Skip to main content
PLOS One logoLink to PLOS One
. 2014 Nov 18;9(11):e112964. doi: 10.1371/journal.pone.0112964

Global Characterization of Differential Gene Expression Profiles in Mouse Vγ1+ and Vγ4+ γδ T Cells

Peng Dong 1, Siya Zhang 1, Menghua Cai 1, Ning Kang 1, Yu Hu 1, Lianxian Cui 1, Jianmin Zhang 1,2,*, Wei He 1,*
Editor: Domingos Henrique3
PMCID: PMC4236085  PMID: 25405356

Abstract

Peripheral γδ T cells in mice are classified into two major subpopulations, Vγ1+ and Vγ4+, based on the composition of T cell receptors. However, their intrinsic differences remain unclear. In this study, we analyzed gene expression profiles of the two subsets using Illumina HiSeq 2000 Sequencer. We identified 1995 transcripts related to the activation of Vγ1+ γδ T cells, and 2158 transcripts related to the activation of Vγ4+ γδ T cells. We identified 24 transcripts differentially expressed between the two subsets in resting condition, and 20 after PMA/Ionomycin treatment. We found that both cell types maintained phenotypes producing IFN-γ, TNF-α, TGF-β and IL-10. However, Vγ1+ γδ T cells produced more Th2 type cytokines, such as IL-4 and IL-5, while Vγ4+ γδ T cells preferentially produced IL-17. Our study provides a comprehensive gene expression profile of mouse peripheral Vγ1+ and Vγ4+ γδ T cells that describes the inherent differences between them.

Introduction

γδ T cells were discovered more than 30 years ago. Although considerable progress has been made in characterizing their biological significance, much remains unknown. γδ T cells arise earlier than αβ T cells during thymic ontogeny, predominately at the early stage of fetal development [1]. After birth, however, γδ T cells make up a minor fraction of circulating T lymphocytes in rodents and humans. Similar to αβ T cells, γδ T cells also have a diverse repertoire of T cell receptors (TCR) derived through somatic rearrangement of V, D and J gene segments. Although few V, D and J gene elements are responsible for genetic rearrangement, additional diversity is added to the γ and δ chains via junctional diversification processes [2].

γδ T cells exert diverse functions, however, individual subsets within the population appear to be biased toward specialized functions [1]. Mouse peripheral lymphoid γδ T cells are classified into two major subsets, Vγ1+ and Vγ4+ γδ T cells, depending on their TCR expression [1], [3], [4]. Vγ1+ and Vγ4+ γδ T cells perform distinct functions in many disease models. For example, Vγ1+ γδ T cells produce IL-4 and IFN-γ in the liver [5], and Vγ4+ γδ T cells produce IFN-γ or IL-17 depending on the studied models [6]. Vγ1+ and Vγ4+ γδ T cells function as oppositional pairs in diseases including coxsackievirus B3 infection [7], West Nile virus infection [4], airway hyperresponsiveness [8], [9], macrophage homeostasis [10] and ovalbumin induced IgE production [11]. However, the functional relatedness of Vγ1+ and Vγ4+ γδ T cells remains unresolved, partly due to a lack of comprehensive analysis and comparison of gene expression. Although, gene-expression profiles of emergent γδTCR+ thymocytes have been reported [12], a comprehensive analysis of peripheral Vγ1+ and Vγ4+ γδ T cells functional differences has not been reported. This is likely due to the limited number of cells that can be obtained from healthy mice.

In this study, we expanded Vγ1+ and Vγ4+ γδ T cells simultaneously from the same pool of mouse splenocytes. We comprehensively analyzed gene expression profiles using Illumina’s sequencing technology. We identified 1995 transcripts related to the activation of Vγ1+ γδ T cells, and 2158 transcripts were related to the activation of Vγ4+ γδ T cells. Interestingly, only 24 transcripts were differentially expressed between two subsets in resting condition, and 20 transcripts after PMA/Ionomycin-induced activation. Both cells produced high levels of IFN-γ, TNF-α, TGF-β and IL-10. However, Vγ1+ γδ T cells produced more Th2 type cytokines, while Vγ4+ γδ T cells tended to produce more IL-17. These findings describe the inherent differences between Vγ1+ and Vγ4+ γδ T cells.

Materials and Methods

Mice

Male C57BL/6J mice aged 6–8 weeks were purchased from the National Institute for Food and Drug Control. All mice were maintained under specific pathogen-free conditions in the Experimental Animal Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. All animal experiments were approved by and performed in accordance with the guidelines of the international Agency for Research on Cancer’s Animal Care and Use Committee and IBMS/PUMC’s Animal Care and Use Committee.

Expansion of Vγ1+ and Vγ4+ γδ T cells

Vγ1+ and Vγ4+ γδ T cells were expanded from splenocytes as described previously [13]. Briefly, flat-bottom 24 well plates were coated with 500µl purified anti-mouse TCRγ/δ antibody (UC7–13D5, 1µg/ml; Biolegend) at 37°C for 2 hours. Splenocytes were collected from six male C57BL/6J mice to decrease individual variation. Erythrocytes were lysed in Tris-NH4Cl buffer. Cells were then loaded onto a sterile nylon wool column, sealed and incubated at 37°C with 5% CO2 for 45 minutes. 5×107 cells were eluted and added to the Ab-coated wells (4×106 cells/well) and cultured in RPMI 1640 medium (Gibco BRL) supplemented with 10% fetal calf serum and IL-2 (200 IU/ml). After 8 days of expansion, the proportion of γδ T cells reached approximately 80% as determined by Flow Cytometry.

Cell sorting and stimulation

1.0×107 Vγ1+ and 1.2×107 Vγ4+ γδ T cells were sorted by Flow Cytometric Cell Sorting (FACS) with PE conjugated anti-mouse TCR Vγ1.1/Cr4 antibody (2.11, Biolegend) and APC conjugated anti-mouse TCR Vγ2 antibody (UC3–10A6, Biolegend). The purity of sorted cells was more than 99%. 5×106 cells per well were seeded into 6-well culture plates at a concentration of 1×106/ml and rested overnight at 37°C in 5% CO2 in RPMI with 10% FCS. Cells were stimulated for 4 h with PBS or 20 ng/ml of PMA (Sigma) and 0.5µg/ml of Ionomycin (Sigma). Cells were washed with PBS and pelleted by centrifugation. Total RNA from each sample was extracted by Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The quality of total RNA from each sample was confirmed and comparable, based on results of Agilent Technologies 2100 Bioanalyzer.

Processing samples for Illumina sequencing

We prepared the Illumina libraries according to the manufacturer’s instructions. Briefly, mRNAs were extracted from total RNA by mRNA enrichment kit (Life technologies, USA) followed by fragmentation of mRNA into 250–350 bp sizes. The first strand cDNAs were synthesized using reverse transcriptase and random primers. Second strand cDNAs were synthesized using DNA Polymerase I followed by the addition of a single A base at the ends for the ligation to the adapters. After purification, the final cDNA library was created by PCR. Finally, 400–500 bp products were used for cluster generation, 36 bp single-end sequencing was performed using Illumina HiSeq 2000 Sequencer according to the manufacturer’s instructions (Beijing Berry Genomics Co. Ltd. China). The RNA-Seq raw data files have been deposited in NCBI’s Sequence Read Archive (SRA) and are accessible through SRA Series accession number SRP042029.

Analysis of RNA-seq data

We performed base calling using CASAVA 1.7 software (Illumina). Low quality and polluted adapter reads were filtered; clean reads were stored on fastq files. The sequence reads were aligned to the mouse genome (mm9), and gene expression was calculated by RPKM value. Differentially expressed transcripts were identified using General Chi-square test analysis. Q values were obtained by the “BH” method [14]. NIH DAVID web server was used for the functional annotation clustering analysis of differentially expressed transcripts.

Quantitative RT-PCR

Several genes from Vγ1+ and Vγ4+ γδ T cells were selected for verification from biological replicates with real-time quantitative PCR. RNA was extracted as described above. 500 ng of total RNA was reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio). Gene-specific primers are listed in (Table 1). The real-time quantitative PCR was performed on the StepOnePlus Real-Time PCR System (Life Technologies) using SYBR green labeling (SYBR Premix Ex Taq II; Takara Bio). A cycle threshold (Ct) was assigned at the beginning of the logarithmic phase of PCR amplification and relative quantitation was done using the 2−ΔΔCt method. β-actin was used for normalization control.

Table 1. Gene-specific primers for real-time quantitative PCR.

Specificity Primer orientation Sequence (5′ → 3′)
IL-4 Forward ACGGAGATGGATGTGCCAAAC
Reverse AGCACCTTGGAAGCCCTACAGA
IL-5 Forward TGAGGCTTCCTGTCCCTACTCATAA
Reverse TTGGAATAGCATTTCCACAGTACCC
IL-17A Forward CTGATCAGGACGCGCAAAC
Reverse TCGCTGCTGCCTTCACTGTA
IL-17F Forward ATGAAGTGCACCCGTGAAACAG
Reverse CTCAGAATGGCAAGTCCCAACA
SCART 2 Forward GGATCAGGGCCTTTGTGGA
Reverse TGCCATTGACCAGTCGGAAC
beta-actin Forward CATCCGTAAAGACCTCTATGCCAAC
Reverse ATGGAGCCACCGATCCACA

Cytokines

Cells were stimulated 4 h with PBS or PMA and Ionomycin then pelleted by centrifugation. Determined cytokine concentration in cell-free supernatants by enzyme linked immunosorbent assay (ELISA; R&D Systems) as described previously [15] and MILLIPLEX MAP Mouse Cytokine Kit (MT17MAG47 K–PX25; Merck Millipore) according to the manufacturer’s instructions.

Results

Expansion and isolation of Vγ1+ and Vγ4+ γδ T cells from mouse splenocytes

γδ T cells account for approximately 1∼2% of total splenocytes in healthy mice and Vγ1+ and Vγ4+ γδ T cells comprised approximately 35% and 25% respectively (Figure 1A). Therefore, we expanded the cells from mouse spleens in vitro for RNA-seq analysis. Although Vγ1+ and Vγ4+ γδ T cells can be expanded separately with sorted splenic γδ T cells using anti-Vγ1 and anti-Vγ4 Abs [16], [17], potentially important biological interactions between the subsets during culture would be neglected. We therefore established a primary culture method to expand the cells simultaneously from the same pool of mouse splenocytes with pan anti-mouse TCR γδ antibodies (UC7–13D5) and IL-2. After 8 days of expansion, the proportion of γδ T cells reached approximately 80%, Vγ1+ and Vγ4+ γδ T cells comprised approximately 40% and 30% of the expanded cells, respectively (Figure 1B). No significant change was observed in the ratio of γ1 cells to γ4 cells in the in vitro expanded γδ T cells when compared with that of freshly isolated γδ T cells (in vivo subsets). γδ T cells were not screwed to one preferential subset after in vitro expansion, suggesting that in vitro expanded γδ T cells with anti-mouse TCRγδ antibodies plus IL-2 were still representative of in vivo subsets of γδ T cells. Expanded Vγ1+ and Vγ4+ γδ T cells were then sorted by FACS with PE-conjugated anti-mouse TCR Vγ1.1/Cr4 antibody and APC conjugated anti-mouse TCR Vγ2 antibody. We found the purities of sorted Vγ1+ and Vγ4+ γδ T cells were more than 99% (Figure 1B).

Figure 1. Vγ1+ and Vγ4+ γδ T cells are the major subpopulations in the spleen.

Figure 1

(A) γδ T cells account for approximately 1.5% of total splenocytes. Isolated fresh Vγ1+ and Vγ4+ γδ T cells comprised approximately 35% and 25% of γδ T cells respectively. (B) 1.5×108 cells were expanded simultaneously from a single pool of mouse splenocytes with purified pan anti-mouse TCR γδ antibody (UC7–13D5). After 8 days, Vγ1+ and Vγ4+ γδ T cells comprised approximately 40% and 30% of the expanded cells, respectively. 1.0×107 Vγ1+ γδ T cells were sorted by FACS with PE conjugated anti-mouse TCR Vγ1.1/Cr4 antibody and 1.2×107 Vγ4+ γδ T cells were sorted by FACS with APC conjugated anti-mouse TCR Vγ2 antibody. Purity of sorted cells was >99%. Data are representative of four independent experiments.

cDNA library preparation for RNA sequencing from resting and activated Vγ1+ and Vγ4+ γδ T cells

In order to compare gene expression profiles between subsets in both the resting and activated state, sorted cells were rested overnight at 37°C then stimulated 4 h with either PBS (control) or 20 ng/ml of PMA+0.5 µg/ml of Ionomycin (activated) before mRNA extraction and fragmentation. After cDNA synthesis, adapter ligation and PCR amplification, four cDNA libraries were constructed for the resting and activated γδ T cell subsets. 400–500 bp-sized products were used for cluster generation and 36 bp single-end sequencing was performed by using Illumina HiSeq 2000 Sequencer. Approximately 28 million clean reads were obtained from each sample. More than 88% of reads were mapped to the mouse genome using the default setting in TopHat, suggesting high quality of RNA-seq (Table 2). Cufflinks with default settings were used to assemble the mapped reads against the ENSEMBL gene structure annotation, and estimated expression levels for each transcript. More than 18,286 genes were detected. 25.4–26.1% of genes showed expression levels changed by at least four fold while the majority of genes changed less than four fold (Figure 2, Dataset S1).

Table 2. Sequencing reads and mapping rates of each sample.

Sample Info Total Reads Mapped Reads Ratio
γ1-PBS 22,672,055 20,190,322 89.05%
γ1-PMA/Ion 28,235,208 24,381,541 86.35%
γ4-PBS 33,529,245 29,854,538 89.04%
γ4-PMA/Ion 34,338,657 30,274,218 88.16%

γ1-PBS, Vγ1+ γδ T cells treated with PBS; γ1-PMA/Ion, Vγ1+ γδ T cells treated with PMA and Ionomycin; γ4-PBS, Vγ4+ γδ T cells treated with PBS; γ4-PMA/Ion, Vγ4+ γδ T cells treated with PMA and Ionomycin.

Figure 2. The distribution of gene expression.

Figure 2

The ‘x’ axis represents Log fold-change of differentially expressed genes. The ‘y’ axis represents number of genes. Red region represents genes with expression within 4-fold change; green and blue regions represent genes with more than 4-fold change either up or down regulated, respectively. Library pairs: A, resting Vγ1+ vs activated Vγ1+ γδ T cells; B, resting Vγ4+ vs activated Vγ4+ γδ T cells.

Differential gene expression between Vγ1+ and Vγ4+ γδ T cells

RNA-seq results show Vγ1+ and Vγ4+ γδ T cells share similar transcript profiles in both the resting and activated subsets. We identified 24 transcripts with differential expression between the resting Vγ1+ and Vγ4+ γδ T cells (Table 3). We used the Database for Annotation, Visualization and Integrated Discovery (DAVID), an on-line functional annotation tool for gene enrichment analysis, to gain further insight into biological pathways associated with the differentially expressed gene transcripts. We found most of the differentially expressed genes in the resting subsets related to chemokines, transcription and the plasma membrane (Table 3). Resting Vγ1+ γδ T cells expressed higher levels of XCL1 and CCL1 compared with Vγ4+ γδ T cells, suggesting Vγ1+ γδ T cells possess higher chemotactic activity for lymphocytes and monocytes. Vγ4+ γδ T cells displayed higher levels of Rorc, Sox13 and Scart2 expression. In addition, high levels of Bclaf1 and Atf2 were expressed in Vγ4+ γδ T cells while Arnt2, Hmga1 and Zfp386 were preferentially expressed in Vγ1+ γδ T cells.

Table 3. 24 transcripts expressed differently between resting Vγ1+ and Vγ4+ γδ T cells.

Category GN AN γ1 RPKM γ4 RPKM Gene function
Chemokine
XCL1 NM_008510 340.582 59.158 Chemotactic activity
CCL1 NM_011329 84.8039 11.7718 Chemotactic activity
Transcription
*BCLAF1 NM_001025392 0.10265 8.85303 Transcriptional repressor
RORC NM_011281 0.0844492 0.761408 Orphan nuclear receptor
SOX13 NM_011439 0.909818 4.99875 Ttranscription factor
*ATF2 NM_009715 0.702722 4.69872 Transcriptional activator
*ARNT2 NM_007488 0.799234 0.135113 Recognizes xenobiotic response element (XRE)
*HMGA1 NM_001039356 5.3784 0.84425 Regulation of inducible gene transcription
*ZFP386 NM_019565 20.4163 0.927052 Transcriptional regulation
Plasma membrane
*CD74 NM_001042605 3.99813 0.540024 Antigen processing
*CTC1 NM_001013256 0.062176 6.89298 Uncharacterized
*ABI1 NM_145994 0.0359843 6.83637 Cytoskeletal reorganization and EGFR signaling
*CACNB3 NM_001044741 0.410331 4.17596 The beta subunit of calcium channels
*SYT13 NM_183369 1.88579 0.141228 Vesicle trafficking
*SLC17A6 NM_080853 0.80135 0.0264333 Mediates the uptake of glutamate
*TMEM219 NM_028389 0.071877 43.5973 Unknown
Miscellaneous
SCART2 NM_175533 0.22478 3.02098 Scavenger receptor
*SENP7 NM_001003972 0.178749 7.79658 Protease
*ENTPD5 NM_007647 8.35339 0.00516434 Promote reglycosylation
*FAR1 NM_026143 0.900286 6.64512 Fatty Acyl CoA Reductase 1
*GOLGA2 NM_133852 0.942965 7.61176 Maintaining cis-Golgi structure
*ITIH5 NM_172471 2.98889 0.530132 Tumor suppressor
*PPHLN1 NM_001083114 4.76635 0.114948 Epidermal integrity and barrier formation
*BC003331 NM_001077237 5.03977 0.527241 LAG1-Interacting Protein

GN, Gene name; AN, Accession Number; γ1 RPKM, the RPKM value of gene in resting Vγ1+ γδ T cells; γ4 RPKM, the RPKM value of gene in resting Vγ4+ γδ T cells; “*”, Gene’s alternatively spliced transcript variants.

In the PMA/Ionomycin-activated Vγ1+ and Vγ4+ γδ T cells, we found 20 differentially expressed genes, most of which are related to cytokines, cell differentiation, transcription and translation (Table 4). Activated Vγ1+ γδ T cells expressed higher levels of IL-4 and IL-5. Vγ4+ γδ T cells secreted more IL-17A and IL-17F. Alternatively spliced transcript variants Smurf1, Pphln1, Ilf3 and Sema6d were preferentially expressed in Vγ4+ γδ T cells. Vγ1+ γδ T cells preferentially expressed Bcl11b, Hmga1 and a second spliced transcript variant of Sema6d. These results taken together indicate that a very small number of genes are sufficient to define the characteristics of these two subsets of γδ T cells.

Table 4. 20 transcripts expressed differently between activated Vγ1+ and Vγ4+ γδ T cells.

Category GN AN γ1 RPKM γ4 RPKM Gene function
Cytokine
IL-17A NM_010552 0.360943 5.13468 Inflammation
IL-17F NM_145856 0.0597255 2.86449 Inflammation
IL −4 NM_021283 3.25878 0.126145 B-cell activation
IL- 5 NM_010558 3.89427 0.355691 Differentiation of late-developing B-cells
Cell differentiation
*BCL11B NM_021399 0.980076 0.0949643 Regulator of thymocyte development
SCART2 NM_175533 0.064865 0.562434 Scavenger receptor
*SMURF1 NM_029438 0.00711406 6.66404 E3 ubiquitin-protein ligase
*PPHLN1 NM_175363 0.0117361 8.20294 Epidermal integrity and barrier formation
*SEMA6D NM_199238 0.18461 6.73579 Neuronal connections
*SEMA6D NM_199240 3.96619 0.503894 Neuronal connections
Transcription/Translation
*HMGA1 NM_001039356 5.04288 0.0149135 Regulation of inducible gene transcription
*ILF3 NM_001042707 0.0338755 6.4809 Regulate gene expression
*ZFP692 NM_001040686 0.0424843 5.96934 Transcriptional regulation
*GM5633 XM_001480560 27.59 0.0958007 mRNA turnover and ribosome assembly
*TXNL4A NM_001042408 0.577893 19.5602 Pre-mRNA splicing
Miscellaneous
*DCUN1D2 NM_001042651 0.459734 3.03555 DCN1-Like Protein 2
*GNAS NR_003258 23.7675 2.81557 G protein α subunit
*CEACAM1 NM_001039186 0.870669 0.0859013 Immunoglobulin per family
*NOLC1 NM_001039353 2.11695 18.0875 Lipid transporter activity
*PLEC NM_201392 0.00166738 1.77384 Intermediate Filament Binding Protein
*SYTL3 NM_183369 0.146591 4.75764 Vesicle trafficking

GN, Gene name; AN, Accession Number; γ1 RPKM, the RPKM value of gene in activated Vγ1+ γδ T cells; γ4 RPKM, the RPKM value of gene in activated Vγ4+ γδ T cells; “*”, Gene’s alternatively spliced transcript variants.

Validation of differentially expressed genes in Vγ1+ and Vγ4+ γδ T cells

We measured expression levels in both subsets by PCR to verify whether the genes identified via RNA-sequencing were differentially expressed in Vγ1+ and Vγ4+ γδ T cells. Several genes from both subsets were randomly selected for verification (Figure 3). Consistent with the RNA-seq results, Scart2 mRNA was only detectable in Vγ4+ γδ T cells (Figure 3E). Real-time quantitative PCR confirmed that expression levels of IL-4 and IL-5 mRNA were significantly higher in PMA/Ionomycin-activated Vγ1+ γδ T cells compared with activated Vγ4+ γδ T cells (Figure 3A and 3B), whereas the expression levels of IL-17A and IL-17F mRNA were significantly higher in activated Vγ4+ γδ T cells (Figure 3C and 3D). ELISA results confirmed that IL-4 was mainly expressed in activated Vγ1+ γδ T cells whereas IL-17 was predominately expressed in activated Vγ4+ γδ T cells (Figure 4A and 4B). Together, all of the genes randomly selected for expression analysis were consistent with RNA-seq results, confirming differential expression in Vγ1+ and Vγ4+ γδ T cells.

Figure 3. Gene verification with real-time quantitative PCR.

Figure 3

Several genes from Vγ1+ and Vγ4+ γδ T cells were selected for verification against biological replicates using real-time quantitative PCR (A-E). Expression data for each gene were normalized against β-actin. Data shown are the means ± SD (error bars). (* p≤0.05, ** p≤0.01, *** p≤0.001, unpaired two-tailed Student’s t-test). Data are representative of three independent experiments.

Figure 4. Cytokine expression.

Figure 4

ELISA results of (A) IL-4 and (B) IL-17 after PBS or PMA and Ionomycin treatment. MILLIPLEX results of (C) TNF-α, (D) IL-2 and (E) IFN-γ after PBS or PMA and Ionomycin treatment. Data shown are mean ± SD (error bars). (* p≤0.05, ** p≤0.01, *** p≤0.001, unpaired two-tailed Student’s t-test). Data are representative of three independent experiments.

Gene expression in the resting compared with PMA/Ionomycin-activated state

PMA/Ionomycin treatment induces a robust non-TCR mediated response in γδ T cells [18]. As expected, we found both Vγ1+ and Vγ4+ γδ T cells responded robustly to PMA/Ionomycin treatment, as reflected in the total number of genes that significantly changed in each subset. 1,995 transcripts were differentially expressed between the resting and activated Vγ1+ γδ T cells, with 560 up-regulated and 1435 down-regulated genes (q<0.05) (Figure 5A, Dataset S2). 2,158 transcripts were differentially expressed between resting and activated Vγ4+ γδ T cells, with 622 up-regulated and 1536 down-regulated genes (q<0.05) (Figure 5A,Dataset S3). For a global perspective on gene dynamics, two heat maps of the 1,995 and 2,158 differentially expressed gene transcripts were generated using hierarchical clustering analysis (Figure 5B).

Figure 5. Changes in gene expression profile among Vγ1+ and Vγ4+ γδ T cells.

Figure 5

(A) The number of up and down regulated genes between resting and activated Vγ1+ and Vγ4+ γδ T cells. (B) Heat maps of 1,995 (Vγ1+) and 2,158 (Vγ4+) differentially expressed transcripts associated with activated cells using hierarchical clustering analysis. γ1 vs γ1 T, resting Vγ1+ vs activated Vγ1+ γδ T cells; γ4 vs γ4T, resting Vγ4+ vs activated Vγ4+ γδ T cells; RPKM, Reads Per Kilo bases per Million reads.

DAVID functional annotation clustering analysis showed the 1,995 transcripts identified via activation of Vγ1+ γδ T cells were enriched for 32 KEGG pathways (p<0.05) (Table 5). 2,158 transcripts identified via activation of Vγ4+ γδ T cells were enriched for 29 KEGG pathways (p<0.05) (Table 6). Our comparison of the KEGG pathways between the two subsets showed they share most of the same signal pathways including cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, hematopoietic cell lineage, apoptosis, and pathways in cancer. Interestingly, both Vγ1+ and Vγ4+ γδ T cells showed connections to the intestinal immune network for IgA production, biosynthesis of unsaturated fatty acids, glycosphingolipid biosynthesis, glutathione metabolism, and purine and pyrimidine metabolism.

Table 5. Significantly changed genes between resting and activated Vγ1+ γδ T cells enriched for KEGG pathways.

Term Count P-Value
Cytokine-cytokine receptor interaction 45 1.50E-05
Jak-STAT signaling pathway 29 3.80E-04
Hematopoietic cell lineage 19 6.80E-04
Glutathione metabolism 14 8.20E-04
Apoptosis 19 1.10E-03
Intestinal immune network for IgA production 14 1.20E-03
Prostate cancer 19 1.60E-03
Small cell lung cancer 18 2.10E-03
Pathways in cancer 46 4.40E-03
p53 signaling pathway 15 4.40E-03
Bladder cancer 11 4.70E-03
Glycosphingolipid biosynthesis 8 5.40E-03
Pyrimidine metabolism 18 7.80E-03
Endometrial cancer 12 8.10E-03
Arrhythmogenic right ventricular cardiomyopathy 15 9.50E-03
Natural killer cell mediated cytotoxicity 21 9.80E-03
One carbon pool by folate 6 1.30E-02
Type I diabetes mellitus 13 1.30E-02
Colorectal cancer 16 1.40E-02
Melanoma 14 1.40E-02
Glioma 13 1.50E-02
Allograft rejection 12 1.80E-02
Chemokine signaling pathway 27 2.00E-02
Phosphatidylinositol signaling system 14 2.20E-02
ABC transporters 10 2.30E-02
Non-small cell lung cancer 11 2.80E-02
Asthma 8 3.10E-02
Insulin signaling pathway 21 3.40E-02
Biosynthesis of unsaturated fatty acids 7 3.70E-02
Fc gamma R-mediated phagocytosis 16 4.10E-02
Graft-versus-host disease 11 4.30E-02
ECM-receptor interaction 14 4.60E-02

Database for Annotation, Visualization and Integrated Discovery (DAVID), was used to analyze biological pathways associated with the differentially expressed gene transcripts. 1,995 transcripts that were identified to be related to the activation of Vγ1+ γδ T cells were enriched for 32 KEGG pathways (p<0.05). KEGG, Kyoto Encyclopedia of Genes and Genomes.

Table 6. Significantly changed genes between resting and activated Vγ4+ γδ T cells enriched for KEGG pathways.

Term Count P-Value
Cytokine-cytokine receptor interaction 50 1.00E-06
Biosynthesis of unsaturated fatty acids 10 8.50E-04
Hematopoietic cell lineage 19 1.30E-03
Intestinal immune network for IgA production 14 2.00E-03
Jak-STAT signaling pathway 28 2.00E-03
Pathways in cancer 49 2.90E-03
Prostate cancer 19 3.00E-03
Small cell lung cancer 18 3.90E-03
Colorectal cancer 18 4.40E-03
Arrhythmogenic right ventricular cardiomyopathy 16 6.50E-03
Glycosphingolipid biosynthesis 8 7.30E-03
p53 signaling pathway 15 7.40E-03
Dilated cardiomyopathy 18 8.80E-03
Apoptosis 17 1.10E-02
Endometrial cancer 12 1.20E-02
Chemokine signaling pathway 29 1.30E-02
Non-small cell lung cancer 12 1.60E-02
One carbon pool by folate 6 1.70E-02
Melanoma 14 2.20E-02
Glioma 13 2.30E-02
Amyotrophic lateral sclerosis (ALS) 12 2.40E-02
Pyrimidine metabolism 17 2.80E-02
Glutathione metabolism 11 3.10E-02
Toll-like receptor signaling pathway 17 3.60E-02
Chronic myeloid leukemia 14 3.70E-02
Purine metabolism 24 3.90E-02
Regulation of actin cytoskeleton 31 4.10E-02
Endocytosis 29 4.50E-02
Type I diabetes mellitus 12 4.60E-02

Database for Annotation, Visualization and Integrated Discovery (DAVID), was used to analyze biological pathways associated with the differentially expressed gene transcripts. 2,158 transcripts that were identified to be related to the activation of Vγ4+ γδ T cells were enriched for 29 KEGG pathways (p<0.05). KEGG, Kyoto Encyclopedia of Genes and Genomes.

We analyzed the expression levels of some common representative markers in resting Vγ1+ and Vγ4+ γδ T cells (Table 7). Both subsets expressed high levels of the β and γ chains in the cytokine receptor genes IL-2R, IL-7R and interferon gamma receptor 1. We measured medium expression levels of interferon (alpha and beta) receptor 1 and 2, α and β chains of IL-10R, IL-18 receptor 1, IL-18 receptor beta, IL-21R, α chain of IL-27R, beta receptor II of transforming growth factor and IL-4R. Both Vγ1+ and Vγ4+ γδ T cells expressed high levels of TGF-β, known to down-regulate immune response and a key regulator of T cell and Th17 differentiation [19][21]. Additionally, both Vγ1+ and Vγ4+ γδ T cells expressed IL-16. In contrast, IFN-γ, TNFα and LTA were expressed at relatively low levels during the resting condition. Several conventional T cell surface antigens were highly expressed in Vγ1+ and Vγ4+ γδ T cells, including CD2, CD3, CD7, CD27, CD37, CD47, CD48, CD52, CD53, CD82 and CD97. However, some surface markers, including CD25, CD44, and CD69 were expressed at low levels.

Table 7. Expression levels for specific genes identified by RNA-seq in both resting Vγ1+ and Vγ4+ γδ T cells.

Expression levels
Category ++++ +++ ++ +
Cytokine/chemokine/similar
CCL4 XCL1 CCL1 CCR1
CCL5 Il16 CCL3 CCR10
CCR2 Ifnar1 CCR7 CCR4
CCR5 Ifnar2 CXCR4 CCR8
CXCR3 Il10ra Csf1 CCRk
CXCR6 Il10rb Ifng CCRl2
Il2rb Il18RAP Tnf Il18
Il7R Il21r Lta Tgfb
Ifngr1 Il27ra Il12rb1 Il11ra1
Il2rg Il4ra Il15ra Il15ra
Tgfb1 TnfrSF1B Il3ra Il17rd
Tgfbr2 Ifnar1 Il1rap
Il18r1 Il20rb
Il4i1
Surface antigens
Cd2 Cd164 Cd1d1 Cd1d2
Cd27 Cd247 Cd226 Cd200
Cd37 Cd96 Cd244 Cd320
Cd3d CTLA4 Cd274 Cd38
Cd3e Cd28 Cd3eap
Cd3g Cd5 Cd55
Cd47 Cd6 Cd63
Cd48 Cd68 Cd69
Cd52 Cd72 Cd74
Cd53 Cd79b Cd79a
Cd7 Cd80 Cd81
Cd82 Cd84 Cd93
Cd97 Cd8a
Cd8b1
Cd9
Cd25
Cd44
Cd62L
NK cell related
Klrc1; NKG2A KLRK1; NKG2D Klrb1c; NKRP1A
KLRD1; CD94 Klrc2; NKG2C
Cd160; BY55 Klrc3; NKG2E
Integrin
ITGB7; Ly69 ITGA4; Cd49D ITGAX; Cd11c ITGAD; Cd11d
ITGB2; Cd18 ITGB3; Cd61 ITGAM; Cd11b ITGA6; Cd49f
ITGAL; Cd11a ITGAV; Cd51 ITGA3; Cd49C
ITGAE; Cd103 ITGA2; Cd49b
ITGB1; Cd29 ITGB5
Miscellaneous
Gzma Gzmc Fasl Tlr1
Gzmb Gzmk Tlr12
Tlr6

According to the expression abundance, transcripts with RPKM value over 1 were divided into 4 categories: “+” (1–10 RPKM), “++”(10–50 RPKM), “+++” (50–100 RPKM), and “++++”(>100 RPKM). RPKM, Reads Per Kilo bases per Million reads.

Resting Vγ1+ and Vγ4+ γδ T cells expressed high levels of Fas ligand and the granzymes Gzma and Gzmb. NK cells associated receptors including NKG2A, CD94 and NKG2D were also highly expressed by both resting subsets (Table 7). Interestingly, several integrins were highly expressed including Itgb7 (Ly69), Itgb2 (Cd18), Itgal (Cd11a), Itgae (Cd103) and Itgb1 (Cd29) (Table 7). However, none of the TLRs showed high expression levels in either subset. In fact, TLR1, TLR6 and TLR12 were the only three detected, and with very low expression levels.

PMA/Ionomycin treatment activates Vγ1+ and Vγ4+ γδ T cells, upregulating T cell activation markers CD25, CD69 and CD44 along with several cytokines. Therefore, we analyzed the expression of these representative markers in activated Vγ1+ and Vγ4+ γδ T cells. As expected, PMA/Ionomycin treatment induced expression of XCL1, CCL3, CCL4, CCL1, IFN-γ, Lta, Csf2, TNF-α, IL-2, Gzmb and Gzmc (Table 8). MILLIPLEX results further confirmed that both Vγ1+ and Vγ4+ γδ T cells produced high levels of TNF-α, IL-2 and IFN-γ after PMA/Ionomycin treatment (Figure 4C, 4D and 4E). This is consistent with the hypothesis that γδ T cells acquire a pre-activated status poised to actively transcribe genes related to effector functions. Interestingly, IL-10, a Th1 cytokine down-regulator, was also highly expressed by both Vγ1+ and Vγ4+ γδ T cells (Table 8).

Table 8. Expression levels of significantly changed genes identified by RNA-seq in both Vγ1+ and Vγ4+ γδ T cells after PMA/Inomycin treatment.

Expression levels
Category ++++ +++ ++ +
Cytokine/chemokine/similar
XCL1 CCL9 CXCR3 CXCL14 CXCR4
CCL3 Tnfsf11 CCR2 CCR7 CCR8
CCL4 Il2 Il13 Ifngr1 CCR10
CCL1 Tnfrsf8 Tnfrsf12a Tnfaip8l2 CX3CR1
Ifng Tnfsf9 Ifnar1 Il10rb Tnfrsf11b
Tnfrsf9 Vegfa Il1rl1 Tnfrsf23
Lta Il1r2 Tnfrsf26
Csf2 Ifnar2 Tgfb1i1
Tnfa Il16 Il11ra1
Tnfsf14 Il10ra Tnfrsf13c
Tnfrsf4 Il1rap Tnfsf12
Il10 Il7r Il17rd
Il1rl1 il-18
Il33
Tnfaip8l1
Surface antigens
Cd44 Cd274 Cd63 Cd83 Cd1d1
Cd25 Cd7 Cd96 Cd24a Cd200r1
Cd69 Cd320 Cd79b Cd79a
Cd70 Cd93 Cd1d2
Cd200r4
Cd55
NK cell related
KLRD1 Klrb1c Klrb1d
Miscellaneous
Gzmb Gzme Gzmk Tlr1
Gzmc Gzmf Tlr6
Tlr12

According to the expression abundance, transcripts were divided into 5 categories: “−” (<1 RPKM), “+” (1–10 RPKM), “++”(10–50 RPKM), “+++” (50–100 RPKM), and “++++”(>100 RPKM). RPKM, Reads Per Kilo bases per Million reads.

We analyzed the expression levels of transcription factors related to Th cell differentiation and cytokine secretion (Dataset S4). Both Vγ1+ and Vγ4+ γδ T cells expressed high levels of Gata3, T-bet, Eomes, Foxp1, Stat1, Stat3, Stat4, Stat5a, Stat5b, Stat6, Runx3, Irf1, Ikzf1, Ikzf3, Ets1, Junb and Batf at resting condition. After PMA/Ionomycin treatment, the expression levels of Stat5a and Irf4 were upregulated significantly. The expression levels of T-bet, Eomes, Foxp1, Stat5b, Gfi1 and Junb were upregulated slightly. Interestingly, the expression levels of Gata3, Irf4 and Gfi1 were slightly higher in Vγ1+ γδ T cells than Vγ4+ γδ T cells after PMA/Ionomycin treatment.

Taken together, these findings indicate that both Vγ1+ and Vγ4+ γδ T cells maintain phenotypes producing IFN-γ, TNFα, TGF-β and IL-10. However, Vγ1+ γδ T cells tend to produce Th2 type cytokine while Vγ4+ γδ T cells preferentially produce IL-17 (Figure 6).

Figure 6. Cytokines secreted by Vγ1+ and Vγ4+ γδ T cells.

Figure 6

Both subsets of γδ T cells produce IFN-γ, TNFα, TGF-β and IL-10. Vγ1+ γδ T cells tend to produce Th2 type cytokines IL-4 and IL-5 while Vγ4+ γδ T cells tend to produce IL-17.

Discussion

Phylogenetic analysis suggests γδ T cells are precursors to modern B and αβ T cells [22]. γδ T cells are divided into subsets based on composition of T cell receptors. Interestingly, γδ T cell subsets demonstrate bias in carrying out particular functions [1]. Previously, Jutila et al. analyzed gene expression profiles of bovine CD8+ and CD8 γδ T cells using microarray and serial analysis of gene expression (SAGE) technology. They concluded inherent gene expression differences in subsets defined their distinct functional responses [23], [24]. In addition, Kress et al. found considerable inherent differences in gene expression among subsets of post PMA/Ionomycin or LPS treatment of circulating Vδ1 and Vδ2 subsets in humans [18].

Vγ1+ and Vγ4+ γδ T cells are major subpopulations of peripheral γδ T cells in mice. Although global gene expression profiles of all emergent γδ thymocyte subsets have been reported by the Immunological Genome (ImmGen) Project and much knowledge has been obtained about the early divergence of gene expression programs between different γδ thymocyte subsets [12], a comprehensive gene expression profiles analysis of peripheral Vγ1+ and Vγ4+ γδ T cells isn’t available. A major hurdle has been the limited number of cells that can be obtained from healthy mice.

In this study, we resolved the limited cell count issue by establishing a primary culture method expanding Vγ1+ and Vγ4+ γδ T cells simultaneously from a single pool of mouse splenocytes. Our results proved that in vitro TCR-induced expansion for a week did not significantly change the proportion of Vγ1+ and Vγ4+ γδ T cells. We provide a comprehensive gene expression profile of mouse peripheral Vγ1+ and Vγ4+ γδ T cells in the resting and activated state. Although Vγ1+ and Vγ4+ γδ T cells share similar transcript profiles, we identified subset specific genes defining characteristics of each subset.

We identified 24 transcripts differentially expressed in resting Vγ1+ and Vγ4+ γδ T cells, and 20 transcripts differentially expressed after PMA/Ionomycin treatment. Consistent with γδ thymocytes, expression levels of Rorc, Sox13 and Scart2 were higher in Vγ4+ γδ T cells compared with Vγ1+ γδ T cells [12]. Rorc expression is reported in γδ T cells, Th22 cells, NKT cells, CD4+ CD8+ thymocytes, and others that do not belong to the T or B cell lineage [25][28]. Rorc is recognized as a lineage-specific transcription factor of Th17 and is also required for IL-17 production [29]. Transcription factor Sox13 serves a general role in the differentiation of γδ T cells [30]. Moreover, Gray et al. reported that Sox13 was indispensable for the maturation of Vγ4+ Th17 cells [31], [32]. Scavenger receptor Scart2 is a marker of γδ T cells prepared to secrete IL-17A [12], [31], [33], [34]. Our data showing Vγ4+ γδ T cells compared with Vγ1+ γδ T cells produce significantly more IL-17A and IL-17F after PMA/Ionomycin treatment are also consistent with findings in γδ thymocytes [12]. Our findings show Vγ1+ γδ T cells produce significantly more IL-4 and IL-5 after PMA/Ionomycin treatment compared with Vγ4+ γδ T cells. This finding is consistent with earlier reports showing Vγ1+ γδ T cells preferentially produce IL-4, and the depletion of Vγ1+ subset cells increases host resistance against Listeria monocytogenes infection [35]. It is important to note that Vγ1+ γδ T cells suppress Vγ4+ γδ T cell mediated antitumor function through IL-4 [36].

Alternative splicing plays an important role in increasing functional diversity of eukaryotes. Compared with the ImmGen Project, one of the advantages of RNA-seq is able to quantify individual transcript isoforms and identify differentially expressed transcripts between Vγ1+ and Vγ4+ γδ T cells. We found Bclaf1 and Atf2 were preferentially expressed in Vγ4+ γδ T cells while Hmga1 and Bcl11b were preferentially expressed in Vγ1+ γδ T cells. As a transcriptional repressor, Bclaf1 interacts with several members of the Bcl2 protein family and plays a role in the regulation of apoptosis and DNA repair [37], [38]. Bclaf1 also plays an important role in lymphocyte homeostasis and activation [39]. Atf2 transcription factor is a member of the leucine zipper family of DNA binding proteins and forms a homodimer or a heterodimer with c-Jun, stimulating cAMP responsive element (CRE) dependent transcription. Atf2 expression is lower in CD8+ T cells compared with CD4+ T cells, a functional explanation to the differential response to glucocorticoids between CD8+ and CD4+ T cells [40]. As an architectural chromatin factor, Hmga1 binds preferentially to the minor groove of AT rich regions in double stranded DNA. It is involved in many cellular processes including regulation of inducible gene transcription, insulin resistance, diabetes and malignant transformation [41], [42]. Nakao et al. revealed a new role for Hmga1 in transcriptional silencing in T cell lineages and leukemic cells [43]. However, the roles of Bclaf1, Atf2 and Hmga1 in γδ T cells have not been reported. Bcl11b is a T-cell specific gene and required for T-lineage commitment. Aberrant expression of Bcl11b contributes to human T-ALL [44]. In contrast with ImmGen Project results showing Bcl11b was preferentially expressed in Vγ4+ γδ thymocytes [12], we identified one transcript isoform of Bcl11b preferentially expressed in activated Vγ1+ γδ T cells. The role of the transcript isoform of Bcl11b in Vγ1+ γδ T cells needs further study.

Many of the differentially expressed gene transcripts identified in activated Vγ1+ and Vγ4+ γδ T cells shared similar signaling pathways. We found higher expression of IL-4 and IL-5 in activated Vγ1+ γδ T cells. This suggests a role in asthma given that Vγ4+ γδ T cells suppress airway hyperresponsiveness, compared with Vγ1+ γδ T cells that enhance airway hyperresponsiveness and raise levels of Th2 cytokines and eosinophils infiltration in the airways [8], [9], [45].

Both resting Vγ1+ and Vγ4+ γδ T cells exhibited high levels of transcripts for several chemokines and chemokine receptors, including CCL4, CCL5, CCR2, CCR5 and CXCR3. These data highlight the role of Vγ1+ and Vγ4+ γδ T cells in immunoregulatory and inflammatory processes. For example, CCL4 (MIP-1beta) and CCL5 (RANTES) are both Th1-associated chemokines that bind to CCR5. Up-regulation of CCR5 ligands may play a role in the recruitment process of blood monocytes, memory T helper cells and eosinophils. CCR2 is expressed on both Vγ1+ and Vγ4+ γδ T cells, and is necessary for the accumulation of γδ TILs to the tumor bed [46]. It is interesting to note that CXCR6 was previously thought to be expressed in human Vδ2 cells, but not Vδ1 cells [18]. However, we found high CXCR6 levels in both Vγ1+ and Vγ4+ γδ T cells. CXCR6 plays a critical role in NK cell memory of haptens and viruses [47]. Whether CXCR6 plays a role in Vγ1+ and Vγ4+ γδ T memory cells needs further examination.

Integrins play key roles in immune responses, leukocyte trafficking and many human diseases. Most integrin related research has been focused on αβ T cells, with little published on γδ T cells. Our results show several integrins were highly expressed in Vγ1+ and Vγ4+ γδ T cells. For example, Itgae (Cd103), implicated in epithelial T cell retention, is highly expressed on Vγ1+ and Vγ4+ γδ T cells [48]. Itgae contributes to clustering and activation of Vγ 5 TCRs expressed by epidermal T cells [49]. Signals mediated by integrins play important roles in the activation of T cells [50]. Therefore, we suggest stimulating integrin expression provides a costimulation signal, increasing the sensitivity of γδ T cell activation.

PMA/Ionomycin induces a robust non-TCR mediated response in Vγ1+ and Vγ4+ γδ T cells. We show after PMA/Ionomycin treatment several activation markers of T cells were upregulated including CD25, CD69 and CD44, along with most cytokine genes in both subsets. In addition, activated Vγ1+ and Vγ4+ γδ T cells produced high levels of XCL1, CCL3, CCL4, CCL1, IFN-γ, TNFα, Lta, Csf2 and IL-10. IFN-γ and TNFα are Th1 type cytokines. Previous reports show Vγ4+ γδ T cells are the major γδ T subset producing IFN-γ, and they steer CD4+ T cells toward a dominant Th1 cell response [7], [51], [52]. Moreover, He et al. reported that CD44 rich Vγ4+ γδ T cells produced significantly more IFN-γ compared with Vγ1+ γδ T cells, partly due to the high expression level of eomesodermin [16]. In contrast, Matsuzaki et al. reported that Vγ1+ γδ T cells were the major γδ T subset producing IFN-γ in response to L. monocytogenes infection [53]. The opposing results are likely due to different disease models and treatment methods. A separate study reported higher levels of IL-10 in human Vδ1 cells compared with Vδ2 cells [18]. However, our results show both Vγ1+ and Vγ4+ γδ T cells produce high levels of IL-10.

Narayan et al. reported that Vγ4+ γδ thymocytes expressed high levels of Stat4, Maf, Gata3 and Eomes compared with Vγ1+ γδ thymocytes [12]. However, our results show both Vγ1+ and Vγ4+ γδ T cells expressed high levels of these transcription factors and the levels of Gata3 were slightly higher in Vγ1+ γδ T cells compared with Vγ4+ γδ T cells after PMA/Ionomycin treatment. Gata3 is critical for Th2 cell differentiation and required for IL-4 production. The higher level of Gata3 expression in Vγ1+ γδ T cells is consistent with the phenotype of Vγ1+ γδ T cells producing more IL-4 than Vγ4+ γδ T cells. T-bet is a major factor for Th1 cell differentiation and IFN-γ production [54]. Eomes is also involved in Th1 differentiation and IFN-γ production [55]. The upregulation of T-bet and Eomes is consistent with the phenotype of both Vγ1+ and Vγ4+ γδ T cells that produce high levels of IFN-γ. The difference between our results with the ImmGen Project may be due to the source of γδ T cells. The cells used in the ImmGen Project are γδ thymocytes, however the cells in our study were peripheral γδ T cells derived from the spleen.

Taken together, this study shows both Vγ1+ and Vγ4+ γδ T cells maintain inflammatory and regulatory phenotypes. Both demonstrate an inflammatory cell phenotype via IFN-γ and TNFα expression. And, both display a regulatory cell phenotype via TGF-β and IL-10 production. Vγ1+ γδ T cells produced more Th2 type cytokines, while Vγ4+ γδ T cells tended to produce more IL-17. Thus, Th2 type cytokines may explain how Vγ1+ γδ T cells affect anti-inflammatory functions in different infection models, and describe the enhancing effect on airway hyperresponsiveness (AHR) [56]. IL-17 cytokines support the pro-inflammatory function of Vγ4+ γδ T cells in the infection models and the inhibitory effect on airway hyperresponsiveness (AHR). Although this study was performed in Vγ1+ and Vγ4+ γδ T cells expanded in vitro, which may not fully represent the true status of Vγ1+ and Vγ4+ γδ T cells in vivo, our results support the hypothesis that distinct γδ TCR types direct cells to acquire a certain type of functional programming during thymic development [57].

Complementary to the ImmGen Project, this report provides a comprehensive gene expression profile of mouse peripheral Vγ1+ and Vγ4+ γδ T cells following PMA/Ionomycin treatment. Although both γδ T cell populations have similar transcript profiles, subset-specific transcripts define distinct characteristics and describe the inherent differences between Vγ1+ and Vγ4+ γδ T cells.

Supporting Information

Dataset S1

Raw data and differential expression analysis in RNA-seq.

(XLSX)

Dataset S2

Differentially expressed genes between the resting and activated Vγ1+ γδ T cells.

(XLSX)

Dataset S3

Differentially expressed genes between the resting and activated Vγ4+ γδ T cells.

(XLSX)

Dataset S4

Transcription factors related to Th cell differentiation and cytokine secretion.

(XLSX)

Acknowledgments

We thank Fang Hua, Yuli Zhu and Dan Wu for technical assistance and helpful discussion. We thank the flow cytometry facility at the Peking University Health Science Center for cell sorting and data analysis support.

Data Availability

The authors confirm that all data underlying the findings are fully available without restriction. The raw data files have been deposited in NCBI’s Sequence Read Archive (SRA) and are accessible through SRA Series accession number SRP042029.

Funding Statement

This study was supported by the Health Research Special Program, Ministry of Science and Technology of the People’s Republic of China (Grant No. 20130217). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Bonneville M, O’Brien RL, Born WK (2010) γδ T cell effector functions: a blend of innate programming and acquired plasticity. Nature Reviews Immunology 10: 467–478. [DOI] [PubMed] [Google Scholar]
  • 2. Kaufmann S (1996) gamma/delta and other unconventional T lymphocytes: what do they see and what do they do? Proceedings of the National Academy of Sciences 93: 2272–2279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Carding SR, Egan PJ (2002) γδ T cells: functional plasticity and heterogeneity. Nature reviews immunology 2: 336–345. [DOI] [PubMed] [Google Scholar]
  • 4. Welte T, Lamb J, Anderson JF, Born WK, O’Brien RL, et al. (2008) Role of two distinct γδ T cell subsets during West Nile virus infection. FEMS Immunology & Medical Microbiology 53: 275–283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Gerber DJ, Azuara V, Levraud J-P, Huang SY, Lembezat M-P, et al. (1999) IL-4-producing γδ T cells that express a very restricted TCR repertoire are preferentially localized in liver and spleen. The Journal of Immunology 163: 3076–3082. [PubMed] [Google Scholar]
  • 6. Huber S, Shi C, Budd RC (2002) γδ T cells promote a Th1 response during coxsackievirus B3 infection in vivo: role of Fas and Fas ligand. Journal of virology 76: 6487–6494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Huber S, Sartini D, Exley M (2002) Vγ4+ T cells promote autoimmune CD8+ cytolytic T-lymphocyte activation in coxsackievirus B3-induced myocarditis in mice: role for CD4+ Th1 cells. Journal of virology 76: 10785–10790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hahn Y-S, Taube C, Jin N, Sharp L, Wands J, et al. (2004) Different potentials of γδ T cell subsets in regulating airway responsiveness: Vγ1+ cells, but not Vγ4+ cells, promote airway hyperreactivity, Th2 cytokines, and airway inflammation. The Journal of Immunology 172: 2894–2902. [DOI] [PubMed] [Google Scholar]
  • 9. Hahn Y-S, Taube C, Jin N, Takeda K, Park J-W, et al. (2003) Vγ4+ γδ T cells regulate airway hyperreactivity to methacholine in ovalbumin-sensitized and challenged mice. The Journal of Immunology 171: 3170–3178. [DOI] [PubMed] [Google Scholar]
  • 10. Tramonti D, Andrew EM, Rhodes K, Newton DJ, Carding SR (2006) Evidence for the opposing roles of different γδ T cell subsets in macrophage homeostasis. European journal of immunology 36: 1729–1738. [DOI] [PubMed] [Google Scholar]
  • 11. Huang Y, Jin N, Roark CL, Aydintug MK, Wands J, et al. (2009) The influence of IgE-enhancing and IgE-suppressive γδ T cells changes with exposure to inhaled ovalbumin. The Journal of Immunology 183: 849–855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Narayan K, Sylvia KE, Malhotra N, Yin CC, Martens G, et al. (2012) Intrathymic programming of effector fates in three molecularly distinct [gamma][delta] T cell subtypes. Nature immunology 13: 511–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kang N, Tang L, Li X, Wu D, Li W, et al. (2009) Identification and characterization of Foxp3< sup>+</sup> γδ T cells in mouse and human. Immunology letters 125: 105–113. [DOI] [PubMed] [Google Scholar]
  • 14. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B (Methodological): 289–300. [Google Scholar]
  • 15. Kong Y, Cao W, Xi X, Ma C, Cui L, et al. (2009) The NKG2D ligand ULBP4 binds to TCRγ9/δ2 and induces cytotoxicity to tumor cells through both TCRγδ and NKG2D. Blood 114: 310–317. [DOI] [PubMed] [Google Scholar]
  • 16. He W, Hao J, Dong S, Gao Y, Tao J, et al. (2010) Naturally activated Vγ4 γδ T cells play a protective role in tumor immunity through expression of eomesodermin. The Journal of Immunology 185: 126–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhao N, Hao J, Ni Y, Luo W, Liang R, et al. (2011) Vγ4 γδ T cell-derived IL-17A negatively regulates NKT cell function in Con A-induced fulminant hepatitis. The Journal of Immunology 187: 5007–5014. [DOI] [PubMed] [Google Scholar]
  • 18. Kress E, Hedges JF, Jutila MA (2006) Distinct gene expression in human Vδ1 and Vδ2 γδ T cells following non-TCR agonist stimulation. Molecular immunology 43: 2002–2011. [DOI] [PubMed] [Google Scholar]
  • 19. Chen W, Jin W, Hardegen N, Lei K-j, Li L, et al. (2003) Conversion of peripheral CD4+ CD25− naive T cells to CD4+ CD25+ regulatory T cells by TGF-β induction of transcription factor Foxp3. The Journal of experimental medicine 198: 1875–1886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, et al. (2006) Transforming growth factor-β induces development of the TH17 lineage. Nature 441: 231–234. [DOI] [PubMed] [Google Scholar]
  • 21. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B (2006) TGFβ in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24: 179–189. [DOI] [PubMed] [Google Scholar]
  • 22. Richards M, Nelson J (2000) The evolution of vertebrate antigen receptors: a phylogenetic approach. Molecular biology and evolution 17: 146–155. [DOI] [PubMed] [Google Scholar]
  • 23. Hedges JF, Cockrell D, Jackiw L, Meissner N, Jutila MA (2003) Differential mRNA expression in circulating γδ T lymphocyte subsets defines unique tissue-specific functions. Journal of leukocyte biology 73: 306–314. [DOI] [PubMed] [Google Scholar]
  • 24. Meissner N, Radke J, Hedges JF, White M, Behnke M, et al. (2003) Serial analysis of gene expression in circulating γδ T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. The Journal of Immunology 170: 356–364. [DOI] [PubMed] [Google Scholar]
  • 25. Duhen T, Geiger R, Jarrossay D, Lanzavecchia A, Sallusto F (2009) Production of interleukin 22 but not interleukin 17 by a subset of human skin-homing memory T cells. Nature immunology 10: 857–863. [DOI] [PubMed] [Google Scholar]
  • 26. Eberl G, Marmon S, Sunshine M-J, Rennert PD, Choi Y, et al. (2004) An essential function for the nuclear receptor RORγt in the generation of fetal lymphoid tissue inducer cells. Nature immunology 5: 64–73. [DOI] [PubMed] [Google Scholar]
  • 27.Jetten AM (2009) Retinoid-related orphan receptors (RORs): critical roles in development, immunity, circadian rhythm, and cellular metabolism. Nucl Recept Signal 7. [DOI] [PMC free article] [PubMed]
  • 28. Trifari S, Kaplan CD, Tran EH, Crellin NK, Spits H (2009) Identification of a human helper T cell population that has abundant production of interleukin 22 and is distinct from TH-17, TH1 and TH2 cells. Nature immunology 10: 864–871. [DOI] [PubMed] [Google Scholar]
  • 29. Ivanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, et al. (2006) The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17< sup>+</sup> T Helper Cells. Cell 126: 1121–1133. [DOI] [PubMed] [Google Scholar]
  • 30. Melichar HJ, Narayan K, Der SD, Hiraoka Y, Gardiol N, et al. (2007) Regulation of γδ Versus αß T Lymphocyte Differentiation by the Transcription Factor SOX13. Science 315: 230–233. [DOI] [PubMed] [Google Scholar]
  • 31. Gray EE, Ramírez-Valle F, Xu Y, Wu S, Wu Z, et al. (2013) Deficiency in IL-17-committed V [gamma] 4+[gamma][delta] T cells in a spontaneous Sox13-mutant CD45. 1+ congenic mouse substrain provides protection from dermatitis. Nature immunology 14: 584–592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Malhotra N, Narayan K, Cho OH, Sylvia KE, Yin C, et al. (2013) A network of high-mobility group box transcription factors programs innate interleukin-17 production. Immunity 38: 681–693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kisielow J, Kopf M, Karjalainen K (2008) SCART scavenger receptors identify a novel subset of adult γδ T cells. The Journal of Immunology 181: 1710–1716. [DOI] [PubMed] [Google Scholar]
  • 34. Ribot JC, Pang DJ, Neves JF, Peperzak V, Roberts SJ, et al. (2009) CD27 is a thymic determinant of the balance between interferon-γ-and interleukin 17–producing γδ T cell subsets. Nature immunology 10: 427–436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. O’Brien RL, Yin X, Huber SA, Ikuta K, Born WK (2000) Depletion of a γδ T cell subset can increase host resistance to a bacterial infection. The Journal of Immunology 165: 6472–6479. [DOI] [PubMed] [Google Scholar]
  • 36. Hao J, Dong S, Xia S, He W, Jia H, et al. (2011) Regulatory role of Vγ1 γδ T cells in tumor immunity through IL-4 production. The Journal of Immunology 187: 4979–4986. [DOI] [PubMed] [Google Scholar]
  • 37. Liu H, Lu Z-G, Miki Y, Yoshida K (2007) Protein kinase C δ induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Molecular and cellular biology 27: 8480–8491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Lee Y, Yu Y, Gunawardena H, Xie L, Chen X (2012) BCLAF1 is a radiation-induced H2AX-interacting partner involved in γH2AX-mediated regulation of apoptosis and DNA repair. Cell death & disease 3: e359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. McPherson JP, Sarras H, Lemmers B, Tamblyn L, Migon E, et al. (2009) Essential role for Bclaf1 in lung development and immune system function. Cell Death & Differentiation 16: 331–339. [DOI] [PubMed] [Google Scholar]
  • 40. Li L-b, Leung DY, Strand MJ, Goleva E (2007) ATF2 impairs glucocorticoid receptor–mediated transactivation in human CD8+ T cells. Blood 110: 1570–1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Fedele M, Fidanza V, Battista S, Pentimalli F, Klein-Szanto AJ, et al. (2006) Haploinsufficiency of the Hmga1 gene causes cardiac hypertrophy and myelo-lymphoproliferative disorders in mice. Cancer research 66: 2536–2543. [DOI] [PubMed] [Google Scholar]
  • 42. Resar LM (2010) The high mobility group A1 gene: transforming inflammatory signals into cancer? Cancer research 70: 436–439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Xi Y, Watanabe S, Hino Y, Sakamoto C, Nakatsu Y, et al. (2012) Hmga1 is differentially expressed and mediates silencing of the CD4/CD8 loci in T cell lineages and leukemic cells. Cancer science 103: 439–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Li L, Zhang JA, Dose M, Kueh HY, Mosadeghi R, et al. (2013) A far downstream enhancer for murine Bcl11b controls its T-cell specific expression. Blood 122: 902–911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Lahn M, Kanehiro A, Takeda K, Terry J, Hahn Y-S, et al. (2002) MHC class I-dependent Vγ4+ pulmonary T cells regulate αβ T cell-independent airway responsiveness. Proceedings of the National Academy of Sciences 99: 8850–8855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Lança T, Costa MF, Gonçalves-Sousa N, Rei M, Grosso AR, et al. (2013) Protective Role of the Inflammatory CCR2/CCL2 Chemokine Pathway through Recruitment of Type 1 Cytotoxic γδ T Lymphocytes to Tumor Beds. The Journal of Immunology 190: 6673–6680. [DOI] [PubMed] [Google Scholar]
  • 47. Paust S, Gill HS, Wang B-Z, Flynn MP, Moseman EA, et al. (2010) Critical role for the chemokine receptor CXCR6 in NK cell-mediated antigen-specific memory of haptens and viruses. Nature immunology 11: 1127–1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Cepek KL, Shaw SK, Parker CM, Russell GJ, Morrow JS, et al. (1994) Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the αEβ7 integrin. [DOI] [PubMed]
  • 49. Timerbaev A, Sturup S (2012) Analytical approaches for assaying metallodrugs in biological samples: Recent methodological developments and future trends. Current drug metabolism 13: 272–283. [DOI] [PubMed] [Google Scholar]
  • 50. Brownlie RJ, Zamoyska R (2013) T cell receptor signalling networks: branched, diversified and bounded. Nature Reviews Immunology 13: 257–269. [DOI] [PubMed] [Google Scholar]
  • 51. Huber SA, Graveline D, Born WK, O’Brien RL (2001) Cytokine production by Vγ+-T-cell subsets is an important factor determining CD4+-Th-cell phenotype and susceptibility of BALB/c mice to coxsackievirus B3-induced myocarditis. Journal of virology 75: 5860–5869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Huber SA, Graveline D, Newell MK, Born WK, O’Brien RL (2000) Vγ1+ T cells suppress and Vγ4+ T cells promote susceptibility to coxsackievirus B3-induced myocarditis in mice. The Journal of Immunology 165: 4174–4181. [DOI] [PubMed] [Google Scholar]
  • 53. Matsuzaki G, Yamada H, Kishihara K, Yoshikai Y, Nomoto K (2002) Mechanism of murine Vγ1+ γ δ T cell-mediated innate immune response against Listeria monocytogenes infection. European journal of immunology 32: 928–935. [DOI] [PubMed] [Google Scholar]
  • 54. Szabo SJ, Kim ST, Costa GL, Zhang X, Fathman CG, et al. (2000) A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100: 655–669. [DOI] [PubMed] [Google Scholar]
  • 55. Suto A, Wurster AL, Reiner SL, Grusby MJ (2006) IL-21 inhibits IFN-γ production in developing Th1 cells through the repression of Eomesodermin expression. The Journal of Immunology 177: 3721–3727. [DOI] [PubMed] [Google Scholar]
  • 56. Jin N, Roark CL, Miyahara N, Taube C, Aydintug MK, et al. (2009) Allergic airway hyperresponsiveness-enhancing γδ T cells develop in normal untreated mice and fail to produce IL-4/13, unlike Th2 and NKT cells. The Journal of Immunology 182: 2002–2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. O’Brien RL, Born WK (2010) γδ T cell subsets: A link between TCR and function? Elsevier. 193–198. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Dataset S1

Raw data and differential expression analysis in RNA-seq.

(XLSX)

Dataset S2

Differentially expressed genes between the resting and activated Vγ1+ γδ T cells.

(XLSX)

Dataset S3

Differentially expressed genes between the resting and activated Vγ4+ γδ T cells.

(XLSX)

Dataset S4

Transcription factors related to Th cell differentiation and cytokine secretion.

(XLSX)

Data Availability Statement

The authors confirm that all data underlying the findings are fully available without restriction. The raw data files have been deposited in NCBI’s Sequence Read Archive (SRA) and are accessible through SRA Series accession number SRP042029.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES