ± SD. One-way analysis of variance followed by Tukey’s post hoc test analysis for multiple comparisons was performed in the studies addressing production and release of infectious viral particles; p-values <0.05 were considered to be statistically significant.

Two-tailed t-tests were used to determine statistical significance between amplification values obtained from stromal cells from different donors when compared to stromal cells from CMV negative donors; p-values < 0.05 were considered to be statistically significant.

Results

BM-, LVR-, BRN- and LNG-derived perivascular Stro-1+ MSC are permissive to HCMV infection as determined by detection of GFP-positive cells and detection of virus-induced cytopathic effects

We used the Davis (43) and FIX-BAC (32) strains of HCMV to investigate the permissivity of BM-, LVR-, BRN- and LNG-derived Stro-1+ perivascular MSC to HCMV infection. MSC were isolated from the different organs based on Stro-1 expression, as previously described (30). Flow cytometric analysis revealed these cells to be CD29+, CD44+, CD73+, CD90+, CD146+, NG2+ and negative for the hematopoietic markers CD34 and CD45. After infection of stromal layers with HCMV FIX-BAC at an MOI of 3, susceptibility to infection was assessed, in each one of the cell populations, by analyzing GFP expression over a 10-day period. GFP expression was readily seen by day 5 in BM-(n = 4) LVR-(n = 4), LNG-(n = 4) and BRN-(n = 4) MSC (Figure 1A).

Figure 1.

Figure 1

(A) Perivascular stromal cells are permissive to in vitro infection with HCMV FIX-BAC and are able to propagate the virus. Human foreskin fibroblasts (HF); Stro-1-selected bone marrow (BM)-, liver (LVR)-, lung (LNG)- and brain (BRN)-mesenchymal stromal cells (MSC) were infected at MOI of 3 with HCMV FIX-BAC strain and analyzed for 10 days for infection and viral growth/spread through the expression of GFP using an Olympus IX-71 microscope with a 10× objective. (B) Supernatants from HCMV FIX-BAC-infected cells were used to serially infect, de novo, respective stromal layers. BAC, bacterial artificial chromosome; GFP, green fluorescence protein; HCMV, human cytomegalovirus.

In order to demonstrate that each of the different cell layers supported HCMV FIX-BAC replication, supernatants from infected BM-, LVR-, LNG- and BRN-MSC were collected at 10 dpi and used to infect new cell monolayers of the corresponding cell type from which each supernatant had been harvested. As can be seen in Figure 1B, GFP expression was readily observed by day 5 in all stromal cell layers, demonstrating that all phases of viral replication occurred upon initial infection.

We also infected MSC derived from the various organs with HCMV Davis at MOI of 3, and investigated the generation of cytopathic effects (CPE) in cell cultures (n = 6 for each cell type). In a 10-day period, all infected cells displayed HCMV CPEs (Figure 2), demonstrating their susceptibility to HCMV infection.

Figure 2. HCMV Davis strain infects perivascular stromal cells.

Figure 2

Cytopathic effects were observed in human fibroblasts (HF), Stro-1-selected bone marrow (BM)-, liver (LVR)-, lung (LNG) and brain (BRN)-mesenchymal stromal cells (MSC) after infection with HCMV Davis strain at MOI of 3. These representative images of the cytopathic effects were taken at 10 dpi with Olympus IX-71 microscope with a 10× objective. HCMV, human cytomegalovirus; MOI, multiplicity of infection.

In addition, and in similarity to HCMV FIX-BAC, HCMV Davis could also be propagated in all BM-, LVR-, LNG- and BRN-MSC monolayers (data not shown).

BM-, LVR-, BRN- and LNG-derived perivascular Stro-1+ MSC produce and release infectious viral particles

We next collected at 3 h, 1, 3 and 5 dpi, supernatants from the different MSC layers infected with HCMV Davis strain at an MOI of 3, and used each of the supernatants to infect HF cells. Analysis of HF cells for the presence IE proteins at 48 h postinfection demonstrated conclusively that supernatants from each of the HCMV-infected MSC cultures contained infectious viral particles with the ability to infect HF. After calculating the number of IU present at the different time points, the values were log 10–transformed to allow statistical comparison between the number of viral particles present in the supernatants of the different MSC types (Figure 3). At 1 dpi, BM-MSC (3.70 ± 0.13; n = 3), LNG-MSC (3.55 ± 0.16; n = 3) and LVR-MSC (3.61 ± 0.03; n = 3) supernatants had similar levels of IU. BRN-MSC supernatants (3.22 ± 0.17; n = 3) had lower levels than the LVR- and BM-MSC (p < 0.05), but the difference was not significant when compared with LNG-MSC (p > 0.05).

Figure 3. Perivascular stromal cells produce and release infectious viral particles.

Figure 3

In order to determine the number of infectious units (IU) produced by infected BM-, LNG-, LVR- and BRN-MSC, these cells were infected with HCMV Davis strain at MOI of 3, and supernatants collected at 3 h postinfection, 1, 3, and 5 dpi and used to infect HF. The number of IE-positive HF present at the different time points were calculated, and the values were log 10–transformed and plotted graphically, to facilitate comparison between the supernatants from the different MSC types. The results represent the mean ± SD from three independent experiments. BM, bone marrow; BRN, brain; dpi, day postinfection; HCMV, human cytomegalovirus; HF, human foreskin fibroblasts; IE, immediate early; LNG, lung; LVR, liver; MOI, multiplicity of infection; MSC, mesenchymal stromal cells.

By contrast, at 3 dpi, BRN-MSC (4.69 ± 0.12) produced significantly higher levels than the LVR- and BM-MSC (p < 0.05), and LNG-MSC formed the highest levels of viral particles (6.67 ± 0.06) when compared with the other three populations (p < 0.05). At this same time point, LVR-MSC (3.63 ± 0.01) and BM-MSC (3.83 ± 0.12) produced the smallest amount of IU, with no significant difference between the two cell populations (p > 0.05).

At 5 dpi, production of IU was maintained in BM-, BRN- and LNG-MSC. BM-MSC levels were 3.58 ± 0.04; BRN, 4.89 ± 0.05; LNG, 6.57 ± 0.05; and LVR-MSC, 6.90 ± 0.04.

BM-, LVR-, BRN- and LNG-derived perivascular Stro-1+ MSC are permissive to HCMV infection as determined by presence of the IE gene UL123 and quantitation of CMV genomes

HCMV (Davis strain)-infected MSC (n = 3 for each population at MOI of 3) were extensively washed to remove residual viral particles, and allowed to grow for 7 days with regular media changes to remove any possible residual unbound virions. Mock-infected cells were used as NCs to ascertain that the viral DNA amplified by PCR resulted from successful HCMV infection in vitro. DNA was extracted at 7 dpi and PCR was performed with primers specific for the IE gene UL123, as described in the Materials and Methods section. HCMV-infected MSC were positive for HCMV DNA, while the mock-infected cells were consistently devoid of HCMV DNA (Figure 4A), demonstrating that cultures were indeed infected by HCMV and maintained the viral genome. Further confirmation of successful HCMV infection of the various MSC was obtained by using qPCR to determine the viral copy number present in the cultured MSC at 7 dpi. As can be seen in Figure 4B, all cultures contained ≥5 × 104 viral copies/100 ng of cellular DNA. Since an MOI of 3 corresponds to 4.8 × 104 viral copies/100 ng of cellular DNA, the presence of viral copy numbers exceeding the initial viral input at 7 days after exposure to HCMV demonstrates successful infection of the MSC and production of new viral genomes. In addition, LNG-MSC contained a significantly higher number of viral copy numbers by 100 ng/DNA than any other organ-derived MSC.

Figure 4. Perivascular stromal cells are permissive to HCMV infection in vitro.

Figure 4

(A) Stro-1-selected bone marrow (BM)-, liver (LVR)-, lung (LNG)- and brain (BRN)-derived mesenchymal stromal cells (MSC) were infected at MOI of 3 with HCMV Davis strain, and the presence of viral UL123 (immediate early gene) DNA was analyzed at 7 dpi by PCR. Negative control (NC) consisted of PCR in absence of DNA. Positive control (PC): PCR in presence of viral HCMV Davis strain DNA; Mock: PCR performed with DNA from respective cell populations prior to infection, to establish the specificity of the assay and to ensure that amplification was not due to latent HCMV in stromal layers. Amplification of β-actin was used to verify DNA integrity. Marker: 1 kb plus Ladder. (B) Quantitative PCR determined the viral copy number present in the different cultured cells at 7 dpi. To prepare a calibration/standard curve, known number of viral copies per microliter and serial 10-fold dilutions (from 1 × 108 to 1 × 102 viral copies per reaction) were amplified simultaneously and under the same conditions as the various MSC samples. The Ct values obtained from each standard dilution were then plotted against the viral copy number to construct the standard curve. Each Ct value, obtained from viral DNA amplification for each sample, was used to extrapolate from the standard curve the absolute viral copy number for that sample. Finally, the viral copy numbers for each sample were statistically compared to the numbers obtained for the HCMV negative samples. The amplification results were validated based on the quality of dissociation curves and high amplification efficiency of the primers. Each sample was analyzed at least in triplicate, along with nontemplate controls, serial dilutions of the solution containing known viral copies per microliter, and mock infected samples. HCMV, human cytomegalovirus; MOI, multiplicity of infection; PCR, polymerase chain reaction; UL, unique long.

Transcription of UL123 and UL83 genes after HCMV infection of Stro-1+ BM-, LVR-, BRN- and LNG-derived perivascular MSC

In order to confirm that HCMV was able to establish a productive infection, BM- (n = 3), LVR- (n = 3), BRN- (n = 3) and LNG- (n = 3) MSC, and HF (n = 3) were infected with HCMV Davis strain at MOI of 3, and analyzed by RT-PCR for expression UL123 and UL83 (44). In order to exclude any potential DNA contamination or viral carryover, NCs included PCR reactions in the absence of template, and for each RNA sample, RT-PCR was performed in the absence of reverse transcriptase enzyme. Analysis of mRNA at 1, 3 and 5 dpi demonstrated that UL123 and UL83 were being transcribed at most time points during the 5 days following infection (Figure 5).

Figure 5. Transcription of UL123 and UL83 genes confirms HCMV infection of Stro-1+ bone marrow (BM)-, liver (LVR)-, lung (LNG)- and brain (BRN)-derived MSC.

Figure 5

HF and Stro-1-selected human LVR-, LNG-, BRN- and BM-MSC were infected at MOI of 3 with HCMV Davis strain. RNA from each cell population, prior to and after infection, was purified, DNase-treated, reverse-transcribed and analyzed for the presence of UL123 and UL83 transcripts up to 5 dpi. Amplification of β-actin was used as a positive control to verify RNA integrity and ensure that the RT-PCR reactions were successfully performed. Negative control (NC): PCR in absence of cDNA. Positive control (PC): PCR in presence of viral HCMV DNA. Mock: PCR performed with cDNA from uninfected cells to guarantee that amplification was not due to reactivation of latent HCMV in stromal layers. In addition, for each RNA sample, RT-PCR was performed in the absence of reverse transcriptase enzyme (NO RT). dpi, day postinfection; HCMV, human cytomegalovirus; HF, human foreskin fibroblasts; MOI, multiplicity of infection; MSC, mesenchymal stromal cells; PCR, polymerase chain reaction; UL, unique long.

BM-, LVR-, BRN- and LNG-derived perivascular Stro-1+ MSC are naturally infected with HCMV

We next investigated whether BM-MSC served as a natural reservoir for HCMV within the body by performing nested qPCR (n = 3) on MSC isolated from the BM of 19 healthy HCMV-seropositive donors. Our results showed that 7 of these 19 donors harbored HCMV DNA (Figure 6) in their BM-derived stromal cells, confirming that these cells were naturally infected in these individuals.

Figure 6. Bone marrow (BM)-, liver (LVR)-, brain (BRN)- and lung (LNG)-derived perivascular Stro-1+ mesenchymal stromal cells (MSC) are naturally infected with HCMV.

Figure 6

DNA isolated from BM-MSC obtained from healthy CMV-seropositive adult donors, and DNA isolated from LNG-, BRN- and LVR-MSC from different donors, for which serologic status/presence of active disease was unknown were analyzed by nested qPCR. Negative controls included BM-MSC from CMV serologically negative adult donors, as well as stromal cells obtained from cord tissue from serologically negative mothers. CMV, cytomegalovirus; HCMV, human cytomegalovirus; qPCR, quantitative polymerase chain reaction.

The same method for US6 nested PCR (n = 3) was used to determine whether LNG-, (n = 9) BRN- (n = 9) and LVR- (n = 8) MSC contained HCMV DNA sequences (Figure 6). While the serologic status or the presence of active disease was unknown for these donors, eight out of nine BRN donors, seven out of nine LNG donors and four out of nine LVR donors were found to be positive for viral DNA, demonstrating that LVR, BRN and LNG stromal cells can be naturally infected with HCMV. Of note is also that LNG-derived stromal cells, overall, had the highest copy number/100 ng of DNA of any naturally infected tissue, while BM had the least (p < 0.05) (Figure 6).

Discussion

HCMV infection remains one of the major complications after both solid organ and allogeneic BM transplantation (BMT), contributing to allograft rejection and development of graft-versus-host disease (45). While in solid organ recipients the transplanted organ is the main target of CMV infection, in BMT recipients, interstitial pneumonia is the primary manifestation of HCMV infection (46). In addition, HCMV is one of the pathogens that have been convincingly implicated in the pathophysiology of cardiac allograft vasculopathy and arteriosclerosis (47). Although the hematopoietic myeloid lineage has been implicated as the main reservoir of the virus (14,17,48–51), HCMV transmission occurs following transplantation of virtually every organ; therefore, it is conceivable that tissue-derived cell populations are also able to be infected and serve as a reservoir contributing to HCMV disease (52). For instance, we and others have shown that, within the BM, the stromal components are susceptible to HCMV infection (17,19,53,54), and that HCMV replication differs depending upon the cell type and organ of origin (6). When HCMV-infected BRN microvascular endothelial cells (BMVEC) and aortic-derived endothelial cells (AEC) were compared, the former underwent rapid cellular lysis, while in the latter the infection was nonlytic, but cells continued to release the virus for the lifespan of the culture. In addition, mature viral particles were only detected at significant amounts in the cytoplasm of BMVEC. This suggests that the levels of HCMV replication in endothelial cells obtained from different organs are distinct, and that in addition to hematopoietic cells, persistently infected AEC may also serve as a reservoir of the virus (6). When other BRN-derived cells, such as human BRN pericytes (7), were infected with HCMV, these cells, in similarity to BMVEC, experienced lytic infection. By contrast, neural progenitor cells and mature neural cell types were shown to be fully permissive to HCMV, but depending on the strain of HCMV used, the development of CPE varied (55). Therefore, identification of cells that are permissive to HCMV within the different organs could provide a means of pinpointing the source of viral transmission and/or reactivation. Here, we demonstrate that perivascular MSC, isolated from organs directly associated with HCMV pathological manifestations, are productively infected by HCMV, albeit at different levels. It has been shown that MSC actively migrate to sites of inflammation, allograft rejection (56) and vascular injury (57), and actively participate in tissue repair. Therefore, CMV-positive MSC could conceivably be mobilized into circulation and spread the virus to the transplanted tissue and thereby contribute to pathology and/or rejection.

In agreement with other studies using AEC (6), BM-derived stroma (54), BRN-derived endothelial cells (6) and BRN pericytes (7), we show that HCMV is able to infect BRN-, LVR-, LNG- and BM-derived perivascular MSC and release infectious virus particles. In addition, because all the perivascular MSC used in these studies were isolated based upon Stro-1 expression (27,58) and displayed identical phenotypic markers (30), we were able, for the first time, to perform a side-by-side comparison of identical perivascular cell populations harvested from different organs, for their susceptibility to and kinetics of HCMV infection. The highest HCMV infection rate was observed in LNG-MSC, while MSC from the BM exhibited the lowest viral load. We also demonstrated conclusively that supernatants from each of the HCMV-infected MSC cultures contained infectious viral particles, with the number of infectious virions produced varying widely between the various organ-specific MSC. For instance, LVR-MSC produced high levels of virions at a later time point than LNG-MSC, and the viral copy number/100 ng of DNA of LVR-MSC was considerably lower than that of LNG-MSC, demonstrating differing abilities of these two phenotypically identical cell populations to support a productive infection. BM-MSC remained the cell type producing the smallest number of viral particles throughout culture and containing the smallest viral copy number/100 ng of DNA. However, because of their direct interaction with HSC within the niche, it is possible that they can still function as a source of HCMV infection. Indeed, in the present study, using nested qPCR, we were able to demonstrate the presence of HCMV DNA in BM-MSC from 7 out of 19 healthy, HCMV-seropositive adults; the viral copy number/100 ng DNA was significantly lower than those found after in vitro infection of the same cells. While other studies have been unsuccessful in finding HCMV DNA in BM-MSC from serologically positive human patients (54), the ability to detect HCMV infection is continually improving as more sensitive tests are developed, and it is likely that our use of a more sensitive nested qPCR assay contributed to our ability to detect HCMV-infected MSC within these seropositive donors.

In conclusion, organ-derived perivascular MSC are permissive to HCMV infection and have the ability to produce infectious HCMV virions, providing evidence that they may represent a previously overlooked natural HCMV reservoir for infection.

Supplementary Material

Suppl 1

Acknowledgments

This work was supported by National Institutes of Health NHLBI: HL97623.

Abbreviations

AEC

aortic-derived endothelial cells

BAC

bacterial artificial chromosome

BM

bone marrow

BMT

BM transplantation

BMVEC

brain microvascular endothelial cells

BRN

brain

CPE

cytopathic effects

dpi

day postinfection

GFP

green fluorescence protein

HCMV

human cytomegalovirus

HF

human foreskin fibroblasts

HSC

hematopoietic stem cells

IE

immediate early

IU

infectious units

LNG

lung

LVR

liver

MOI

multiplicity of infection

MSC

mesenchymal stromal cells

NC

negative control

PBS

phosphate buffered saline

PC

positive control

PCR

polymerase chain reaction

qPCR

quantitative polymerase chain reaction

RT

reverse transcriptase

UL

unique long

Footnotes

Disclosure

The authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.

Supporting Information

Additional Supporting Information may be found in the online version of this article.

Supplementary Materials and Methods

References

  • 1.Freeman RB., Jr The ‘indirect’ effects of cytomegalovirus infection. Am J Transplant. 2009;9:2453–2458. doi: 10.1111/j.1600-6143.2009.02824.x. [DOI] [PubMed] [Google Scholar]
  • 2.Baldanti F, Lilleri D, Gerna G. Monitoring human cytomegalovirus infection in transplant recipients. J Clin Virol. 2008;41:237–241. doi: 10.1016/j.jcv.2007.12.001. [DOI] [PubMed] [Google Scholar]
  • 3.Griffiths PD. Burden of disease associated with human cytomegalovirus and prospects for elimination by universal immunisation. Lancet Infect Dis. 2012;12:790–798. doi: 10.1016/S1473-3099(12)70197-4. [DOI] [PubMed] [Google Scholar]
  • 4.Legendre C, Pascual M. Improving outcomes for solid-organ transplant recipients at risk from cytomegalovirus infection: Late-onset disease and indirect consequences. Clin Infect Dis. 2008;46:732–740. doi: 10.1086/527397. [DOI] [PubMed] [Google Scholar]
  • 5.Sinzger C, Jahn G. Human cytomegalovirus cell tropism and pathogenesis. Intervirology. 1996;39:302–319. doi: 10.1159/000150502. [DOI] [PubMed] [Google Scholar]
  • 6.Fish KN, Soderberg-Naucler C, Mills LK, Stenglein S, Nelson JA. Human cytomegalovirus persistently infects aortic endothelial cells. J Virol. 1998;72:5661–5668. doi: 10.1128/jvi.72.7.5661-5668.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Alcendor DJ, Charest AM, Zhu WQ, Vigil HE, Knobel SM. Infection and upregulation of proinflammatory cytokines in human brain vascular pericytes by human cytomegalovirus. J Neuroinflammation. 2012;9:95. doi: 10.1186/1742-2094-9-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Almeida GD, Porada CD, St Jeor S, Ascensao JL. Human cytomegalovirus alters interleukin-6 production by endothelial cells. Blood. 1994;83:370–376. [PubMed] [Google Scholar]
  • 9.Michelson S, Rohrlich P, Beisser P, et al. Human cytomegalovirus infection of bone marrow myofibroblasts enhances myeloid progenitor adhesion and elicits viral transmission. Microbes Infect. 2001;3:1005–1013. doi: 10.1016/s1286-4579(01)01464-2. [DOI] [PubMed] [Google Scholar]
  • 10.Mendelson M, Monard S, Sissons P, Sinclair J. Detection of endogenous human cytomegalovirus in CD34+ bone marrow progenitors. J Gen Virol. 1996;77:3099–3102. doi: 10.1099/0022-1317-77-12-3099. [DOI] [PubMed] [Google Scholar]
  • 11.Goodrum F, Jordan CT, Terhune SS, High K, Shenk T. Differential outcomes of human cytomegalovirus infection in primitive hematopoietic cell subpopulations. Blood. 2004;104:687–695. doi: 10.1182/blood-2003-12-4344. [DOI] [PubMed] [Google Scholar]
  • 12.Maciejewski JP, Bruening EE, Donahue RE, Mocarski ES, Young NS, St Jeor SC. Infection of hematopoietic progenitor cells by human cytomegalovirus. Blood. 1992;80:170–178. [PubMed] [Google Scholar]
  • 13.Saffert RT, Penkert RR, Kalejta RF. Cellular and viral control over the initial events of human cytomegalovirus experimental latency in CD34+ cells. J Virol. 2010;84:5594–5604. doi: 10.1128/JVI.00348-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hahn G, Jores R, Mocarski ES. Cytomegalovirus remains latent in a common precursor of dendritic and myeloid cells. Proc Natl Acad Sci USA. 1998;95:3937–3942. doi: 10.1073/pnas.95.7.3937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fest T, Angonin R, Mougin C, et al. Detection of cytomegalovirus-infected cells in bone marrow biopsy specimens obtained before allogeneic bone marrow transplantation from donors and recipients. Transplantation. 1994;57:1681–1683. [PubMed] [Google Scholar]
  • 16.Apperley JF, Dowding C, Hibbin J, et al. The effect of cytomegalovirus on hemopoiesis: In vitro evidence for selective infection of marrow stromal cells. Exp Hematol. 1989;17:38–45. [PubMed] [Google Scholar]
  • 17.Simmons P, Kaushansky K, Torok-Storb B. Mechanisms of cytomegalovirus-mediated myelosuppression: Perturbation of stromal cell function versus direct infection of myeloid cells. Proc Natl Acad Sci USA. 1990;87:1386–1390. doi: 10.1073/pnas.87.4.1386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Taichman RS, Nassiri MR, Reilly MJ, Ptak RG, Emerson SG, Drach JC. Infection and replication of human cytomegalovirus in bone marrow stromal cells: Effects on the production of IL-6, MIP- 1alpha, and TGF-beta1. Bone Marrow Transplant. 1997;19:471–480. doi: 10.1038/sj.bmt.1700685. [DOI] [PubMed] [Google Scholar]
  • 19.Smirnov SV, Harbacheuski R, Lewis-Antes A, Zhu H, Rameshwar P, Kotenko SV. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential. Virology. 2007;360:6–16. doi: 10.1016/j.virol.2006.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lagneaux L, Delforge A, Snoeck R, Stryckmans P, Bron D. Decreased production of cytokines after cytomegalovirus infection of marrow-derived stromal cells. Exp Hematol. 1994;22:26–30. [PubMed] [Google Scholar]
  • 21.Reiser H, Kuhn J, Doerr HW, Kirchner H, Munk K, Braun R. Human cytomegalovirus replicates in primary human bone marrow cells. J Gen Virol. 1986;67:2595–2604. doi: 10.1099/0022-1317-67-12-2595. [DOI] [PubMed] [Google Scholar]
  • 22.Mendez-Ferrer S, Michurina TV, Ferraro F, et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature. 2010;466:829–834. doi: 10.1038/nature09262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sacchetti B, Funari A, Michienzi S, et al. Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell. 2007;131:324–336. doi: 10.1016/j.cell.2007.08.025. [DOI] [PubMed] [Google Scholar]
  • 24.Crisan M, Yap S, Casteilla L, et al. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell. 2008;3:301–313. doi: 10.1016/j.stem.2008.07.003. [DOI] [PubMed] [Google Scholar]
  • 25.Gerlach JC, Over P, Turner ME, et al. Perivascular mesenchymal progenitors in human fetal and adult liver. Stem Cells Dev. 2012;21:3258–3269. doi: 10.1089/scd.2012.0296. [DOI] [PubMed] [Google Scholar]
  • 26.Pober JS, Tellides G. Participation of blood vessel cells in human adaptive immune responses. Trends Immunol. 2012;33:49–57. doi: 10.1016/j.it.2011.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Simmons PJ, Torok-Storb B. Identification of stromal cell precursors in human bone marrow by a novel monoclonal antibody STRO-1. Blood. 1991;78:55–62. [PubMed] [Google Scholar]
  • 28.Feire AL, Roy RM, Manley K, Compton T. The glycoprotein B disintegrin-like domain binds beta 1 integrin to mediate cytomegalovirus entry. J Virol. 2010;84:10026–10037. doi: 10.1128/JVI.00710-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bentz GL, Yurochko AD. Human CMV infection of endothelial cells induces an angiogenic response through viral binding to EGF receptor and beta1 and beta3 integrins. Proc Natl Acad Sci USA. 2008;105:5531–5536. doi: 10.1073/pnas.0800037105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sanada C, Kuo CJ, Colletti EJ, et al. Mesenchymal stem cells contribute to endogenous FVIIIc production. J Cell Physiol. 2013;228:1010–1016. doi: 10.1002/jcp.24247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Colletti EJ, Airey JA, Liu W, et al. Generation of tissue-specific cells from MSC does not require fusion or donor-to-host mitochondrial/membrane transfer. Stem Cell Res. 2009;2:125–138. doi: 10.1016/j.scr.2008.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Murphy E, Yu D, Grimwood J, et al. Coding potential of laboratory and clinical strains of human cytomegalovirus. Proc Natl Acad Sci USA. 2003;100:14976–14981. doi: 10.1073/pnas.2136652100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hahn G, Khan H, Baldanti F, Koszinowski UH, Revello MG, Gerna G. The human cytomegalovirus ribonucleotide reductase homolog UL45 is dispensable for growth in endothelial cells, as determined by a BAC-cloned clinical isolate of human cytomegalovirus with preserved wild-type characteristics. J Virol. 2002;76:9551–9555. doi: 10.1128/JVI.76.18.9551-9555.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Borst EM, Hahn G, Koszinowski UH, Messerle M. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: A new approach for construction of HCMV mutants. J Virol. 1999;73:8320–8329. doi: 10.1128/jvi.73.10.8320-8329.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Greaves RF, Brown JM, Vieira J, Mocarski ES. Selectable insertion and deletion mutagenesis of the human cytomegalovirus genome using the Escherichia coli guanosine phosphoribosyl transferase (gpt) gene. J Gen Virol. 1995;76:2151–2160. doi: 10.1099/0022-1317-76-9-2151. [DOI] [PubMed] [Google Scholar]
  • 36.McVoy MA, Mocarski ES. Tetracycline-mediated regulation of gene expression within the human cytomegalovirus genome. Virology. 1999;258:295–303. doi: 10.1006/viro.1999.9724. [DOI] [PubMed] [Google Scholar]
  • 37.Greaves RF, Mocarski ES. Defective growth correlates with reduced accumulation of a viral DNA replication protein after low-multiplicity infection by a human cytomegalovirus ie1 mutant. J Virol. 1998;72:366–379. doi: 10.1128/jvi.72.1.366-379.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang D, Bresnahan W, Shenk T. Human cytomegalovirus encodes a highly specific RANTES decoy receptor. Proc Natl Acad Sci USA. 2004;101:16642–16647. doi: 10.1073/pnas.0407233101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Chou SW, Scott KM. Rapid quantitation of cytomegalovirus and assay of neutralizing antibody by using monoclonal antibody to the major immediate-early viral protein. J Clin Microbiol. 1988;26:504–507. doi: 10.1128/jcm.26.3.504-507.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hemmings DG, Kilani R, Nykiforuk C, Preiksaitis J, Guilbert LJ. Permissive cytomegalovirus infection of primary villous term and first trimester trophoblasts. J Virol. 1998;72:4970–4979. doi: 10.1128/jvi.72.6.4970-4979.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nordling D, Kaiser A, Reeves L. Release testing of retroviral vectors and gene-modified cells. Methods Mol Biol. 2009;506:265–279. doi: 10.1007/978-1-59745-409-4_18. [DOI] [PubMed] [Google Scholar]
  • 42.Soland MA, Bego MG, Colletti E, et al. Modulation of human mesenchymal stem cell immunogenicity through forced expression of human cytomegalovirus us proteins. PLoS ONE. 2012;7:e36163. doi: 10.1371/journal.pone.0036163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Weller TH, Hanshaw JB, Scott DE. Serologic differentiation of viruses responsible for cytomegalic inclusion disease. Virology. 1960;12:130–132. doi: 10.1016/0042-6822(60)90156-2. [DOI] [PubMed] [Google Scholar]
  • 44.Schmolke S, Kern HF, Drescher P, Jahn G, Plachter B. The dominant phosphoprotein pp65 (UL83) of human cytomegalovirus is dispensable for growth in cell culture. J Virol. 1995;69:5959–5968. doi: 10.1128/jvi.69.10.5959-5968.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Beam E, Razonable RR. Cytomegalovirus in solid organ transplantation: Epidemiology, prevention, and treatment. Curr Infect Dis Rep. 2012;14:633–641. doi: 10.1007/s11908-012-0292-2. [DOI] [PubMed] [Google Scholar]
  • 46.Varani S, Landini MP. Cytomegalovirus-induced immunopathology and its clinical consequences. Herpesviridae. 2011;2:6. doi: 10.1186/2042-4280-2-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Valantine HA. The role of viruses in cardiac allograft vasculopathy. Am J Transplant. 2004;4:169–177. doi: 10.1046/j.1600-6143.2003.00316.x. [DOI] [PubMed] [Google Scholar]
  • 48.Hargett D, Shenk TE. Experimental human cytomegalovirus latency in CD14+ monocytes. Proc Natl Acad Sci USA. 2010;107:20039–20044. doi: 10.1073/pnas.1014509107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Minton EJ, Tysoe C, Sinclair JH, Sissons JG. Human cytomegalovirus infection of the monocyte/macrophage lineage in bone marrow. J Virol. 1994;68:4017–4021. doi: 10.1128/jvi.68.6.4017-4021.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Streblow DN, Nelson JA. Models of HCMV latency and reactivation. Trends Microbiol. 2003;11:293–295. doi: 10.1016/s0966-842x(03)00149-5. [DOI] [PubMed] [Google Scholar]
  • 51.Koffron AJ, Hummel M, Patterson BK, et al. Cellular localization of latent murine cytomegalovirus. J Virol. 1998;72:95–103. doi: 10.1128/jvi.72.1.95-103.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Seckert CK, Griessl M, Buttner JK, et al. Viral latency drives ‘memory inflation’: A unifying hypothesis linking two hallmarks of cytomegalovirus infection. Med Microbiol Immunol. 2012;201:551–566. doi: 10.1007/s00430-012-0273-y. [DOI] [PubMed] [Google Scholar]
  • 53.Almeida-Porada G, Ascensao JL. Isolation, characterization, and biologic features of bone marrow endothelial cells. J Lab Clin Med. 1996;128:399–407. doi: 10.1016/s0022-2143(96)80012-6. [DOI] [PubMed] [Google Scholar]
  • 54.Sundin M, Orvell C, Rasmusson I, Sundberg B, Ringden O, Le Blanc K. Mesenchymal stem cells are susceptible to human herpesviruses, but viral DNA cannot be detected in the healthy seropositive individual. Bone Marrow Transplant. 2006;37:1051–1059. doi: 10.1038/sj.bmt.1705368. [DOI] [PubMed] [Google Scholar]
  • 55.D’Aiuto L, Di Maio R, Heath B, et al. Human induced pluripotent stem cell-derived models to investigate human cytomegalovirus infection in neural cells. PLoS ONE. 2012;7:e49700. doi: 10.1371/journal.pone.0049700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wu GD, Nolta JA, Jin YS, et al. Migration of mesenchymal stem cells to heart allografts during chronic rejection. Transplantation. 2003;75:679–685. doi: 10.1097/01.TP.0000048488.35010.95. [DOI] [PubMed] [Google Scholar]
  • 57.Wan M, Li C, Zhen G, et al. Injury-activated transforming growth factor beta controls mobilization of mesenchymal stem cells for tissue remodeling. Stem Cells. 2012;30:2498–2511. doi: 10.1002/stem.1208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Bianco P, Cao X, Frenette PS, et al. The meaning, the sense and the significance: Translating the science of mesenchymal stem cells into medicine. Nat Med. 2013;19:35–42. doi: 10.1038/nm.3028. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl 1

RESOURCES