Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jun 12.
Published in final edited form as: FEBS J. 2008 Sep 15;275(20):5062–5073. doi: 10.1111/j.1742-4658.2008.06639.x

The Drosophila homeodomain transcription factor, Vnd, associates with a variety of cofactors, is extensively phosphorylated, and forms multiple complexes in embryos

Huanqing Zhang 1, Li-Jyun Syu 2, Vicky Modica, Zhongxin Yu, Tonia Von Ohlen 3, Dervla M Mellerick 4
PMCID: PMC4055028  NIHMSID: NIHMS78134  PMID: 18795949

Abstract

Vnd is a dual transcriptional regulator that is essential for Drosophila dorsal-ventral patterning. Yet, our understanding of the biochemical basis for its regulatory activity is limited. Consistent with Vnd's ability to repress target expression in embryos, endogenously expressed Vnd physically associates with the co-repressor, Groucho, in Drosophila Kc167 cells. Vnd exists as a single complex in Kc167 cells in contrast to embryonic Vnd, which forms multiple high molecular weight complexes. Unlike its vertebrate homologue, Nkx2.2, full length Vnd can bind its target in EMSA, suggesting that co-factor availability may influence Vnd's weak regulatory activity in transient transfections. We identify the HMG1-type protein, D1, and the novel HLH protein, Olig, as novel Vnd-interacting proteins using co-immunoprecipitation assays. Furthermore, we demonstrate that both D1 and Olig are co-expressed with Vnd during Drosophila embryogenesis, consistent with a biological basis for this interaction. We also suggest that the phosphorylation state of Vnd influences its ability to interact with co-factors, because we show that Vnd is extensively phosphorylated in embryos and that it can be phosphorylated by activated MAP kinase in vitro. These results highlight the complexities of Vnd-mediated regulation.

1. Introduction

The Drosophila homeodomain transcription factor, Vnd, is the founding member of the Nk class of homeodomain proteins, which is both necessary and sufficient to specify ventral CNS cell fates in Drosophila embryos [1,2]. Drosophila neuroblasts are arranged in three columns, ventral, intermediate and lateral, with the ventral cells juxtaposed at either side of the ventral midline. Ventral column identity is transformed to intermediate column identity in vnd mutant embryos, whereas ectopic Vnd expression ventralizes the neuroectoderm [1,2]. Both mutant analyses [1,3-5] and biochemical data [6,7] indicate that Vnd functions as a dual regulator, capable of both activating and repressing target gene expression. Vnd interacts with the co-repressor, Groucho, to repress target gene expression. While Vnd's interaction with the HMG protein, Dichaete, facilitates activation of target genes [6,8]. However, co-transfection analyses indicate that additional unidentified co-factors are required to recapitulate the robust regulatory effects of Vnd evident in embryos.

In this report, we further explore the biochemical basis for Vnd's capacity to function as a dual regulator. We identify Drosophila Kc167 cells as an endogenous source of Vnd and show that the co-repressor, Groucho, physically interacts with Vnd in these cells. We show that Vnd exists as a complex in both Kc167 cells and in multiple high molecular weight complexes in embryos. We eliminate target DNA binding as the bottleneck in Vnd's incapacity to exert robust regulatory effects in tissue culture cells, since full length Vnd from either transient transfections or bacteria can bind its target in EMSA assays. These observations suggested that the phosphorylation state of Vnd may impinge on Vnd-mediated regulation. We demonstrate that Vnd exists as multiple isoforms in embryos, and that phosphorylation contributes to this diversity. We also confirm that the AT-hook protein, D1, physically interacts with Vnd and show that D1 is co-expressed with Vnd in embryos. In addition, we show that like its vertebrate homolog, Nkx2.2, Vnd physically interacts with the unique Drosophila Olig homolog, and that Vnd and Olig are co-expressed in at least one neuroblast and many neuroblast progeny. The significance of these findings is discussed.

2. Results

This study was prompted by previous findings that transiently expressed Vnd is relatively inert in both Drospohila S2 and vertebrate Hek 293 cells [6,7], despite using enhancers that are regulated by Vnd activity in embryos [9,10] to monitor regulatory activity. Co-expression of the co-regulators, Groucho and Dichaete, which both physically interact with Vnd, also generated only weak readouts [6], despite the fact that both these co-regulators modulate Vnd activity in Drosophila embryos [3,11]. Thus, unidentified co-factors, additional to the co-regulators so far identified, appear necessary for Vnd to exert the robust regulatory effects evident in Drosophila CNS development. Here we explore the nature of these co-factors.

2.1 Drosophila Kc167 cells co-express Vnd and Groucho

In an attempt to identify an easily accessible source of Vnd for biochemical analyses, we screened a number of different cell lines for endogenous Vnd expression using immunoprecipitation analyses (data not shown). Using our Vnd antibody for immunoprecipitations, we identified Drosophila Kc167 cells as an endogenous source of Vnd. Transfection of Kc167 cells with a luciferase reporter driven by either the 3’ ind enhancer through which Vnd represses ind expression in embryos [10] or a 5’ vnd enhancer through which Vnd mediates auto-activation [12] resulted in repression of both reporters (data not shown), suggesting that these cells likely co-express factors that are required for Vnd-mediated repression but not activation. Association of Vnd with the co-repressor, Groucho, mediates Vnd's repressor capacity in embryos [8]. Thus, we asked whether Vnd physically interacts with this protein in Kc167 cells by determining whether endogenous Vnd can pull down Groucho from these cells. Fig. 1 shows that immunoprecipitated Vnd pulls down endogenous Groucho, which suggests that Vnd in Kc167 cells may be a good source of Vnd for further biochemical analyses.

Fig. 1. Endogenous Vnd in Drosophila Kc167 cells associates with the co-repressor, Groucho.

Fig. 1

Open in a new tab

Immunoprecipitations, performed using an anti-Vnd antibody (lanes 2 and 4) or preserum (lanes 1 and 3), were Western blotted and incubated with an anti-Vnd antibody (lanes 1 and 2), or an anti-Groucho (Gro) antibody (lanes 3 and 4). Immunoprecipitated Vnd (lane 2) pulls down Gro (lane 4). Thus, endogenous Vnd physically associates with this co-repressor in Kc167 cells.

2.2. Vnd forms high molecular weight complexes in Kc cells and in embryos

To explore this possibility further, we compared the physical state of Vnd in Kc167 cells to its state in embryos by determining how both Vnd sources fractionate on sucrose gradients. To determine the physical distribution of Vnd, nuclear fractions from Kc167 cell and embryonic lysates were separated by SDS page, Western blotted, and incubated with a Vnd–specific antibody [13], following centrifugation on 0-30% sucrose gradients. Recombinant full length Vnd with a histidine tag fractionates at approximately 77 KD, based on the migration of labeled molecular weight markers loaded on parallel sucrose gradients. Whereas Vnd from Kc167 cells fractionated at approximately 230 KD (Fig. 2), which indicates that Vnd exists as a low molecular complex in these cells.

Fig. 2. Vnd is present in Kc167 cells and in embryos as high molecular weight complexes.

Fig. 2

Open in a new tab

Top. Western blots of sucrose gradient fractions prepared from nuclear extracts of Drosophila Kc167 cells (upper panel) or UAS-Vnd X Kruppel Gal4 embryos (lower panel) incubated with a Vnd antibody. Vnd from Kc167 cells fractionates in a 0-30% sucrose gradient at approximately 230 kD, whereas Vnd from embryos generates at least 4 high molecular weight complexes of 250, 300, 600 and more than 800 kD. Arrows indicate the location of recombinant Vnd (77 kD), lactose dehydrogenase (140 kD), catalase (232 kD), and ferritin (440 kD), which were fractionated on parallel gradients simultaneously. Bottom. Densitometer readings of blots shown above.

To examine how Vnd physically partitions from embryos, Vnd levels were enriched by over-expression using the UAS-Gal4 system [14] under the control of the Scabrous enhancer. This driver directs over-expression in all neuroectodermal cells from stage 10 onwards. Embryonic Vnd generated a number of independent peaks of high molecular weight (Fig. 2) on sucrose gradients, which indicates that Vnd is present in a variety of complexes in embryos, coincident with Vnd's diverse roles in CNS development [13] [2]. Thus, although Kc167 cells co-express Vnd and Groucho, they only partially mimic the microenvironment of Vnd in embryos. Thus, we did not consider them as an ideal source for further biochemical dissection of Vnd.

2.3. Vnd is extensively phosphorylated in embryos, and can be phosphorylated in vitro by activated MAP kinase

Unpublished transient transfection competition experiments to determine the basis for the selective interaction of Vnd with either Dichaete or Groucho [6] indicate that when Vnd is bound to Dichaete, addition of Groucho fails to displace Dichaete, and vice versa (data not shown). Since Vnd's activity is modulated by EGF signaling [11,15] and activated MAP kinase co-localizes with Vnd in embryos [15,16], phosphorylation of Vnd is likely to be important in its role as a dual regulator. However, to date whether Vnd is modified post-translationally or is a target of activated MAP kinase has not been directly addressed. Vnd has five candidate MAP kinase phosphorylation sites, 32PASP, 43PSSPATP, 157PWSP and 419PASP that conform to the consensus phosphorylation site, PXS/TP [17]. Moreover, the essential proline and serine/threonine are conserved between Drosophila (D) melanogaster and D. virilis (Fig. 3B). Thus, post-translational modification of Vnd may modulate the differential affinity of this transcription factor for embryonic co-factors that are simultaneously co-expressed with Vnd and modulate Vnd's capacity to function as either an activator or repressor.

Fig. 3. Vnd is extensively phosphorylated in embryos, and can be phosphorylated by activated MAP kinase in vitro.

Fig. 3

Open in a new tab

A. Western blots of two-dimensional gels of Vnd immunoprecipitated from Drosophila embryos detected using a Vnd antibody. The sample was divided; the one on the left was untreated, whereas that on the right was treated with alkaline phosphatase. The presence of multiple Vnd reactive spots indicates that Vnd is extensively post-translationally modified in embryos (left panel). The phosphatase treated sample on the right has significant fewer bands indicating that phosphorylation contributes to the multiple isoforms of Vnd. Molecular weight markers are as in Fig 2. Note the band at approx. 50 Kd are the IgG heavy chain isoforms.

B. Schematic of D. melanogaster Vnd showing the location of the five candidate MAP kinase phosphorylation sites (in green, labeled 1-5) in the full-length protein, and the N-terminal Vnd peptide used in C. Positions of the Eh domain (black), the homeodomain (red), and the Nk-2 box (yellow) are highlighted. The candidate MAP kinase target sites of Vnd from D. melanogaster and D. virilis are enlarged. Note that the essential proline (P) and serine (S) or threonine (T) residues are conserved.

C. Top. SDS PAGE of Vnd (lanes 1-5) used as in vitro phosphorylation substrate, as well as negative (lane 6) and positive (lane 7) controls.

Bottom. Autoradiograph of in vitro phosphorylation time course used activated MAP kinase, showing increasing incorporation of P32 into Vnd with increasing time. The negative control is not phosphorylated, whereas the positive control, PHAS-1, incorporates significant amounts of P32 after 30 minutes.

To directly address whether Vnd is post-translationally modified in embryos, we immunoprecipitated this transcription factor from Scabrous-Gal4 X UAS-vnd embryos and subjected the immunoprecipitate to two-dimensional gel electrophoresis and Western analyses. Our Vnd antibody identified multiple isoforms of Vnd (Fig. 3A), which are at least partially due to different phosphorylation states of the protein, since phosphatase treatment of the immunoprecipitate generated many fewer isoforms of Vnd (Fig. 3A). We also addressed whether Vnd can be phosphorylated in vitro by MAP kinase. A his-tagged recombinant Vnd peptide encompassing the five candidate Map kinase target sites (Fig. 3B) was purified from bacteria and assayed as phosphorylation substrate for activated MAP kinase. For these experiments we utilized the vertebrate homolog of Rolled, the Drosophila MAP kinase. These two kinases have identical active sites, therefore they should phosphorylate targets with the same specificity. Our results show that recombinant Vnd is phosphorylated by activated MAP kinase in vitro (Fig. 3C). Thus, phosphorylation of Vnd likely plays a role in Vnd's ability to function as a dual regulator, potentially by affecting its selective interaction with co-factors that mediate its opposing regulatory activities.

2.4 Full length Vnd can bind its target in EMSAs

Watada et al. [18] previously reported that Nkx2.2, the mouse homologue of Vnd, has a carboxyl terminal DNA binding interference domain, which had to be removed (or possibly inactivated in vivo) for efficient target recognition [18]. If Vnd's capacity to bind target DNA is similarly regulated, this might explain why this transcription factor is such an inefficient regulator in S2 cells and Hek 293 cells [6,7]. We previously showed that the recombinant Vnd homeodomain binds 3 Vnd target sites in the ind enhancer, and the Vnd binding sites were further localized by footprinting [10]. However, we have not as yet determined whether full length Vnd can bind target DNA, and whether post-translational modification of Vnd affects Vnd's capacity to bind its target.

To address this question, we performed EMSA assays using either the recombinant full length Vnd or Vnd that was transiently expressed in Hek293 cells, and thus potentially post-translationally modified. We used an oligonucleotide (oligo) that corresponds to the binding sites in the 3’ ind enhancer [10] (through which Vnd represses ind expression in embryos) as target (Fig. 4A). When we compared the binding of Vnd from transiently transfected Hek293 cell lysates to that of purified recombinant full length Vnd, we found that Vnd from both sources caused mobility shifts, paralleling our previous finding using the Vnd HD [10]. Thus, binding of Vnd to its target is unlikely to be the bottleneck in Vnd's inability to robustly regulate target expression in the tissue culture cells tested thus far. The availability of essential cofactors required for Vnd regulation is potentially the factor limiting Vnd's capacity to regulate target gene expression in tissue culture cells.

Fig. 4. Full length Vnd can bind its in vivo target.

Fig. 4

Open in a new tab

A. Oligo used in B corresponding to the Vnd target in the ind enhancer, which contains 4 Vnd binding sites (underlined).

B. Lanes 1-3: EMSA using recombinant full length Vnd. Lanes 4-6: EMSA using Hek 293 cell extracts. Lane 4 is cell extract containing the empty vector. Lane 5 is Vnd-containing cell extract. Lanes 6 corresponds to lanes 5 with excess unlabelled probe. Negative control in lane 1 corresponds to probe without protein.

Incubation of the recombinant Vnd with labeled oligo generates a mobility shift (lane 3), when large levels are used. Note lane 2 contains 5-fold less recombinant protein than lane 3. Incubation of Vnd in cell extract also generates a mobility shift (lane 5). Incubation of cell extract with excess unlabelled oligo interferes with the binding to the labeled oligo (lane 6).

2.5. Vnd physically associates with the AT-hook protein, D1, and the HLH protein, Olig

Since unidentified co-factors additional to Dichaete and Groucho are likely to be required for Vnd's capacity to either activate or repress target gene expression, we next explored other co-factors that may impinge on Vnd's regulatory activity. We selected two proteins, D1 and Olig, as candidate Vnd co-regulators. D1 was identified in a genome wide 2- yeast hybrid interaction screen as a novel Vnd interacting protein [19]. However, this reported interaction has not been confirmed using more rigorous interaction assays. Olig was considered as a second likely Vnd interacting protein, since the Vnd homologue, Nkx2.2, both physically and genetically interact with the vertebrate HLH protein, Olig2, to influence neural/glial cell sub-type specification [20-22]. Thus, we hypothesized that either Drosophila D1 and/or Olig may bind Vnd and impinge on its activities as a dual regulator.

To determine whether Vnd can immunoprecipitate either of these transcription factors, we transiently expressed Vnd with an amino terminal Gal4 domain in Hek 293 cells, (which were selected because of their high transfection efficiency), and immunoprecipitated it using the Gal4 antibody. D1 and Olig were also independently expressed, and cell lysates containing either factor were incubated with the Vnd immunoprecipitate. To express D1 and Olig, both candidate co-factors were cloned into an expression vector carrying an amino terminal Flag tag (see Methods and Materials for details). As positive controls, Dichaete expressed with a Flag tag, and Groucho with a Myc tag were also tested for Vnd interaction, since we previously demonstrated that Vnd can immunoprecipitate both these co-regulators [6].

The Vnd immunoprecipitate was split and incubated with lysates from either untransfected cells, or cells that transiently express Flag-tagged D1, Olig, or Dichaete, or Myc-tagged Groucho. Then the co-precipitates were size separated by SDS-page, and Western blotted. To identify which proteins Vnd could pull down, blots were incubated with either an anti-Flag or an anti-Myc tag antibody. Here we show that Vnd physically associates not only with Myc-tagged Groucho and Flag-tagged Dichaete, but also with Flag-tagged D1 and Flag-tagged Olig (Fig. 5). Thus, these co-immunoprecipitation analyses verify that Vnd physically interacts with the AT-hook protein, D1, and identifies the unique HLH protein, Olig, as a novel protein that physically associates with this transcription factor.

Fig. 5. Two new Vnd interacting proteins: D1 and Olig.

Fig. 5

Open in a new tab

Western blots of immunoprecipitates incubated with an anti-Gal4 antibody which detects Vnd with a Gal4 DNA binding domain tag or Gal4 DNA binding domain (DBD) alone (A), anti-Flag, which detects Flag tagged D1, Dichaete, or anti-Myc, which detects Myc-tagged-Groucho (B). Bands of interest are highlighted with arrows.

Lane 1: Gal4-DBD +Olig

Lane 2: Gal4-DBD-Vnd+Olig

Lane 3: Gal4-DBD +D1

Lane 4: Gal4-DBD-Vnd+D1

Lane 5: Gal4-DBD +Dichaete

Lane 6: Gal4-DBD-Vnd+Dichaete

Lane 7: Gal4-DBD +Groucho

Lane 8: Gal4-DBD-Vnd+Groucho

B. The Gal4 DBD does not interact with either antibody indicating that there is no non-specific binding. In contrast, the presence of Vnd leads to Olig (lane 2) and D1 (lane 4) being pulled down. As previously reported, Dichaete (lane 6) and Groucho (lane 8) are also pulled down by Vnd.

2.6 Expression of Drosophila olig and D1 overlap with the Vnd expression domain in a spatiotemporally restricted fashion

If the physical interactions between Vnd and the candidate co-regulators, Olig and D1, are relevant in vivo, we would expect to find Vnd co-expressed with each of these genes in at least a subset of cells. Vnd is expressed in the embryonic nervous system throughout embryogenesis initially in ventral neuroectodermal cells (Fig. 6A and 7A), then in most ventral neuroblasts and posterior intermediate neuroblasts (Fig. 6B and 6C), and later in many CNS neurons (Fig. 6D and Fig. 6E). Because the expression patterns for olig and D1 have not previously been described, we performed in situ hybridizations to determine the expression patterns of each of these genes. The results of these experiments are shown in Figs 6 and 7.

Figure 6. Vnd co-localizes with olig in a subset of Drosophila CNS cells.

Figure 6

Open in a new tab

Anterior is up, all views are ventral. A-E) Vnd protein expression. Embryos in panels A through E are stages 10, 11, 12, 14 and 15 respectively. F-J) olig mRNA expression pattern. Embryos in panels F through J are stages 10, 11, 12, 14 and 15, respectively. K. Engrailed protein, which demarcates posterior compartment neuroblasts (brown) and olig mRNA (purple). Dashed line indicates midline. The MP2 and 7.1 neuroblasts are highlighted. L-N) Vnd protein, (brown) and olig mRNA (purple). L) Stage 10, ventral (V), intermediate (I) and lateral (L) neuroblasts are indicated. M) Stage 11. N) Stage 12.

Figure 7. D1 is broadly expressed in the embryonic CNS and is co-expressed with Vnd in a subset of cells.

Figure 7

Open in a new tab

Anterior is up, all views are ventral except A, which is ventrolateral. A) Vnd distribution in stage 5 wild-type embryo. B-F) Wild-type embryos labeled for D1 mRNA expression, ventral midline is indicated in white. B) D1 is initially detected ubiquitously due to maternal contribution; later message is restricted to the CNS. B) Stage 5. C) Stage 11; inset shows schematic of Vnd-expressing neuroblasts in ventral (V) and intermediate (I), but not lateral (L), neuroblasts. D) Stage 12. E) Stage 14. F) Stage 15. G-J) Vnd protein (brown) and D1 mRNA (purple). G) In stage 5 embryos, all Vnd expressing cell co-express D1, which is ubiquitous (see B) (H-J). After stage 11, a subset of the D1 positive cells also express Vnd. F) Stage 11. G) Stage 12 embryo. H) Stage 14 nerve cord.

We find that olig mRNA is initially detected at late stage ten in one/two ventral column neuroblasts per hemi-segment, initially in MP2 (Fig. 6F), (Fig. 6F). At Stage 11, olig transcripts are detected in ventral neuroblasts and anterior intermediate neuroblasts and ganglion mother cells (GMCs) (Fig. 6G and M). For the remainder of embryogenesis, the majority of CNS cells express the olig message (Fig. 6H, I, J and N). Thus, Vnd is co-expressed with Olig in a subset of CNS cells, suggesting that the physical interaction that we uncovered is biologically significant.

Next we examined the distribution of D1 mRNA. Initially, we detect ubiquitous D1 message, due to a maternal contribution (Fig. 7B). We find that in stage 5 –8 embryos, double labeled for Vnd protein and D1 mRNA, all cells that express Vnd also express D1 (e.g. Fig. 7G). This is because the distribution of D1 message is ubiquitous at these stages of development. From stage 11 in development, we detect nascent transcription of the D1 message in the embryonic CNS. Indeed, D1 message is detected exclusively in the CNS in a broad pattern that includes most, if not all, cells of the nervous system through the end of embryogenesis (Fig. 7C-F). From stage 11 onwards, a subset of the D1 expressing cells also express Vnd (Fig. 7H-J). Thus, D1 and Olig are not only capable of physically interacting with Vnd, but each of these genes is also co-expressed with Vnd in the developing embryonic nervous system. These observations support our hypothesis that the selective physically interaction of these proteins with Vnd influences the ability of Vnd to regulate target gene expression.

3. Discussion

Here we take a biochemical approach to further elucidate the intricacies of Vnd-mediated regulation. This homeodomain protein has both activator and repressor activities, and is essential to early CNS patterning in Drosophila. We show that Drosophila Kc167 cells express endogenous Vnd, and that Vnd is associated with the co-repressor, Groucho, in these cells. Sucrose gradient fractionation indicates that Vnd in Kc167 cells is present as a complex of greater than 200 Kd, while Vnd from embryos exists as multiple high molecular weight complexes of sizes greater than 200 Kd. We show that full length Vnd can bind its target in tissue culture cells where the transcription factor is relatively inert. We also show that Vnd is extensively post-translationally modified in embryos, in part due to multiple phosphorylations, and that Vnd is a substrate for activated MAP kinase. We further identify the AT-hook protein, D1, and the HLH protein, Olig, as Vnd interacting proteins that co-localize with this transcription factor in Drosophila embryos. These results further our understanding of the multiple levels of regulation of Vnd in embryos.

Our observation that Vnd exists in a variety of high molecular weight complexes in embryos concurs with our findings that Vnd interacts with at least four different cofactors, in part in spatio-temporally restricted patterns. These include the ubiquitous corepressor, Groucho, and the CNS-specific transcription factors, Dichaete [6], Olig, and D1. The significance of the interaction of Vnd with the co-repressor, Groucho, and the co-activator, Dichaete, has previously been defined [3,4,6,8,11]. In contrast, the impact of the interaction of Vnd with either Olig or D1 is currently unknown. In vertebrates, the homolog of Olig, Olig2, plays critical roles in both motorneuron and oligodendrocyte specification. Olig2 is expressed early in neurogenesis in a restricted region of the ventricular zone that gives rise to oligodendrocytes and then motor neurons and is critical for the specification of both cell types [20-22]. In contrast, Drosophila Olig expression is activated relatively late, initially in the MP2 and 7.1 neuroblasts, and subsequently in most CNS cells. Interestingly, the timing of Drosophila Olig activation roughly corresponds to the time in vertebrate development when the expression domains of Olig2 and Nkx2.2 expression switch from being mutually exclusive to overlapping. Thus, the difference in spatiotemporal distribution of Olig relative to its vertebrate counterparts suggests that the function of Olig in Drosophila may differ from that of its vertebrate counterparts. Despite this observation, co-expression of Olig2 and Nkx2.2 is evolutionarily conserved, since Olig and Vnd are also co-expressed in a subset of CNS cells. At this time, the significance of this observation remains undefined, since Olig mutants are currently unavailable.

Our demonstration that Vnd interacts with D1 confirms the previous findings of Giot et al., [19], and presents the possibility that Vnd is part of the transcriptional machinery that targets chromatin remodeling complexes to specific loci. D1, the Drosophila homologue of HMG1, contains 10 AT-hooks that bind the minor groove of DNA [23]. This gene suppresses variegation, consistent with its role in the modification of chromatin structure [24]. D1 also interacts with boundary elements involved in gene insulation via its acidic carboxyl terminal tail. In keeping with its potential role in chromatin remodeling D1 also interacts with SnR1, which in turn interacts with Brahma and Trithorax [19]. Further work is clearly required to explore the effect of the interaction of Vnd with D1 more fully. Our DNA binding data indicate that full length Vnd can bind its targets in the ind enhancer, which suggests that robust regulatory readouts require unidentified co-factors in addition to Groucho and Dichaete that modulate chromatin architecture subsequent to DNA binding. Indeed, we found that the AT hook protein, D1, also binds the ind enhancer (data not shown). D1 may potentially bind through the CArG box, which HMG-1(Y) binds [25], since three of the four Vnd binding sites have a CAAG core, corresponding to this domain.

Our 2-dimensional gel analyses indicate that Vnd is extensively phosphorylated. The range of Vnd isoforms observed in the Western analyses may be due to selective phosphorylation of Vnd's five consensus MAP kinase target sequences, PXS/TP, at positions 32, 43,157, and 419 in the protein. Indeed, the fact that recombinant Vnd is phosphorylated by activated MAP kinase points to the potential functional significance of these sites. The phosphorylation state of many other transcription factors affects their regulatory activity. For instance, phosphorylation of the homeodomain protein Antennapedia by casein kinase II is important for its activity [26]. Likewise, MAP kinase phosphorylation of two Drosophila Ets transcription factors, Pointed-P2 (PntP2) and Yan/Anterior open [27], affects both eye development and embryonic dorsal-ventral patterning. PntP2, the homolog of human Ets-1, functions as a transcriptional activator when phosphorylated by MAP kinase [27,28,29]. While Yan, the homolog of human Tel1, represses target genes in the absence of MAP kinase [30,31]. Both PntP2 and Yan contain an Ets DNA-binding domain and compete for access to promoter regions of common downstream transcriptional targets [32]. Upon Ras activation and subsequent stimulation of MAP kinase, Yan is phosphorylated and exported from the nucleus where it is thought to be degraded [30,31]. This results in derepression of transcriptional targets and allows cells to respond appropriately to the initial PntP2 –mediated activating signal. In the case of Vnd, Skeath [16] previously reported that the distribution of activated MAP kinase overlaps with the expression domain of Vnd, and over-expression of the ligand, Spitz, results in ectopic Vnd expression. Moreover, Vnd auto-activates its own expression [8,9]. These combined observations suggest that Vnd must be phosphorylated to interact with co-regulators required for Vnd-mediated activation. Further work is required to address this issue more thoroughly.

In summary, the data presented here highlight the multiple levels at which Vnd regulatory activity is controlled. This apparent complexity is not surprising, since Vnd plays a key role in early patterning of the CNS, functioning as both an activator and repressor of target gene expression. This range of controls potentially influences the selectivity of Vnd for target gene regulation in a dynamically changing environment, ensuring that targets are appropriately activated or repressed.

4. Methods and Materials

4.1 Immunoprecipitation of Vnd from Kc167 cells

Kc167 cells were maintained in Schneider's medium (Gibco) containing 10% fetal calf serum and 1% penicillin/streptomycin. Immunoprecipitations were performed as described previously [6], using nuclear extracts that were prepared from Kc167 cells as described in [33]. Cells were homogenized (× 20 strokes) with a type A Dounce homogenizer in 5 ml of ice-cold NB1 (10 mM Tris-HCl, pH 8.0, 10 mM NaCl, 3 mM MgCl2, 0.5 mM DTT, 0.1% Triton X-100, 0.1M sucrose). Following centrifugation at 200g for 1 min, the supernatant was gently mixed with an equal volume of chilled NB2 (NB1 with 0.25 M sucrose). 2.5 ml of NB3 (10 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 0.5 mM DTT, 0.33 M sucrose) was layered under the cell suspension, and nuclei were pelleted at 1,000 g at 4°C for 10 min. Nuclei were resuspended in immunoprecipitation (IP) buffer [20 mM Tris–HCl, 100 mM NaCl, 10 mM NaF, 1 mM Na3VPO4, 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Roche) containing 0.5% Triton X-100] and briefly vortexed. Following pre-incubation with protein A/G PLUS agarose (Santa Cruz Biotechnology) for 30 min at 4°C, the nuclear lysate was incubated with our rabbit polyclonal anti-Vnd antibody rotating overnight at 4°C. Then protein A/G PLUS agarose was added and the lysate rotated at 4°C for 2 h. Beads were precipitated by centrifugation, and washed three times with IP buffer containing 0.1% Triton X-100 and resuspended in SDS–PAGE sample buffer. The immunoprecipitates were separated by SDS–PAGE electrophoresis, transferred onto Immobilon-P (Millipore) membrane and Western blotted. Duplicate blots were incubated with anti-Vnd antibody [1] to detect Vnd or an anti-Groucho mouse antibody (University of Iowa Hybridoma Core) to detect Groucho. Binding of peroxidase-conjugated secondary antibodies was detected by chemiluminescence, using the Lightning kit (Perkin Elmer).

4.2 Sucrose Gradient fractionation of Vnd from Drosophila Kc167 cells and from Drosophila embryos

Nuclei were isolated from Kc167 cells as described above. For embryos, following collection of progeny of pUAST-vnd X Scabrous Gal4 flies, embryos were dechorionated in clorox, washed with 0.7% NaCl, 0.1% triton-X 100, and stored at – 80°C. Embryonic nuclear extracts were prepared as described above using 1g of embryos in 50 mls of NB1 buffer. 25 ml of NB3 was layered under the cell suspension in NB1 and NB2 buffer, and nuclei were pelleted at 1,000 g at 4°C for 10 min. Nuclei were lysed in 1 ml of buffer consisting of 50 mM HEPES (Invitrogen), pH 7.5, 0.1% NP-40, 50 mM NaCl, 200 [.proportional]M Na3VO4, 50 mM β-glycerol phosphate, 50 mM NaF (Sigma) and protease inhibitor cocktail (Roche) and centrifuged at 14,000 g at 4°C for 15 min. Then the supernatant was loaded onto a 10 ml 0-30% continuous sucrose gradient in lysis buffer. High molecular weight standards (Amersham Biosciences) and a bacterial cell lysate containing full-length recombinant Vnd (see 4.6 for details) were fractionated on a separate, but identical, gradients. Following centrifugation in a SW41 rotor at 35,000 rpm for 16 hr, 440 μl fractions were collected from the surface of the gradients. Fractions were precipitated with methanol and chloroform according to [34]. Fraction pellets were dissolved in Laemmli sample buffer (Bio-Rad) for SDS-PAGE and Western blotted. Vnd distribution was detected using a rabbit anti-Vnd antibody. Binding of peroxidase-conjugated secondary antibodies was detected by chemiluminescence, using the Lightning kit (Perkin Elmer).

4.3 Immunoprecipitation of Vnd from embryos, 2-dimensional gel electrophoresis, and phosphatase treatment

Vnd was immunoprecipitated from nuclei from 1 gm of Scabrous-Gal4 X UAS-vnd embryos, as described above. Half the sample was treated with alkaline phosphatase; the remainder was left untreated. Two-dimensional gel electrophoresis was performed at the University of Michigan Protein Core. Vnd distribution was detected using a rabbit anti-Vnd antibody. Chemiluminescence was used for detection using the Lightning kit (Perkin Elmer).

4.4 In vitro phosphorylation of Vnd

A Vnd fusion protein encompassing the 5 candidate MAP kinase target sites was purified under denaturing conditions from the pRSet C vector (Invitrogen) containing a 1.68-kb vnd fragment that extends from the translation start site into the first helix of the homeodomain [35]. Following stepwise renaturation into 10 mM Tris, pH 8, 1 mM β-mercaptoethanol, the peptide was subjected to in vitro phosphorylation using the MAP kinase kit (Stratagene). PHAS-1 (Stratagene), a 117 amino acid substrate that is highly specific for activated MAP kinase was used as positive control. 2 μC of gamma 32ATP was added to each reaction. Reactions were incubated at 30°C, and stopped by addition of Laemmli buffer. Following SDS-page separation, the gel was dried, and exposed to film.

4.5 Isolation of Drosophila virilis Vnd

Two overlapping genomic D. virilis vnd clones were isolated from a custom genomic library following hybridization at 55°C, and washing in 2X SSC at 55°C. Fragments were sub-cloned into pBluescript and sequenced in both directions at the University of Michigan Sequencing Core. Putative open reading frames were translated and aligned with D. melanogaster Vnd using MACVECTOR.

4.6 Generation of full length Vnd and EMSA

A PCR product corresponding to full length vnd was generated using the 5’ GATAT ACTCGAGTACCACGTCGGCGTCCTTGGA 3’ sense, and the 5’ CTCGACGAATTCCT AGCAATATTAGGGCCACCAG 3’ antisense primers, and cloned into the pRSet B vector (Invitrogen) using the synthetic EcoR1 and Xho1 sites included in the primers. Full length Vnd was purified under denaturing conditions as described previously and dialyzed into Z buffer (10% glycerol, 12.5 mM Hepes, pH 7.8, 6 mM MgCl2, 0.5 mM DTT, 50 mM KCl, 0.05% NP 40). For generation of Vnd from tissue culture cells, 100mm Hek293 plates, maintained in DMEM containing 10% fetal calf serum and 1% penicillin/streptomycin, were transfected with 6 μg of vector using 18 μl of Fugene. 48 hr. post-transfection, nuclear lysates were generated as described above and dialyzed into Z buffer. EMSA was performed as described previously in [11], except that 100 ng of salmon sperm DNA was used as competitor in place of poly dI-dC.

4.7 Co-immunoprecipitation analyses

olig was amplified from Est GH17679 using the following sense and antisense primers: 5’ GCTCGTGATATCTATGGATCCCTCGAATCTTGC 3’ and 5’ GTGCATTCTAGATT AACTGCTGCTAGTCGGTGG 3’, with synthetic Sal1 and Xho1 sites. D1 was amplified from Est RE39218 using the following sense and antisense primers: 5’ GCACTCGAAT TCGATGGAGGAAGTTGCGGTAAAGAAGC 3’, and GTCTCAGTCGACTAACCGTCGTT GGCATCATTTTCG 3’ with synthetic EcoR1 and Sal1 sites. The PCR products were then directionally cloned into the pFlag vector (Sigma). Dishes (100 mm) containing Hek 293 cells were independently transfected with 6 μg of each vector. Immunprecipitations were performed as described in [6]. Cell lysates were prepared 48 h after transfection using IP buffer and proteinase inhibitor cocktail (Roche) containing 0.5% Triton X-100. The Vnd Gal4 DNA binding domain chimeras was precipitated from cell lysates using an antibody that recognizes the Gal4 DNA binding domain (Santa Cruz Biotechnology) rotating overnight at 4 °C. Following immunoprecipitation of the protein using A/G PLUS agarose (Santa Cruz Biotechnology), beads were divided into aliquots and incubated with equal amounts of cell lysate containing each of the candidate Vnd interacting proteins. Co-immunoprecipitates were rotated for 2 h at 4 °C, precipitated by centrifugation, and washed three times with IP buffer containing 0.1% Triton X-100 and Western blotted. Then triplicate blots were incubated with anti-Myc antibody (Sigma) to detect the Myc-tagged Groucho, ant-Flag (Sigma) to detect Flag-tagged Dichaete, Olig and D1, or the Gal4-specific antibody (Santa Cruz Biotechnology) to detect the Gal4-Vnd chimera. Binding of peroxidase-conjugated secondary antibodies was detected by chemiluminescence using the Lightning kit (Perkin-Elmer).

4.7 In situ hybridization localization of D1 and Olig in Drosophila embryos relative to Vnd protein

ESTs for D1 and Olig (see 4.6), obtained from DGRC, were used to make digoxigenin labeled antisense RNA probes as described previously [35]. Double labels with Vnd antibody were done sequentially as described in [35]; in situ hybridization with the antisense probes was immediately followed by incubation in rabbit anti-Vnd antibody at a concentration of 1:200 [35].

Acknowledgements

This research was made possible by grant R01HD38403 from NIH to DM and a P20 RR016475, to T.V.O., from the National Center for Research Resources (NCRR) at NIH. The contents of this publication are solely the responsibility of the authors and do not necessarily represent the official views of NCRR or NIH.

References

  • 1.McDonald JA, Doe CQ. Establishing neuroblast-specific gene expression in the Drosophila CNS: huckebein is activated by Wingless and Hedgehog and repressed by Engrailed and Gooseberry. Development. 1997;124:1079–87. doi: 10.1242/dev.124.5.1079. [DOI] [PubMed] [Google Scholar]
  • 2.Chu H, Parras C, White K, Jimenez F. Formation and specification of ventral neuroblasts is controlled by vnd in Drosophila neurogenesis. Genes & Development. 1998;12:3613–24. doi: 10.1101/gad.12.22.3613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Overton PM, Meadows LA, Urban J, Russell S. Evidence for differential and redundant function of the Sox genes Dichaete and SoxN during CNS development in Drosophila. Development. 2002;129:4219–28. doi: 10.1242/dev.129.18.4219. [DOI] [PubMed] [Google Scholar]
  • 4.Russell SR, Sanchez-Soriano N, Wright CR, Ashburner M. The Dichaete gene of Drosophila melanogaster encodes a SOX-domain protein required for embryonic segmentation. Development. 1996;122:3669–76. doi: 10.1242/dev.122.11.3669. [DOI] [PubMed] [Google Scholar]
  • 5.Soriano NS, Russell S. The Drosophila SOX-domain protein Dichaete is required for the development of the central nervous system midline. Development. 1998;125:3989–96. doi: 10.1242/dev.125.20.3989. [DOI] [PubMed] [Google Scholar]
  • 6.Yu Z, Syu LJ, Mellerick DM. Contextual interactions determine whether the Drosophila homeodomain protein, Vnd, acts as a repressor or activator. Nucleic Acids Res. 2005;33:1–12. doi: 10.1093/nar/gki140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Stepchenko A, Nirenberg M. Mapping activation and repression domains of the vnd/NK-2 homeodomain protein. Proc Natl Acad Sci U S A. 2004;101:13180–5. doi: 10.1073/pnas.0404775101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cowden J, Levine M. Ventral dominance governs sequential patterns of gene expression across the dorsal-ventral axis of the neuroectoderm in the Drosophila embryo. Dev Biol. 2003;262:335–49. doi: 10.1016/s0012-1606(03)00395-6. [DOI] [PubMed] [Google Scholar]
  • 9.Saunders HH, Koizumi K, Odenwald W, Nirenberg M. Neuroblast pattern formation: regulatory DNA that confers the vnd/NK-2 homeobox gene pattern on a reporter gene in transgenic lines of Drosophila. Proc Natl Acad Sci U S A. 1998;95:8316–21. doi: 10.1073/pnas.95.14.8316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Weiss JB, Von Ohlen T, Mellerick DM, Dressler G, Doe CQ, Scott MP. Dorsoventral patterning in the Drosophila central nervous system: the intermediate neuroblasts defective homeobox gene specifies intermediate column identity. Genes & Development. 1998;12:3591–602. doi: 10.1101/gad.12.22.3591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhao G, Skeath JB. The Sox-domain containing gene Dichaete/fish-hook acts in concert with vnd and ind to regulate cell fate in the Drosophila neuroectoderm. Development. 2002;129:1165–74. doi: 10.1242/dev.129.5.1165. [DOI] [PubMed] [Google Scholar]
  • 12.Estes P, Mosher J, Crews ST. Drosophila single-minded represses gene transcription by activating the expression of repressive factors. Developmental Biology. 2001;232:157–175. doi: 10.1006/dbio.2001.0174. [DOI] [PubMed] [Google Scholar]
  • 13.McDonald JA, Holbrook S, Isshiki T, Weiss J, Doe CQ, Mellerick DM. Dorsoventral patterning in the Drosophila central nervous system: the vnd homeobox gene specifies ventral column identity. Genes & Development. 1998;12:3603–12. doi: 10.1101/gad.12.22.3603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–15. doi: 10.1242/dev.118.2.401. [DOI] [PubMed] [Google Scholar]
  • 15.Zhao G, Boekhoff-Falk G, Wilson BA, Skeath JB. Linking pattern formation to cell-type specification: Dichaete and Ind directly repress achaete gene expression in the Drosophila CNS. Proc Natl Acad Sci U S A. 2007;104:3847–52. doi: 10.1073/pnas.0611700104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Skeath JB. The Drosophila EGF receptor controls the formation and specification of neuroblasts along the dorsal-ventral axis of the Drosophila embryo. Development. 1998;125:3301–12. doi: 10.1242/dev.125.17.3301. [DOI] [PubMed] [Google Scholar]
  • 17.Alvarez E, Northwood IC, Gonzalez FA, Latour DA, Seth A, Abate C, Curran T, Davis RJ. Pro-Leu-Ser/Thr-Pro is a consensus primary sequence for substrate protein phosphorylation. Characterization of the phosphorylation of c-myc and c-jun proteins by an epidermal growth factor receptor threonine 669 protein kinase. Journal of Biological Chemistry. 1991;266:15277–85. [PubMed] [Google Scholar]
  • 18.Watada H, Mirmira RG, Kalamaras J, German MS. Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins. Proc Natl Acad Sci U S A. 2000;97:9443–8. doi: 10.1073/pnas.97.17.9443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Giot L, et al. A protein interaction map of Drosophila melanogaster. Science. 2003;302:1727–36. doi: 10.1126/science.1090289. [DOI] [PubMed] [Google Scholar]
  • 20.Qi Y, et al. Control of oligodendrocyte differentiation by the Nkx2.2 homeodomain transcription factor. Development. 2001;128:2723–33. doi: 10.1242/dev.128.14.2723. [DOI] [PubMed] [Google Scholar]
  • 21.Sun T, Echelard Y, Lu R, Yuk DI, Kaing S, Stiles CD, Rowitch DH. Olig bHLH proteins interact with homeodomain proteins to regulate cell fate acquisition in progenitors of the ventral neural tube. Curr Biol. 2001;11:1413–20. doi: 10.1016/s0960-9822(01)00441-9. [DOI] [PubMed] [Google Scholar]
  • 22.Sun T, Dong H, Wu L, Kane M, Rowitch DH, Stiles CD. Cross-repressive interaction of the Olig2 and Nkx2.2 transcription factors in developing neural tube associated with formation of a specific physical complex. J Neurosci. 2003;23:9547–56. doi: 10.1523/JNEUROSCI.23-29-09547.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ashley CT, Pendleton CG, Jennings WW, Saxena A, Glover CV. Isolation and sequencing of cDNA clones encoding Drosophila chromosomal protein D1. A repeating motif in proteins which recognize at DNA. J Biol Chem. 1989;264:8394–401. [PubMed] [Google Scholar]
  • 24.Aulner N, et al. The AT-hook protein D1 is essential for Drosophila melanogaster development and is implicated in position-effect variegation. Mol Cell Biol. 2002;22:1218–32. doi: 10.1128/MCB.22.4.1218-1232.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chin MT, Pellacani A, Wang H, Lin SS, Jain MK, Perrella MA, Lee ME. Enhancement of serum-response factor-dependent transcription and DNA binding by the architectural transcription factor HMG-I(Y). J Biol Chem. 1998;273:9755–60. doi: 10.1074/jbc.273.16.9755. [DOI] [PubMed] [Google Scholar]
  • 26.Jaffe L, Ryoo HD, Mann RS. A role for phosphorylation by casein kinase II in modulating Antennapedia activity in Drosophila. Genes Dev. 1997;11:1327–40. doi: 10.1101/gad.11.10.1327. [DOI] [PubMed] [Google Scholar]
  • 27.O'Neill EM, Rebay I, Tjian R, Rubin GM. The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell. 1994;78:137–47. doi: 10.1016/0092-8674(94)90580-0. [DOI] [PubMed] [Google Scholar]
  • 28.Klambt C. The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells. Development. 1993;117:163–76. doi: 10.1242/dev.117.1.163. [DOI] [PubMed] [Google Scholar]
  • 29.Brunner D, Ducker K, Oellers N, Hafen E, Scholz H, Klambt C. The ETS domain protein pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway. Nature. 1994;370:386–9. doi: 10.1038/370386a0. [DOI] [PubMed] [Google Scholar]
  • 30.Rebay I, Rubin GM. Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell. 1995;81:857–66. doi: 10.1016/0092-8674(95)90006-3. [DOI] [PubMed] [Google Scholar]
  • 31.Lai ZC, Rubin GM. Negative control of photoreceptor development in Drosophila by the product of the yan gene, an ETS domain protein. Cell. 1992;70:609–20. doi: 10.1016/0092-8674(92)90430-k. [DOI] [PubMed] [Google Scholar]
  • 32.Vivekanand P, Tootle TL, Rebay I. MAE, a dual regulator of the EGFR signaling pathway, is a target of the Ets transcription factors PNT and YAN. Mech Dev. 2004;121:1469–79. doi: 10.1016/j.mod.2004.07.009. [DOI] [PubMed] [Google Scholar]
  • 33.Phelps DE, Dressler GR. Identification of novel Pax-2 binding sites by chromatin precipitation. Journal of Biological Chemistry. 1996;271:7978–7985. doi: 10.1074/jbc.271.14.7978. [DOI] [PubMed] [Google Scholar]
  • 34.Wessel D, a.F.U. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. 1984;138:141–143. doi: 10.1016/0003-2697(84)90782-6. [DOI] [PubMed] [Google Scholar]
  • 35.Uhler J, Garbern J, Yang L, Kamholz J, Mellerick DM. Nk6, a novel Drosophila homeobox gene regulated by vnd. Mech Dev. 2002;116:105–16. doi: 10.1016/s0925-4773(02)00155-7. [DOI] [PubMed] [Google Scholar]

RESOURCES