Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2014 Jul;80(13):4051–4062. doi: 10.1128/AEM.01146-14

Benzoate Metabolism Intermediate Benzoyl Coenzyme A Affects Gentisate Pathway Regulation in Comamonas testosteroni

Dong-Wei Chen a,b, Yun Zhang c, Cheng-Ying Jiang a,d, Shuang-Jiang Liu a,d,*,✉
Editor: F E Löffler
PMCID: PMC4054210  PMID: 24771026

Abstract

A previous study showed that benzoate was catabolized via a coenzyme A (CoA)-dependent epoxide pathway in Azoarcus evansii (R. Niemetz, U. Altenschmidt, S. Brucker, and G. Fuchs, Eur. J. Biochem. 227:161-168, 1995), but gentisate 1,2-dioxygenase was induced. Similarly, we found that the Comamonas testosteroni strain CNB-1 degraded benzoate via a CoA-dependent epoxide pathway and that gentisate 1,2-dioxygenase (GenA) was also induced when benzoate or 3-hydroxybenzoate served as a carbon source for growth. Genes encoding the CoA-dependent epoxide (box genes) and gentisate (gen genes) pathways were identified. Genetic disruption revealed that the gen genes were not involved in benzoate and 3-hydroxybenzoate degradation. Hence, we investigated gen gene regulation in the CNB-1 strain. The PgenA promoter, a MarR-type regulator (GenR), and the GenR binding site were identified. We found that GenR took gentisate, 3-hydroxybenzoate, and benzoyl-CoA as effectors and that binding of GenR to its target DNA sequence was prohibited when these effectors were present. In vivo studies showed that the CNB-1 mutant that lost benzoyl-CoA synthesis was not able to activate PgenA promoter, while transcription of genA was upregulated in another CNB-1 mutant that lost the ability to degrade benzoyl-CoA. The finding that benzoyl-CoA (a metabolic intermediate of benzoate degradation) and 3-hydroxybenzoate function as GenR effectors explains why GenA was induced when CNB-1 grew on benzoate or 3-hydroxybenzoate. Regulation of gentisate pathways by MarR-, LysR-, and IclR-type regulators in diverse bacterial groups is discussed in detail.

INTRODUCTION

Bacteria adopt three different strategies for benzoate degradation. (i) Under anaerobic conditions, benzoate is first converted to benzoyl coenzyme A (benzoyl-CoA), which is subsequently reduced to cyclohex-1,5-diene-1-carbonyl-CoA; the latter compound is finally cleaved into acetyl-CoA (1). (ii) Under aerobic conditions, benzoate is initially oxidized by mono-oxygenases into dihydroxylated intermediates such as catechol (2, 3), protocatechuate (3, 4), or gentisate (3, 5); the dihydroxylated intermediates are cleaved at the 1,2 or 3,4 position and linearized by various dioxygenases, such as catechol 1,2-dioxygenase (6, 7), protocatechuate 3,4-dioxygenase (8, 9), and gentisate 1,2-dioxygenase (7, 9). (iii) The CoA-dependent epoxide pathway (10, 11) (Fig. 1A) is used. The CoA-dependent epoxide pathway begins at activation of benzoate to benzoyl-CoA by benzoate-CoA ligase. Benzoyl-CoA is subsequently converted into an epoxide (2,3-epoxybenzoyl-CoA) (12), which is catalyzed by benzoyl-CoA oxygenase (BoxB) and reductase (BoxA) (11). 2,3-Epoxybenzoyl-CoA is hydrolyzed into formic acid and 3,4-dehydroadipyl-CoA semialdehyde by benzoyl-CoA hydratase (BoxC) (13). The latter intermediate is subsequently oxidized by 3,4-dehydroadipyl-CoA semialdehyde dehydrogenase (BoxD) to 3,4-dehydroadipyl-CoA (14). Further metabolism of 3,4-dehydroadipyl-CoA proceeds via reactions similar to β-oxidation and the β-ketoadipate pathway (3, 15), with succinyl-CoA and acetyl-CoA as products (11). Thus far, the CoA-dependent epoxide pathway has been found in Pseudomonas species (16), Escherichia coli (17–19), Azoarcus evansii, and Bacillus species (10, 11, 20).

FIG 1.

FIG 1

Open in a new tab

The CoA-dependent epoxide pathway (A) and its genetic cluster (B) and the gentisate 1,2-dioxygenase pathway (C) and its genetic cluster (D) in C. testosteroni. Abbreviations: BCL, benzoate-CoA ligase; BoxA, benzoyl-CoA reductase; BoxB, benzoyl-CoA oxygenase (2,3-epoxidase); BoxC, 2,3-epoxybenzoyl-CoA dihydrolase; BoxD, 3,4-dehydroadipyl-CoA semialdehyde dehydrogenase; GenA, gentisate 1,2-dioxygenase; GenC, maleylpyruvate isomerase; GenB, fumarylpyruvate hydrolase. In panel A, gene tags for these strain CNB-1 enzymes are beneath the arrows.

Multiple metabolic pathways for benzoate degradation may occur simultaneously in bacteria, making benzoate degradation a complex process. A catechol ortho-cleavage pathway and two benzoyl-CoA pathways are involved in benzoate degradation in Burkholderia xenovorans LB400 (21), and transcription and expression of genes in these pathways are dependent on the growth phase of this bacterium (22). Recently, benzoate degradation in A. evansii (formerly Pseudomonas strain KB 740) was shown to proceed through a CoA-dependent epoxide pathway (11). However, gentisate 1,2-dioxygenase activity was induced in this particular strain (23). Niemetz et al. deduced that benzoate was degraded via 3-hydroxybenzoyl-CoA and gentisate (24), but subsequent studies did not support this hypothesis (25). To date, an explanation for induction of gentisate 1,2-dioxygenase activity in KB 740 is lacking.

The Comamonas testosteroni strain CNB-1 was isolated for degradation of 4-chloronitrobenzene (4-CNB) (26). In addition to 4-CNB, CNB-1 also uses benzoate and many other aromatic compounds as carbon sources for growth (26, 27) and has been applied for rhizoremediation of CNB-polluted soil (28). Our previous investigations revealed that the CNB-1 strain metabolizes 4-CNB via a partial reductive pathway and metabolizes 3-hydroxybenzoate, 4-hydroxybenzoate, protocatechuate, and vanillate via the protocatechuate 4,5-cleavage pathway. CNB-1 grows on benzoate, but how it degrades benzoate has not been investigated. Previous studies reported that gentisate 1,2-dioxygenase activity was induced when CNB-1 grew on benzoate (27). In the present study, we showed that CNB-1 degrades benzoate via a CoA-dependent epoxide pathway (Fig. 1A) but not a gentisate pathway (Fig. 1C). We identified the promoter (PgenA) of the gen cluster, a MarR-type transcriptional regulator (GenR), and gentisate, benzoyl-CoA, and 3-hydroxybenzoate as effectors of GenR. We further demonstrated that benzoyl-CoA induced transcription of genA, and thus, benzoyl-CoA was responsible for the induction of gentisate 1,2-dioxygenase activities during benzoate degradation in CNB-1.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. E. coli was grown aerobically on a rotary shaker (200 rpm) at 37°C in Luria-Bertani (LB) broth or on LB plates with 1.5% (wt/vol) agar. C. testosteroni was cultivated and maintained in LB medium or in minimal salt broth (MSB) (29) containing 1 g/liter of ammonium chloride as the nitrogen source at 30°C. Benzoate, gentisate, pyruvate, or succinate was added at a final concentration of 2 mM when used as a carbon and energy source. Cellular growth was monitored by measuring the optical density of the culture at a wavelength of 600 nm (OD600). If necessary, antibiotics were used at the following concentrations: kanamycin, 50 μg/ml (E. coli) and 150 μg/ml (C. testosteroni); tetracycline, 20 μg/ml (for both E. coli and C. testosteroni).

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Description Reference or source
Strains
    Comamonas testosteroni
        CNB-1 Wild type 26
        CNB-1Δ0097bcl A fragment of 0097bcl encoding amino acids 152 to 436 was deleted This study
        CNB-1Δ0097bcl/pBBR1MCS3-bcl Complementation for CNB-1Δ0097bcl This study
        CNB-1Δ0394bcl A fragment of 0394bcl DNA was deleted This study
        CNB-1Δ0097_0394bcl Carries mutations of 0097bcl and 0394bcl This study
        CNB-1ΔboxAB DNA fragment encoding BoxAB was deleted This study
        CNB-1ΔboxAB/pBBR1MCS3-boxBA Complementation for CNB-1ΔboxAB This study
        CNB-1ΔboxC A fragment of boxC encoding amino acids 15 to 472 was deleted This study
        CNB-1ΔboxC/pBBR1MCS3-boxC Complementation for CNB-1ΔboxC This study
        CNB-1ΔgenA A fragment of genA encoding amino acids 1 to 332 was deleted This study
        CNB-1ΔgenA_boxC Carries mutations of genA and boxC This study
    E. coli
        DH5α ϕ80 lacZ ΔM15 endA1 recA1 hsdR17(rK− mK−) supE44 ΔlacU169 31
        BL21(DE3) F− ompT hsdSB(rB− mB−) gal dcm λDE3 (harboring gene 1 of the RNA polymerase from the phage T7 under the control of the PlacUV5 promoter) 31
        Rosetta(DE3) F− ompT hsdSB(rB− mB−) gal dcm (DE3) pRARE (Camr) Novagen
Plasmids
    pK18mobsacB Mobilizable vector; allows selection of double crossover in CNB-1 34
    pK18mobsacB-Δ0097bcl Construction of CNB-1Δ0097bcl and CNB-1Δ0097_0394bcl This study
    pK18mobsacB-Δ0394bcl Construction of CNB-1Δ0394bcl This study
    pK18mobsacB-ΔboxAB Construction of CNB-1ΔboxAB This study
    pK18mobsacB-ΔboxC Construction of CNB-1ΔboxC and CNB-1ΔgenA_boxC This study
    pK18mobsacB-ΔgenA Construction of CNB-1ΔgenA This study
    pBBR1MCS3 Tcr, lacPOZ′ broad-host-range vector with R-type conjugative origin 54
    pBBR1MCS3-bcl Carries 0097bcl to generate complementation for 0097bcl This study
    pBBR1MCS3-boxBA Carries boxBA to generate complementation for boxAB This study
    pBBR1MCS3-boxC Carries boxC to generate complementation for boxC This study
    pBBR1MCS2-PgenA::eGFP pBBR1MCS2 derivative for fusion of PgenA and eGFP This study
    pET28a Expression vector Novagen
    pET28a-bcl pET28a derivative for expression of 0097bcl This study
    pET28a-boxA pET28a derivative for expression of boxA This study
    pET28a-boxB pET28a derivative for expression of boxB This study
    pET28a-boxC pET28a derivative for expression of boxC This study
    pET28a-boxD pET28a derivative for expression of boxD This study
    pET28a-genA pET28a derivative for expression of genA This study
    pET28a-genB pET28a derivative for expression of genB This study
    pET28a-genC pET28a derivative for expression of genC This study
    pET28a-genR pET28a derivative for expression of genR This study
Open in a new tab

Comparative proteomic analysis.

Comparative proteomic studies were conducted as previously described (30). Briefly, cells were harvested at the late exponential phase of growth and sonicated on ice. Supernatants of cellular lysates (ca. 300 μg proteins) were analyzed by 2-dimensional electrophoresis (2-DE). Isoelectric focusing and sodium dodecyl sulfate-polyacrylamide gel electrophoresis were conducted as previously described (30). Proteins were digested with trypsin, and the resultant peptides were detected by mass spectrometry. Protein identification was carried out according to peptide fingerprint analysis. A two-tailed Student's t test was adopted to evaluate the spot differences between the control and experimental gels (P < 0.05). Significant change in protein abundance was defined as a 2-fold increase above the normalized volume in the two sets of 2-DE spots. Three biological tests were run in parallel.

DNA extraction, plasmid isolation, PCR amplification, and DNA sequence analysis.

CNB-1 genomic DNA was isolated and purified using the SiMax genomic-DNA extraction kit (SBS Genetech, Beijing, China). DNA manipulation, plasmid preparation, agarose gel electrophoresis, ligation, and transformation were performed using standard methods (31). Plasmids were extracted and purified with the plasmid minispin HP kit (Vigorous, Beijing, China). Restriction endonucleases, T4 DNA ligase, and DNA polymerases were used as recommended by the manufacturer's instructions (New England BioLabs, Beijing, China).

Primers used for DNA amplification in this work are listed in Table S1 in the supplemental material. To facilitate cloning, forward and reverse primers were flanked with restriction endonuclease sites (see Table S1). PCRs were carried out in a Biometra thermocycler (Analytik Jena, Germany) using Pfu or Taq DNA polymerases (TransGen Tech, Beijing, China). PCR products were analyzed by electrophoresis using 0.8% agarose gels and purified from gels with the Tiangel midi purification kit (Tiangen, Beijing, China). Fragments were digested using the corresponding endonucleases and ligated into the pEASY-T1 vector.

The chromosome sequence of C. testosteroni CNB-2 (accession no. NC_013446) (32), a plasmid-curing derivative of the C. testosteroni strain CNB-1 (26, 29), was retrieved from GenBank (http://www.ncbi.nlm.nih.gov). Sequence comparisons and database searches were performed using BLAST programs at the BLAST server of the NCBI website.

Construction of mutants and genetic complementation.

Truncated target genes were obtained by gene splicing and overlap extension (33). For genetic disruption and complementation, pK18mobsacB and pBBR1MCS3 vectors were used. Various plasmids derived from these vectors were constructed, and their relevant characteristics are listed in Table 1. Plasmids were electroporated into CNB-1, and the mutants obtained were screened according to the method of Schäfer et al. (34), except that LB medium was supplemented with sucrose at a final concentration of 20%. Deletion of the target genes in pK18mobsacB derivatives and in the CNB-1 mutants was verified by PCR amplification. Complementation of the target genes was conducted by introducing pBBR1MCS3 derivatives into the mutants.

Overexpression and purification of enzymes.

His6-tagged fusion proteins of benzoate-CoA ligase, BoxAB, BoxC, or BoxD were produced in E. coli BL21(DE3). His6-tagged GenR was produced in E. coli Rosetta(DE3). Syntheses of the His6-tagged fusion proteins were induced by addition of isopropyl-β-d-thiogalactopyranoside when the OD600 of the cultures reached 0.4. Cells were continuously incubated at a decreased temperature of 16°C for 4 h before being harvested. Cells were pelleted by centrifugation at 8,000 × g for 10 min, and the cell pellet was suspended in binding buffer (20 mM Tris-HCl, 0.5 M NaCl, 5 mM imidazole [pH 7.9]) and then lysed by sonication for 10 min. The cellular lysate was centrifuged at 12,000 × g for 15 min, and the supernatant was filtered through a 0.22-μm Millipore Express membrane (Millipore, Carrigtwohill, Ireland) and then applied to a Ni2+-charged His · Bind column (Novagen, Frankfurter, Germany) that was pre-equilibrated with binding buffer. Proteins were eluted with elution buffer (20 mM Tris-HCl, 0.5 M NaCl, 1 M imidazole [pH 7.9]), and the separated protein fractions were analyzed by electrophoresis on a 12% sodium dodecyl sulfate-polyacrylamide gel. The fractions containing a single target protein were pooled, desalted with the PD MiniTrap G-25 kit (GE Healthcare, Shanghai, China), and concentrated with Amicon Ultra-15 centrifugal filter units (Millipore, Beijing, China). The proteins obtained were stored in 10% (wt/vol) glycerol at −80°C until use. Protein concentration was determined according to the Bradford method (35).

Enzyme activity assays.

Benzoate-CoA ligase activity was determined at 30°C using the indirect assay method of Schühle et al. (36), which was originally described by Ziegler et al. (37). Briefly, benzoate-CoA ligase activity was coupled to myokinase, pyruvate kinase, and lactate dehydrogenase. The reaction mixture (1 ml) contained 100 mM Tris-HCl (pH 8.0), 2 mM dithiothreitol, 5 mM MgCl2, 1 mM ATP, 0.4 mM CoA, 0.4 mM NADH, 1 mM phosphoenolpyruvate, 0.5 mM benzoic acid, myokinase (1 U), pyruvate kinase (1 U), lactate dehydrogenase (1.5 U), and 10 μl protein fraction (0.2 to 0.4 mg). Reactions were initiated by the addition of benzoic acid, and the decrease of adsorption at 365 nm, which reflects NADH oxidation, was recorded. Benzoyl-CoA oxygenase/reductase activity was measured spectrophotometrically at 340 nm at 30°C for NADPH oxidation (12). The assay mixture (1 ml) contained 100 mM Tris-HCl (pH 8.0), 0.2 mM FAD, 0.6 mM NADPH, 0.2 mM benzoyl-CoA, and 0.04 mg purified BoxA, and the reaction was started by the addition of 0.8 mg purified BoxB. A control test without addition of BoxB was run in parallel.

2,3-Epoxybenzoyl-CoA dihydrolase (BoxC) activity was analyzed by following the decrease of 2,3-epoxybenzoyl-CoA at a wavelength of 310 nm (13). The catalytic product of BoxAB (2,3-epoxybenzoyl-CoA) was used, and 0.08 mg BoxC was added to the assay mixture.

Photometric assays of 3,4-dehydroadipyl-CoA semialdehyde dehydrogenase (BoxD) were carried out by following NADP+ reduction at 340 nm (14). The catalytic product of BoxC (3,4-dehydroadipyl-CoA semialdehyde) was used, and 0.04 mg BoxD was added to the assay mixture.

Gentisate 1,2-dioxygenase activity was assayed spectrophotometrically by measuring the increase of absorption at 330 nm derived from maleylpyruvate. The mixture (total volume, 2 ml) contained 0.1 mM gentisate, 10 μl of recombinant gentisate 1,2-dioxygenase from E. coli, and 50 mM Tris-HCl buffer (pH 8.0) (38). Maleylpyruvate isomerase was measured by following the disappearance of maleylpyruvate at 330 nm. Crude maleylpyruvate was prepared from gentisate by gentisate 1,2-dioxygenase digestion at room temperature for 5 min as described above; 0.5 μM glutathione (GSH) was added, and the reaction was initiated by adding 10 μl of maleylpyruvate isomerase (39). Fumarylpyruvate hydrolase activity was followed by measuring the disappearance of fumarylpyruvate absorption at 340 nm. The assay mixture consisted of 0.1 mM gentisate, 0.5 μM GSH, 10 μl of recombinant gentisate 1,2-dioxygenase, and maleylpyruvate isomerase in 50 mM Tris-HCl buffer (pH 8.0); 10 μl of fumarylpyruvate hydrolase was added 15 min later at room temperature to initiate the reaction (40).

All spectrophotometric assays were performed on a SPECORD 205 UV/Vis spectrophotometer (Analytik Jena AG, Jena, Germany).

Preparation of benzoyl-CoA.

Benzoyl-CoA was chemically synthesized from CoA and benzoic acid anhydride according to previously published procedures (41). To purify benzoyl-CoA, the reaction mixture was applied to a solid-phase extraction column (Supelclean LC-18 SPE tube; bed weight, 500 mg; volume, 3 ml; Supelco, Sigma-Aldrich, Bellefonte, PA) equilibrated with 20 mM ammonium formate (pH 3.5) containing 2% (vol/vol) methanol (as the equilibration buffer). The column was washed with 6 ml of the equilibration buffer, and purified benzoyl-CoA was eluted with 80% (vol/vol) methanol. The eluate fraction was evaporated under reduced pressure and lyophilized.

Extraction of total RNA and quantitative RT-PCR (qRT-PCR).

CNB-1 and mutant cells growing on benzoate, gentisate, or pyruvate were harvested at mid-exponential growth phase (OD600, ∼0.15). For determination of benzoyl-CoA as a GenR effector in vivo, CNB-1Δ0097bcl and CNB-1ΔboxAB cells were cultivated on pyruvate, followed by incubation with 2 mM benzoate for 2 h. Total RNA was extracted using TRIzol reagent (Life Technologies, Shanghai, China) following the manufacturer's instructions. Reverse transcription was conducted according to the instructions for the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China). qRT-PCR was performed using a Kapa SYBR Fast qPCR kit (Kapa Biosystems, Boston, MA) according to the manufacturer's protocol with a LightCycler 480 real-time PCR system (Roche Applied Science, Basel, Switzerland). The specific primer pairs used for qRT-PCR analyses are listed in Table S1 in the supplemental material. The housekeeping gene rpoB of C. testosteroni CNB-1 was used as an internal standard for normalization. Each sample was run in triplicate. The relative levels of target gene expression in wild-type CNB-1 and its mutants under defined culture conditions were evaluated using LightCycler relative quantification software (LightCycler 480; Roche Applied Science).

Construction of a transcriptional fusion reporter plasmid and microscopy analysis of recombinant cells.

The pBBR1MCS2-eGFP (enhanced green fluorescent protein) vector was used to construct the plasmid for transcriptional fusions. The genA promoter was PCR amplified using the primers PgenAfF and PgenAfR (see Table S1 in the supplemental material), digested with KpnI and HindIII, and ligated upstream of the eGFP gene in the digested pBBR1MCS2-eGFP vector. The resulting pBBR1MCS2-PgenA::eGFP plasmid was verified by DNA sequencing and subsequently electroporated into CNB-1, CNB-1Δ0097bcl, or CNB-1Δ0097bcl/pBBR1MCS3-bcl cells (Table 1). Transformants were selected with kanamycin (150 μg/ml) and cultivated in MSB medium with benzoate or succinate as the carbon source. Cells were obtained from cultures at mid-exponential growth phase (OD600, ∼0.15). Microscopy analyses were performed with a confocal laser scanning microscope (TCS SP8 microscope; Leica, Benshein, Germany) with a 63× objective (Plan-Neofluar; numerical aperture, 1.4) and using LAS AF software (Leica Microsystems).

Electrophoretic mobility shift assay (EMSA).

A 219-bp DNA fragment containing the promoter region of genA was obtained from CNB-1 genomic DNA by PCR using the primer pairs listed in Table S1 as a probe. A 215-bp DNA fragment upstream of boxD was used as a nonspecific control probe. Binding experiments were performed as previously described (42). The DNA probe (10 ng) was incubated with various concentrations of purified GenR at 25°C for 30 min in binding buffer containing 20 mM Tris-HCl (pH 7.5), 2 mM dithiothreitol (DTT), 5 mM MgCl2, 0.5 mg/ml calf bovine serum albumin (BSA), and 5% (vol/vol) glycerol in a total volume of 20 μl. Mixtures were then loaded onto native 4% (wt/vol) polyacrylamide gels (mono/bis, 80:1) in 0.5× TBE (90 mM Tris-boric acid and 2 mM EDTA). Gels were stained with SYBR gold nucleic acid gel stain (Invitrogen) for 30 min in TBE buffer and photographed under UV transillumination.

To analyze disassociation of the DNA probe and GenR, effector molecules of benzoate, 3-hydroxybenzoate, gentisate, protocatechuate, benzoyl-CoA, acetyl-CoA, and HS-CoA were added to the reaction mixture at various concentrations.

DNase I footprinting.

To determine the GenR binding sites in the genA promoter region, a DNase I footprinting assay was performed using a fluorescent-labeling procedure (43). Briefly, the DNA fragment was prepared by PCR using the PgenAF and 5′-labeled hexachlorofluorescein phosphoramidite (HEX)-PgenAR primers listed in Table S1. The labeled DNA fragment (100 to 150 ng) was purified from an agarose gel, and various concentrations of His6-GenR were added to the footprinting reaction mixture containing 20 mM HEPES (pH 7.4), 2 mM DTT, 100 mM KCl, 5 mM MgCl2, 0.5 mg/ml calf BSA, and 5% (vol/vol) glycerol in a total volume of 50 μl. After incubation at 25°C for 30 min, DNase I digestion was conducted for a further 1 min at 25°C and then terminated by addition of stop buffer (20 mM EGTA, pH 8.0) (Promega, Madison, WI, USA). The purified samples were loaded into an Applied Biosystems 3730xl DNA genetic analyzer along with an internal lane size standard (GeneScan 500 LIZ; Applied Biosystems, Beijing, China). The electropherograms generated were then analyzed with GeneMarker v2.2 (SoftGenetics, State College, PA).

Fluorescent primer extension.

To analyze the transcriptional start site of the genA gene, we performed fluorescent primer extension following the method of Lloyd et al. (44). CNB-1 cells that were growing on benzoate were harvested at mid-exponential growth phase (OD600, ∼0.15). Total RNA was prepared from C. testosteroni strain CNB-1 as described above. Total RNA (30 μg) was treated with 30 U of RNase-free DNase I (Promega) for 30 min at 37°C and then hybridized to HEX-PgenAR. The final volume was adjusted to 20 μl using DEPC-treated water in a sterile DEPC-treated microcentrifuge tube. The tube was heated to 70°C for 5 min and then cooled on ice for 10 to 30 min. Then, 400 U of Moloney murine leukemia virus reverse transcriptase (M-MLV RT), 40 U of RNasin RNase inhibitor, and 2 mM concentrations of deoxynucleoside triphosphates (dNTPs) in 1× M-MLV reaction buffer (Promega) were added to the annealed primer-RNA mixture. The final volume was adjusted to 40 μl with DEPC-treated water. The primer extension reaction mixture was incubated at 42°C for 60 min. After addition of 1 μl RNase A (10 mg/ml; Sigma-Aldrich), the sample was incubated for 30 min at 37°C. HEX-labeled cDNA was extracted with phenol-chloroform–isoamyl alcohol and precipitated with DNAmate (TaKaRa, Dalian, China) according to the manufacturer's instructions. Capillary electrophoresis was performed on an Applied Biosystems 3730xl DNA genetic analyzer with GeneScan 500 LIZ (Applied Biosystems) as the internal lane size standard. The length of the HEX-labeled cDNA product was calculated by GeneMarker v 2.2 software (SoftGenetics).

Surface plasmon resonance (SPR).

SPR experiments were performed on a Biacore 3000 apparatus (GE Healthcare, Buckinghamshire, United Kingdom) with a running buffer composed of 20 mM Tris-HCl, 150 mM NaCl, and 0.005% Tween 20 (pH 8). To determine the association and dissociation of the operator PgenA and GenR after the addition of effector molecules, a 5′-end-biotinylated double-stranded PgenA DNA fragment was immobilized on a streptavidin-coated SA sensor chip (GE Healthcare), and His6-GenR (32 nM, 30 μl) with benzoate, 4-hydroxybenzoate, protocatechuate, succinate, or acetyl-CoA (1 mM, 30 μl) or running buffer was injected with a COINJECT pattern and with various concentrations of 3-hydroxybenzoate, gentisate, and benzoyl-CoA with a KINJECT pattern at a flow rate of 30 μl/min. At the end of each cycle, the sensor chip was regenerated by injecting 5 μl of running buffer plus 0.02% sodium dodecyl sulfate.

RESULTS

Two putative metabolic pathways for benzoate degradation in C. testosteroni CNB-1.

CNB-1 grows on benzoate as the sole carbon source. The only detectable aromatic ring cleavage dioxygenase activity from benzoate-grown cells was gentisate 1,2-dioxygenase activity (27), indicating that benzoate was metabolized via the gentisate 1,2-cleavage pathway (Fig. 1C). Indeed, two representative enzymes of the gentisate pathway, gentisate 1,2-dioxygenase (B19, GenA) and fumarylpyruvate hydrolase (B6, GenB), were detected in benzoate-grown CNB-1 cells (Table 2; also, see Fig. S1 in the supplemental material). A genetic cluster (CtCNB1_2776 to CtCNB1_2780, designated the genABC cluster) that encodes a complete gentisate 1,2-cleavage pathway was identified in this study in the CNB-2 genome (Fig. 1D; Table 3). GenA, GenC, and GenB were confirmed as gentisate 1,2-dioxygenase, maleylpyruvate isomerase, and fumarylpyruvate hydrolase, respectively (see Fig. S2 in the supplemental material).

TABLE 2.

Proteins related to aromatic compound degradationa

No. ORF Protein name; putative function Scoreb Matchc Coverage (%)d pI/MWf
Theoreticale Experimental
B6 CtCNB1_2779 GenB; fumarylpyruvate hydroxylase 77 12 58 5.31/26 5.47/27
B13 CtCNB1_0066 BoxB; benzoyl-CoA oxygenase component B 133 18 43 5.63/54 5.83/55
B14 CtCNB1_0065 BoxA; benzoyl-CoA oxygenase; reductase 120 29 45 5.66/47 5.94/55
B15 CtCNB1_0097 BCL; benzoate-CoA ligase family 69 15 31 5.90/57 6.10/59
B17 CtCNB1_0097 BCL; benzoate-CoA ligase family 61 15 31 5.90/57 6.30/59
B19 CtCNB1_2778 GenA; gentisate 1,2-dioxygenase 54 11 34 6.10/42 6.40/47
B22 CtCNB1_0093 LivG; ABC-type branched-chain amino acid transport systems, ATPase component 52 13 48 5.99/28 6.51/27
Open in a new tab
a

Proteins related to aromatic compound degradation were induced in cells grown with benzoate as the sole carbon source. The proteomes of CNB-1 cells grown on succinate were used for reference. The 2-DE gel images of proteomes from CNB-1 cells grown on benzoate and succinate are provided in Fig. S1 in the supplemental material. For all comparisons, P was <0.05; i.e., the spot was found only on gels where CNB-1 was grown on benzoate as opposed to succinate. Induction was observed for each protein.

b

Mascot protein score among the fractions where the protein was identified.

c

Number of spectra matched to the protein.

d

Protein sequence coverage for the fraction.

e

From a Mascot search.

f

MW, molecular weight (in thousands).

TABLE 3.

Genomic analysis of benzoate- and gentisate-degradative pathways in C. testosteroni strain CNB-1a

Gene (ORF) Gene product (no. of aa) Related gene product
Name Function Organism % identity; no. of aa Accession no.
CtCNB1_0065 BoxA (433) BoxA Benzoyl-CoA oxygenase component A Azoarcus evansii 59; 414 Q9AIX6
CtCNB1_0066 BoxB (474) BoxB Benzoyl-CoA oxygenase component B Azoarcus evansii 72; 473 Q9AIX7
CtCNB1_0067 BoxC (552) BoxC Benzoyl-CoA-dihydrodiol lyase Azoarcus evansii 67; 555 Q84HH6
CtCNB1_0091 TE (157) PaaI Thioesterase Haemophilus influenzae 47; 138 1SC0_A
CtCNB1_0092 LivF (233) LivF ABC transporter, ATPase component Azoarcus sp. strain CIB 57; 257 CCD33112
CtCNB1_0093 LivG (256) LivG ABC transporter, ATPase component Azoarcus sp. strain CIB 57; 252 CCD33113
CtCNB1_0094 LivM (364) LivM ABC transporter, permease component Azoarcus sp. strain CIB 47; 329 CCH23034
CtCNB1_0095 LivH (289) LivH ABC transporter, permease components Azoarcus evansii 62; 288 AAN39369
CtCNB1_0096 LivK (387) LivK ABC transporter, periplasmic component Azoarcus evansii 70; 391 AAL02078
CtCNB1_0097 BCL (521) BCL Benzoate-CoA ligase Rhodopseudomonas palustris 64; 524 4EAT_A
CtCNB1_0098 BoxD (531) BoxD Aldehyde dehydrogenase Burkholderia xenovorans LB400 64; 532 2VRO_A
CtCNB1_0099 BoxR (300) BoxR Transcriptional regulator Azoarcus sp. strain CIB 51; 300 CCD33120
CtCNB1_2776 LysR (300) LysR Transcriptional regulator, LysR family Pseudomonas sp. strain 19-rlim 55; 298 AEO27403
CtCNB1_2777 GenR (200) GenR Transcriptional regulatory protein Comamonas testosteroni 55; 172 BAF34929
CtCNB1_2778 GenA (375) GenA Gentisate 1,2-dioxygenase Rhodococcus sp. strain NCIMB 12038 61; 359 ADT78164
CtCNB1_2779 GenB (239) GenB Fumarylpyruvate hydroxylase Ralstonia sp. 78; 192 O86042
CtCNB1_2780 GenC (214) GenC Maleylpyruvate isomerase Ralstonia sp. 70; 212 O86043
Open in a new tab
a

aa, amino acids.

In addition to GenA and GenB, the comparative proteomic studies on benzoate- and succinate-grown cells also revealed proteins that were induced in CNB-1 when benzoate was used the carbon source. Benzoate-CoA ligase (B15, B17, BCL), benzoyl-CoA reductase (B14, BoxA), and benzoyl-CoA oxygenase (B13, BoxB) were induced (Table 2; also, see Fig. S1 in the supplemental material). This observation prompted us to consider a different pathway alternative to the above-mentioned gentisate 1,2-cleavage pathway (Fig. 1A), i.e., the recently identified CoA-dependent epoxide pathway in A. evansii (11). Data mining of the CNB-2 genome revealed that two genetic clusters (CtCNB1_0065 to CtCNB1_0067 and CtCNB1_0097 to CtCNB1_0098, designated box clusters) (Table 3) possibly encode the conversion of benzoate to 3,4-dehydroadipyl-CoA (Fig. 1B).

CNB-1 metabolism of benzoate via the CoA-dependent epoxide pathway and identification of genes involved in the CoA-dependent epoxide pathway in CNB-1.

To determine whether benzoate was metabolized via gentisate 1,2-cleavage or the CoA-dependent epoxide pathway, the genes putatively encoding gentisate 1,2-dioxygenase (genA, CtCNB1_2778) and 2,3-epoxybenzoyl-CoA dihydrolase (boxC, CtCNB1_0067) were disrupted. Like CNB-1, the CNB-1ΔgenA mutant also grew on benzoate (Fig. 2A). This result indicated that benzoate degradation was independent of the gentisate pathway. Furthermore, our results (Fig. 2) indicated that disruption of box genes resulted in CNB-1 mutants that were not able to grow on benzoate. These results clearly demonstrated that benzoate was metabolized via the CoA-dependent epoxide pathway in CNB-1.

FIG 2.

FIG 2

Open in a new tab

Genetic disruption and complementation of genA and boxC (A), bcl (B), and boxAB (C) in C. testosteroni.

The CoA-dependent epoxide pathway starts by the activation of benzoate, which is catalyzed by benzoate-CoA ligase. Two candidate benzoate-CoA ligase genes (bcl) were identified in the genome, which were tagged as CtCNB1_0097 and CtCNB1_0394. The theoretical translational products of CtCNB1_0097 and CtCNB1_0394 showed sequence identities of 53% and 36%, respectively, to the benzoate-CoA ligase from A. evansii. When the two candidate bcl genes were individually disrupted, only the CNB-1Δ0097bcl mutant was unable to grow on benzoate. Furthermore, the growth phenotype on benzoate was restored by expression of the CtCNB1_0097 (bcl) gene in the CNB-1Δ0097bcl mutant (Fig. 2B). This indicates that CtCNB1_0097 is the authentic bcl gene that has an in vivo benzoate degradation function in the CNB-1 strain. Indeed, benzoate-CoA ligase activity was detected when CtCNB1_0097 was expressed and purified from E. coli cells (see Fig. S3A in the supplemental material).

BoxAB catalyzes the conversion of benzoyl-CoA to 2,3-epoxybenzoyl-CoA in the CoA-dependent epoxide pathway (12). We showed that CtCNB1_0065 and CtCNB1_0066 encode BoxAB in CNB-1. The CNB-1ΔboxAB mutant was not able to grow aerobically on benzoate (Fig. 2C). The CtCNB1_0065 and CtCNB1_0066 genes were cloned and expressed in E. coli, and their translational products (BoxAB) showed benzoyl-CoA oxygenase/reductase activities (see Fig. S3B in the supplemental material). We cloned and expressed the BoxC gene (CtCNB1_0067), and enzymatic assays showed that the purified BoxC exhibited 2,3-epoxybenzoyl-CoA dihydrolase activity (see Fig. S3 in the supplemental material). Oxidation of 3,4-dehydroadipyl-CoA semialdehyde to the corresponding 3,4-dehydroadipyl-CoA acid is catalyzed by BoxD (14). When the CtCNB1_0098 gene, encoding aldehyde dehydrogenase in CNB-1, was heterologously expressed in E. coli, its translation product showed aldehyde dehydrogenase activity (BoxD) (see Fig. S3D in the supplemental material).

GenR negatively regulates transcription of the gen cluster.

The above results clearly show that benzoate was metabolized via the CoA-dependent epoxide pathway, but not the gentisate pathway, in the CNB-1 strain. To explain why gentisate 1,2-dioxygenase was induced when CNB-1 grew on benzoate, we investigated the regulation of the gen cluster for the gentisate pathway. The gen cluster is organized into two transcriptional units, lysR-genR and genABC (see Fig. S4 in the supplemental material). Two putative regulators are encoded by CtCNB1_2776 (LysR type, named lysR) and CtCNB1_2777 (MarR type, named genR), and they are oriented divergently to other genes of the gen cluster. To clarify which regulator governed regulation of the gen genes, quantitative RT-PCR was performed with CNB-1 and the mutants CNB-1ΔlysR and CNB-1ΔgenR. Results showed that the transcription of lysR, genA, genB, and genC increased in CNB-1ΔgenR compared to that of CNB-1 (Fig. 3). Transcription of gen cluster genes was not significantly influenced when the lysR gene was deleted (Fig. 3). Therefore, these results indicate that GenR negatively regulated transcription of the gen cluster genes in CNB-1.

FIG 3.

FIG 3

Open in a new tab

GenR negatively regulates the transcription of genes encoding the gentisate pathway. The housekeeping gene rpoB of C. testosteroni was used as an internal control. Relative transcription levels are defined as the transcription ratios of the target genes in mutants to their counterparts in wild-type CNB-1.

GenR specifically binds to a 41-bp sequence in the intergenic region of genR and genA.

To identify the gen cluster promoter and characterize the interaction between GenR and its binding sequence, genR was expressed and purified from E. coli Rosetta(DE3) cells. Native His6-GenR had an apparent molecular mass of 51.6 kDa (the monomer has a calculated molecular mass of 23.8 kDa), suggesting that it was a homodimer. The interaction between the GenR regulator and the genR-genA intergenic region was next examined. GenR bound to the genR-genA intergenic region in a concentration-dependent manner (Fig. 4A). To pinpoint the specific GenR-binding sequences, DNase I footprinting was performed using a capillary sequencer. The results showed that GenR bound to a 41-nt sequence (ACGCATATCAACATTATGCTAATCATCAGTGTGCTGTTTAT) (Fig. 5A). The transcription start site for genA was determined (Fig. 5B), and the detailed structure of its promoter region (PgenA) is shown in Fig. 5C.

FIG 4.

FIG 4

Open in a new tab

Electrophoretic mobility shift assays (EMSA) for GenR binding to the genR-genA intergenic region (A) and determination of effector molecules by EMSA (B) and by surface plasmon resonance (SPR) analysis (C to F). (A and B) Each lane contained 10 ng of DNA probe. (A) Lane 1, PgenA probe alone; lane 2, 1.5 μM BSA as a control protein; lanes 3 to 6, retardation assays using 2 nM, 20 nM, 100 nM, 2 μM, and 4 μM His6-GenR proteins, respectively. DNA upstream of boxD was used as a nonbinding control. (B) Lane 1, PgenA probe alone; lane 2, the PgenA probe and 4 μM His6-GenR proteins. Lanes 3 to 15 contain, in addition to the PgenA probe and 4 μM His6-GenR proteins, 2 mM benzoate (Ben; lane 3), protocatechuate (PCA; lane 10), acetyl-CoA (AcA; lane 14) and HS-CoA (CoA; lane 15), and various concentrations of 3-hydroxybenzoate (3HB; lanes 4 to 6, 10 μM, 20 μM, and 30 μM), gentisate (Gen; lanes 7 to 9, 3 μM, 10 μM, and 30 μM), or benzoyl-CoA (BzA; lanes 11 to 13, 10 μM, 20 μM, and 50 μM). (C to F) Biotinylated PgenA was immobilized on a streptavidin-coated SA sensor chip. Detailed conditions are described in Materials and Methods. 4HB, 4-hydroxybenzoate; PCA, protocatechuate; 3HB, 3-hydroxybenzoate.

FIG 5.

FIG 5

Open in a new tab

DNase I footprinting of the coding strand of the genA promoter region. (A) Fluorograms correspond to the control (DNA plus 10 μM BSA) and to the protection reactions (with concentrations of 0.9, 2.7, and 9 μM His6-GenR protein). (B) Transcription start site analysis of genA as determined by fluorescent primer extension. (C) Nucleotide sequence of the genR-genA intergenic region. The numbers on the left indicate the nucleotide positions. The genA transcription start site (TSS) is indicated by a bent arrow and an asterisk. Presumptive −10 and −35 regions of the genA promoter are underlined. The sequence protected from DNase I digestion is indicated by a shaded box. The GenR and GenA translational start codons are boxed, and the translated amino acids are shown below the nucleotide sequence.

3-Hydroxybenzoate, gentisate, and benzoyl-CoA affect GenR binding to PgenA.

To identify effectors that affect the binding of GenR to PgenA, a range of molecules, including succinate, benzoyl-CoA, acetyl-CoA, HS-CoA, benzoate, 3-hydroxybenzoate, 4-hydroxybenzoate, gentisate, and protocatechuate, were tested. EMSA results showed that 3-hydroxybenzoate, gentisate, and benzoyl-CoA dissociated the GenR-PgenA complex, while the other compounds showed no observable effects (Fig. 4B). The effect of 3-hydroxybenzoate, gentisate, and benzoyl-CoA on dissociation of the GenR-PgenA complex was further observed with SPR assays (Fig. 4C to F).

Benzoyl-CoA functions in vivo as an effector for the regulator GenR.

As demonstrated above, we found that benzoyl-CoA antagonized the binding of GenR to the genA promoter in vitro. To establish whether benzoyl-CoA is an effector for GenR in vivo and regulates the transcription of gen cluster, we analyzed the transcription of genA and genR in CNB-1, CNB-1Δ0097bcl, and CNB-1ΔboxAB. As shown in Fig. 6A, the transcription of genA was mostly unchanged in CNB-1Δ0097bcl (benzoyl-CoA synthesis was disabled), but it increased significantly in CNB-1ΔboxAB (benzoyl-CoA degradation was disabled). We also observed that the transcription of genR slightly decreased in both CNB-1Δ0097bcl and CNB-1ΔboxAB. These data indicated that benzoyl-CoA affected in vivo the transcription of the gen genetic cluster.

FIG 6.

FIG 6

Open in a new tab

In vivo determination of benzoyl-CoA regulation of transcription of genA by qRT-PCR (A) and a GFP promoter-reporter system (B).

To demonstrate in vivo the effect of benzoyl-CoA on the interaction between promoter PgenA and GenR, we constructed a promoter-reporter to visualize the effect of benzoyl-CoA. The promoter-reporter plasmid carried the pBBR1MCS2-PgenA::eGFP fusion, and the promoter activity was dependent on the presence of benzoyl-CoA. The pBBR1MCS2-PgenA::eGFP reporter plasmid was electroporated into CNB-1, CNB-1Δ0097bcl, and CNB-1Δ0097bcl/pBBR1MCS3-bcl cells. No GFP fluorescence was observed in CNB-1Δ0097bcl, while its complementary strain (CNB-1Δ0097bcl/pBBR1MCS3-bcl) and wild-type CNB-1 showed strong GFP fluorescence (Fig. 6B). These data clearly indicated that benzoyl-CoA affected in vivo the interaction between promoter PgenA and GenR.

DISCUSSION

The present study demonstrated that CNB-1 degrades benzoate via a CoA-dependent epoxide pathway, although a previous investigation (27) and this study both observed that gentisate 1,2-dioxygenase and other enzymes of the gentisate pathway were induced when the CNB-1 strain was cultivated with benzoate as the carbon source. Rather et al. (11) reported that 4 to 5% of the sequenced microbial genomes carry genes putatively encoding this CoA-dependent epoxide pathway. We further explored the updated NCBI databank using BoxB and BoxC sequences as queries and found that the CoA-dependent epoxide pathway is identifiable in Actinobacteria (3.1% of a total 160 genomes), Firmicutes (0.8% of a total 240 genomes), and Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria (10.3%, 36.7%, 0.4%, and 6.1% of a total of 150, 98, 230, and 49 genomes, respectively). Thus, the CoA-dependent epoxide pathway seems to be more widely distributed among Betaproteobacteria (36.7%) than in the other bacteria mentioned above. Several bacterial species carrying box genetic clusters encoding the CoA-dependent epoxide pathway were confirmed as being able to grow on benzoate (11, 21), Nonetheless, the functionalities of the CoA-dependent epoxide pathway have so far been identified only in A. evansii (11), B. xenovorans (21), and C. testosteroni (this study). The genes involved in the CoA-dependent epoxide pathway in CNB-1 are interrupted by putative ABC transporter genes, which differ from the box genes of A. evansii, which are continuously organized in one genetic cluster (45).

The discovery that the MarR-type regulator GenR regulates the gene encoding the gentisate pathway and that it accepts benzoyl-CoA as an effector explains the induction of gentisate 1,2-dioxygenase and other enzymes of the gentisate pathway when was CNB-1 grown on benzoate: benzoate was converted into benzoyl-CoA, which then released the GenR repression of genA in CNB-1. The genA gene was subsequently transcribed, and gentisate 1,2-dioxygenase was synthesized. The induction of gentisate 1,2-dioxygenase activity with benzoate was observed previously in the A. evansii strain KB 740 (23), which harbors the same CoA-dependent epoxide pathway (24) for benzoate degradation as that found in CNB-1. To date, there are no genome data or published studies on the genetics of gentisate degradation in A. evansii. Hence, we explored the available genomic data for other Azoarcus members, i.e., Aromatoleum aromaticum EbN1 (synonym Azoarcus sp. strain EbN1) (46) and Azoarcus sp. strain BH72 (47). As shown in Fig. 7, the gen clusters in the EbN1 and BH72 strains are very different from that of CNB-1. There are no MarR-type regulators in EbN1 and BH72. In fact, only putative LysR-type regulators are associated with the gen clusters in EbN1 and BH72. A putative LysR-type regulator was also observed in the CNB-1 strain, which is adjacent to GenR in the cluster. Our results demonstrated that this putative LysR regulator in CNB-1 did not regulate the gen cluster. Therefore, we deduced that gentisate 1,2-dioxygenase activity is regulated differently in Azoarcus species than in C. testosteroni, although benzoyl-CoA might be the common molecule involved in such regulation. Previous literature showed that gentisate 1,2-dioxygenase was coinduced in Pseudomonas testosteroni when 3-hydroxybenoate was fed as the carbon source, although P. testosteroni metabolizes 3-hydroxybenoate exclusively through a protocatechuate pathway (48, 49).

FIG 7.

FIG 7

Open in a new tab

Genome data-mining for the gentisate catabolism pathway and its regulator proteins. Boldface type indicates that the species' regulator proteins belong to the MarR family.

The mechanism by which GenR regulates the gen cluster in CNB-1 has been illustrated by the present study: GenR binds to its target DNA sequence (ACGCATATCAACATTATGCTAATCATCAGTGTGCTGTTTAT) in the absence of effectors and represses gene transcription of the genABC genes. When effectors such as gentisate, 3-hydroxybenzoate, or benzoyl-CoA are present, GenR protein is released from its DNA binding site and the repression of transcription is abolished. According to our study (Fig. 6A), GenR also exerts positive self-regulation of its own transcript unit, i.e., the lysR-genR unit. GenR is a MarR-type regulator, and several MarR-type regulators have been found to be involved in regulation of aromatic compound degradation. For examples, BadR activates benzoyl-CoA reductase (50), CouR governs p-coumarate degradation in Rhodopseudomonas palustris (51), CbaR controls the cbaABC operon for 3-chlorobenzoate degradation in C. testosteroni BR60 (52), and FerC regulates the ferulate catabolic operon in Sphingobium sp. strain SYK-6 (53). p-Coumaroyl-CoA and feruloyl-CoA have been identified as effectors for CouR and FerC, respectively. This study corroborated that benzoyl-CoA is an effector of GenR. These aromatic CoA thioesters represent a new category of effectors for MarR-type regulators. More putative MarR-type proteins, as well as LysR- and IclR-type proteins that potentially regulate gentisate degradation, have been identified in the genomes of diverse bacterial species (Fig. 7). These represent new candidate regulators for gentisate degradation regulation that merit further investigation.

Supplementary Material

Supplemental material
supp_80_13_4051__index.html (1.4KB, html)

ACKNOWLEDGMENT

This work was supported by a grant from the National Natural Science Foundation of China (31230003).

Footnotes

Published ahead of print 25 April 2014

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01146-14.

REFERENCES

  • 1.Boll M, Loffler C, Morris BE, Kung JW. 2014. Anaerobic degradation of homocyclic aromatic compounds via arylcarboxyl-coenzyme A esters: organisms, strategies and key enzymes. Environ. Microbiol. 16:612–627. 10.1111/1462-2920.12328 [DOI] [PubMed] [Google Scholar]
  • 2.Andreoni V, Bernasconi S, Bestetti P, Villa M. 1991. Metabolism of lignin-related compounds by Rhodococcus rhodochrous: bioconversion of anisoin. Appl. Microbiol. Biotechnol. 36:410–415 [Google Scholar]
  • 3.Harwood CS, Parales RE. 1996. The β-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 50:553–592. 10.1146/annurev.micro.50.1.553 [DOI] [PubMed] [Google Scholar]
  • 4.Parke D, Rynne F, Glenn A. 1991. Regulation of phenolic catabolism in Rhizobium leguminosarum biovar trifolii. J. Bacteriol. 173:5546–5550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ishiyama D, Vujaklija D, Davies J. 2004. Novel pathway of salicylate degradation by Streptomyces sp. strain WA46. Appl. Environ. Microbiol. 70:1297–1306. 10.1128/AEM.70.3.1297-1306.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ornston LN. 1966. The conversion of catechol and protocatechuate to β-ketoadipate by Pseudomonas putida. III. Enzymes of the catechol pathway. J. Biol. Chem. 241:3795–3799 [PubMed] [Google Scholar]
  • 7.Harayama S, Kok M, Neidle EL. 1992. Functional and evolutionary relationships among diverse oxygenases. Annu. Rev. Microbiol. 46:565–601. 10.1146/annurev.mi.46.100192.003025 [DOI] [PubMed] [Google Scholar]
  • 8.Ornston LN. 1966. The conversion of catechol and protocatechuate to β-ketoadipate by Pseudomonas putida. II. Enzymes of the protocatechuate pathway. J. Biol. Chem. 241:3787–3794 [PubMed] [Google Scholar]
  • 9.Vaillancourt FH, Bolin JT, Eltis LD. 2006. The ins and outs of ring-cleaving dioxygenases. Crit. Rev. Biochem. Mol. 41:241–267. 10.1080/10409230600817422 [DOI] [PubMed] [Google Scholar]
  • 10.Zaar A, Eisenreich W, Bacher A, Fuchs G. 2001. A novel pathway of aerobic benzoate catabolism in the bacteria Azoarcus evansii and Bacillus stearothermophilus. J. Biol. Chem. 276:24997–25004. 10.1074/jbc.M100291200 [DOI] [PubMed] [Google Scholar]
  • 11.Rather LJ, Knapp B, Haehnel W, Fuchs G. 2010. Coenzyme A-dependent aerobic metabolism of benzoate via epoxide formation. J. Biol. Chem. 285:20615–20624. 10.1074/jbc.M110.124156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zaar A, Gescher J, Eisenreich W, Bacher A, Fuchs G. 2004. New enzymes involved in aerobic benzoate metabolism in Azoarcus evansii. Mol. Microbiol. 54:223–238. 10.1111/j.1365-2958.2004.04263.x [DOI] [PubMed] [Google Scholar]
  • 13.Gescher J, Eisenreich W, Wörth J, Bacher A, Fuchs G. 2005. Aerobic benzoyl-CoA catabolic pathway in Azoarcus evansii: studies on the non-oxygenolytic ring cleavage enzyme. Mol. Microbiol. 56:1586–1600. 10.1111/j.1365-2958.2005.04637.x [DOI] [PubMed] [Google Scholar]
  • 14.Gescher J, Ismail W, Ol̈geschläger E, Eisenreich W, Wörth J, Fuchs G. 2006. Aerobic benzoyl-coenzyme A (CoA) catabolic pathway in Azoarcus evansii: conversion of ring cleavage product by 3,4-dehydroadipyl-CoA semialdehyde dehydrogenase. J. Bacteriol. 188:2919–2927. 10.1128/JB.188.8.2919-2927.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Stanier RY, Ornston LN. 1973. The β-ketoadipate pathway. Adv. Microb. Physiol. 9:89–151. 10.1016/S0065-2911(08)60377-X [DOI] [PubMed] [Google Scholar]
  • 16.Olivera ER, Minambres B, Garcia B, Muniz C, Moreno MA, Ferrandez A, Diaz E, Garcia JL, Luengo JM. 1998. Molecular characterization of the phenylacetic acid catabolic pathway in Pseudomonas putida U: the phenylacetyl-CoA catabolon. Proc. Natl. Acad. Sci. U. S. A. 95:6419–6424. 10.1073/pnas.95.11.6419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Teufel R, Mascaraque V, Ismail W, Voss M, Perera J, Eisenreich W, Haehnel W, Fuchs G. 2010. Bacterial phenylalanine and phenylacetate catabolic pathway revealed. Proc. Natl. Acad. Sci. U. S. A. 107:14390–14395. 10.1073/pnas.1005399107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fernandez C, Ferrandez A, Minambres B, Diaz E, Garcia JL. 2006. Genetic characterization of the phenylacetyl-coenzyme A oxygenase from the aerobic phenylacetic acid degradation pathway of Escherichia coli. Appl. Environ. Microbiol. 72:7422–7426. 10.1128/AEM.01550-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ferrandez A, Minambres B, Garcia B, Olivera ER, Luengo JM, Garcia JL, Diaz E. 1998. Catabolism of phenylacetic acid in Escherichia coli—characterization of a new aerobic hybrid pathway. J. Biol. Chem. 273:25974–25986. 10.1074/jbc.273.40.25974 [DOI] [PubMed] [Google Scholar]
  • 20.Mohamed MES, Ismail W, Heider J, Fuchs G. 2002. Aerobic metabolism of phenylacetic acids in Azoarcus evansii. Arch. Microbiol. 178:180–192. 10.1007/s00203-002-0438-y [DOI] [PubMed] [Google Scholar]
  • 21.Denef VJ, Klappenbach JA, Patrauchan MA, Florizone C, Rodrigues JLM, Tsoi TV, Verstraete W, Eltis LD, Tiedje JM. 2006. Genetic and genomic insights into the role of benzoate-catabolic pathway redundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 72:585–595. 10.1128/AEM.72.1.585-595.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Denef VJ, Patrauchan MA, Florizone C, Park J, Tsoi TV, Verstraete W, Tiedje JM, Eltis LD. 2005. Growth substrate- and phase-specific expression of biphenyl, benzoate, and C1 metabolic pathways in Burkholderia xenovorans LB400. J. Bacteriol. 187:7996–8005. 10.1128/JB.187.23.7996-8005.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Schennen U, Braun K, Knackmuss HJ. 1985. Anaerobic degradation of 2-fluorobenzoate by benzoate-degrading, denitrifying bacteria. J. Bacteriol. 161:321–325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Niemetz R, Altenschmidt U, Brucker S, Fuchs G. 1995. Benzoyl-coenzyme A 3-monooxygenase, a flavin-dependent hydroxylase—purification, some properties and its role in aerobic benzoate oxidation via gentisate in a denitrifying bacterium. Eur. J. Biochem. 227:161–168. 10.1111/j.1432-1033.1995.tb20372.x [DOI] [PubMed] [Google Scholar]
  • 25.Mohamed ME-S, Zaar A, Ebenau-Jehle C, Fuchs G. 2001. Reinvestigation of a new type of aerobic benzoate metabolism in the proteobacterium Azoarcus evansii. J. Bacteriol. 183:1899–1908. 10.1128/JB.183.6.1899-1908.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wu JF, Sun CW, Jiang CY, Liu ZP, Liu SJ. 2005. A novel 2-aminophenol 1,6-dioxygenase involved in the degradation of p-chloronitrobenzene by Comamonas strain CNB-1: purification, properties, genetic cloning and expression in Escherichia coli. Arch. Microbiol. 183:1–8. 10.1007/s00203-004-0738-5 [DOI] [PubMed] [Google Scholar]
  • 27.Ni B, Zhang Y, Chen DW, Wang BJ, Liu SJ. 2013. Assimilation of aromatic compounds by Comamonas testosteroni: characterization and spreadability of protocatechuate 4,5-cleavage pathway in bacteria. Appl. Microbiol. Biotechnol. 97:6031–6041. 10.1007/s00253-012-4402-8 [DOI] [PubMed] [Google Scholar]
  • 28.Liu L, Jiang CY, Liu XY, Wu JF, Han JG, Liu SJ. 2007. Plant-microbe association for rhizoremediation of chloronitroaromatic pollutants with Comamonas sp. strain CNB-1. Environ. Microbiol. 9:465–473. 10.1111/j.1462-2920.2006.01163.x [DOI] [PubMed] [Google Scholar]
  • 29.Wu JF, Jiang CY, Wang BJ, Ma YF, Liu ZP, Liu SJ. 2006. Novel partial reductive pathway for 4-chloronitrobenzene and nitrobenzene degradation in Comamonas sp. strain CNB-1. Appl. Environ. Microbiol. 72:1759–1765. 10.1128/AEM.72.3.1759-1765.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhang Y, Ma Y, Qi S, Meng B, Chaudhry MT, Liu S, Liu S. 2007. Responses to arsenate stress by Comamonas sp. strain CNB-1 at genetic and proteomic levels. Microbiology 153:3713–3721. 10.1099/mic.0.2007/011403-0 [DOI] [PubMed] [Google Scholar]
  • 31.Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 32.Ma Y, Zhang Y, Zhang J, Chen D, Zhu Y, Zheng H, Wang S, Jiang C, Zhao G, Liu S. 2009. The complete genome of Comamonas testosteroni reveals its genetic adaptations to changing environments. Appl. Environ. Microbiol. 75:6812–6819. 10.1128/AEM.00933-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Heckman KL, Pease LR. 2007. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2:924–932. 10.1038/nprot.2007.132 [DOI] [PubMed] [Google Scholar]
  • 34.Schäfer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69–73. 10.1016/0378-1119(94)90324-7 [DOI] [PubMed] [Google Scholar]
  • 35.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254. 10.1016/0003-2697(76)90527-3 [DOI] [PubMed] [Google Scholar]
  • 36.Schühle K, Gescher J, Feil U, Paul M, Jahn M, Schägger H, Fuchs G. 2003. Benzoate-coenzyme A ligase from Thauera aromatica: an enzyme acting in anaerobic and aerobic pathways. J. Bacteriol. 185:4920–4929. 10.1128/JB.185.16.4920-4929.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ziegler K, Buder R, Winter J, Fuchs G. 1989. Activation of aromatic acids and aerobic 2-aminobenzoate metabolism in a denitrifying Pseudomonas strain. Arch. Microbiol. 151:171–176. 10.1007/BF00414434 [DOI] [Google Scholar]
  • 38.Shen XH, Jiang CY, Huang Y, Liu ZP, Liu SJ. 2005. Functional identification of novel genes involved in the glutathione-independent gentisate pathway in Corynebacterium glutamicum. Appl. Environ. Microbiol. 71:3442–3452. 10.1128/AEM.71.7.3442-3452.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Feng J, Che YS, Milse J, Yin YJ, Liu L, Ruckert C, Shen XH, Qi SW, Kalinowski J, Liu SJ. 2006. The gene ncgl2918 encodes a novel maleylpyruvate isomerase that needs mycothiol as cofactor and links mycothiol biosynthesis and gentisate assimilation in Corynebacterium glutamicum. J. Biol. Chem. 281:10778–10785. 10.1074/jbc.M513192200 [DOI] [PubMed] [Google Scholar]
  • 40.Lack L. 1961. Enzymic cis-trans isomerization of maleylpyruvic acid. J. Biol. Chem. 236:2835–2840 [PubMed] [Google Scholar]
  • 41.Schachter D, Taggart JV. 1953. Benzoyl coenzyme A and hippurate synthesis. J. Biol. Chem. 203:925–934 [PubMed] [Google Scholar]
  • 42.Wang J, Wang WS, Wang LQ, Zhang GF, Fan KQ, Tan HR, Yang KQ. 2011. A novel role of ‘pseudo' γ-butyrolactone receptors in controlling γ-butyrolactone biosynthesis in Streptomyces. Mol. Microbiol. 82:236–250. 10.1111/j.1365-2958.2011.07811.x [DOI] [PubMed] [Google Scholar]
  • 43.Zianni M, Tessanne K, Merighi M, Laguna R, Tabita FR. 2006. Identification of the DNA bases of a DNase I footprint by the use of dye primer sequencing on an automated capillary DNA analysis instrument. J. Biomol. Tech. 17:103–113 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2291779/ [PMC free article] [PubMed] [Google Scholar]
  • 44.Lloyd AL, Marshall BJ, Mee BJ. 2005. Identifying cloned Helicobacter pylori promoters by primer extension using a FAM-labelled primer and GeneScan analysis. J. Microbiol. Methods 60:291–298. 10.1016/j.mimet.2004.10.009 [DOI] [PubMed] [Google Scholar]
  • 45.Gescher J, Zaar A, Mohamed M, Schägger H, Fuchs G. 2002. Genes coding for a new pathway of aerobic benzoate metabolism in Azoarcus evansii. J. Bacteriol. 184:6301–6315. 10.1128/JB.184.22.6301-6315.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rabus R, Kube M, Heider J, Beck A, Heitmann K, Widdel F, Reinhardt R. 2005. The genome sequence of an anaerobic aromatic-degrading denitrifying bacterium, strain EbN1. Arch. Microbiol. 183:27–36. 10.1007/s00203-004-0742-9 [DOI] [PubMed] [Google Scholar]
  • 47.Krause A, Ramakumar A, Bartels D, Battistoni F, Bekel T, Boch J, Bohm M, Friedrich F, Hurek T, Krause L, Linke B, McHardy AC, Sarkar A, Schneiker S, Syed AA, Thauer R, Vorholter FJ, Weidner S, Puhler A, Reinhold-Hurek B, Kaiser O, Goesmann A. 2006. Complete genome of the mutualistic, N2-fixing grass endophyte Azoarcus sp. strain BH72. Nat. Biotechnol. 24:1385–1391. 10.1038/nbt1243 [DOI] [PubMed] [Google Scholar]
  • 48.Wheelis ML, Palleroni NJ, Stanier RY. 1967. The metabolism of aromatic acids by Pseudomonas testosteroni and P. acidovorans. Arch. Microbiol. 59:302–314 [DOI] [PubMed] [Google Scholar]
  • 49.Harpel MR, Lipscomb JD. 1990. Gentisate 1,2-dioxygenase from Pseudomonas—purification, characterization, and comparison of the enzymes from Pseudomonas testosteroni and Pseudomonas acidovorans. J. Biol. Chem. 265:6301–6311 [PubMed] [Google Scholar]
  • 50.Egland PG, Harwood CS. 1999. BadR, a new MarR family member, regulates anaerobic benzoate degradation by Rhodopseudomonas palustris in concert with AadR, an Fnr family member. J. Bacteriol. 181:2102–2109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hirakawa H, Schaefer AL, Greenberg EP, Harwood CS. 2012. Anaerobic p-coumarate degradation by Rhodopseudomonas palustris and identification of CouR, a MarR repressor protein that binds p-coumaroyl coenzyme A. J. Bacteriol. 194:1960–1967. 10.1128/JB.06817-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Providenti MA, Wyndham RC. 2001. Identification and functional characterization of CbaR, a MarR-like modulator of the cbaABC-encoded chlorobenzoate catabolism pathway. Appl. Environ. Microbiol. 67:3530–3541. 10.1128/AEM.67.8.3530-3541.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Kasai D, Kamimura N, Tani K, Umeda S, Abe T, Fukuda M, Masai E. 2012. Characterization of FerC, a MarR-type transcriptional regulator, involved in transcriptional regulation of the ferulate catabolic operon in Sphingobium sp strain SYK-6. FEMS Microbiol. Lett. 332:68–75. 10.1111/j.1574-6968.2012.02576.x [DOI] [PubMed] [Google Scholar]
  • 54.Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, II, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. 10.1016/0378-1119(95)00584-1 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_80_13_4051__index.html (1.4KB, html)
AEM.01146-14_zam999105461so1.pdf (563.7KB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES