Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Dev Dyn. 2013 Dec 27;243(4):612–620. doi: 10.1002/dvdy.24101

Anterior-posterior regionalized gene expression in the Ciona notochord

Wendy Reeves 1,#, Rachel Thayer 1,*,#, Michael Veeman 1
PMCID: PMC4060897  NIHMSID: NIHMS564278  PMID: 24288133

Abstract

Background

In the simple ascidian chordate Ciona the signaling pathways and gene regulatory networks giving rise to initial notochord induction are largely understood and the mechanisms of notochord morphogenesis are being systematically elucidated. The notochord has generally been thought of as a non-compartmentalized or regionalized organ that is not finely patterned at the level of gene expression. Quantitative imaging methods have recently shown, however, that notochord cell size, shape and behavior vary consistently along the anterior-posterior (AP) axis.

Results

Here we screen candidate genes by whole mount in situ hybridization for potential AP asymmetry. We identify 4 genes that show non-uniform expression in the notochord. Ezrin/radixin/moesin (ERM) is expressed more strongly in the secondary notochord lineage than the primary. CTGF is expressed stochastically in a subset of notochord cells. A novel calmodulin-like gene (BCamL) is expressed more strongly at both the anterior and posterior tips of the notochord. A TGF-β ortholog is expressed in a gradient from posterior to anterior. The asymmetries in ERM, BCamL and TGF-β expression are evident even before the notochord cells have intercalated into a single-file column.

Conclusions

We conclude that the Ciona notochord is not a homogeneous tissue but instead shows distinct patterns of regionalized gene expression.

Keywords: Ciona, notochord, differential expression, patterning, TGF-β, calmodulin, CTGF, ERM

Introduction

The notochord is a rod of axial mesoderm found in all chordate embryos (Stemple, 2005). In vertebrates it acts as a source of inductive signals that help pattern the neural tube, somites and other flanking tissues. In embryos with swimming larval forms, the notochord is also an important structural element in the tail. In many vertebrate embryos the notochord becomes segmented later in development and contributes to the nucleus pulposus of the intervertebral disks (Choi et al., 2008). At earlier stages, however, the notochord is not obviously divided into morphologically distinct subregions.

The ascidian Ciona is an invertebrate chordate with a particularly small, simple body plan (Passamaneck and Di Gregorio, 2005; Munro et al., 2006). The Ciona notochord consists of only 40 cells that intercalate into a single-file column of cylindrical cells. We recently used in toto imaging and image analysis methods to quantify cell shape in the Ciona notochord (Veeman and Smith, 2012). We found that cell shape depends strongly on AP position in the notochord, with cells in the middle of the notochord wider than cells at the ends. This gives the Ciona notochord a characteristic tapered shape. This tapered shape is conserved in many other chordates, including amphioxus, lamprey, and zebrafish.

We found that two main mechanisms account for most of the taper in the Ciona notochord. One is that the notochord cells intercalate into a single-file column from the ends towards the middle, giving the cells at the ends a “head start” on a subsequent cell shape change that makes them narrower. The other is that cell volumes vary along the AP axis, with cells being smaller in volume towards the ends. By identifying sibling cells early in notochord morphogenesis and comparing their volumes, we found that this variation in cell volume involves asymmetric cell division.

While it is clear that cell size, shape and behavior vary along the AP axis of the notochord, the underlying molecular basis for this variation is not clear. One possibility is that it might involve differences in gene expression along the AP axis. Numerous Ciona notochord genes have been identified, and spatially asymmetric expression has generally not been noted. One potential exception is a monoclonal antibody that was found to give differential staining between the primary and secondary notochord lineages (Tanaka et al., 1996). Of the 40 Ciona notochord cells, the anterior 32 “primary” cells are derived from the A7.3 and A7.7 blastomeres whereas the posterior 8 cells are derived from the B8.6 blastomeres (Nishida, 1987). The only other example of non-uniform expression in the notochord comes from the gene multidom, which is stochastically expressed in a subset of notochord cells (Oda-Ishii and Di Gregorio, 2007).

Results and Discussion

We hypothesized that there might be previously unrecognized AP differences in the RNA expression patterns of known notochord genes. These come from molecular screens for targets of the notochord master regulatory gene brachyury (bra) (Hotta et al., 1999; Takahashi et al., 1999; Hotta et al., 2000; Hotta et al., 2007b), from high throughput in situ screening (Nishikata et al., 2001; Satou et al., 2001; Fujiwara et al., 2002; Kusakabe et al., 2002; Ogasawara et al., 2002; Imai et al., 2004; Miwata et al., 2006), and from diverse studies of Ciona development. In situ hybridization images for Ciona have been centralized in the Aniseed database (Tassy et al.,2010).

We queried Aniseed for genes expressed in the notochord between stage 14 (early neurula) and stage 24 (late tailbud II) and generated a list of 1049 images representing several hundred genes. For most of these genes, there were only limited images and stages available. We examined all of these database images for signs of potential asymmetry and developed a candidate list of six genes. We performed in situ hybridization at a wide range of stages against all six of these genes. We also used the notochord master regulatory gene brachyury (bra) as a control. We did not detect any expression for one of the six genes (alpha-macroglobulin), and we found another to be uniformly expressed (tropomyosin-like) (Di Gregorio et al., 1999). Here we report the detailed expression patterns for the four genes we confirmed as being non-uniformly expressed in the notochord.

Ezrin/radixin/moesin is differentially expressed between the 1° and 2° notochord lineages

Ezrin/radixin/moesin (ERM) is the single Ciona ortholog of ezrin, radixin and moesin (Hotta et al., 2007b). ERM proteins are involved in crosslinking actin filaments to the plasma membrane (Fehon et al.). Ciona ERM is known to be transcriptionally downstream of brachyury, and knockdown experiments suggest roles in post-intercalation notochord cell elongation and lumen formation (Dong et al.; Hotta et al., 2007b).

During neurulation and initial tailbud formation, we find ERM is highly expressed in the intercalating notochord, with visibly stronger expression in the posteriormost notochord cells (Fig. 1A and B, stage 15 and stage 17). At these early stages, there is also faint, diffuse staining throughout the embryo. By early tailbud (stage 19), ERM expression has decreased in other tissues but remains robust in the notochord (Fig. 1C). Following completion of intercalation (stage 21) and during notochord elongation (stage 23), it is clear that the darker staining in the posterior of the notochord is specifically in the posterior 8 cells that are derived from the secondary notochord lineage (Fig. 1D,E). We also repeated these in situ hybridizations using a fluorescent alkaline phosphatase substrate that we could image by confocal microscopy to better quantify the signal intensity along the AP axis of the notochord. This confirmed that expression levels were largely uniform in the front and middle of the notochord but then increased substantially at the posterior tip (Fig. 1F,G).

Figure 1. ERM is differentially expressed between primary and secondary notochord cells.

Figure 1

Open in a new tab

Whole-mount in situ hybridization for Ciona Ezrin/radixin/moesin (ERM) at A) Hotta stage 15, B) stage 17, C) stage 19, D) stage 21, and E) stage 23. Anterior is to the left and posterior to the right in all images. Dorsal is towards the viewer in A and B and towards the top in C-E. Arrowheads indicate increased expression in the secondary notochord lineage at the posterior tip of the tail. F) Digitally flattened mid-notochord confocal section of a fluorescent in situ for ERM at stage 21. G) Quantitation of normalized, background-subtracted fluorescence as measured along a thick line tracing the curve of the notochord. Each trace represents a different imaged embryo.Scale bars=50μm.

The secondary notochord cells are induced later than the primary notochord cells by a different set of inductive signals (Hudson and Yasuo, 2006). The increased ERM expression in the secondary notochord cells is stable over time, however, suggesting that it reflects a consistent difference in transcription or transcript stability between these two lineages and not a transient difference due to the timing of brachyury induction.

Connective Tissue Growth Factor (CTGF) is stochastically expressed in a subset of notochord cells

CTGF is a member of the CCN family of secreted, extracellular matrix-associated heparin binding proteins (Leask and Abraham, 2006). CTGF proteins have diverse functions in development and disease and are known to be expressed in the notochord in zebrafish (Chiou et al., 2006) and in notochord-derived canine cells (Erwin et al., 2006).

We did not detect any expression of CTGF until intercalation is complete at stage 21, at which point notochord-specific expression becomes evident in a subset of notochord cells (Fig. 2, A-D). From embryo to embryo the subset of notochord cells expressing CTGF appears to be stochastic. Expression levels are both highest and most stochastic at stage 22 when the notochord cells are elongating (Fig. 2 E). By stage 23 the expression levels are somewhat more uniform along the notochord but still distinctly variable (Fig. 2F).

Figure 2. CTGF is expressed stochastically in a subset of notochord cells.

Figure 2

Open in a new tab

Whole-mount in situ hybridization for Ciona Connective Tissue Growth Factor (CTGF) at A) stage 14, B) stage 17, C) stage 19, D) stage 21, E) stage 22, and F) stage 23. Anterior is to the left and posterior to the right in all images. Dorsal is towards the viewer in A and towards the top in B-F. Scale bars=50μm.

The stochastic pattern of CTGF expression is reminiscent of the expression pattern of Ciona multidom, a CCP/VWFA domain protein which is also expressed in a stochastic subset of notochord cells in a lineage-independent fashion (Oda-Ishii and Di Gregorio, 2007). multidom expression differs from CTGF, however, in being initially expressed much earlier, and in being more sparsely expressed. The multidom pattern also remains extremely mosaic whereas CTGF slowly becomes more uniform. Stochastic aspects of gene expression are important in many biological contexts (Raj and van Oudenaarden, 2008), and the multidom and CTGF expression patterns indicate that this phenomenon may be relevant in the ascidian notochord.

Bactrian CamL is more strongly expressed at the anterior and posterior tips of the notochord

The Aniseed images for this clone are supplementary data from a microarray-based study of Ciona heart cell migration (Christiaen et al., 2008). The best hit BLAST match for this gene is to calmodulin, but a phylogenetic analysis reveals that it is not a calmodulin ortholog but is instead a divergent member of the EF-hand family of calcium binding proteins that also includes troponin C and myosin light chains (Fig. 3). The only obvious orthologs we have found are in Ciona savignyi and Halocynthia roretzi, suggesting that this may be a tunicate-specific gene. We have named it Bactrian CamL (BCamL) because it is a calmodulin-like (CamL) gene with a distinctive “two-humped” expression pattern.

Figure 3. BCamL is a divergent calmodulin-like protein.

Figure 3

Open in a new tab

Calmodulin is part of a family of EF-hand containing proteins that includes centrin, troponin C and myosin alkali and regulatory light chains. A Bayesian amino acid tree for BCamL and other EF-hand family members reveals that BCamL is not the Ciona ortholog of calmodulin but is instead a divergent member of this family. The red dots indicate Ciona proteins.

BCamL expression is first visible at stage 17 when the embryo has completed neurulation and notochord intercalation is underway (Fig. 4A, B). At this stage through the end of intercalation at stage 21, the anterior and posterior tips of the notochord consistently show higher levels of BCamL expression than the more central regions (Fig. 4C, D). There is also a wedge of localized expression in the ventral/posterior endoderm. As the notochord elongates following intercalation, anterior expression of BCamL decreases relative to the high expression levels seen in the posterior (Fig. 4E). By late tailbud (stage 23), expression has become largely limited to the posterior 8 cells (Fig. 4F).

Figure 4. BCamL is expressed more strongly at the anterior and posterior tips of the notochord.

Figure 4

Open in a new tab

Whole mount in situ hybridization for BCamL at A) stage 14, B) stage 17, C) stage 19, D) stage 21, E) stage 22 and F) stage 23. Anterior is to the left and posterior to the right for all images. Dorsal is towards the viewer for A and B and towards the top for C-F. Red arrowheads indicate high expression in the anterior tip of the notochord. Black arrowheads indicate high expression in the posterior tip of the notochord. Scale bars=50μm.

We used fluorescent in situ hybridization to quantify this bipolar expression pattern. As expected, we again saw strongest expression in the anterior and posterior regions of the notochord during intercalation, which resolved to predominantly posterior expression after completion of intercalation (Fig. 5). We quantified these results for multiple embryos imaged at each timepoint by measuring fluorescence intensities along the length of the notochord (Fig. 5).

Figure 5. Fluorescent in situ and quantitation of BCamL expression.

Figure 5

Open in a new tab

Digitally flattened mid-notochord confocal sections of fluorescent in situ hybridization for BCamL at A) stage 17, B) stage 20, C) stage 21, D) stage 22, and E) stage 23. Anterior is to the left and posterior is to the right for all images. Red arrowheads indicate high expression in the anterior tip of the notochord. White arrowheads indicate high expression in the posterior tip of the notochord. The graphs associated with each panel show normalized, background-subtracted fluorescence as measured along a thick line tracing the curve of the notochord. Each trace represents a different imaged embryo. Scale bars=50μm.

This is the first demonstration of tip-specific gene expression in the Ciona notochord. The Ciona notochord is known to intercalate from the anterior and posterior ends towards the middle (Veeman and Smith, 2012). That suggests that one possible mode of tip specific expression might be a tips-to-middle wave of expression as the cells complete intercalation. We did not observe any evidence for this sort of traveling wave with respect to BCamL. The anterior and posterior zones of increased expression seemed to remain constant in terms of the approximate number of cells involved, before the increased expression in the anterior zone slowly became less intense. The posterior zone of increased expression is congruent with the secondary notochord lineage. The primary notochord lineage, however, is thought to intercalate quite randomly, so the anterior ~8 cells in the anterior zone of increased expression may vary from embryo to embryo in their origins within that lineage (Nishida, 1987). It seems broadly plausible, however, that there would be distinct morphogenetic processes at work in the tips of the notochord. For example, we previously determined that the rates of post-intercalation notochord cell narrowing are different at the two tips than in the more central regions (Veeman and Smith, 2012).

Transforming growth factor β (TGF-β) is expressed in a posterior to anterior gradient

TGF-βs are a well-known family of secreted signaling molecules. The gene in question here is likely the only true Ciona TGF-β ortholog, but Ciona also has another 9 members of the TGF-β superfamily including a Nodal, GDF-8, several BMPs and two orphan ligands (Hino et al., 2003; Imai et al., 2004). TGF-β ligands are expressed in the notochord in many chordates (Gotz et al., 1995; Unsicker et al., 1996; Kondaiah et al., 2000), but the developmental significance of this expression is not well established.

We find that TGF-β is expressed specifically in the Ciona notochord as early as stage 14, (early neurula, Fig. 6A). The staining is relatively faint at this time point, but it is clearly biased towards the posterior of the unintercalated notochord primordium. As the notochord intercalates, a gradient pattern of expression becomes apparent (Fig. 6B-D), where the staining is strongest in the posterior of the notchord, moderate in the center, and faintest in the most anterior cells. The gradient shrinks during tail elongation stages (Fig. 6E) such that it is eventually expressed largely in the secondary notochord cells (Fig. 6F). We confirmed this gradient pattern by quantifying confocal images of fluorescent in situ hybridizations (Fig. 6G, H) at stage 21.

Figure 6. TGF-β is expressed in a posterior to anterior gradient.

Figure 6

Open in a new tab

Whole mount in situ hybridization for TGF-β at A) stage 14, B) stage 17, C) stage 19, D) stage 21, E) stage 22, and F) stage 23. Anterior is to the left for all images. Dorsal is towards the viewer in A and B and towards the top in C-F. G) Digitally flattened mid-notochord confocal section of a fluorescent in situ for TGF-β at stage 21. H) Quantitation of normalized, background-subtracted fluorescence as measured along a thick line tracing the curve of the notochord. Each trace represents a different imaged embryo. Scale bars=50μm.

The gradient expression pattern of TGF-β is unlike the expression of any other known notochord gene. Gradients have not previously been described in the Ciona notochord, and the expression pattern of TGF-β is unlike the other differentially expressed notochord genes characterized here. BCamL, for example is differentially expressed but shows sharp boundaries of expression. It is not clear from our current imaging and image analysis whether TGF-β forms a smooth gradient or a stepped gradient. In either case, however, this raises important questions as to how the gradient is formed at the transcriptional level and what role it is playing in notochord morphogenesis.

Asymmetric gene expression in the Ciona notochord

Our study here examined the six most promising candidates for potential non-uniform expression based on Aniseed database images. From this it is now clear that there are several distinct spatial patterns of notochord-specific gene expression in Ciona (summarized in Fig. 7). These include uniform expression (e.g. brachyury and tropomyosin-like), differential expression between the primary and secondary notochord lineages (ERM), stochastic expression (CTGF and multidom), tip-specific expression (BCamL) and gradient expression (TGF-β). These expression differences are relatively subtle, so it may be that a broader range of notochord genes would show aspects of spatial asymmetry if examined carefully. Regardless of its prevalence, differential expression within the notochord seems likely to be of functional significance. These differentially expressed genes indicate that the Ciona notochord is not a homogenous population of cells but instead shows signs of being finely spatially patterned.

Figure 7. Summary of expression patterns.

Figure 7

Open in a new tab

Cartoon diagrams illustrating the 5 distinct spatial patterns of notochord gene expression identified. Uniform expression is common and has been described for a large number of notochord genes. All of the other patterns are from this paper, with the exception of the stochastic gene expression pattern that was also previously seen for Ciona multidom (Oda-Ishii and Di Gregorio, 2007).

AP patterning of the notochord across the chordates

While the notochord is not as obviously subdivided into different functional regions as other axial structures such as the gut and the neural tube, both embryological experiments and molecular expression data suggest that the notochord may be patterned along its AP axis in diverse chordates. Different AP regions of the amphibian notochord have different inductive abilities in explant assays (Hemmati-Brivanlou et al., 1990). There is also some data to suggest that the zebrafish notochord may have some form of cryptic early segmentation (Fleming et al., 2004). On a molecular level, several genes have been described as being differentially expressed between anterior and posterior notochord in various chordates (Graham and Lumsden, 1996; Shamim et al., 1999; Liaubet et al., 2000; Cleaver and Krieg, 2001). Nested expression of a series of Hox genes has been described in the notochords of both zebrafish and the larvacean Oikopleura (Prince et al., 1998; Seo et al., 2004). The simple genome and embryonic morphology of Ciona make it a good model system for studying the spatial complexities of notochord gene regulatory networks.

Experimental Procedures

Generating the candidate list

The Aniseed database was used to search for genes expressed in Ciona intestinalis notochord between early neurula (Stage 14) and late tailbud (Stage 24). Over 1000 images representing several hundred genes were examined for potential anterior-posterior differences in expression. Six genes were identified as strong candidates for further study.

Clones

Most clones were from the Ciona Gateway whole-ORF gene collection, except for BCamL and CTGF which were from the original Kyoto gene collection. Alpha-macroglobulin was amplified from cDNA with primers XbaI-AMGforward (GCATCTAGAATGGTGCATTTGGATGAACAGG) and AMG-HindIIIreverse (CGAAAGCTTAACCAGTTTGATCCTGTCTTTCAC) and cloned into pBSII SK(-). Gene collection IDs, gene model IDs and other relevant identifiers are as follows:

alpha-macroglobulin; gene ID KH2012:KH.C5.22

TGFbeta; clone cima871542; plate VES66_A21; gene ID KH2012:KH.C3.724

ERM; clone cima873948; plate VES67_K08; gene ID KH2012:KH.C12.129

Tropomyosin-like; clone cima827886 plate VES61_F09; gene ID KH2012:KH.C7.260

BCamL; clone cilv002e11 (received from L. Christiaen); plate R1CiGC25c07; gene ID KH2012:KH.C2.209

CTGF; clone ciad008d17 (received from L. Christiaen) plate R1CiGC01d20; gene ID KH2012:KH.C9.172

Brachyury; cDNA clone from W. Smith; gene ID KH2012:KH.S1404.1

Animal husbandry

Ciona were collected in San Diego and shipped to KSU by Marine Research and Educational Products Inc. (M-REP, San Diego). Adult Ciona were maintained in a recirculating aquarium with a UV sterilizer, protein skimmer and chilller for up to two weeks at a time. Gametes were removed surgically and eggs were fertilized and dechorionated by standard methods. The San Diego Ciona seem to be warm-adapted compared to our previous experiences with animals from Santa Barbara, and we maintained our aquarium at ~16°C and routinely cultured embryos at 21°C. Embryos were staged according to the staging series of Hotta (Hotta et al., 2007a).

Probe synthesis

Linear DNA template for RNA probe synthesis was created by PCR using m13forward and m13reverse primers to amplify cDNA clones from Bluescript (BCamL, cilv02e11; CTGF, ciad08d17; Bra, pBS-Bra; pBS-alpha-macroglobulin) and pDONR222 (ERM, VES67_K08; Tropomyosin-like, VES61_F09; TGFβ, VES66_A21). One microgram of gel-purified PCR product was used as template for the Roche DIG labeling kit (Roche11175025910) and labelled RNA probe was then purified with the Zymo Quick RNA Miniprep kit (R1054).

Fixation

Embryos were fixed in MEM-PFA (0.1M MOPS, 0.5M NaCl, 1mM EGTA, 2mM MgSO4, 0.05% Tween, 4% PFA) overnight at 4°C and dehydrated through a PBS/EtOH series before storing at -20°C in 75%EtOH/PBS until use.

In situ hybridization

Protocol was modified from (Christiaen et al., 2009). Embryos were rehydrated through a EtOH/PBT (PBT: 1x PBS, 0.1% Tween) series, treated with proteinase K (4ug/ml in PBT, 25 min, 37°C), washed with glycine (2mg/ml in PBT) then fixed again (4% PFA in PBT). Embryos were pretreated with hybridization buffer (1x Denhardt's, 6x SSC, 50% Formamide, 0.005% heparin, 0,05% Tween, 100ug/ml tRNA). Heat denatured probe was then added and embryos were hybridized for approximately 40 hours at 55°C.

After hybridization, embryos were extensively washed at 55°C; 2x 20 minutes with WB1 (50% Formamide, 5x SSC, 0.1% SDS), 2x 20 minutes with 1:1 WB1:WB2, 2x 20 minutes with WB2 (50% Formamide, 2x SSC, 0.1% Tween20) and 2x 20 minutes with WB3 (2x SSC, 0.1% Tween). Embryos were preblocked (100mM Tris, pH 7.5, 150mM NaCl, 0.5% Blocking reagent (Roche11096176001)) then stained overnight with anti-DIG-AP Fab fragments (1:2000 dilution; Roche11093274910). Embryos were washed with PBT and AP buffer (100mM NaCl, 50mM MgCl2, 100mM Tris-HCl pH 9.5, 0.1% Tween) then stained (AP buffer + 0.675mg/ml NBT (Roche11383213001) and 0.35mg/ml BCIP (Roche11383221001)) for 3-24 hrs, depending upon the probe used. Embryos were washed in PBT, mounted to poly-L-lysine coated coverslips, and cleared through a glycerol/PBT series. Embryos were imaged on a Olympus BX61wi microscope using a Canon Eos T3i camera.

Fluorescent in situ hybridization

Protocol was as above until after the antibody hybridization. PBT washed embryos were pretreated in 0.1M Tris-HCl pH 8.2 with 0.1% Tween, and were then stained with SIGMAFAST FastRed (Sigma F4648)) as per the manufacturer's instructions. Washed embryos were mounted and cleared as above, then confocal imaged on a Zeiss LSM700 with a 1.3NA 40x oil immersion objective.

Image Analysis

All image analysis was performed using ImageJ (Wayne Rasband, NIH). The tail is usually slightly curved in the Z dimension such that no slice cuts through the midline of the notochord at all AP levels. We first used the reslice function to reorient the entire confocal volume to the XZ or YZ orientation. We then resliced along a hand-drawn segmented line selection that followed the middle of the notochord through any curvature of the tail. This creates a single XY plane in which the tail has been digitally flattened such that all AP regions of the notochord are represented in a single 2D image. We then used a wide segmented line selection to quantify fluorescence intensity along the notochord from its anterior to posterior tip. All fluorescence intensities were background subtracted and normalized for comparison such that the brightest region along the AP length of the notochord is equal to 1.

Phylogenetic analysis

For the BCamL phylogeny, amino acid sequences for EF-hand family members were aligned with MUSCLE (Edgar, 2004) and a Bayesian phylogeny was constructed with MRBAYES (Huelsenbeck and Ronquist, 2001). Although parts of this phylogeny are poorly resolved, it is clear that BCamL is not the Ciona ortholog of human calmodulin despite calmodulin being the best hit blast match for BCamL in vertebrate genomes.

Bullet Points.

  • *Gene expression in the Ciona notochord is not always spatially uniform

  • *CTGF is expressed stochastically in a subset of notochord cells

  • *ERM is differentially expressed in the two notochord lineages

  • *A calmodulin-like gene is more strongly expressed at the tips of the notochord

  • *TGF-β is expressed in a posterior to anterior gradient

Acknowledgements

We thank William Smith and Lionel Christiaen for sharing plasmids. We thank Lionel Christiaen and Brad Davidson for advice about in situ hybridizations. We are grateful to the KSU CVM Confocal Core for use of the Zeiss LSM700. We acknowledge support from the Kansas INBRE (NIH P20 RR016475 and P20 GM103418). Rachel Thayer was supported by the NSF-funded KSU Biology REU program (NSF DBI-1156571).

Funding: Kansas INBRE (NIH P20 GM103418) to MV. KSU Biology REU Program (NSF DBI-1156571) to RT.

References

  1. Chiou MJ, Chao TT, Wu JL, Kuo CM, Chen JY. The physiological role of CTGF/CCN2 in zebrafish notochond development and biological analysis of the proximal promoter region. Biochem Biophys Res Commun. 2006;349:750–758. doi: 10.1016/j.bbrc.2006.08.095. [DOI] [PubMed] [Google Scholar]
  2. Choi KS, Cohn MJ, Harfe BD. Identification of nucleus pulposus precursor cells and notochordal remnants in the mouse: implications for disk degeneration and chordoma formation. Dev Dyn. 2008;237:3953–3958. doi: 10.1002/dvdy.21805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Christiaen L, Davidson B, Kawashima T, Powell W, Nolla H, Vranizan K, Levine M. The transcription/migration interface in heart precursors of Ciona intestinalis. Science. 2008;320:1349–1352. doi: 10.1126/science.1158170. [DOI] [PubMed] [Google Scholar]
  4. Christiaen L, Wagner E, Shi W, Levine M. Whole-mount in situ hybridization on sea squirt (Ciona intestinalis) embryos. Cold Spring Harb Protoc. 20092009 doi: 10.1101/pdb.prot5348. pdb prot5348. [DOI] [PubMed] [Google Scholar]
  5. Cleaver O, Krieg PA. Notochord patterning of the endoderm. Dev Biol. 2001;234:1–12. doi: 10.1006/dbio.2001.0214. [DOI] [PubMed] [Google Scholar]
  6. Di Gregorio A, Levine M. Regulation of Ci-tropomyosin-like, a Brachyury target gene in the ascidian, Ciona intestinalis. Development. 1999;126(4):5599–5609. doi: 10.1242/dev.126.24.5599. [DOI] [PubMed] [Google Scholar]
  7. Dong B, Deng W, Jiang D. Distinct cytoskeleton populations and extensive crosstalk control Ciona notochord tubulogenesis. Development. 138:1631–1641. doi: 10.1242/dev.057208. [DOI] [PubMed] [Google Scholar]
  8. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Erwin WM, Ashman K, O'Donnel P, Inman RD. Nucleus pulposus notochord cells secrete connective tissue growth factor and up-regulate proteoglycan expression by intervertebral disc chondrocytes. Arthritis Rheum. 2006;54:3859–3867. doi: 10.1002/art.22258. [DOI] [PubMed] [Google Scholar]
  10. Fehon RG, McClatchey AI, Bretscher A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11:276–287. doi: 10.1038/nrm2866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fleming A, Keynes R, Tannahill D. A central role for the notochord in vertebral patterning. Development. 2004;131:873–880. doi: 10.1242/dev.00952. [DOI] [PubMed] [Google Scholar]
  12. Fujiwara S, Maeda Y, Shin IT, Kohara Y, Takatori N, Satou Y, Satoh N. Gene expression profiles in Ciona intestinalis cleavage-stage embryos. Mech Dev. 2002;112:115–127. doi: 10.1016/s0925-4773(01)00651-7. [DOI] [PubMed] [Google Scholar]
  13. Gotz W, Osmers R, Herken R. Localisation of extracellular matrix components in the embryonic human notochord and axial mesenchyme. J Anat. 1995;186(Pt 1):111–121. [PMC free article] [PubMed] [Google Scholar]
  14. Graham A, Lumsden A. Interactions between rhombomeres modulate Krox-20 and follistatin expression in the chick embryo hindbrain. Development. 1996;122:473–480. doi: 10.1242/dev.122.2.473. [DOI] [PubMed] [Google Scholar]
  15. Hemmati-Brivanlou A, Stewart RM, Harland RM. Region-specific neural induction of an engrailed protein by anterior notochord in Xenopus. Science. 1990;250:800–802. doi: 10.1126/science.1978411. [DOI] [PubMed] [Google Scholar]
  16. Hino K, Satou Y, Yagi K, Satoh N. A genomewide survey of developmentally relevant genes in Ciona intestinalis. VI. Genes for Wnt, TGFbeta, Hedgehog and JAK/STAT signaling pathways. Dev Genes Evol. 2003;213:264–272. doi: 10.1007/s00427-003-0318-8. [DOI] [PubMed] [Google Scholar]
  17. Hotta K, Mitsuhara K, Takahashi H, Inaba K, Oka K, Gojobori T, Ikeo K. A web-based interactive developmental table for the ascidian Ciona intestinalis, including 3D real- image embryo reconstructions: I. From fertilized egg to hatching larva. Dev Dyn. 2007a;236:1790–1805. doi: 10.1002/dvdy.21188. [DOI] [PubMed] [Google Scholar]
  18. Hotta K, Takahashi H, Asakura T, Saitoh B, Takatori N, Satou Y, Satoh N. Characterization of Brachyury-downstream notochord genes in the Ciona intestinalis embryo. Dev Biol. 2000;224:69–80. doi: 10.1006/dbio.2000.9765. [DOI] [PubMed] [Google Scholar]
  19. Hotta K, Takahashi H, Erives A, Levine M, Satoh N. Temporal expression patterns of 39 Brachyury-downstream genes associated with notochord formation in the Ciona intestinalis embryo. Dev Growth Differ. 1999;41:657–664. doi: 10.1046/j.1440-169x.1999.00467.x. [DOI] [PubMed] [Google Scholar]
  20. Hotta K, Yamada S, Ueno N, Satoh N, Takahashi H. Brachyury-downstream notochord genes and convergent extension in Ciona intestinalis embryos. Dev Growth Differ. 2007b;49:373–382. doi: 10.1111/j.1440-169X.2007.00935.x. [DOI] [PubMed] [Google Scholar]
  21. Hudson C, Yasuo H. A signalling relay involving Nodal and Delta ligands acts during secondary notochord induction in Ciona embryos. Development. 2006;133:2855–2864. doi: 10.1242/dev.02466. [DOI] [PubMed] [Google Scholar]
  22. Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  23. Imai KS, Hino K, Yagi K, Satoh N, Satou Y. Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks. Development. 2004;131:4047–4058. doi: 10.1242/dev.01270. [DOI] [PubMed] [Google Scholar]
  24. Kondaiah P, Taira M, Vempati UD, Dawid IB. Transforming growth factor-beta5 expression during early development of Xenopus laevis. Mech Dev. 2000;95:207–209. doi: 10.1016/s0925-4773(00)00326-9. [DOI] [PubMed] [Google Scholar]
  25. Kusakabe T, Yoshida R, Kawakami I, Kusakabe R, Mochizuki Y, Yamada L, Shin-i T, Kohara Y, Satoh N, Tsuda M, Satou Y. Gene expression profiles in tadpole larvae of Ciona intestinalis. Dev Biol. 2002;242:188–203. doi: 10.1006/dbio.2002.0538. [DOI] [PubMed] [Google Scholar]
  26. Leask A, Abraham DJ. All in the CCN family: essential matricellular signaling modulators emerge from the bunker. J Cell Sci. 2006;119:4803–4810. doi: 10.1242/jcs.03270. [DOI] [PubMed] [Google Scholar]
  27. Liaubet L, Bertrand N, Medevielle F, Pituello F. Identification by differential display of a chicken tolloid-related metalloprotease specifically expressed in the caudal notochord. Mech Dev. 2000;96:101–105. doi: 10.1016/s0925-4773(00)00382-8. [DOI] [PubMed] [Google Scholar]
  28. Miwata K, Chiba T, Horii R, Yamada L, Kubo A, Miyamura D, Satoh N, Satou Y. Systematic analysis of embryonic expression profiles of zinc finger genes in Ciona intestinalis. Dev Biol. 2006;292:546–554. doi: 10.1016/j.ydbio.2006.01.024. [DOI] [PubMed] [Google Scholar]
  29. Munro E, Robin F, Lemaire P. Cellular morphogenesis in ascidians: how to shape a simple tadpole. Curr Opin Genet Dev. 2006;16:399–405. doi: 10.1016/j.gde.2006.06.004. [DOI] [PubMed] [Google Scholar]
  30. Nishida H. Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. III. Up to the tissue restricted stage. Dev Biol. 1987;121:526–541. doi: 10.1016/0012-1606(87)90188-6. [DOI] [PubMed] [Google Scholar]
  31. Nishikata T, Yamada L, Mochizuki Y, Satou Y, Shin-i T, Kohara Y, Satoh N. Profiles of maternally expressed genes in fertilized eggs of Ciona intestinalis. Dev Biol. 2001;238:315–331. doi: 10.1006/dbio.2001.0370. [DOI] [PubMed] [Google Scholar]
  32. Oda-Ishii I, Di Gregorio A. Lineage-independent mosaic expression and regulation of the Ciona multidom gene in the ancestral notochord. Dev Dyn. 2007;236:1806–1819. doi: 10.1002/dvdy.21213. [DOI] [PubMed] [Google Scholar]
  33. Ogasawara M, Sasaki A, Metoki H, Shin-i T, Kohara Y, Satoh N, Satou Y. Gene expression profiles in young adult Ciona intestinalis. Dev Genes Evol. 2002;212:173–185. doi: 10.1007/s00427-002-0230-7. [DOI] [PubMed] [Google Scholar]
  34. Passamaneck YJ, Di Gregorio A. Ciona intestinalis: chordate development made simple. Dev Dyn. 2005;233:1–19. doi: 10.1002/dvdy.20300. [DOI] [PubMed] [Google Scholar]
  35. Prince VE, Price AL, Ho RK. Hox gene expression reveals regionalization along the anteroposterior axis of the zebrafish notochord. Dev Genes Evol. 1998;208:517–522. doi: 10.1007/s004270050210. [DOI] [PubMed] [Google Scholar]
  36. Raj A, van Oudenaarden A. Nature, nurture, or chance: stochastic gene expression and its consequences. Cell. 2008;135:216–226. doi: 10.1016/j.cell.2008.09.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Satou Y, Takatori N, Yamada L, Mochizuki Y, Hamaguchi M, Ishikawa H, Chiba S, Imai K, Kano S, Murakami SD, Nakayama A, Nishino A, Sasakura Y, Satoh G, Shimotori T, Shin IT, Shoguchi E, Suzuki MM, Takada N, Utsumi N, Yoshida N, Saiga H, Kohara Y, Satoh N. Gene expression profiles in Ciona intestinalis tailbud embryos. Development. 2001;128:2893–2904. doi: 10.1242/dev.128.15.2893. [DOI] [PubMed] [Google Scholar]
  38. Seo HC, Edvardsen RB, Maeland AD, Bjordal M, Jensen MF, Hansen A, Flaat M, Weissenbach J, Lehrach H, Wincker P, Reinhardt R, Chourrout D. Hox cluster disintegration with persistent anteroposterior order of expression in Oikopleura dioica. Nature. 2004;431:67–71. doi: 10.1038/nature02709. [DOI] [PubMed] [Google Scholar]
  39. Shamim H, Mahmood R, Logan C, Doherty P, Lumsden A, Mason I. Sequential roles for Fgf4, En1 and Fgf8 in specification and regionalisation of the midbrain. Development. 1999;126:945–959. doi: 10.1242/dev.126.5.945. [DOI] [PubMed] [Google Scholar]
  40. Stemple DL. Structure and function of the notochord: an essential organ for chordate development. Development. 2005;132:2503–2512. doi: 10.1242/dev.01812. [DOI] [PubMed] [Google Scholar]
  41. Takahashi H, Hotta K, Erives A, Di Gregorio A, Zeller RW, Levine M, Satoh N. Brachyury downstream notochord differentiation in the ascidian embryo. Genes Dev. 1999;13:1519–1523. doi: 10.1101/gad.13.12.1519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tanaka K, Chiba S, Nishikata T. Two distinct cell types identified in the ascidian notochord. Zoological Science. 1996;13:725–730. [Google Scholar]
  43. Tassy O, Dauga D, Daian F, Sobral D, Robin F, Khoueiry P, Salgado D, Fox V, Caillol D, Schiappa R, Laporte B, Rios A, Luxardi G, Kusakabe T, Joly JS, Darras S, Christiaen L, Contensin M, Auger H, Lamy C, Hudson C, Rothbacher U, Gilchrist MJ, Makabe KW, Hotta K, Fujiwara S, Satoh N, Satou Y, Lemaire P. The ANISEED database: digital representation, formalization, and elucidation of a chordate developmental program. Genome Res. 2010;20:1459–1468. doi: 10.1101/gr.108175.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Unsicker K, Meier C, Krieglstein K, Sartor BM, Flanders KC. Expression, localization, and function of transforming growth factor-beta s in embryonic chick spinal cord, hindbrain, and dorsal root ganglia. J Neurobiol. 1996;29:262–276. doi: 10.1002/(SICI)1097-4695(199602)29:2<262::AID-NEU10>3.0.CO;2-D. [DOI] [PubMed] [Google Scholar]
  45. Veeman MT, Smith WC. Whole-organ cell shape analysis reveals the developmental basis of ascidian notochord taper. Dev Biol. 2012 doi: 10.1016/j.ydbio.2012.11.009. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES