A Reciprocal Shift in Transient Receptor Potential Channel 1 (TRPC1) and Stromal Interaction Molecule 2 (STIM2) Contributes to Ca²⁺ Remodeling and Cancer Hallmarks in Colorectal Carcinoma Cells

Background: Changes in Ca²⁺ handling in tumor cells might provide novel targets for cancer.

Results: Colon carcinoma cells show enhanced store-operated Ca²⁺ entry and currents and depleted Ca²⁺ stores associated with changes in STIM1/STIM2 ratio and TRPC1.

Conclusion: Ca²⁺ remodeling in colon cancer is driven by a reciprocal shift in TRPC1 and STIM2.

Significance: STIM1/STIM2 and TRPC1 should be investigated further as novel targets for colon cancer.

Abstract

We have investigated the molecular basis of intracellular Ca²⁺ handling in human colon carcinoma cells (HT29) versus normal human mucosa cells (NCM460) and its contribution to cancer features. We found that Ca²⁺ stores in colon carcinoma cells are partially depleted relative to normal cells. However, resting Ca²⁺ levels, agonist-induced Ca²⁺ increases, store-operated Ca²⁺ entry (SOCE), and store-operated currents (I_SOC) are largely enhanced in tumor cells. Enhanced SOCE and depleted Ca²⁺ stores correlate with increased cell proliferation, invasion, and survival characteristic of tumor cells. Normal mucosa cells displayed small, inward Ca²⁺ release-activated Ca²⁺ currents (I_CRAC) mediated by ORAI1. In contrast, colon carcinoma cells showed mixed currents composed of enhanced I_CRAC plus a nonselective I_SOC mediated by TRPC1. Tumor cells display increased expression of TRPC1, ORAI1, ORAI2, ORAI3, and STIM1. In contrast, STIM2 protein was nearly depleted in tumor cells. Silencing data suggest that enhanced ORAI1 and TRPC1 contribute to enhanced SOCE and differential store-operated currents in tumor cells, whereas ORAI2 and -3 are seemingly less important. In addition, STIM2 knockdown decreases SOCE and Ca²⁺ store content in normal cells while promoting apoptosis resistance. These data suggest that loss of STIM2 may underlie Ca²⁺ store depletion and apoptosis resistance in tumor cells. We conclude that a reciprocal shift in TRPC1 and STIM2 contributes to Ca²⁺ remodeling and tumor features in colon cancer.

Introduction

Critical cancer hallmarks include enhanced cell proliferation, apoptosis resistance, and acquired ability to migrate and invade foreign tissues (1), cell functions that are regulated by intracellular Ca²⁺ signals. Increasing evidence suggests that tumor cells may undergo a deep remodeling of their Ca²⁺ homeostasis (2, 3), likely contributing to cancer features. However, mechanisms and contribution of Ca²⁺ deregulation are largely unknown (4), and no data are available in many types of cancer, including colon cancer. Store-operated Ca²⁺ entry (SOCE),⁴ a ubiquitous Ca²⁺ entry pathway involved in many physiological functions, particularly in nonexcitable cells, has been proposed to be remodeled in some cancers (5). This pathway is triggered by the release of Ca²⁺ from intracellular stores induced by phospholipase C activation after receptor stimulation. SOCE is believed to be mediated by the interaction of Stim1 (6), a Ca²⁺ sensor at the endoplasmic reticulum (ER), and Orai1, a pore-forming protein of store-operated channels (SOCs) at the plasma membrane that enables Ca²⁺ influx (7, 8). It is also widely accepted that STIM1/ORAI1 interactions are responsible for I_CRAC activation underlying SOCE in some cell types (8). However, other store-operated currents (I_SOC) less selective for Ca²⁺ might be mediated by canonical transient receptor potential (TRPC) channels, particularly TRPC1 and TRPC4 (2, 9).

Some of the above proteins have been reported to be up-regulated in cancer. For instance, TRP channels, including several TRPCs, TRPV6, and TRPM8, are overexpressed in several tumor cells, thus suggesting they may have oncogenic potential (10–13). SOCE and TRPC6 have been reported to control human hepatoma cell proliferation, and their blockade inhibits cell migration and invasion (10, 14). STIM1 and ORAI1 underlie I_CRAC and regulate glioblastoma cell proliferation, apoptosis, and invasion (15, 16) and are involved in neuroblastoma proliferation as well (17). ORAI3 may form Ca²⁺-permeable channels with roles in breast cancer (18) and in non-small cell lung adenocarcinoma (19). The Ca²⁺ sensor STIM1 may also play an important role in cervical cancer growth, migration, and angiogenesis (20), and its knockdown suppresses SOCE, cell proliferation, and tumorigenesis in human epidermoid carcinoma cells (21). Stim2 is overexpressed in glioblastoma multiforme and colon cancer, but no functional data are available yet (22, 23). Here, we have investigated the deep remodeling of Ca²⁺ handling in human colon carcinoma, one of the most widespread and deadly forms of cancer. In addition, we have addressed the mechanisms involved in the remodeling and their contribution to the hallmarks of cancer.

EXPERIMENTAL PROCEDURES

Materials

NCM460 and NCM356 cells were obtained after a material transfer agreement with INCELL Corp. (San Antonio, TX). HT29 cells were donated by Dr. J. C. Fernández-Checa (Consejo Superior de Investigaciones Científicas, Barcelona, Spain), and SW480-ADH and SW480-R cells were donated by Prof. A. Muñoz (Consejo Superior de Investigaciones Científicas, Madrid, Spain). Dulbecco's modified Eagle's medium (DMEM), penicillin, streptomycin, l-glutamine, and fetal bovine serum were from Lonza (Basel, Switzerland). M3:10^TM medium was from INCELL Corp. Detachin was from Gelantis (San Diego). Fura2/AM, Fura4F/AM, and Fluo4/AM were from Invitrogen. 2-Aminoethoxydiphenylborate and H₂O₂ were from Calbiochem. Thapsigargin and antibodies against TRPC1, ORAI1, ORAI2, and STIM1 were from Alomone Labs (Jerusalem, Israel). Antibodies against STIM2 and ORAI3 were from Santa Cruz Biotechnology. Anti-β-actin was from Abcam (Cambridge, UK). Caged-IP₃ was from Sachem GmbH (Bremen, Germany). Glass bottom culture dishes were from MatTek (Ashland, MA). FITC annexin V was from BD Biosciences. Propidium iodide was from Sigma. SYBR Green I was from Kappa Biosystems (Boston, MA). Primers were obtained from Thermo Scientific (Ulm, Germany).

Cell Culture

Cells were cultured in DMEM 1 g/liter glucose or in M3:10^TM medium as reported previously (24, 25) and supplemented with 1% penicillin/streptomycin, 1% l-glutamine, and 10% fetal bovine serum. Cells were maintained under standard conditions (37 °C, 10% CO₂) and subcultured once a week. All cells were used at passages 3–10.

Cytosolic Ca²⁺ Imaging

[Ca²⁺]_cyt was monitored as reported previously (25) by fluorescence imaging of cells using an inverted Zeiss Axiovert microscope equipped with an OrcaER Hamamatsu digital camera (Hamamatsu Photonics France). Cells were loaded with Fura2/AM (4 μm, 60 min) in external saline solution containing (in mm) the following: 145 NaCl, 5 KCl, 1 CaCl₂, 1 MgCl₂, glucose 10, Hepes/Na 10, pH 7.42. For SOCE, cells were washed twice and treated with thapsigargin (1 μm, 10 min) in the same medium except that it was devoid of Ca²⁺ and also contained 0.5 mm EGTA. Cells were located on a PH1 platform (Warner Instruments) attached on the stage of an inverted microscope and subjected to fluorescence imaging while continuously perfused with external medium at 37 °C. Cells were epi-illuminated alternately at 340 and 380 nm using bandpass filters, and light emitted above 520 nm at both excitation lights was filtered by the dichroic mirror, collected every 5–10 s with a ×40, 1.4 NA, oil objective. For estimation of Ca²⁺ store content, we assessed the effects of cyclopiazonic acid or ionomycin on [Ca²⁺]_cyt in the absence of extracellular Ca²⁺. In the case of ionomycin, the increases in [Ca²⁺]_cyt tended to saturate Fura2 signals. Accordingly, experiments with ionomycin were performed using the low affinity probe Fura4F/AM.

Cell Proliferation

Cells were seeded in 6-well plates at about 10 × 10⁵ cells and incubated with supplemented DMEM or containing test solutions. Wells were counted by triplicate at time 0 and after 72 or 96 h. Cell viability was estimated using trypan blue staining.

Flash Photolysis of Caged-IP₃ and Confocal Microscopy

Cells were plated in glass bottom culture dishes and loaded with Fluo4/AM (2 μm) and caged-IP₃ (0.5 μm) for 1 h. Images were taken using a Leica TCS SP5 confocal microscope (Leica Microsystems, Mannheim, Germany) using a ×40 objective. Fluo4 was excited at 488 nm, and emissions between 503 and 571 nm were collected every 3 s. Photolysis of caged-IP₃/acetoxymethyl ester was performed at 405 nm. The images were analyzed in LAS AF Lite software (Leica Microsystems, Mannheim, Germany). Background was subtracted from all images, and fluorescence intensity (F) was normalized to the resting fluorescence intensity (F₀).

Invasion Assay

Cell invasion assay was performed using BD Biocoat^TM Matrigel^TM invasion chambers (BD Biosciences) containing a membrane with 8-μm pores. HT29 cells (1 × 10⁶ cells) in DMEM were seeded to the upper chamber. DMEM containing 20% FBS was added in the lower chamber as chemoattractant. After 48 h, noninvading cells were removed with a cotton swab from the upper chamber. Cells invading the outer side of the insert were fixed in methanol and stained with toluidine blue solution and 1% chloride double salt (Panreac, Barcelona, Spain). Cells per field were counted randomly at ×200 magnification.

Annexin V Staining Assay

Cell survival assay was performed by flow cytometry using FITC annexin V (BD Biosciences) and propidium iodide (Sigma). Cells were treated with 1 or 2 mm H₂O₂ for 30 or 150 min, respectively, depending on the experiment and then detached with trypsin/EDTA, centrifuged at 290 × g, and washed with cold PBS. The cells were then suspended in binding buffer (0.1 m Hepes, pH 7.4, 1.4 m NaCl, and 25 mm CaCl₂) at a density of 1 × 10⁶ cells/ml. After that, 1 × 10⁵ cells were incubated with 5 μl of annexin V and 10 μl of propidium iodide (50 μg/ml) for 15 min at room temperature in the dark. Cells were analyzed using Gallios Flow Cytometer (Beckman Coulter, Brea, CA), and the results were processed with Kaluza Analysis Software (Beckman Coulter, Brea, CA).

Electrophysiological Recordings

I_SOC in colonic cells was recorded using a Port-a-Patch planar patch clamp system (Nanion Technologies, Munich, Germany) in the whole-cell, voltage clamp configuration at room temperature (20 ± 2 °C). Cultured cells (3–5 days after plating) were detached with Detachin and suspended at a cell density of 1–5 × 10⁶ cells/ml in external recording solution contained (in mm) the following: 145 NaCl, 2.8 KCl, 2 MgCl₂, 10 CaCl₂, 10 Hepes, 10 d-glucose, pH 7.4. For siRNA assays, recordings were performed 48 h after silencing. Suspended cells were placed on the NPC©1 chip surface, and the whole-cell configuration was achieved. Internal recording solution containing (in mm) 50 CsCl, 60 CsF, 10 NaCl, 20 EGTA, 10 Hepes, 2 Na⁺-ATP, pH 7.2 (adjusted with CsOH), was deposited in recording chips, having resistances of 3–5 megohms. The high concentration of EGTA was used to deplete stores and to activate I_SOC in intact and in silenced cells. In some experiments in which I_SOC was activated with thapsigargin or ATP, internal EGTA was diminished from 20 to 0.2 mm and supplemented with a mitochondrial mixture (in mm) of 2 pyruvic acid, 2 malic acid, and 1 NaH₂PO₄. I_SOC was assessed using voltage ramps (−100 to + 100 mV in 200 ms) applied every 5 s, from a holding potential of 0 mV and acquired with an EPC-10 patch clamp amplifier (HEKA). Immediately after the whole-cell configuration was established, the cell capacitance and the series resistances (<10 megohms) were measured. During recordings, these two parameters were measured, and if they exceeded ≥10% with respect to the initial value, the experiment was discontinued. Resting membrane potentials were estimated by reading the potential of the recorded cell immediately after rupturing the membrane in the current-clamp configuration. Leak currents were eliminated by subtracting the average of the first five ramp currents (obtained just after whole-cell configuration was reached) to all subsequent currents. Inward and outward current amplitudes were measured at −80 and +80 mV, respectively. Data were normalized with respect to cell capacitance. Liquid junction potential and capacitive currents were cancelled using the automatic compensation of the EPC-10. Data were filtered at 10 kHz and sampled at 5 kHz.

Conventional and Quantitative PCR

Total cellular RNA was isolated from cells using TRIzol reagent (Invitrogen). Extracted RNA integrity was tested by electrophoresis on agarose gels, and the purity and concentration were determined by spectrophotometry. RNA was reverse-transcribed using a high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) and the cDNA diluted prior to PCR amplification. Nucleotide sequences of the STIM1, ORAI1, ORAI2, and ORAI3 primers used were taken from Ref. 26 and β-actin from Ref. 27. The remaining primers were designed with Primer-BLAST (28). Table 1 shows all primer sequences used. Qualitative PCR was performed on a TGradient system (Biometra, Goettingen, Germany) using a Taq polymerase (Fermentas). The reaction protocol consisted of 3 min at 94 °C, 35 cycles of 1 min at 94 °C, 1 min at 57 °C, and 30 s at 72 °C and finished at 72 °C for 10 min. Real time quantitative-PCR was performed using a SYBR Green I detection in a LightCycler rapid thermal cycler (Roche Applied Science). The PCR protocol started with 5 min at 95 °C followed by 45 cycles of 15 s at 95 °C, 20 s at 57 or 60 °C, and 5 s at 72 °C. β-Actin was used as housekeeping gene. The data were normalized by PCR analysis of β-actin. Melting curves were used to determine the specificity of PCR products (data not shown).

TABLE 1.

Primers used for PCR experiments

ORAI1, ORAI2, ORAI3, and STIM1 primers were taken from Takahashi et al. (26) and β-actin primers from Wang et al. (27). The remaining primers were designed using BLAST primer software (28). F indicates forward, and R indicates reverse.

Name	Primers (5′ to 3′)	Predicted size
		bp
TRPC1	F, TACTTGCACAAGCCCGGAAT	209
	R, ACCCGACATCTGTCCAAACC
TRPC6	F, ATCTGGTGCCGAGTCCAAAG	364
	R, TCCTTCAGTTCCCCTTCGTTC
TRPV4	F, GGGTGGATGAGGTGAACTGG	182
	R, GTCCGGGTTCGAGTTCTTGT3
TRPV6	F, CTGGCTCTGCCAAGTGTAAC	364
	R, GAGGAGACTCCCAGATCCTCTT
TRPM8	F, GATTCCAAGGCCACGGAGAA	345
	R, GGACTGCGCGATGTAGATGA
ORAI1	F, AGCAACGTGCACAAATCTCAA	344
	R, GTCTTATGGCTAACCAGTGA
ORAI2	F, CGGCCATAAGGGCATGGATT	333
	R, TTGTGGATGTTGCTCACGGC
ORAI3	F, CTCTTCCTTGCTGAAGTTGT	380
	R, CGATTCAGTTCCTCTAGTTC
STIM1	F, AGGGTACTGAGAATGAGCGGA	399
	R, CACAGAGGATCTCGATCTGT
STIM2	F, TGTCACTGAGTCCACCATGC	469
	R, GGGCGTGTTAGAGGTCCAAA
β-Actin	F, TACGCCAACACAGTGCTGTCTGG	206
	R, TACTCCTGCTTGCTGATCCACAT

Western Blotting

Total protein was extracted from cells and used to quantify expression of TRPC1, ORAI1, ORAI2, ORAI3, STIM1, and STIM2. Whole-cell lysate was obtained using RIPA buffer (20 mm Tris-HCl, pH 7.8, 150 mm NaCl, 1% Triton X-100, 1% deoxycholic acid, 1 mm EDTA, 0.05% SDS) supplemented with a protease inhibitor mixture. Protein concentrations were determined by a Bradford protein assay. Proteins were fractionated by SDS-PAGE, electroblotted onto PVDF membranes, and probed with the antibodies at a dilution of 1:200, except the anti-β-actin was used at dilution 1:5000. Antibodies were visualized by addition of goat anti-rabbit IgG (TRPC1, ORAI1, ORAI2, ORAI3, STIM1, and STIM2) or rabbit anti-mouse IgG (Stim2 and β-actin). Detection was performed using Pierce ECL Western blotting substrate (Thermo Scientific) and VersaDoc Imaging System (Bio-Rad). Quantification of protein expression was carried out using Quantity One software (Bio-Rad).

Gene Silencing

siRNA sequences of human TRPC1, ORAI1, ORAI2, ORAI3, and STIM2 were obtained from Santa Cruz Biotechnology, as well as control siRNA. NCM460 and HT29 cells (1 × 10⁶) were transfected transiently with 50 pmol of siRNA using Nucleofector II (Amaxa Biosystems, Cologne, Germany) and the W-017 program according to the manufacturer's instructions. After transfection, cells were grown in culture for 48 h, and then imaging, electrophysiology, and cell survival experiments were performed. The effectiveness of silencing was tested by real time qRT-PCR.

Statistics

When only two means were compared, Student's t test was used. For more than two groups, statistical significance of the data was assessed by analysis of variance and compared using Bonferroni's multiple comparison tests. Differences were considered significant at p < 0.05.

RESULTS

Store-operated Ca²⁺ Entry and Cell Proliferation in Colon Carcinoma Cells

Cell proliferation and SOCE were tested in a series of human colon mucosa (NCM460 and NCM356) and human colon carcinoma cell lines (HT29, SW480-ADH, and SW480-R cells). SOCE was monitored by imaging the increase in cytosolic Ca²⁺ concentration ([Ca²⁺]_cyt) induced by Ca²⁺ re-addition to cells previously treated with thapsigargin (1 μm, 10 min) in Ca²⁺-free medium. Under these conditions, Ca²⁺ stores are empty (data not shown). Therefore, this procedure enables monitoring maximally activated SOCE when Ca²⁺ stores are fully depleted. We found that SOCE is small in normal colon mucosa cell lines, and it is largely up-regulated in all three human colon carcinoma cell lines tested (Fig. 1, A and B). Cell proliferation is low in normal mucosa cell lines and increases in carcinoma cells as expected (Fig. 1C). We found that there is an excellent correlation between SOCE and cell proliferation in all five cell lines tested (Fig. 1D) suggesting that increased SOCE contributes to enhanced proliferation in carcinoma cells. These data are consistent with our previous report showing the correlation between SOCE inhibition and prevention of HT29 cell proliferation (25, 29). Therefore, increased SOCE may contribute to enhance cell proliferation of colon carcinoma cells.

FIGURE 1.

Increased SOCE correlates with increased cell proliferation in human colon carcinoma cells. A, SOCE in normal colon cancer cell lines. SOCE was recorded by Ca²⁺ imaging of fura-2-loaded cells treated with thapsigargin (1 μm, 10 min) in Ca²⁺-free medium by the Ca²⁺ re-addition protocol. Pictures show typical Ca²⁺ images coded in pseudocolor. Traces are representative single cell recordings of fluorescence ratios excited at 340 and 380 nm. B, average SOCE values in normal mucosa and colon carcinoma cell lines. Bars show mean ± S.E. values of rises in fluorescence ratios (n = 3, *, p ≤ 0.05). C, cell proliferation in normal and colon cancer cell lines. Cell proliferation was tested for 72 h (mean ± S.E., n = 3, *, p ≤ 0.05). D, correlation between SOCE and cell proliferation in normal and colon cancer cell lines. Cell proliferation (number of cell divisions in 72 h) was plotted versus increases in ratio fluorescence representing SOCE. Pictures show bright field images of HT29 and NCM460 cells.

We tested whether Ca²⁺ fluxes induced by physiological agonists were also remodeled in colon cancer. For this and subsequent studies, we selected NCM460 and HT29 cells as models of normal and colon carcinoma cells, respectively. The physiological agonist ATP increases [Ca²⁺]_cyt in both normal and colon carcinoma cells. However, ATP-induced increases in [Ca²⁺]_cyt in normal cells are small and transient, whereas in tumor cells [Ca²⁺]_cyt increases are much larger and sustained (Fig. 2A). Fig. 2B shows that resting levels of [Ca²⁺]_cyt are also significantly larger in tumor cells. ATP induces both Ca²⁺ release and (store-operated) Ca²⁺ entry. We tested both independently in normal and tumor cells. Fig. 2, C and E, shows that ATP-induced Ca²⁺ release is significantly larger in tumor cells. Similar results are obtained with carbachol (Fig. 2, D and F). Surprisingly, both agonists induce Ca²⁺ entry in tumor cells but not in normal cells (Fig. 2, C–F) suggesting that SOCE activation in physiological conditions is somehow prevented in normal cells. Therefore, in normal colonic cells, physiological agonists produce a small and transient increase in [Ca²⁺]_cyt due solely to Ca²⁺ release, whereas tumor cells display a much larger increase due to both enhanced Ca²⁺ release and SOCE.

FIGURE 2.

Agonist-induced Ca²⁺ release and Ca²⁺ entry are increased in human colon carcinoma cells. A, agonist-induced rise in [Ca²⁺]_cyt is larger in colon carcinoma cells than in normal cells. [Ca²⁺]_cyt increases induced by ATP (200 μm) in normal (NCM460) and colon carcinoma (HT29) cells. Traces are the mean ± S.E. values of fluorescence ratios of 19–23 individual cells (n = 4). B, resting [Ca²⁺]_cyt is larger in tumor cells. Fluorescence ratios reflecting resting [Ca²⁺] estimated just before ATP perfusion in the same experiments (mean ± S.E., n = 4, *, p ≤ 0.05). C, ATP-induced Ca²⁺ release and entry are larger in tumor cells. Ca²⁺ release induced by ATP (200 μm) in Ca²⁺-free medium (Ca0) and Ca²⁺ entry induced by re-addition of external Ca²⁺ in normal and tumor cells (mean ± S.E., n ≥3). D, carbachol-induced Ca²⁺ release and entry are larger in tumor cells. Ca²⁺ release induced by carbachol (100 μm) in Ca²⁺-free medium (Ca0) and Ca²⁺ entry induced by re-addition of external Ca²⁺ in normal and tumor cells (mean ± S.E., n ≥3). E, average increases in ratio fluorescence for ATP-induced Ca²⁺ release and entry (mean ± S.E., *, p ≤ 0.05). F, average increases in ratio fluorescence for carbachol-induced Ca²⁺ release and entry (mean ± S.E., *, p ≤ 0.05). G, release of Ca²⁺ induced by caged-IP₃ in normal and tumor cells. Cells were loaded with Fluo4/AM and Ca²⁺ release induced by flash photolysis of caged-IP₃ was monitored by confocal imaging in normal and tumor cells. Pictures show fluorescence images coded in pseudocolor before and after of stimulation with UV light to release IP₃. H, Fluo4 fluorescence recordings in normal and tumor cells (mean ± S.E.; n = 4, *, p ≤ 0.05).

Ca²⁺ Release and Ca²⁺ Store Content in Normal and Tumor Cells

Experiments were designed to ascertain whether IP₃ availability causes differential Ca²⁺ release and as a consequence different amplitudes of Ca²⁺ increases between normal mucosa and colon carcinoma cells. Flash photolysis of caged-IP₃ induces Ca²⁺ release in both normal and tumor cells as shown by confocal imaging of Fluo4-loaded cells. However, the Ca²⁺ release was still significantly larger in tumor cells (Fig. 2, G and H) suggesting that tumor cells store more Ca²⁺ and/or are more sensitive to IP₃ than normal cells. Ca²⁺ store content in normal and colon carcinoma cells was estimated by measuring release of Ca²⁺ induced by the sarcoplasmic and endoplasmic reticulum Ca²⁺-ATPase pump blocker cyclopiazonic acid (CPA) and by low concentrations of the Ca²⁺ ionophore ionomycin. Unexpectedly, we found that CPA induces larger [Ca²⁺]_cyt increases in normal cells than in tumor cells (Fig. 3A) consistently with a larger Ca²⁺ store content in normal cells. In fact, a few minutes after CPA treatment, normal cells still responded largely to ATP, whereas tumor cell stores did not respond at all (Fig. 3A). Consistently, ionomycin induces also a larger [Ca²⁺]_cyt increase in normal cells (Fig. 3B) than in tumor cells. Thus, contrary to expectations, Ca²⁺ store content is seemingly larger in normal cells than in tumor cells.

FIGURE 3.

Ca²⁺ stores are partially depleted in colon cancer cells. A, CPA-induced Ca²⁺ release is smaller in tumor cells than in normal cells. Fura2 and Fura4F-loaded cells were subjected to fluorescence imaging for estimating Ca²⁺ store content. Recordings show the release of Ca²⁺ induced by 30 μm CPA in Ca²⁺-free medium (Ca0) in normal (black traces) and tumor (red traces) cells loaded with Fura2/AM (mean ± S.E.; n = 4). Bars represent area under curve (mean ± S.E.) of the records (*, p < 0.05). B, ionomycin-induced Ca²⁺ release is smaller in tumor cells than in normal cells. Recordings show the release of Ca²⁺ induced by 400 nm ionomycin in Ca²⁺-free medium (Ca0) in normal (black traces) and tumor (red traces) cells loaded with Fura4F/AM (mean ± S.E.; n = 7). Bars represent area under curve (mean ± S.E.) of the records (*, p < 0.05). C, Ca²⁺ store content after ATP-induced Ca²⁺ release in normal and tumor cells. Ca²⁺ release induced by 200 μm ATP in Ca²⁺-free medium was tested in normal and tumor cells. The remaining stored Ca²⁺ was estimated in the same cells by the adding 400 nm ionomycin (mean ± S.E.; n = 4–7). Bars are Ca²⁺ release-induced by ATP expressed as % of the total area under the curves (mean ± S.E., n ≥4, *, p ≤ 0.05). D, estimation of resting Ca²⁺ store content in normal and tumor cells (area under curve of bars in B) before (resting) and after ATP. Values after ATP were calculated by decreasing resting Ca²⁺ store content by the percent released estimated in C. (a, p < 0.05 versus resting cells; b, p < 0.05 versus normal cells.)

The extent of agonist-induced Ca²⁺ release relative to total stored Ca²⁺ was estimated next in normal and tumor cells. For this end, the amount of Ca²⁺ remaining in the store after ATP was tested using ionomycin in Ca²⁺-free medium (Fig. 3C). We found that ATP mobilizes about 20% of total stored Ca²⁺ in normal cells. In contrast, in tumor cells, ATP releases about 60% of total stored Ca²⁺ (Fig. 3C). Fig. 3D shows the Ca²⁺ store content estimated before and after stimulation with ATP in normal and tumor cells. Data indicate that Ca²⁺ stores in normal cells are overloaded relative to tumor cells, and physiological stimulation does not release much Ca²⁺, leaving stores nearly intact. In contrast, Ca²⁺ stores in tumor cells are substantially depleted in resting conditions and release relatively more Ca²⁺ in response to stimulation, thus likely enabling cells to reach the threshold for SOCE activation.

It has been reported that Ca²⁺ store content is critical for apoptosis resistance and survival (4). Accordingly, we have assessed apoptosis resistance (survival) of normal mucosa and carcinoma colon cells by flow cytometry after treatment with H₂O₂, a well established agent that promotes oxidative stress, apoptosis, and cell death. Consistently, colon carcinoma (HT29) cells are much more resistant to cell death than normal colonic epithelial (NCM460) cells (Fig. 4, A and B). These data suggest that the low Ca²⁺ store content of tumor cells may contribute to apoptosis resistance characteristic of human colon carcinoma cells.

FIGURE 4.

Colon carcinoma cells are resistant to cell death. A, resistance of NCM460 and HT29 cells to cell death induced by H₂O₂. Representative flow cytometry assays of FITC annexin V- and propidium iodide (PI)-stained cells. Viable cells are annexin V- and PI-negative; cells in early apoptosis are annexin V-positive and PI-negative, and cells in late apoptosis or necrosis are annexin V- and PI-positive. NCM460 and HT29 cells were treated with 2 mm H₂O₂ for 150 min. B, total cell death of treated and untreated cells with H₂O₂ (early apoptosis, late apoptosis, and necrosis). Bars are mean ± S.E. of the assay with three replicates and representative of five experiments (a, p < 0.05 versus untreated cells; b, p < 0.05 versus normal cells).

Store-operated Currents (I_SOC) in Normal and Colon Carcinoma Cells

Ion currents involved in SOCE and agonist-induced Ca²⁺ entry were investigated next using planar patch clamp electrophysiology in the whole-cell voltage clamp configuration. The estimated resting membrane potential for HT29 cells was −64 ± 2 mV (n = 33) and for NCM460 cells was −45 ± 4 mV (n = 22). For I_SOC activation, Ca²⁺ stores were passively depleted by dialyzing cells with a recording internal solution containing 20 mm EGTA. NCM460 cells displayed I_SOC with small inward current amplitude (−2.3 ± 0.3 pA/pF, at −80 mV; n = 18) and without apparent outward current. The current-voltage (I-V) relationship of these I_SOC, observed among all normal cells recorded (n = 82), displayed strong inward rectification and very positive reversal potential (Fig. 5A). All these characteristics are similar to the previously reported I_CRAC (31). Fig. 5B shows the average time course graph, constructed by plotting the amplitude of the I_CRAC-like current (at −80 mV) with respect to recording time, in which the Ca²⁺-dependent inactivation was prevented by the presence of a high concentration of EGTA. I_SOC currents in tumor cells were quite different. In HT29 cells, I_SOC has a small inward current that was significantly greater than in normal cells (−4.9 ± 0.15 pA/pF, at −80 mV; n = 31; Student's t test, p < 0.05). In addition, I-V relationships of I_SOC display complex profiles that were classified in two principal groups as follows: a I_CRAC-like current presented in about 36% of cells (Fig. 5, C and D; n = 11) and a mixture of a I_CRAC-like plus a nonselective I_SOC obtained from about 64% of cells (Fig. 5E; n = 20). Both I-V relationship profiles contain an inward component, without significant current amplitude differences when comparing them (Student's t test, p < 0.05). The outward component has an amplitude of 5.3 ± 0.2 pA/pF at 80 mV (n = 20) and displays rectification. Comparison of inward and outward currents in normal and tumor cells is shown in Fig. 5F. The electrophysiological data indicate that Ca²⁺ store depletion in tumor cells activates I_CRAC-like currents with higher amplitude than in normal cells, probably contributing to their increased SOCE. Meanwhile, the nonselective I_SOC observed in tumor cells could be an additional pathway for more Ca²⁺ influx. Similar results are obtained when I_SOC was induced by passive depletion of intracellular Ca²⁺ stores with thapsigargin or the physiological agonist ATP (Fig. 6). Again, normal cells display only I_CRAC-like currents with low amplitude (−1.6 ± 0.3 pA/pF, n = 17 for thapsigargin; −1.4 ± 0.6 pA/pF, n = 13 for ATP) compared with inward I_SOC of tumor cells (−4.0 ± 0.4 pA/pF, n = 15 for thapsigargin; −2.4 ± 0.4 pA/pF, n = 13 for ATP). Tumor cells show currents similar to I_SOC activated with high intracellular EGTA, thapsigargin as well as ATP activated I_CRAC-like and nonselective I_SOC currents.

FIGURE 5.

Store-operated currents (I_SOC) in normal (NCM460) and colon carcinoma (HT29) cells. A, current-voltage (I-V) relationship of I_SOC in normal cells. Average I-V relationships of I_SOC obtained from NCM460 cells (n = 18). In this set of experiments SOCs were activated by passive Ca²⁺ store depletion with intracellular EGTA (20 mm). In this and following electrophysiological data, the current amplitudes were normalized with respect to cell capacitance; inward and outward currents were measured at −80 and +80 mV, respectively, and average plots are presented as mean ± S.E. B, averaged time course recordings of I_SOC obtained from NCM460 cells (n = 18). C, I-V relationship of I_CRAC-like currents in colon carcinoma cells. Average I-V relationships of I_SOC obtained from the 36% of HT29 cells examined (n = 11). D, averaged time course recordings of I_SOC obtained from HT29 cells (n = 31). E, I-V relationship of the nonselective I_SOC in colon carcinoma cells. Average I-V relationships of I_SOC obtained from the 64% of HT29 cells tested (n = 20). F, maximal current amplitude of I_SOC in normal and tumor cells (n = 18–31, *, p < 0.05).

FIGURE 6.

SOCs activated by thapsigargin and ATP in normal (NCM460) and colon carcinoma (HT29) cells. A, average time course plot of I_CRAC activated with extracellular thapsigargin (1 μm) in normal colon cells (n = 17). B, average time course plots of I_SOC activated with extracellular thapsigargin in HT29 cells (n = 15). C, average time course plots of I_CRAC activated with ATP (200 μm) in NCM460 cells (n = 13). D, average time course plot of I_SOC activated with ATP (200 μm) in HT29 cells (n = 13–14). E, mean ± S.E. of I_SOC maximal amplitude for NCM460 (n = 17–13). F, mean of I_SOC maximal amplitude for HT29 cells (n = 15–13, *, p < 0.05).

Sensitivity to antagonists was tested next to identify further the channels involved in I_SOC in normal and tumor cells. Fig. 7 shows the effects of La³⁺, a classic SOCE antagonist of SOCs in normal and tumor cells. La³⁺ inhibited almost totally I_CRAC-like currents in normal cells and both inward and outward currents in tumor cells. Low concentrations (30 μm) of 2APB largely inhibit the I_CRAC-like current of normal cells (Fig. 8A) and the I_CRAC-like component of tumor cells (Fig. 8B), but they have no effect on the outward I_SOC. At 100 μm 2APB, the outward component is now inhibited (Fig. 8C). Average results are shown in Fig. 8D. 2APB is also more efficient in preventing SOCE in normal cells than in tumor cells (data not shown). Results suggest that normal and tumor cells express I_SOC, similar to I_CRAC, which are sensitive to low concentrations of 2APB. Yet the additional nonselective I_SOC observed only in tumor cells is less sensitive to this SOCE antagonist. It has been reported that 2APB may enhance I_SOC carried out by ORAI3 (32). In our hands 2APB did not potentiate I_SOC in normal or tumor cells (Fig. 8). It has been reported that SOCE is involved in cell migration and invasion in tumor cells (30). Accordingly, colon carcinoma cell invasion was tested in vitro by transwell assay. HT29 cells displayed invasive characteristics. In addition, HT29 cell invasion was inhibited significantly by classic SOCE antagonist 2APB (Fig. 8E).

FIGURE 7.

Effects of La³⁺ on I_SOC in normal (NCM460) and colon carcinoma (HT29) cells. I_SOC were activated by passive Ca²⁺ store depletion with extracellular thapsigargin (1 μm). For NCM460 cells, representative I-V relationships of I_SOC, in the absence and in the presence of 5 μm La³⁺ (A) and La³⁺-sensitive currents (B; n = 6). C, example of time course recordings of I_SOC that was further inhibited by La³⁺. D, average effect of La³⁺ on I_SOC in NCM460 cells, measured at −80 mV (mean ± S.E. of six independent experiments). F, *, p < 0.05. E–H, inhibition of I_SOC of HT29 cells by 5 μm La³⁺ (n = 10; *, p < 0.05).

FIGURE 8.

Effects of 2APB on I_SOC and SOCE in normal (NCM460) and colon carcinoma (HT29) cells and on HT29 cell invasion. A, low concentrations of 2APB (30 μm) inhibit I_CRAC in normal cells. Left, representative I-V relationships of the I_SOC in the absence (black) and in the presence (green) of 30 μm 2APB; middle, average I-V relationships of 2APB-sensitive currents (n = 11); right, example of time course recordings of I_SOC that was further inhibited by 2APB. B, low concentrations of 2APB (30 μm) inhibit I_CRAC component in tumor cells. Left, same as in A but for HT29 cells; middle, average I-V relationship of 30 μm 2APB-sensitive current (n = 6); right, example of time course recordings of I_SOC and its subsequent inhibition by 30 μm 2APB concentration in tumor cells. C, high concentrations of 2APB (100 μm) inhibit the nonselective I_SOC in tumor cells. Same as in B but using 100 μm 2-APB (n = 12); middle, average I-V relations of 100 μm 2APB concentration-sensitive currents (n = 12); right, example of time course recordings of I_SOC. Both inward and outward currents were sensitive to high 2APB concentration. D, mean of I_SOC maximal amplitude (at −80 and +80 mV) before and after 2APB at 30 and 100 μm (n = 5–12, #, p < 0.05). E, effects of 2APB (100 μm) on colon carcinoma (HT29) cell invasion. HT29 cells invaded a transwell invasion chamber from the top to the bottom in 48 h following an FBS gradient. Bars are mean ± S.E. of cells detected in three invasion experiments expressed relative to control (*, p < 0.05).

Ca²⁺ selectivity and Ba²⁺ permeability of I_SOC was characterized further. The inward component of I_SOC was very selective for Ca²⁺ because removal of Na⁺ (substituted by NMDG⁺) did not affect current amplitude (from −4.9 ± 1.5 pA/pF for Na⁺ medium to −4.2 ± 2.5 for Na⁺-free medium; n = 14–31). These data were consistent with the involvement of the high Ca²⁺-selective ORAI1 channel. In contrast, the outward component was nearly abolished in Na⁺-free medium (from 5.3 ± 0.2 pA/pF for Na⁺ medium to 0.2 ± 0.7 for Na⁺-free medium; n = 14–31) suggesting that this cation is the main current carrier of this component. However, it has been reported that Ba²⁺ decreases currents mediated by ORAI1 but potentiate those mediated by ORAI2 and ORAI3. We found that the inward I_SOC carried Ba²⁺ ions, but the current amplitude was lower than that transported by Ca²⁺ (from −4.9 ± 15 pA/pF for Ca²⁺ to −2.6 ± 1.4 for Ba²⁺; n = 12–31) (data not shown). Data suggest that ORAI1 channels, rather than ORAI2 and -3, contribute to I_CRAC-like currents in tumor cells. In addition, a nonselective channel also contributes to I_SOC in tumor cells but not in normal cells.

Expression of SOCE Molecular Players in Normal and Tumor Carcinoma Cells

Expression of molecular candidates involved in I_SOC and SOCE in normal and tumor cells was investigated next. PCR analysis shows expression of probable TRP channels involved in SOCE in normal and tumor cells. We found that only TRPC1 is expressed in both normal and tumor cells (Fig. 9A). TRPV6 and TRPM8 were expressed in normal but not in tumor cells (Fig. 9A). Consistently, TRPM8 agonist menthol had no effect on I_SOC in tumor cells (data not shown). Other candidates tested, including TRPC6 and TRPV4, were missing in both cell lines (Fig. 9A). Regarding candidates involved in I_CRAC, we found that all members of the ORAI (ORAI1, -2, and -3) and STIM (STIM1 and -2) protein families are expressed in both normal and tumor cells (Fig. 9B). Quantitative, real time RT-PCR studies were carried out on those candidates expressed in both normal and tumor cells (Fig. 9C). Expression values were normalized relative to expression of β-actin. The expression profile of these candidates in normal NCM460 cells was STIM2 = ORAI2 > STIM1 = ORAI1 > ORAI3 ≫ TRPC1. In HT29 colon carcinoma cells, the expression profile was roughly similar except that STIM1 now doubled the ORAI1 expression (Fig. 9C). More importantly, we found that several transcripts were increased significantly relative to normal cells, including STIM2, ORAI2, STIM1, and TRPC1 (Fig. 9C). ORAI1 and ORAI3 transcripts were similar in normal and tumor cells (Fig. 9C).

FIGURE 9.

mRNA expression levels of SOCE-related channels and Stim proteins in normal (NCM460) and colon carcinoma (HT29) cells. A, mRNA expression of selected transient receptor potentials in normal and colon carcinoma cells. Pictures show specific bands of RT-PCR products of TRPC1, TRPC6, TRPV6, and TRP8. β-Actin expression was used as internal control. B, mRNA expression of orai and stim family members in normal and colon carcinoma cells. Pictures show specific bands of RT-PCR products of ORAI1, ORAI2, ORAI3, STIM1, and STIM2. β-Actin expression was used as internal control. C, transcript levels of TRPC1, ORAIS, and STIMs. mRNA levels of candidate molecular players were measured in normal (black bars) and tumor (red bars) cells by qPCR and normalized to β-actin. Data are mean ± S.E. of at least three experiments (*, p < 0.05).

Western blotting analysis was carried out to test expression of molecular candidates at the protein level. Fig. 10 shows that expression of almost all tested proteins was increased in tumor cells, including ORAI1, ORAI2, ORAI3, TRPC1, and STIM1 (Fig. 10, A–E), despite some of them showing no change at the mRNA level. Relative changes were not similar. TRPC1 and STIM1 increased 5.2 and 3.7 times in tumor cells, respectively. ORAI1, ORAI2, and ORAI3 increased 2.3-, 2.9-, and 1.5-fold in tumor cells, respectively (Table 2). Surprisingly, we found that STIM2 protein is nearly lost in colon carcinoma HT29 cells relative to normal colon NCM460 cells (Fig. 10F) despite that stim2 was the most increased transcript in tumor cells (Fig. 9C).

FIGURE 10.

Protein expression levels of SOCE-related channels and Stim proteins in normal (NCM460) and colon carcinoma (HT29) cells. A, Western blot assay of ORAI1 protein expression in normal and tumor cells. In this and the following panels, bars are mean ± S.E. values relative to normal cells (n ≥3; *, p < 0.05). B, Western blot assay of ORAI2 protein expression in normal and tumor cells. C, Western blot assay of ORAI3 protein expression in normal and tumor cells. D, Western blot assay of TRPC1 protein expression in normal and tumor cells. E, Western blot assay of STIM1 protein expression in normal and tumor cells. F, Western blot assay of STIM2 protein expression in normal and tumor cells.

TABLE 2.

Changes (fold increase) in proteins involved in SOCE in tumor cells relative to normal cells

Values correspond to the fold increase for each protein in tumor cells relative to normal cells. Thus, for instance, TRPC1 is 5.2 times more abundant in colon carcinoma cells than in normal colonic cells. Data are taken from the bars shown in Fig. 7. All proteins are more abundant (fold change >1) in tumor cells except for Stim2, which is decreased by 85% in tumor cells. The most important changes are those observed in TRPC1, Stim1, and Stim2 (shown in boldface).

	Fold change tumor vs. normal cells
TRPC1	5.20
ORAI1	2.30
ORAI2	2.90
ORAI3	1.50
STIM1	3.70
STIM2	0.15

An emerging concept in Ca²⁺ signaling is that stoichiometry of molecular components may influence SOCE and I_SOC critically (33). Accordingly, we have estimated the fold change of each component in tumor cells relative to the changes of the remaining proteins. Table 3 shows the fold change ratios of each protein relative to the changes of the rest of the proteins. TRPC1/ORAI1, TRPC1/ORAI2, and TRPC1/ORAI3 ratios increased 2.2-, 1.8-, and 3.5-fold, respectively, in tumor cells, suggesting that SOCs in tumor cells are enriched in TRPC1. In addition, fold change ratios for TRPC1/STIM2, ORAI1/STIM2, ORAI2/STIM2, ORAI3/STIM2, and STIM1/STIM2 increased by 35-, 13-, 19-, 20-, and 25-fold, respectively. These values suggest that, in tumor cells, STIM2 protein is essentially removed from any possible interaction with other SOCE molecular players. Interestingly, it has been reported that STIM2 may inhibit STIM1-mediated SOCE (34) and may regulate Ca²⁺ store content (35). Accordingly, loss of STIM2 may impact on both SOCE and Ca²⁺ store content. Knockdown experiments were carried out next to ascertain the role of the above-mentioned proteins on SOCE, I_SOC, and Ca²⁺ store content.

TABLE 3.

Ratio of change in proteins involved in SOCE relative to the change observed in the remaining proteins

Each value corresponds to the fold change of a particular protein in tumor cells relative to the fold change of the remaining proteins. For instance, TRPC1 increases 5.2 fold in tumor cells whereas Orai1 increases only 2.3 times. Thus, TRPC1 protein expression increases 2.2 times more than Orai1. These ratios are very large for any combination of proteins with Stim2 in the denominator as this protein actually decreases in tumor cells.

Effects of TRPC1 and ORAI1 Silencing on SOCE and I_SOC in Normal and Tumor Cells

Results suggest that ORAI1 and TRPC1 are likely involved in SOCE and I_SOC in colon carcinoma cells. To test for this possibility, ORAI1 and TRPC1 were silenced in HT29 cells using small interference RNA (siRNA) technology. siRNA probes against ORAI1 and TRPC1 decreased significantly the amount of corresponding mRNA (Fig. 11, A and B). ORAI1 silencing decreases significantly SOCE in HT29 cells almost as much as it decreases ORAI1 transcript (Fig. 11A). In contrast, TRPC1 knockdown fails to reduce SOCE in tumor cells (Fig. 11B). The effects of silencing ORAI1 and TRPC1 on I_SOC and I_CRAC were tested next. In tumor cells, scramble siRNA had no effect on the inward or the outward I_SOC (Fig. 11, C and F). As expected, ORAI1 silencing decreases largely the inward I_SOC (from −4.9 ± 0.6 pA/pF for scramble siRNA to −2,2 ± 0.4 for ORAI1 siRNA; n = 13–19) but also reduces significantly the outward component (from 4.5 ± 1 pA/pF for scramble siRNA to 2.4 ± 1 for ORAI1 siRNA; n = 13–19) (Fig. 11, D and F). TRPC1 silencing nearly abolishes the outward component of the I_SOC (from 4.5 ± 1 pA/pF for scramble siRNA to 0.7 ± 0.4 for TRPC1 siRNA; n = 13–17) and also reduces significantly the inward component (from −4.9 ± 0.6 pA/pF for scramble siRNA to −1.7 ± 0.5 for TRPC1 siRNA; n = 13–17) (Fig. 11, E and F). In normal cells, the results are quite different (Fig. 12). TRPC1 silencing or scramble siRNA has no effect on I_CRAC (Fig. 12, A and B). However, silencing of ORAI1 inhibits I_CRAC in normal cells (Fig. 12C). Average data are shown in Fig. 12D. Likewise, silencing of ORAI1 but not TRPC1 inhibits SOCE in normal cells (data not shown). These results indicate that both ORAI1 and TRPC1 contribute to I_SOC in colon carcinoma cells, although in normal cells I_CRAC is mediated only by ORAI1. We have also tested the contribution of ORAI2 and ORAI3 on SOCE in tumor cells. Fig. 13 shows that, paradoxically, silencing of either ORAI2 or ORAI3 in HT29 cells tends to increase SOCE. However, differences were not statistically significant (Fig. 13).

FIGURE 11.

Effects of ORAI1 and TRPC1 knockdown on SOCE and SOCs in colon carcinoma (HT29) cells. A, ORAI1 knockdown inhibits SOCE. Real time PCR of HT29 cells transfected with siRNAs scramble and orai1. Data were normalized to β-actin (mean ± S.E., n = 3, *, p < 0.05). SOCE recordings in HT29 cells transfected with scramble siRNA (black traces) or ORAI1 siRNA. Records are mean ± S.E. (n ≥15). Bars represent the mean ± S.E. of Δ ratios (*, p < 0.05). B, TRPC1 knockdown does not inhibit SOCE. Real time PCR of TRPC1 in HT29 cells transfected with scramble and TRPC1 siRNAs. Data were normalized to β-actin (mean ± S.E., n = 3, *, p < 0.05). SOCE recordings in HT29 cells transfected with scramble siRNA (black traces) or siRNA against TRPC1. Records are mean ± S.E. (n ≥15). Bars represent the mean ± S.E. of SOCE (Δ ratio) (*, p < 0.05). C, average time course plots of I_SOC current amplitude from colon cancer cells transfected with scramble siRNA (n = 13). D, average time course plots of I_SOC in colon cancer cells transfected with siRNA against ORAI1 (n = 19). E, average time course plots of I_SOC in colon cancer cells transfected with siRNA against TRPC1 (n = 17). F, average data obtained from the above experiments (n = 13–19, *, p < 0.05).

FIGURE 12.

Effects of ORAI1 and TRPC1 knockdown on I_CRAC in normal (NCM460) cells. A, representative I-V relationships (left) and current kinetics of I_CRAC at −80 mV (right) in normal NCM460 cells transfected with scramble siRNA (n = 12). B, representative I-V relationships (left) and current kinetics of I_CRAC at −80 mV (right) in normal NCM460 cells transfected with TRPC1 siRNA (n = 8). C, representative I-V relationships (left) and current kinetics of I_CRAC at −80 mV (right) in normal NCM460 cells transfected with ORAI1 siRNA (n = 14). D, average current density (pA/pF) of I_CRAC at −80 mV for nonsilenced cells and cells transfected with scramble siRNA, TRPC1 siRNA, and ORAI1 siRNA. Data are mean ± S.E. of 8–14 cells (*, p < 0.05), ns, nonsignificant.

FIGURE 13.

Effects of ORAI2 and ORAI3 knockdown on SOCE in colon carcinoma (HT29) cells. A, HT29 cells were transfected with scramble siRNA or siRNA for ORAI2 or ORAI3, and levels of corresponding mRNAs were estimated by quantitative RT-PCR. B, SOCE was estimated in control and knockdown cells for ORAI2 (left) and ORAI3 (right) HT29 cells treated with thapsigargin. Data are mean ± S.E. of four independent recordings for each case. C, Δ ratio (mean ± S.E.) of cells transfected with siRNA scramble or siRNAs for ORAI2 (left) or ORAI3 (right).

Finally, we have investigated the molecular basis and functional significance of Ca²⁺ store depletion in tumor cells. For this end, we tested the effects of STIM2 silencing in normal NCM460 cells on Ca²⁺ store content, SOCE, and apoptosis resistance. STIM2 silencing decreases STIM2 mRNA by 64 ± 6% (data not shown).

We found that STIM2 silencing decreased the rise in [Ca²⁺]_cyt induced by ionomycin in Ca²⁺-free medium consistently with decreased Ca²⁺ store content in STIM2-silenced cells (Fig. 14A). In addition, re-addition of external Ca²⁺ to ionomycin treated is decreased in STIM2-silenced cells suggesting that STIM2 knockdown inhibits SOCE in normal cells. Consistently, SOCE in cyclopiazonic acid-treated cells was reduced in silenced cells (Fig. 14, A and B) relative to control cells. Therefore, these data indicate that STIM2 contributes to SOCE and Ca²⁺ store content in normal cells, and its silencing leads to decreased SOCE and Ca²⁺ store content. As Ca²⁺ store content may be relevant for apoptosis resistance, we next tested the effects of STIM2 silencing on apoptosis resistance. We found that after strong oxidative damage (2 mm H₂O₂, 150 min), resistance to apoptosis was similar in control and silenced cells (data not shown). However, when damage was less severe (1 mm H₂O₂, 30 min), STIM2-silenced cells proved to be more resistant to cell death than control cells (Fig. 14C). These data indicate that STIM2 participates in SOCE in normal colon epithelial cells, and the inhibition of its expression during tumorigenesis may contribute to Ca²⁺ store depletion and apoptosis resistance, which are characteristic of tumor cells.

FIGURE 14.

Effects of STIM2 knockdown on Ca²⁺ store content, SOCE, and apoptosis resistance in normal (NCM460) cells. A, STIM2 knockdown decreased significantly the increase in cytosolic Ca²⁺ induced by ionomycin in Ca²⁺-free medium (Ca²⁺ store content) and the increase in Ca²⁺ recorded in the same cells after external Ca²⁺ re-addition (SOCE) in normal NCM460 cells loaded with Fura4F/AM (*, p < 0.05, n = 3 independent experiments). B, STIM2 knockdown decreased SOCE significantly in normal NCM460 cells. SOCE was estimated by the re-addition of extracellular Ca²⁺ to cyclopiazonic acid (CPA)-treated, normal NCM460 cells transfected with scramble or STIM2 siRNA (*, p < 0.05, n = 3 independent experiments). C, effects of STIM2 knockdown on cell death induced by H₂O₂ (1 mm, 30 min) in normal NCM460 cells. Representative flow cytometry assays of FITC annexin V and propidium iodide-stained cells. Viable cells are annexin V- and PI-negative; cells in early apoptosis are annexin V-positive and propidium iodide-negative, and cells in late apoptosis or necrosis are annexin V- and PI-positive. Bars show the increase in total cell death (mean ± S.E.) induced by H₂O₂ in STIM2-silenced cells relative to the effects in scramble siRNA-transfected cells. Data are from three independent experiments (*, p < 0.05).

DISCUSSION

We have investigated the remodeling of intracellular Ca²⁺ handling in colon cancer, its molecular basis, and its contribution to cancer hallmarks. To this end, functional parameters and molecular players involved in Ca²⁺ homeostasis were studied in normal human mucosa and colon carcinoma cells. All colon carcinoma cell lines tested displayed a much larger SOCE than normal cell lines, which correlated with increased cell proliferation in tumor cells, thus suggesting that enhanced SOCE contributes to increased tumor cell proliferation in colon cancer. Consistently, up-regulation of SOCE has been recently correlated with cancer features in a number of cancers (10, 12, 13, 16, 20, 21, 36). We have shown previously that SOCE antagonists inhibit colon carcinoma cell proliferation (25, 29). Now, we show that SOCE antagonist 2APB also inhibits colon carcinoma cell invasion suggesting contribution of SOCE to enhanced proliferation and invasion in these cells. Accordingly, we have investigated the mechanisms for increased SOCE in human colon carcinoma cells. Importantly, NCM460 normal and HT29 carcinoma colon cells have been recently validated as normal and tumor cell models, respectively (37).

Increased SOCE in colon carcinoma cells was associated with enhanced resting [Ca²⁺]_cyt, more negative membrane potential, increased I_SOC, and enhanced agonist-induced Ca²⁺ release and entry. As a matter of fact, physiological agonists that induce Ca²⁺ release (ATP and carbachol) promoted Ca²⁺ entry only in tumor cells. This differential response could be due to the fact that Ca²⁺ stores in normal cells are overloaded relative to tumor cells, and the agonist-induced Ca²⁺ store emptying is rather limited. In this scenario, the threshold for SOCE activation could be beyond reach, and SOCE is not permitted unless Ca²⁺ stores are fully depleted by, for instance, thapsigargin. In contrast, Ca²⁺ stores in tumor cells are substantially depleted, and Ca²⁺ release is enhanced, thus putting SOCE threshold at reach and favoring SOCE activation in physiological conditions. This partial Ca²⁺ store depletion in colon carcinoma cells could contribute also to cancer features. First, it favors SOCE activation and therefore cell proliferation and invasion as stated above. Second, it may also contribute to apoptosis resistance, another hallmark of cancer cells. Interestingly, it has been reported recently that Ca²⁺ store content may be critical for survival. Specifically, large Ca²⁺ stores favor enhanced transfer to mitochondria and mitochondrial Ca²⁺ overload, whereas reduced Ca²⁺ store content prevents mitochondrial Ca²⁺ overload and apoptosis (38). Consistently, we show that colon carcinoma cells display substantially depleted stores and enhanced resistance to cell death. Taken together, data suggest that the “Ca²⁺ signature” of colon carcinoma cells shown here and made of enhanced SOCE and depleted Ca²⁺ stores may contribute to enhanced proliferation, invasion, and survival characteristics of cancer cells.

What mechanisms underlie enhanced SOCE and depleted Ca²⁺ stores in human colon carcinoma cells? Regarding SOCE, our combined functional and molecular analysis reveals that SOCE enhancement in tumor cells is mediated by the following: 1) up-regulation of ORAI1 and STIM1 proteins, which likely mediate enhanced I_CRAC and SOCE in tumor cells; 2) overexpression of TRPC1 protein that correlated with the emergence of a nonselective I_SOC; and 3) the switch of the levels of expression between STIM1 and STIM2 Ca²⁺ sensors proteins (Fig. 15). More specifically, differences in ion channel expression and ER Ca²⁺ sensors may contribute to enhance SOCE in tumor cells. This possibility was addressed directly by measuring SOCs in normal and tumor cells. Interestingly, I_SOC was strikingly different. Normal cells display a small I_CRAC current, whereas tumor cells showed a mix of currents, including enhanced I_CRAC plus and additional nonselective I_SOC. It has been reported that SOCE can be supported by different I_SOC expressed in the same cell (9, 39–41). To our knowledge, this is the first report showing that I_SOC currents in normal cells are strikingly different compared with their tumor cell counterparts.

FIGURE 15.

Hypothesis of molecular basis of Ca²⁺ remodeling in colon cancer. The “Ca²⁺ signature” of colon carcinoma cells is enhanced SOCE, differential SOCs, and depleted Ca²⁺ stores. This remodeling is associated with increased protein expression of TRPC1, STIM1, ORAI1, ORAI2, and ORAI3 in tumor cells along with loss of STIM2 protein. Normal cells show small SOCE mediated by canonical I_CRAC carried by ORAI1. STIM2 protein in normal cells may limit STIM1/ORAI1 interaction and may signal for large Ca²⁺ store content, thus preventing SOCE activation and TRPC1 functional expression. In this scenario, cell proliferation and migration are limited, and cells are prone to die as Ca²⁺ stores are loaded. Loss of STIM2 renders cells under control of STIM1 that set Ca²⁺ store content to a lower level. Like in Darier disease, depletion of Ca²⁺ stores likely promotes TRPC1 functional expression. In addition, loss of STIM2 may also favor interaction of STIM1 with ORAI1 and TRPC1 resulting in enhanced I_CRAC and the appearance of a nonselective current.

I_CRAC in normal and colon carcinoma cells is likely mediated by ORAI1 and STIM1/STIM2 proteins because all of them are expressed in both cell lines, and the biophysical and pharmacological characteristics of recorded currents match those described for canonical I_CRAC (31, 42, 43). In our hands, I_CRAC in both normal and tumor colon cells displayed voltage-independent activation, strong inward rectification, and reversal potential in very positive voltages. Also, I_CRAC was inhibited by 2APB at a low concentration (30 μm). In addition, the well known potentiating effect of low concentrations of 2APB on ORAI3-containing SOCs (32, 44) was not observed. Moreover, the extent of I_CRAC was unaffected by the absence of extracellular Na⁺ ions and reduced when Ba²⁺ was used instead Ca²⁺, thus indicating a high Ca²⁺ selectivity and the involvement of ORAI1 channels (42, 45, 46).

However, the emergent I_SOC restricted to tumor cells was nonselective showing a reversal potential near 0 mV. Unlike I_CRAC, the emergent I_SOC was not sensitive to low concentrations of 2APB (30 μm), and the current amplitude of the outward component was significantly decreased by removal of extracellular Na⁺ ions, thus suggesting involvement of a TRPC member (47, 48). At the molecular level, several candidates were excluded because they are not expressed in tumor cells, including TRPV6, TRPM8, TRPC6, and TRPV4. In contrast, TRPC1 was expressed in normal and tumor cells, and its abundance increased quite significantly in colon cancer cells, thus suggesting contribution of TRPC1 to the nonselective, emergent I_SOC of tumor cells. Knockdown experiments corroborated the molecular identity of SOCs underlying SOCE. ORAI1-containing channels mediate I_CRAC in normal and tumor cells. Overexpression of ORAI1 and STIM1 is involved in increased SOCE and I_SOC in tumor cells. Consistently, ORAI1 silencing prevented SOCE in tumor cells. However silencing of either ORAI2 or ORAI3 had no significant effect on SOCE in colon carcinoma (HT29) cells. Meanwhile, TRPC1 channels are involved in the nonselective I_SOC but do not contribute to SOCE. Moreover, the low Ca²⁺ store content may, in turn, modulate the expression of the TRPC1 channel. For example, it has been shown that prolonged depletion of Ca²⁺ stores enhances TRPC1 expression and increases [Ca²⁺]_cyt responses to agonists without affecting SOCE (49). Silencing data are also consistent with the possibility of functional interactions between ORAI1 and TRPC1 channels. ORAI1 knockdown prevents mainly I_CRAC but also reduces significantly the outward component mediated by TRPC1. Conversely, TRPC1 silencing nearly abolishes outward I_SOC, but it also reduces significantly the extent of the inward component. Consistently, it has been shown that STIM1 may drive interactions between ORAI1 and TRPC1 (39, 50).

Our results pose the question regarding what is the role played by TRPC1 up-regulation in colon cancer. TRPC channel has been the subject of a long term controversy about its role as a SOC channel (33). In our experimental conditions, the nonselective I_SOC is likely mediated by TRPC1-containing channels. The most interesting matter is that, in human carcinoma colon cells, TRPC1 protein showed the largest change (up-regulation) together with STIM2 (down-regulation). Accordingly, these changes could represent the most critical events underlying Ca²⁺ remodeling and acquisition of cancer features. In support of this view, it has been reported that TRPC channels are overexpressed and regulate cell proliferation in human non-small cell lung, breast, liver, stomach, and glioma cancer (13, 51–54). The nonselective channel TRPC1 permeates Na⁺ and Ca²⁺, and consequently, it may have a role as a Ca²⁺ influx pathway or as a modulator of membrane potential. For instance, TRPC1 may control the driving force for Ca²⁺ influx during SOCE (55). Moreover, TRPC1 could support cell proliferation of tumor cells because one of its physiological roles is the modulation of the cell cycle progression through the regulation of cell volume (56). In addition, it has been reported recently that the interaction between STIM1 and TRPC1 is essential for cell migration after wounding in rat intestinal, epithelial cells (57). Moreover, it has been shown that the rise in STIM2 relative to STIM1 favors STIM1/STIM2 heteromers that suppress STIM1 translocation to the plasma membrane and its interaction with TRPC1 (57). Therefore, our finding that TRPC1/STIM2, STIM1/STIM2, and ORAI1/STIM2 ratios increase by 35-, 25-, and 13-fold, respectively, in colon cancer cells suggests that STIM2 depletion may enable STIM1 translocation to the plasma membrane and STIM1 interaction with TRPC1, providing an explanation for both enhanced SOCE and functional expression of an emergent, nonselective I_SOC in tumor cells. Further research is needed to ascertain more precisely the role of TRPC1 in colonic tumorigenesis.

What mechanisms are involved in the low level of Ca²⁺ store content in colon carcinoma cells? Ca²⁺ store content at the ER depends on the balance between Ca²⁺ uptake mediated by sarcoplasmic and ER Ca²⁺-ATPase pumps and Ca²⁺ exit through unknown leak channels (4). However, it has been reported that the level of [Ca²⁺] inside the ER is dictated actually by ER Ca²⁺ sensors STIM1 and STIM2 (35) that open Ca²⁺ channels at the plasma membrane to refill Ca²⁺ stores. However, STIM1 and STIM2 are not alike and show different affinities for Ca²⁺. STIM1 senses Ca²⁺ with high affinity and activates SOCE only after substantial depletion of Ca²⁺ stores (EC₅₀ ∼210 μm). In contrast, the STIM2 EF hand displays a low apparent affinity for Ca²⁺ (K_d ∼500 μm) and senses rather small decreases in [Ca²⁺] within the ER with an EC₅₀ of 406 μm (35). Accordingly, in normal mucosa cells expressing both STIM1 and STIM2, it is likely that Ca²⁺ levels inside the ER Ca²⁺ store are set by STIM2 that activates first when the Ca²⁺ store content falls below 500 μm. This view is consistent with the large Ca²⁺ store content found in normal cells where Stim2 is relatively more abundant. However, in tumor cells, STIM2 depletion may render STIM1 as the only Ca²⁺ sensor available. In this scenario, STIM1 could set Ca²⁺ levels within the ER close to 200 μm. Our finding that the STIM1/STIM2 ratio increases by 25-fold in tumor cells where Ca²⁺ stores remain substantially depleted is entirely consistent with this possibility. Our knockdown experiments also support this view. STIM2 knockdown in normal cells decreased Ca²⁺ store content in a significant manner. More importantly, STIM2 silencing induced apoptosis resistance to normal cells, thus confirming the important role of STIM2 loss in Ca²⁺ store emptying and enhanced cell survival.

Interestingly, down-regulation of STIM2 and Ca²⁺ store depletion may contribute to increase TRPC1 in tumor cells in another way. It has been reported that depletion of Ca²⁺ stores with thapsigargin increases TRPC1 protein levels without affecting SOCE (49). Thus, TRPC1 functional expression depends on the filling state of Ca²⁺ stores. This view is supported by a report showing that in Darier disease, a disorder of skin epithelia, a rare mutation that prevents operation of SERCA2 depletes Ca²⁺ stores, and this condition promotes a compensatory up-regulation of TRPC1 (58). Therefore, increased expression of TRPC1 and perhaps other SOCE components in colon cancer could be secondary to Ca²⁺ store depletion associated with the loss of STIM2.

Taken together, the above data suggest that the critical event in Ca²⁺ remodeling in colon cancer could be STIM2 protein down-regulation. As a cautionary note, we must acknowledge that our results are derived from comparison of a few normal and colon carcinoma cell lines that may not reflect entirely human colorectal carcinogenesis. Further research is required to test whether our results apply to other tumor cell lines and real tumor cells. However, in support of the potential relevance of STIM2 loss in colon cancer, recent data suggest that STIM2 is a tumor suppressor but the action mechanism is unknown. The STIM2 gene located at 4p15 has been recently identified as a candidate gene for tumorigenesis in glioblastoma multiforme (23) and colon cancer (22). Paradoxically, STIM2 transcript is actually overexpressed in 64% of all human colon cancers tested (22). However, these results are controversial because, as stated by the own authors, it is intriguing that a gene with a suppressor phenotype is so frequently overexpressed in colon cancer (22). It is worth noting, however, that STIM2 was tested only at the transcript level. Interestingly, STIM2 transcript, which is up-regulated also in prostate cancer, has been recently shown to be down-regulated during the transition from moderate to high Gleason grade (59). Thus, up-regulation of the mRNA level of STIM2 is not necessarily reflected as overexpression of the protein. In agreement, we show that STIM2 transcript is overexpressed in colon carcinoma (HT29) cells, although STIM2 protein is nearly lost in the same cells. Finally, it has also been reported recently that increases in STIM1/STIM2 ratios are associated with a poor prognosis in breast cancer (60).

In summary, we show here that human colon carcinoma cells show increased store-operated Ca²⁺ entry, enhanced and modified store-operated currents, and partially depleted Ca²⁺ stores relative to their normal counterparts. These changes correlate with increased cell proliferation, invasion, and survival characteristic of tumor cells. Finally, most changes can be explained by changes in molecular players involved in SOCE, particularly a reciprocal shift in TRPC1 and STIM2 expression, thus suggesting TRPC1 and STIM2 as novel targets for colorectal cancer. Further research is required to ascertain more precisely the role of these molecular players in colon carcinogenesis.