Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jul 15.
Published in final edited form as: Kidney Int. 2009 Dec 23;77(6):500–508. doi: 10.1038/ki.2009.483

The pelvis–kidney junction contains HCN3, a hyperpolarization-activated cation channel that triggers ureter peristalsis

Romulo Hurtado 1, Gil Bub 2, Doris Herzlinger 1
PMCID: PMC4098940  NIHMSID: NIHMS244868  PMID: 20032965

Abstract

Peristaltic waves of the ureteric smooth muscles move urine down from the kidney, a process that is commonly defective in congenital diseases. To study the mechanisms that control the initiation and direction of contractions, we used video microscopy and optical mapping techniques and found that electrical and contractile waves began in a region where the renal pelvis joined the connective tissue core of the kidney. Separation of this pelvis–kidney junction from more distal urinary tract segments prevented downstream peristalsis, indicating that it housed the trigger for peristalsis. Moreover, cells in the pelvis–kidney junction were found to express isoform 3 of the hyperpolarization-activated cation on channel family known to be required for initiating electrical activity in the brain and heart. Immunocytochemical and real-time PCR analyses found that hyperpolarization-activated cation-3 is expressed at the pelvis–kidney junction where electrical excitation and contractile waves originate. Inhibition of this channel caused a loss of electrical activity at the pelvis–kidney junction and randomized the origin of electrical activity in the urinary tract, thus markedly perturbing contractions. Collectively, our study demonstrates that hyperpolarization-activated cation-3 channels play a fundamental role in coordinating proximal-to-distal peristalsis of the upper urinary tract. This provides insight into the genetic causes of common inherited urinary tract disorders such as reflux and obstruction.

Keywords: obstructive nephropathy, obstructive uropathy

The excretory and regulatory functions of the kidney are dependent on filtration of blood at the glomerulus; reabsorption of solutes and fluids required for homeostasis by the renal tubules; and the movement of excess fluids, solutes, and metabolic wastes into the bladder for storage prior to excretion.1,2 This latter process, the transport of urine from the kidney to the bladder, is controlled, in large part, by coordinated contractions of the smooth-muscle coat investing the renal pelvis and ureter.3 Congenital defects in this peristaltic process are common and can cause a wide spectrum of pathologies ranging from obstruction and permanent, pressure-induced renal damage to more subtle conditions such as persistent infection due to reflux of urine from the bladder back into the kidney.4–7 Despite the high incidence of acquired and congenital defects that impair upper urinary tract peristalsis, the molecular mechanisms that control the initiation site and unidirectional nature of this process remain poorly understood.

In animals with uni-papillary kidneys, such as the mouse, the smooth-muscle coat investing the upper urinary tract begins where the renal pelvis joins the connective tissue core of the kidney (Figure 1).8 It is extremely thin at this site, the pelvis–kidney junction (PKJ), but gradually thickens toward the ureteral–pelvic junction. Although cells along the entire length of the smooth-muscle coat surrounding the renal pelvis and ureter are excitable, under normal conditions contractions always initiate at the PKJ and move distally, in a coordinated, wave-like manner, down the ureter. These coordinated contractile waves are myogenic, occurring in the absence of nervous input, and current hypotheses predict that they are triggered by a specialized cell population at the PKJ.9–11 Specifically, large numbers of atypical smooth-muscle cells are found at the PKJ adjacent to the smooth muscle and when isolated, they exhibit spontaneous depolarizations that are greater in frequency than the pelvic smooth-muscle cells. Moreover, atypical smooth-muscle-cell depolarizations precede contractile activity in tissue strips taken from the wall of the renal pelvis. Thus, it is likely that presence of spontaneous electrical activity at the PKJ localizes the origin of upper urinary tract peristalsis and coordinates downstream contractile activity. However, the molecular mechanisms underlying spontaneous depolarizations at the PKJ have yet to be established and a definitive relationship between this electrical activity and peristalsis remains unclear.

Figure 1. The upper urinary tract is composed of the kidney and ureter.

Figure 1

Open in a new tab

Blood is filtered in the kidney by the glomeruli and plasma ultrafiltrate is modified as it passes through the tubular nephron segments and collecting ducts located in the cortical (c) and medullary (m) zones of the organ. The collecting ducts coalesce into several large ducts in the papilla (pa), and urine flows from these ducts into the renal pelvis (p). The renal pelvis, a funnel shaped structure between the renal tubules and the ureter (u), joins the connective tissue core of the kidney at the pelvis–kidney junction (pkj). Both the renal pelvis and the ureter have a water impermeable epithelium and smooth muscle coat, which thickens at the ureter–pelvis junction (upj) and functions to carry urine, in relatively unmodified form, from the kidney to the bladder.

We used a candidate gene approach to identify ion channels that play a role in initiating urinary tract peristalsis at the PKJ. Specifically, we hypothesized that spontaneous membrane depolarizations observed at the PKJ may be controlled, in part, by members of the hyperpolarization-activated cation (HCN) ion channel family. HCN channels have been shown to be required for spontaneous membrane depolarizations exhibited by pacemaker cells of the heart and for spontaneous depolarizations that underlie autorhythmic electrical activity in the brain.12–16 To test this hypothesis we devised a novel explant system to analyze contractile and electrical activity in the murine urinary tract from the PKJ through to the distal ureter. Reverse transcription-PCR (RTPCR) and immunohistochemical techniques were used to identify HCN-family members expressed in the urinary tract and strikingly, a high level of HCN3 expression was observed at the PKJ. Most importantly, inhibition of HCN channel activity disrupted coordinated, proximal-to-distal contractions of the upper urinary tract smooth-muscle coat, causing it to twitch along its entire length. Optical mapping experiments showed that HCN channel inhibition caused a loss of electrical activity at the PKJ and randomized the site where spontaneous membrane depolarizations initiate along the urinary tract. Thus, we have shown, for the first time, that inhibition of HCN channel activity results in loss of electrical activity at the PKJ, and perturbs both the origin and propagation of peristaltic waves along the upper urinary tract. In addition, these results provide new insight into possible genetic causes of urine reflux and abnormal ureteral peristalsis.

RESULTS

Unidirectional waves of contractile and electrical activity initiate at the PKJ

We devised an explant system to directly and continuously analyze waves of contractile and electrical activity from the PKJ through to the distal ureter. Briefly, ureters with adjoining kidneys were isolated from adult male mice and the PKJ and renal pelvis were exposed by bisecting the kidneys along their sagittal plane (Figure 2b and c). Direct video-microscopic examination of explants prepared in this manner showed that contractile waves always initiated at the PKJ and then moved distally through the renal pelvis and then down the ureter (n = 25) (Figure 2d and e, and Supplementary Movie S1). Contractile waves occurred 4–9 times/min in the explanted urinary tracts, similar to frequencies reported in vivo.17 To analyze electrical activity in explants, changes in membrane potential were detected using the voltage-sensitive dye RH237.18 Explants were loaded with the dye and changes in the intensity of fluorescence signals across the upper urinary tract were recorded over time. Results of these studies showed that spontaneous electrical excitation initiates at the PKJ and propagates distally in a coordinated wave-like manner (n = 15) (Figure 3). Collectively, these video-microscopic and optical mapping data demonstrate that both electrical and contractile activity initiate at the PKJ.

Figure 2. Upper urinary tract contractions begin at the pelvis–kidney junction.

Figure 2

Open in a new tab

Kidneys were bisected as shown in (a) to expose the inside of the organ (b and c). Cortical (c), medullary (m) and papillary (pa) zones are visible in bisected kidneys as well as the renal pelvis (p) and ureter (u). At higher power (c), the pelvis-kidney junction (pkj) can be seen. Bisected kidneys were analyzed by real-time video microscopy and contractile activity was recorded (d-g). Peristaltic waves occurred 4–9 times/min and always initiated at the pkj (e, arrow). As can be seen in f, contractions move distally (arrow) toward the ureteral-pelvic junction and then down the ureter (arrow, g).

Figure 3. Electrical excitation of the upper urinary tract initiates at the pelvic–kidney junction.

Figure 3

Open in a new tab

(a–e) Explants were loaded with the voltage sensitive dye RH237 and changes in membrane potential were detected by monitoring changes in fluorescence intensity over time, as noted. In these frames (a–e), fluorescent intensity represented by color (green to white) marked the electrical activities. Changes in membrane potential occurred in a wave, initiating at the pelvic–kidney junction (pkj) (a), and moving distally down the pelvis (b, c) to the ureter (d, e). These data were used to generate an isochronal map of electrical activity over time (f). In the isochronal map shown in f, time is represented by color and ranges from red, demarking the initial site of electrical activity, to blue, demarking the last electrically active site recorded. As can be seen in the captured still images (a-e), the most proximal zone of the renal pelvis, including the PKJ, was first to depolarize (red). Sequential electrical activity (yellow to blue) was then observed moving distally in a coordinated wave-like fashion down the renal pelvis and the ureter.

Proximal urinary tract tissues containing the PKJ are required for peristalsis

We next asked whether the PKJ was required to initiate contractile waves that propagate distally down the renal pelvis and the ureter. Urinary tract explants were prepared as described above and then further dissected to sequentially remove portions of the urinary tract as shown in Figure 4 (n = 4). Initial dissections removed major portions of the kidney, including the papilla and the outer regions of the cortex and medulla (Figure 4a, illustration; Figure 4a, representative sample; Supplementary Movie S2). Real-time video microscopy of these explants showed that the upper urinary tract continued to contract in a proximal-to-distal wave, initiating at the PKJ (n = 4) (Figure 4d–f). These data showed that kidney tissues, including cortex, medulla, and renal papillae, were not required for initiating peristalsis.

Figure 4. Proximal urinary tract tissues containing the pelvic–kidney junction are required to drive peristalsis.

Figure 4

Open in a new tab

Portions of the upper urinary tract were dissected away from the ureter to determine the minimum tissue required for peristalsis. The initial cuts (a, schematic illustration; b, representative sample) removed the outer cortex, majority of the medulla, and the papilla. The remaining renal pelvis and ureter tissue continued to contract in a coordinated proximal-to-distal direction 4–9 times/ min (c-f). Contractions initiated at the pelvic–kidney junction (d) and moved distally down the renal pelvis and ureter (e and f). To further localize the tissues driving peristalsis, the pelvic–kidney junction was separated from the more distal regions of the pelvis (g, schematic illustration; h, representative sample). The tissue containing the pkj continued to contract (i-l), initiating at the pkj (j) and moving distally (k). In contrast, distal segments separated from the PKJ lost coordinated contractile activity and remained motionless.

To test whether the PKJ was required for triggering the observed proximal-to-distal contractions, we separated the PKJ and the proximal renal pelvis from the more distal regions of the urinary tract (Figure 4g, illustration; Figure 4h, representative sample; Supplementary Movie S3). Real-time video microscopy showed that the proximal renal pelvis still connected to the PKJ continued contracting in a coordinated manner, initiating at the PKJ (Figure 4j) and propagating distally (Figure 4k). In contrast, when separated from the PKJ, distal urinary tract segments lost coordinated contraction and remained motionless (Figure 4i–l). Thus, these data show that the proximal region of the urinary tract containing the PKJ is required for driving peristalsis.

HCN 3 is highly expressed at the PKJ

Collectively, the tissue separation experiments described above combined with our video-microscopic and optical mapping analyses suggest that spontaneous electrical activity observed at the PKJ initiates upper urinary tract peristalsis. To further test this hypothesis we used a candidate gene approach to characterize the molecular mechanisms underlying spontaneous depolarizations observed at the PKJ. Specifically, we tested whether members of the HCN channel family, which are required for initiating cardiac contractions and rhythmic electrical activity in the brain, play a role in initiating urinary tract peristalsis.12–16

We first determined whether mRNAs encoding HCN-family members were expressed at the PKJ. The proximal-most region of the upper urinary tract (Figure 5a, schematic illustration) containing the PKJ was isolated from other kidney tissue and RT-PCR analysis was performed for HCN1–4 (Figure 5b). Abundant levels of HCN3 and low levels of HCN2 mRNAs were detected in the proximal urinary tract. Control experiments assaying brain tissue showed expression of all four HCN channel isoforms (Figure 5c), as previously reported.19

Figure 5. HCN3 is highly expressed in the pelvic–kidney junction.

Figure 5

Open in a new tab

To determine if HCN channels play a role in urinary tract peristalsis HCN mRNA (a–c) and protein (d–l) expression levels were analyzed. For mRNA expression analyses, the proximal region of the upper urinary tract was isolated (a, schematic illustration) and RT-PCR from total RNA was performed (b). Abundant levels of HCN isoform 3 (HCN3) mRNA and faint levels of isoform 2 (HCN2) were detected in urinary tract tissue samples (b), whereas all four HCN isoforms (HCN1-4) were detected in control brain tissue (c). Chromagenic immunohistochemistry on 80 μm thick vibratome sections (d and e) show that HCN3-expressing cells (purple reaction product) were localized to the pelvis–kidney junction (pkj), which is adjacent to the renal artery (ra). HCN3 expression is also detected in the tubular epithelia of the renal papilla (pa). Examination of paraffin sections prepared from vibratome samples processed for immunohistochemical detection of HCN3 antibody binding (f) demonstrate that HCN3-expressing cells are underneath the surface of the renal pelvis (p) and exhibit a spindle-shaped morphology. The purple precipitate indicative of HCN antibody binding was not detected in control tissue sections incubated with secondary antibody reagents in the absence of primary antibody (data not shown). To further characterize the HCN3-positive cell population present at the PKJ, indirect immunofluorescence microscopy was used to detect HCN3-expressing cells and smooth muscle in the same tissue section (g-i). HCN3 antibody binding was visualized with alexa-488 conjugated secondary antibodies (g and i) and smooth muscle was labeled with cy3-anti-smooth muscle actin (SMA, h and i). As can be seen in g, HCN3 staining (green) was detected in a cell population at the pkj in close proximity to the renal artery (ra). Smooth muscle actin staining (h, red) and overlay (i) of both HCN3 (green) and SMA (red) antibody binding demonstrate that these HCN3-expressing cells at the PKJ are located underneath the SMA-positive smooth muscle layer that invests the renal pelvis. Examination of control sections incubated with Alexa-488 secondary antibody alone (j), cy3-anti-SMA alone (k), or overlay of both (l) demonstrate that the renal artery and renal tubules exhibit non-specific staining (j and l). Scale bar = 100 μm.

HCN2 expression has been localized to the inner medullary collecting ducts,20 and to spatially localize HCN3 protein expression we performed chromogenic immunohistochemistry using 80-mm-thick urinary tract sections. HCN3 was highly expressed in the upper urinary tract at the PKJ and in the renal papilla (Figure 5d and e). Paraffin sections of tissues processed for immunohistochemical detection of HCN3 (Figure 5f) showed that HCN3 expression was localized to cells residing within the connective tissue coat investing the renal pelvis. To further define the cell population expressing HCN3 we performed double immunofluorescence for the detection of smooth-muscle actin and HCN3 (Figure 5g–i) using 12-mm-frozen sections. As observed by chromogenic techniques, HCN3 expression was detected at the PKJ (Figure 5g) within the connective tissue layer of the urinary tract, and now could be localized to a cell population sub-adjacent to the smooth-muscle actin-positive (Figure 5h) smooth-muscle coat of the urinary tract (Figure 5i, overlay). Importantly, detection of smooth-muscle actin alone (Figure 5j and l) showed that green autofluorescence (Figure 5j) was observed in the renal tubules, but not the connective surrounding the renal pelvis. Thus, a cell population at the PKJ that underlies the most proximal tip of the smooth-muscle coat expresses high level of HCN ion channels. Collectively, these morphological data combined with the known function of HCN channels in other systems, raise the possibility that HCN ion channel activity may trigger peristalsis at the PKJ.

HCN channel activity is required for coordinated upper urinary tract peristalsis

To determine whether HCN channel activity is required for upper urinary tract peristalsis, we used the well-characterized HCN ion channel inhibitor, ZD7288. Both video-microscopic and optical mapping analyses were performed using urinary tract explants incubated with increasing concentrations of inhibitor. Control explants (n = 8) incubated with buffer alone exhibited proximal-to-distal, contractile (Figure 6a–d) and electrical excitation (Figure 6i and j) waves, as previously seen, initiating at the PKJ and moving distally down the urinary tract.

Figure 6. HCN3 channel activity is required for coordinated peristalsis and electrical propagation of the upper urinary tract.

Figure 6

Open in a new tab

To determine if HCN channels are functionally important for urinary tract peristalsis we used the well characterized HCN channel inhibitor ZD7288. Explants were placed in a bathing tyrodes solution with and without 30 μm ZD7288. Explants exposed to tyrodes solution alone maintained coordinated peristalsis (a-d), initiating at the pkj (b) and propagating distally down the upper urinary tract (c, d). Explants treated with 30 μm ZD7288 (e-h) lost coordinated contractile activity. Explants treated with 30 μm ZD7288 exhibited twitch-like contractile activity difficult to capture in still images, but easily detectable in video recordings (supplemental data). Optical mapping of explants kept in tyrodes solution alone contained proximal-to-distal electrical excitation patterns (i, still image; j, isochronal map) initiating (red) at the pkj and moving distally down the urinary tract. Optical mapping of explants treated with 30 μm ZD7288 contained desynchronized electrical excitation patterns (k, still image; l, isochronal map) with loss of electrical excitation at the pkj, and initiation site (red) randomized within the urinary tract.

Beginning with 15 μm ZD7288, subtle changes in urinary tract peristalsis and electrical excitation patterns were observed (data not shown). Strikingly, at 30 μm ZD7288 (n = 8) coordinated, proximal-to-distal contractions of the urinary tract musculature were lost. Instead, rapid, twitch-like contractile activity was observed, which was difficult to capture in time-lapse still images (Figure 6e–h), but could easily be observed in continuous video recordings included in Supplementary Movies S4 and S5. Whereas control explants (Supplementary Movie S4) exhibited contractions that initiated at the PKJ and propagated distally, contractile activity at the PKJ was absent in explants treated with 30 μm ZD7288 (Supplementary Movie S5) and replaced by random twitches in more distal, focal domains of the urinary tract. Optical mapping analyses are consistent with this ZD7288-induced twitch-like behavior. In the presence of 30 μm ZD7288, electrical activity at the PKJ was lost (Figure 6k and l) but was not completely abolished. The coordinated waves of electrical activity that initiated at the PKJ in control explants were replaced by a random and asynchronized excitation pattern in 30 μm ZD7288-treated explants. Thus, at 30 μm concentration of inhibitor, both electrical and contractile activity at the PKJ is replaced by randomized activity along the urinary tract, resulting in abnormal peristalsis. In contrast to 30 μm ZD7288, we were unable to detect either electrical or contractile activity at much higher concentration (90 μm, data not shown).

Collectively these functional analyses indicate that both contractile and electrical activities of the upper urinary tract musculature are sensitive to HCN channel inhibition, in a dose-dependent manner. These data combined with those from HCN3 expression analyses of the urinary tract indicate that spontaneous depolarizations mediated by HCN ion channels at the PKJ play a fundamental role in driving coordinated, proximal-to-distal contractions of the upper urinary tract.

DISCUSSION

In this study we devised methods to assay contractile and electrical activities characterizing upper urinary tract peristalsis in mouse. Our data show that proximal-to-distal electrical and contractile activity initiate at the junction between the renal pelvis and the connective tissue core of the kidney, the PKJ. These results are in agreement with those of previous studies analyzing electrical activity and smooth-muscle contractions of the upper urinary tract.21–25

Most importantly, our work begins to elucidate the molecular mechanisms underlying spontaneous electrical activity at the PKJ, and establish a definitive relationship between this activity and coordinated peristalsis. We hypothesized that spontaneous membrane depolarizations localized to the PKJ were mediated, in part, by members of the HCN ion channel family. Members of this cation-selective ion channel family are required for spontaneous electrical activity in the brain and heart. All four HCN isoforms (HCN1–4) are expressed in the brain, and HCN channel activity has been shown to be required for spontaneous depolarization in neurons.26–28 In the heart, HCN2 and HCN4 have been shown to be required for spontaneous electrical activity of the cardiac pacemaker cells of the sinaotrial node.14,15 RT-PCR analyses described in this report demonstrate that high levels of HCN3 and barely detectable levels of HCN2 are expressed in the proximal region of the upper urinary tract. Immunohistochemical studies showed that HCN2 expression is restricted to the renal tubules,20 whereas we show that HCN3 expression is localized to the connective tissue layer underlying the smooth-muscle coat at the PKJ. Consistent with this HCN expression pattern, inhibition of HCN channel activity caused loss of spontaneous electrical activity at the PKJ, desynchronized the electrical propagation in the upper urinary tract, and caused abnormal peristalsis.

Perturbation of electrical activity and peristalsis of the upper urinary tract with ZD7288 occurred in a dose-dependent manner. ZD7288 is the most widely used and best characterized HCN channel blocker. Inhibition of HCN channel activity by ZD7288 has been used in the nervous system to alleviate neuropathic pain via reversal of ectopic spontaneous depolarizations of neurons,29–32 and in the heart as a bradycardiac agent to slow down abnormally fast heart rates via inhibition of spontaneous activity of the sinoatrial node.33–36 Importantly, we observed inhibition of electrical activity at the PKJ at a concentration of ZD7288 just below the IC50 documented for HEK239 kidney cell line transfected with HCN channel constructs. At much higher concentrations of ZD7288 all electrical activity was abolished, indicating requirement of ion channel inhibition for more fundamental aspects of smooth-muscle physiology.37–40 Collectively, these drug titration studies combined with HCN expression analyses strongly support the hypothesis that HCN channel activity plays a specialized role in coordinating upper urinary tract peristalsis.

Our finding that HCN channel activity is necessary for proximal-to-distal upper urinary tract peristalsis agrees with published studies implicating HCN channels in coordinating essential physiological processes. In the brain, sensory thalamic neurons spontaneously depolarize after initial afferent excitatory inputs, and deletion of their HCN channel activity (HCN2-KO) disrupts spontaneous depolarizations, altering the firing behavior of the neurons in a physiologically similar manner to epilepsy.41 In the heart, spontaneous electrical activity of sinoatrial node cells are responsible for maintaining coordinated heartbeat, and HCN channel deletion in these cells (HCN2-KO and HCN4-KO) causes cardiac arrhythmia.41–43 In fact, comparisons between spontaneous electrical activity of the heart and upper urinary tract have been drawn by others, based on similarities in electrical activity, including electromyograms recorded from pacemaker cells at the sinoatrial node and PKJ.22,23,44 Our work shows for the first time that these similarities are likely to be due to the role of HCN ion channels in initiating spontaneous depolarizations in both systems.

The spatial distribution and cellular characteristics of the HCN-expressing cells described in this work are similar to those described for atypical smooth-muscle cells thought to be pacemakers of the upper urinary tract.45–48 Spatially, both cell populations are localized to the most proximal regions of the urinary tract, the PKJ, and are found within the connective tissue underlying the smooth-muscle-cell layer of the urinary tract. Furthermore, both cell types have low smooth-muscle actin immunostaining as compared with that of the adjacent smooth-muscle-cell population, indicative of few contractile filaments. Currently, the nature of spontaneous activity detected in atypical smooth-muscle cells is unknown, and our data suggest that HCN channel activity maybe the underlying mechanism. Further characterization of both atypical and HCN-positive cell types in the upper urinary tract will determine whether they are in fact the same cell population.47 Alternatively, it is possible that HCN channel activity indirectly triggers smooth-muscle contractions at the PKJ. For example, HCN channel activity may be important for release of prostaglandins that support urinary tract peristalsis.

In conclusion, the data presented in this study raise the possibility that HCN channel mutations that disrupt spontaneous depolarizations at the PKJ may perturb upper urinary tract peristalsis and cause hydronephrosis. Hydronephrosis, or pressure-induced enlargement of the renal pelvis, is detected in up to 1% of fetuses by routine ultrasound and is a leading cause of renal failure in the pediatric population.49 Genetic studies using the mouse indicate that hydronephrosis can be caused by several different mechanisms. For example, uroplakin mutations can cause hydronephrosis due to obliteration of the ureteral lumen by overgrowth of the urothelium.50,51 Mutations in AQP2, the ADH-sensitive water channel, causes hydronephrosis due to the sheer volume of fluids that must be excreted in the absence of water reabsorption by the collecting duct system.52 Finally, mice with defects in the formation and/or organization of the ureteral smooth-muscle coat develop hydronephrosis due to absence of contractile forces that propel urine from the kidney to the bladder.53–56 Although these mouse mutants prove that physical barriers to urine flow and defective ureteral smooth-muscle differentiation can cause hydronephrosis, this condition often occurs in the absence of any physical barrier or obvious defects in the ureteral smooth-muscle coat. Studies analyzing the physiology of mice harboring HCN3 mutations and/or defects in the HCN-expressing cell types at the PKJ may reveal a possible cause for such functional urinary tract obstructions and provide novel diagnostic tools for identifying fetuses at risk for renal damage due to impaired urine flow out of the kidney.

MATERIALS AND METHODS

Animals

All mice were housed at the Weill Medical College of Cornell University Animal Facility and treated according to the Research Animal Resource Center Guidelines. Adult and postnatal mouse pups were purchased from Taconic Farms (Germantown, NY, USA).

Kidney explants

Kidneys were isolated from adult, 5-week-old mice and were placed in Tyrodes Solution containing sodium bicarbonate (Sigma, St Louis, MO, USA) and cut using a no. 22 surgical blade (Bard-Parker, Franklin Lakes, NJ, USA) to expose the junction between the pelvis and the renal parenchyma. Kidneys were bisected by cutting longitudinally alongside the renal papillae and urinary tract. Explants containing approximately half the renal cortex and medulla, but the entire papilla, pelvis, and ureter were transferred onto 24-mm Costar Transwell Permeable Supports (0.4 mm poly-carbonate membrane) (Corning, Corning, NY, USA) and placed into six-well tissue culture plates (Costar) containing 1.5 ml Tyrodes Solution per well, and 800 ml of Tyrodes Solution were added directly on top of the kidney. Plates were then placed on top of a rocking nutrator housed inside a 5% CO2 incubator, allowing a bathing solution of Tyrodes to pass over the kidney explant without completely submerging it. A ZD7288 (Tocris Bioscience, Ellisville, MI, USA) stock solution of 100 μm in phosphate-buffered saline (PBS) was stored at −20 °C diluted one-half with Hybri-Max dimethylsulfoxide (Sigma) and brought to final concentrations, as noted, in Tyrodes (dimethylsulfoxide was maintained below 0.2% at all times.) The inhibitor and control solutions with the vehicle alone were added directly on top of explants and changed every half hour for a total of 2 h.

Optical mapping

Propagation of cellular excitation and activation sequences of kidney explants were determined by optical mapping techniques in a manner similar as previously described.57,58 In short, kidney explants were stained with the voltage-sensitive dye RH237 (50 μm in Tyrodes) for 10 min in a 5% CO2 incubator. Spread of excitation throughout the urinary tract was monitored by changes in fluorescence signals of RH237 using a Cardioplex 80 80 pixel CCD mounted on a MacroScope-2a system (Redshirt Imaging, Boston, MA, USA) at an acquisition speed of 125 Hz for 9600 ms. The excitation light (528 nm) was provided by a filtered tungsten halogen light source and long-pass-filtered (4650 nm; Chroma Technology, Rockingham, VT, USA) before being imaged by the camera. Cytochalasin-D was used at 75 μm to inhibit muscular contractions since optical mapping cannot be performed using moving tissues. Data were acquired using the Redshirt Cardioplex software and analyzed by custom-written software.

RT-PCR

Total RNA isolated from adult brain and upper urinary tracts with the adjoining kidney tissue was extracted according to the TRIzol (Invitrogen, Carlsbad, CA, USA) reagent protocol, treated with DNase-I (Roche, Indianapolis, IN, USA), and converted to cDNA using the SuperScript cDNA Synthesis system (Invitrogen). cDNA was amplified by PCR using the following primers: HCN1, 5’CCCTCAGTCCTAAATACAGACC3’ (forward) and 5’GGAGCGT GTTCCTTCACCT3’ (reverse); HCN2, 5’CCGTCATCCACACCA-A AGC3’ (forward) and 5’GGCTGGTTATTGCGTGAGC (reverse); HCN3, 5’CCTAACATAC-TGCCCTTTATCACC3’ (forward) and 5’GTGGATTCTCACTTGGTGTGGAC3’ (reverse); HCN4, 5’CCAA GAACTTTCCCGAGTGCC (forward) and 5’CCTAATCA-CAGAAA AACCTGAAGG (reverse); and GAPDH, 5’ATGACATCAAGAAGGT GGTG3’ (forward) and 5’CATACCAGGAAATGAGCTTG3’ (reverse). To analyze DNA sequence fidelity, PCR products were gel-extracted using a gel extraction kit (Qiagen, Germantown, MD, USA) and subcloned into PCRII plasmid using the TOPO-TA cloning system (Invitrogen), and sent to the Cornell University Life Sciences Core Laboratories Center for sequencing of inserts. All respective PCR products showed 100% fidelity with the DNA sequences listed in the National Institute of Health NCBI database.

Immunohistochemistry

P8 kidneys were fixed in Bouins fixative (Sigma) at 4 °C for 6 h. For frozen sections, kidneys were cryoprotected by 30% sucrose in PBS and embedded in OCT compound. Frozen sections of 12 mm thickness were cut, rehydrated with PBS, permeabilized with 0.2% Triton X-100 in PBS for 20 min, and blocked with 1% normal donkey serum in PBS for 20 min. Rat anti-HCN3 monoclonal antibody (clone TLL6C5; Millipore, Billerica, MA, USA) was used at a concentration of 1/700 and mouse anti-smooth-muscle actin conjugated to Cy3 (Sigma) was used at 1/2200, both diluted in 1% normal donkey serum in PBS, at 37 °C for 3 h and 1 h, respectively. After five washes with PBS, the sections were incubated with Dyelight 488-conjugated goat anti-rat (Jackson ImmunoResearch, West Grove, PA, USA) at a concentration of 1/1000, diluted in 1% normal donkey serum in PBS, for 1.5 h at 37 °C. For vibratome sections kidneys were embedded in 7% low-melting-point agarose. Vibratome sections of 80 mm were cut, permeabilized, and blocked with TSP (0.5% Triton X-100, 0.1% saponin), 1% normal donkey serum in TBS overnight at room temperature, and then at 37 °C for 3 h. HCN3 was added at a concentration of 1/700 in blocking solution for 6 h at room temperature. After washing overnight in TSP, sections were incubated with alkaline phosphatase-conjugated anti-rat (Jackson ImmunoR-esearch) at a concentration of 1/1200 in blocking solution for 3 h at room temperature. After washing with TSP, chromagenic detection was performed by NBT-BCIP staining as previously described.59

Supplementary Material

supp 1
Download video file (11.6MB, mov)
supp 2
Download video file (11.1MB, mov)
supp 3
Download video file (11.5MB, mov)
supp 4
Download video file (99.1MB, mov)
supp 5
Download video file (98.4MB, mov)

ACKNOWLEDGMENTS

This work was supported by NIHDK45218 awarded to DH and a BBSRC grant from the UK to GB. We thank Dr Takashi Mikawa and Dr David Christini for providing optical mapping apparatuses and laboratory space.

Footnotes

DISCLOSURE

All the authors declared no competing interests.

SUPPLEMENTARY MATERIAL

Supplementary material is linked to the online version of the paper at http://www.nature.com/ki

REFERENCES

  • 1.Barbuti A, DiFrancesco D. Control of cardiac rate by ‘funny’ channels in health and disease. Ann N Y Acad Sci. 2008;1123:213–223. doi: 10.1196/annals.1420.024. [DOI] [PubMed] [Google Scholar]
  • 2.Biel M, Wahl-Schott C, Michalakis S, et al. Hyperpolarization-activated cation channels: from genes to function. Physiol Rev. 2009;89:847–885. doi: 10.1152/physrev.00029.2008. [DOI] [PubMed] [Google Scholar]
  • 3.Eaton DC, Pooler JP. Physiology. 7th edn. WCB McGraw; Boston: 1998. Vander's Renal Physiology. [Google Scholar]
  • 4.Chevalier RL, Peters CA. Congenital urinary tract obstruction: Proceedings of the State-Of-The-Art Strategic Planning Workshop–National Institutes of Health, Bethesda, Maryland, USA, 11–12 March 2002. Pediatr Nephrol. 2003;18:576–606. doi: 10.1007/s00467-003-1074-8. [DOI] [PubMed] [Google Scholar]
  • 5.Chevalier RL. Pathogenesis of renal injury in obstructive uropathy. Curr Opin Pediatr. 2006;18:153–160. doi: 10.1097/01.mop.0000193287.56528.a4. [DOI] [PubMed] [Google Scholar]
  • 6.Rosen S, Peters CA, Chevalier RL, et al. The kidney in congenital ureteropelvic junction obstruction: a spectrum from normal to nephrectomy. J Urol. 2008;179:1257–1263. doi: 10.1016/j.juro.2007.11.048. [DOI] [PubMed] [Google Scholar]
  • 7.Becker A, Baum M. Obstructive uropathy. Early Hum Dev. 2006;82:15–22. doi: 10.1016/j.earlhumdev.2005.11.002. [DOI] [PubMed] [Google Scholar]
  • 8.Gosling JA, Dixon JS. Species variation in the location of upper urinary tract pacemaker cells. Invest Urol. 1974;11:418–423. [PubMed] [Google Scholar]
  • 9.Santicioli P, Maggi CA. Myogenic and neurogenic factors in the control of pyeloureteral motility and ureteral peristalsis. Pharmacol Rev. 1998;50:683–722. [PubMed] [Google Scholar]
  • 10.Klemm MF, Exintaris B, Lang RJ. Identification of the cells underlying pacemaker activity in the guinea-pig upper urinary tract. J Physiol. 1999;519(Part 3):867–884. doi: 10.1111/j.1469-7793.1999.0867n.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lang RJ, Exintaris B, Teele ME, et al. Electrical basis of peristalsis in the mammalian upper urinary tract. Clin Exp Pharmacol Physiol. 1998;25:310–321. doi: 10.1111/j.1440-1681.1998.tb02357.x. [DOI] [PubMed] [Google Scholar]
  • 12.Santoro B, Grant SG, Bartsch D, et al. Interactive cloning with the SH3 domain of N-src identifies a new brain specific ion channel protein, with homology to eag and cyclic nucleotide-gated channels. Proc Natl Acad Sci USA. 1997;94:14815–14820. doi: 10.1073/pnas.94.26.14815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ludwig A, Zong X, Jeglitsch M, et al. A family of hyperpolarization-activated mammalian cation channels. Nature. 1998;393:587–591. doi: 10.1038/31255. [DOI] [PubMed] [Google Scholar]
  • 14.Ludwig A, Zong X, Stieber J, et al. Two pacemaker channels from human heart with profoundly different activation kinetics. EMBO J. 1999;18:2323–2329. doi: 10.1093/emboj/18.9.2323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ishii TM, Takano M, Xie LH, et al. Molecular characterization of the hyperpolarization-activated cation channel in rabbit heart sinoatrial node. J Biol Chem. 1999;274:12835–12839. doi: 10.1074/jbc.274.18.12835. [DOI] [PubMed] [Google Scholar]
  • 16.Seifert R, Scholten A, Gauss R, et al. Molecular characterization of a slowly gating human hyperpolarization-activated channel predominantly expressed in thalamus, heart, and testis. Proc Natl Acad Sci USA. 1999;96:9391–9396. doi: 10.1073/pnas.96.16.9391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dwyer TM, Schmidt-Nielsen B. The renal pelvis: machinery that concentrates urine in the papilla. News Physiol Sci. 2003;18:1–6. doi: 10.1152/nips.1416.2002. [DOI] [PubMed] [Google Scholar]
  • 18.Kim JH, Dunn MB, Hua Y, et al. Imaging of cerebellar surface activation in vivo using voltage sensitive dyes. Neuroscience. 1989;31:613–623. doi: 10.1016/0306-4522(89)90427-2. [DOI] [PubMed] [Google Scholar]
  • 19.Notomi T, Shigemoto R. Immunohistochemical localization of Ih channel subunits, HCN1–4, in the rat brain. J Comp Neurol. 2004;471:241–276. doi: 10.1002/cne.11039. [DOI] [PubMed] [Google Scholar]
  • 20.Bolivar JJ, Tapia D, Arenas G, et al. A hyperpolarization-activated, cyclic nucleotide-gated, (Ih-like) cationic current and HCN gene expression in renal inner medullary collecting duct cells. Am J Physiol Cell Physiol. 2008;294:C893–C906. doi: 10.1152/ajpcell.00616.2006. [DOI] [PubMed] [Google Scholar]
  • 21.Weiss RM, Tamarkin FJ, Wheeler MA. Pacemaker activity in the upper urinary tract. J Smooth Muscle Res. 2006;42:103–115. doi: 10.1540/jsmr.42.103. [DOI] [PubMed] [Google Scholar]
  • 22.Weiss RM, Wagner ML, Hoffman BF. Wenckebach periods of the ureter. A further note on the ubiquity of the Wenckebach phenomenon. Invest Urol. 1968;5:462–467. [PubMed] [Google Scholar]
  • 23.Bozler E. The activity of the pacemaker previous to the discharge of a muscular impulse. Am J Physiol. 1942;136:9. [Google Scholar]
  • 24.Longrigg N. Minor calyces as primary pacemaker sites for ureteral activity in man. Lancet. 1975;1:253–254. doi: 10.1016/s0140-6736(75)91145-9. [DOI] [PubMed] [Google Scholar]
  • 25.Seki N, Suzuki H. Electrical properties of smooth muscle cell membrane in renal pelvis of rabbits. Am J Physiol. 1990;259:F888–F894. doi: 10.1152/ajprenal.1990.259.6.F888. [DOI] [PubMed] [Google Scholar]
  • 26.Steriade M, Timofeev I. Neuronal plasticity in thalamocortical networks during sleep and waking oscillations. Neuron. 2003;37:563–576. doi: 10.1016/s0896-6273(03)00065-5. [DOI] [PubMed] [Google Scholar]
  • 27.McCormick DA, Bal T. Sleep and arousal: thalamocortical mechanisms. Annu Rev Neurosci. 1997;20:185–215. doi: 10.1146/annurev.neuro.20.1.185. [DOI] [PubMed] [Google Scholar]
  • 28.Pape HC. Queer current and pacemaker: the hyperpolarization-activated cation current in neurons. Annu Rev Physiol. 1996;58:299–327. doi: 10.1146/annurev.ph.58.030196.001503. [DOI] [PubMed] [Google Scholar]
  • 29.Harris NC, Constanti A. Mechanism of block by ZD 7288 of the hyperpolarization-activated inward rectifying current in guinea pig substantia nigra neurons in vitro. J Neurophysiol. 1995;74:2366–2378. doi: 10.1152/jn.1995.74.6.2366. [DOI] [PubMed] [Google Scholar]
  • 30.Chaplan SR, Guo HQ, Lee DH, et al. Neuronal hyperpolarization-activated pacemaker channels drive neuropathic pain. J Neurosci. 2003;23:1169–1178. doi: 10.1523/JNEUROSCI.23-04-01169.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lee DH, Chang L, Sorkin LS, et al. Hyperpolarization-activated, cationnonselective, cyclic nucleotide-modulated channel blockade alleviates mechanical allodynia and suppresses ectopic discharge in spinal nerve ligated rats. J Pain. 2005;6:417–424. doi: 10.1016/j.jpain.2005.02.002. [DOI] [PubMed] [Google Scholar]
  • 32.Sun Q, Xing GG, Tu HY, et al. Inhibition of hyperpolarization-activated current by ZD7288 suppresses ectopic discharges of injured dorsal root ganglion neurons in a rat model of neuropathic pain. Brain Res. 2005;1032:63–69. doi: 10.1016/j.brainres.2004.10.033. [DOI] [PubMed] [Google Scholar]
  • 33.BoSmith RE, Briggs I, Sturgess NC. Inhibitory actions of ZENECA ZD7288 on whole-cell hyperpolarization activated inward current (If) in guinea-pig dissociated sinoatrial node cells. Br J Pharmacol. 1993;110:343–349. doi: 10.1111/j.1476-5381.1993.tb13815.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Berger F, Borchard U, Gelhaar R, et al. Effects of the bradycardic agent ZD 7288 on membrane voltage and pacemaker current in sheep cardiac Purkinje fibres. Naunyn Schmiedebergs Arch Pharmacol. 1994;350:677–684. doi: 10.1007/BF00169374. [DOI] [PubMed] [Google Scholar]
  • 35.Berger F, Borchard U, Gelhaar R, et al. Inhibition of pacemaker current by the bradycardic agent ZD 7288 is lost use-dependently in sheep cardiac Purkinje fibres. Naunyn Schmiedebergs Arch Pharmacol. 1995;353:64–72. doi: 10.1007/BF00168917. [DOI] [PubMed] [Google Scholar]
  • 36.Marshall PW, Rouse W, Briggs I, et al. ICI D7288, a novel sinoatrial node modulator. J Cardiovasc Pharmacol. 1993;21:902–906. doi: 10.1097/00005344-199306000-00008. [DOI] [PubMed] [Google Scholar]
  • 37.Felix R, Sandoval A, Sanchez D, et al. ZD7288 inhibits low-threshold Ca(2+) channel activity and regulates sperm function. Biochem Biophys Res Commun. 2003;311:187–192. doi: 10.1016/j.bbrc.2003.09.197. [DOI] [PubMed] [Google Scholar]
  • 38.Shin KS, Rothberg BS, Yellen G. Blocker state dependence and trapping in hyperpolarization-activated cation channels: evidence for an intracellular activation gate. J Gen Physiol. 2001;117:91–101. doi: 10.1085/jgp.117.2.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Akaike T, Jin MH, Yokoyama U, et al. T-type Ca2+ channels promote oxygenation-induced closure of the rat ductus arteriosus not only by vasoconstriction but also by neointima formation. J Biol Chem. 2009;284:24025–24034. doi: 10.1074/jbc.M109.017061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zeng X, Keyser B, Li M, et al. T-type (alpha1G) low voltage-activated calcium channel interactions with nitric oxide–cyclic guanosine monophosphate pathway and regulation of calcium homeostasis in human cavernosal cells. J Sex Med. 2005;2:620–630. doi: 10.1111/j.1743-6109.2005.00115.x. discussion 630–623. [DOI] [PubMed] [Google Scholar]
  • 41.Ludwig A, Budde T, Stieber J, et al. Absence epilepsy and sinus dysrhythmia in mice lacking the pacemaker channel HCN2. EMBO J. 2003;22:216–224. doi: 10.1093/emboj/cdg032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Stieber J, Herrmann S, Feil S, et al. The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc Natl Acad Sci USA. 2003;100:15235–15240. doi: 10.1073/pnas.2434235100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Herrmann S, Stieber J, Stockl G, et al. HCN4 provides a ‘depolarization reserve’ and is not required for heart rate acceleration in mice. EMBO J. 2007;26:4423–4432. doi: 10.1038/sj.emboj.7601868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Orbelli L, Von Brucke E., IV Beitrage zur Physiologie der autonom innervierten muskulatur. Pflugers Arch Gesamte Physiol Menschen Tiere. 1910;133:23. [Google Scholar]
  • 45.Dixon JS, Gosling JA. The fine structure of pacemaker cells in the pig renal calices. Anat Rec. 1973;175:139–153. doi: 10.1002/ar.1091750203. [DOI] [PubMed] [Google Scholar]
  • 46.Dixon JS, Gosling JA. The musculature of the human renal calices, pelvis and upper ureter. J Anat. 1982;135:129–137. [PMC free article] [PubMed] [Google Scholar]
  • 47.Lang RJ, Hashitani H, Tonta MA, et al. Spontaneous electrical and Ca signals in the mouse renal pelvis that drive pyeloureteric peristalsis. Clin Exp Pharmacol Physiol. 2009 doi: 10.1111/j.1440-1681.2009.05226.x. doi:10.1111/j.1440-1681.2009.05226.x. [DOI] [PubMed] [Google Scholar]
  • 48.Lang RJ, Hashitani H, Tonta MA, et al. Spontaneous electrical and Ca2+ signals in typical and atypical smooth muscle cells and interstitial cell of Cajal-like cells of mouse renal pelvis. J Physiol. 2007;583:1049–1068. doi: 10.1113/jphysiol.2007.137034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Chevalier RL. Obstructive uropathy: state of the art. Pediatr Med Chir. 2002;24:95–97. [PubMed] [Google Scholar]
  • 50.Hu P, Deng FM, Liang FX, et al. Ablation of uroplakin III gene results in small urothelial plaques, urothelial leakage, and vesicoureteral reflux. J Cell Biol. 2000;151:961–972. doi: 10.1083/jcb.151.5.961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wu XR, Kong XP, Pellicer A, et al. Uroplakins in urothelial biology, function, and disease. Kidney Int. 2009;75:1153–1165. doi: 10.1038/ki.2009.73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.McDill BW, Li SZ, Kovach PA, et al. Congenital progressive hydronephrosis (cph) is caused by an S256 L mutation in aquaporin-2 that affects its phosphorylation and apical membrane accumulation. Proc Natl Acad Sci USA. 2006;103:6952–6957. doi: 10.1073/pnas.0602087103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mahoney ZX, Sammut B, Xavier RJ, et al. Discs-large homolog 1 regulates smooth muscle orientation in the mouse ureter. Proc Natl Acad Sci USA. 2006;103:19872–19877. doi: 10.1073/pnas.0609326103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Chang CP, McDill BW, Neilson JR, et al. Calcineurin is required in urinary tract mesenchyme for the development of the pyeloureteral peristaltic machinery. J Clin Invest. 2004;113:1051–1058. doi: 10.1172/JCI20049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yu J, Carroll TJ, McMahon AP. Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney. Development. 2002;129:5301–5312. doi: 10.1242/dev.129.22.5301. [DOI] [PubMed] [Google Scholar]
  • 56.Caubit X, Lye CM, Martin E, et al. Teashirt 3 is necessary for ureteral smooth muscle differentiation downstream of SHH and BMP4. Development. 2008;135:3301–3310. doi: 10.1242/dev.022442. [DOI] [PubMed] [Google Scholar]
  • 57.Bub G, Glass L, Publicover NG, et al. Bursting calcium rotors in cultured cardiac myocyte monolayers. Proc Natl Acad Sci USA. 1998;95:10283–10287. doi: 10.1073/pnas.95.17.10283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hall CE, Hurtado R, Hewett KW, et al. Hemodynamic-dependent patterning of endothelin converting enzyme 1 expression and differentiation of impulse-conducting Purkinje fibers in the embryonic heart. Development. 2004;131:581–592. doi: 10.1242/dev.00947. [DOI] [PubMed] [Google Scholar]
  • 59.Hurtado R, Mikawa T. Enhanced sensitivity and stability in two-color in situ hybridization by means of a novel chromagenic substrate combination. Dev Dyn. 2006;235:2811–2816. doi: 10.1002/dvdy.20909. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supp 1
Download video file (11.6MB, mov)
supp 2
Download video file (11.1MB, mov)
supp 3
Download video file (11.5MB, mov)
supp 4
Download video file (99.1MB, mov)
supp 5
Download video file (98.4MB, mov)

RESOURCES