Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Nov 25.
Published in final edited form as: Yeast. 2010 Aug 24;27(12):1039–1048. doi: 10.1002/yea.1813

Transformation of Candida albicans with a synthetic hygromycin B resistance gene

Luiz R Basso Jr 1, Ann Bartiss 2, Yuxin Mao 1, Charles E Gast 1, Paulo SR Coelho 3, Michael Snyder 3, Brian Wong 1,2
PMCID: PMC4243612  NIHMSID: NIHMS639956  PMID: 20737428

Abstract

Synthetic genes that confer resistance to the antibiotic nourseothricin in the pathogenic fungus Candida albicans are available, but genes conferring resistance to other antibiotics are not. We found that multiple C. albicans strains were inhibited by hygromycin B, so we designed a 1026 bp gene (CaHygB) that encodes Escherichia coli hygromycin B phosphotransferase with C. albicans codons. CaHygB conferred hygromycin B resistance in C. albicans transformed with ars2-containing plasmids or single-copy integrating vectors. Since CaHygB did not confer nourseothricin resistance and since the nourseothricin resistance marker SAT-1 did not confer hygromycin B resistance, we reasoned that these two markers could be used for homologous gene disruptions in wild-type C. albicans. We used PCR to fuse CaHygB or SAT-1 to approximately 1 kb of 5’ and 3’ noncoding DNA from C. albicans ARG4, HIS1 and LEU2, and we introduced the resulting amplicons into 6 wild-type C. albicans strains. Homologous targeting frequencies were approximately 50-70%, and disruption of both ARG4, HIS1 and LEU2 alleles was verified by the respective transformants’ inabilities to grow without arginine, histidine and leucine. CaHygB should be a useful tool for genetic manipulation of different C. albicans strains, including clinical isolates.

INTRODUCTION

Candida albicans was the first medically-important fungus for which integrative and episomal DNA transformation systems were developed. A large number of C. albicans mutants have been constructed by homologous gene targeting, most of which were generated by transforming auxotrophic mutants with the corresponding nutritional markers. This approach has been extremely useful, but it also has limitations. For example, the ura3 null mutation has phenotypic consequences other than nutritional auxotrophy, and these non-nutritional phenotypes are reversed to variable extents when URA3 is reintegrated into different chromosomal sites (for review, Staab and Sundstrom 2003; Brand et al., 2004). Also, nutritional markers cannot be used to study proposed virulence determinants in clinical isolates because these wild-type strains lack nutritional auxotrophies. For reasons such as these, there has been considerable interest in developing dominant selection markers that function in C. albicans. Two groups have shown that overexpression of C. albicans IMH3 conferred resistance to mycophenolic acid in C. albicans transformants (Köhler et al., 1997; Beckerman et al., 2001), but this marker has not been used subsequently. More recently, three groups generated synthetic markers that conferred resistance to the antibiotic nourseothricin, and these markers have since been used to construct many C. albicans mutants (Roemer et al., 2003; Reuss et al., 2004; Shen et al., 2005). Since C. albicans has a diploid genome, two separate homologous gene targeting steps are required to create homozygous mutants. Reuss et al. (2004) addressed this problem by constructing a gene targeting cassette in which the nourseothricin resistance marker can be excised by activating an internal FLP recombinase. Since this marker can be recycled, it can be used to target both chromosomal alleles of a gene of interest. An alternative approach would be to use a second antibiotic resistance marker to target the second chromosomal allele of a gene of interest, but the antibiotic resistance markers that are commonly used in other organisms do not function in C. albicans.

The aminoglycoside antibiotic hygromycin B inhibits protein synthesis (Singh et al., 1979), and hygromycin B resistance genes have been used in DNA transformation of many organisms (Kaster et al., 1983; Shimamoto et al., 1993; Giordano and McAllister, 1990). Genes derived from other hosts often do not function in C. albicans because the codon CTG encodes leucine in C. albicans and a few other Candida species, whereas CTG encodes serine in almost all other organisms (Pesole et al., 1995). Hara et al. (2000) used site-directed mutagenesis to replace the 9 CTG codons in the E. coli hygromycin B phosphotransferase gene with alternative leucine codons and found that the resulting hygromycin B resistance gene (HYG#) conferred hygromycin B resistance in Candida tropicalis. In preliminary experiments, we transformed C. albicans with the HYG# gene under the control of the PGK promoter, but the resulting transformants did not grow on rich media containing 600 μg hygromycin B per ml (unpublished data). Since changing only the CTG codons to alternative leucine codons may not be sufficient to permit optimal expression of heterologous genes in C. albicans (Cormack et al., 1997; Shen et al., 2005), we designed and synthesized a hygromycin B phosphotransferase gene with optimized C. albicans codons. This report describes this synthetic gene's ability to confer hygromycin B resistance when introduced into C. albicans transformants in single and multiple copy vectors and also a new fusion PCR method that uses the synthetic hygromycin B gene to introduce null mutations into wild-type C. albicans strains.

MATERIALS AND METHODS

Strains and media

C. albicans strains SC5314 and its ura3 derivative CAI4 were obtained from W. Fonzi (Georgetown Univ.), C. albicans WO-1 was from P.T. Magee (Univ. of Minnesota), C. albicans B311 was from H. Buckley (Temple Univ.), and C. albicans strain YPT1 (Table1) (containing the nourseothricin resistance gene SAT-1) was from T. Roemer (Mycota Biosciences, Montreal, Canada). C. albicans strains CT98001-5001, CT98004-5004 and CT98009-5009 were bloodstream isolates from patients in a population-based study of Candida fungemias (Hajjeh et al., 2004).

Table 1.

C. albicans strains used in this study

Strain Parent Strain Genotype Reference or source
CAI4 SC5314 Δura3::imm434/Δura3::imm434 Fonzi and Irwin, 1993
SC5314 clinical isolate Wild Type Fonzi and Irwin, 1993
WO-1 clinical isolate Wild Type Sasnauskas et al., 1992
B311 clinical isolate Wild Type Hasenclever and Mitchell, 1962
CT98001-5001 clinical isolate Wild Type This study
CT98004-5004 clinical isolate Wild Type This study
CT98009-5009 clinical isolate Wild Type This study
YPT1 CaSS1 his3::hisG/his3::hisG leu2::tetR-GAL4AD-URA3/LEU2 YPT1Δ::HIS3/YPT1 Roemer et al., 2003
Open in a new tab

C. albicans was cultured in YP medium (yeast extract 1%; peptone 2%) containing glucose (2%) or maltose (2%); in minimal medium (YNB) (0.67% yeast nitrogen base without amino acids containing glucose (2%); or in buffered YNB (YNB buffered to pH 7.0 with 0.15 M Hepes-NaOH). The media listed above were supplemented with graded amounts (200-1200 μg per ml) of hygromycin B (A.G. scientific Inc, USA) and/or nourseothricin (Werner Bioagents, Germany) at 400 μg/ml.

Plasmids were maintained in Escherichia coli DH5α grown in Luria-Bertani medium (LB) containing 100 μg ampicillin per ml.

Design and synthesis of CaHygB

A synthetic hygromycin B resistance gene with optimized C. albicans codons (CaHygB) was designed by reverse transcription of the 342 amino acids in E. coli hygromycin B phosphotransferase (Gritz and Davies, 1983) with the most frequent codon encoding each amino acid in a C. albicans codon usage table (http://www.kazusa.or.jp/codon/cgi bin/showcodon.cgi?species=5476), except that the second most frequent codon was used in a few cases to remove inconvenient restriction endonuclease sites or to introduce convenient ones. The resulting 1026 bp CaHygB coding sequence flanked by an XhoI restriction site at the 5’ end and a BamHI site at the 3’ end (Genbank accession number GU938191) was synthesized and ligated into plasmid pCRII (Invitrogen) by a commercial vendor (Bionexus Inc, Oakland, CA), and the accuracy of the DNA synthesis was verified by DNA sequencing.

Plasmid construction and transformation

Plasmid pBSII-CaHygB was constructed by inserting (i) the C. albicans TEF2 promoter [amplified from C. albicans SC5314 genomic DNA by PCR with primers TEF2pt-5 and TEF2pt-3 (Table 1)] into the the KpnI and XhoI sites of pBluescript II SK+ (Stratagene), (ii) the CaHygB marker into the resulting plasmid's XhoI and BamHI sites, and (iii) the C. albicans ACT1 terminator (amplified from C. albicans SC5314 genomic DNA by PCR with primers ACT1tm-5 and ACT1tm-3) into the BamHI and XbaI sites of the resulting plasmid (Table 3). Plasmid pYM70 (Fig 1) was constructed by ligating into pUC18 (i) an NdeI fragment from pCaARS2 that contains C. albicans ARS2 (Cannon et al., 1990), (ii) the XhoI-BamHI fragment from pBSII-CaHygB that contains CaHygB flanked by the C. albicans TEF2 promoter and ACT1 terminator, (iii) the SacI-SacII fragment from pYM6 that contain the C. albicans TEF2 terminator (Mao et al., 1999), and (iv) the C. albicans ACT1 promoter (amplified from C. albicans SC5314 genomic DNA by PCR with primers ACT1pt-5 and ACT1pt-3) (Table 3). The DNA sequence of plasmid pYM70 has been deposited in Genbank (accession number GU937092). Plasmid pYM70 is available to academic researchers by writing to Brian Wong (wongbri@ohsu.edu).

Table 3.

Primers used in this study

Primer name Sequence 5′ → 3′
Plasmid construction
    TEF2pt-5’ GTGGGTACCGACGTCGTATAGTGCTTGCTGTTCGATATT
    TEF2pt-3’ GGTGGTGGTCTCGAGGATTGATTATATAAAATGTATACTTAGAAAA
    ACT1pt-5’ GGTGGTTCTAGAAGAGCTATTAAGATCACCAGCCT
    ACT1pt-3’ GGTGGTTTAATTAATTTGAATGATTATATTTTTTTAATATTAA
    ACT1tm-5’ GGTGGTGGATCCGAGTGAAATTCTGGAAATCTGGA
    ACT1tm-3’ GGTTCTAGAGACGTCATTTTATGATGGAATGAATGGGA
Gene deletion
        Upstream primers
    ARG4 5’ ATTTTGAAACAATGAATCGATGCTT
    ARG4 3’ TCGCCCTATAGTGAGTCGTTATTAATTGATTATCTTGATAGCTGTTATG
    HIS1 5’ GTGCCACTGTATACGCATTT
    HIS1 3’ TCGCCCTATAGTGAGTCGTTATCGGTAGTTGGTGGTTAAGTAA
    LEU2 5’ TTAGTTTCTATTATGGCCGTCAAT
    LEU2 3’ TCGCCCTATAGTGAGTCGTGTTTTTTGGATATTGGTTTTAAAAGA
        Downstream primers
    ARG4 5’ TTCCCTTTAGTGAGGGTTAATTTATAAATAGTCATATAATAATCACAGTAT
    ARG4 3’ TGCAAACAAACAGGGGAAAA
    HIS1 5’ TTCCCTTTAGTGAGGGTTAAAAGAAGTGATAGTTTCTCATAAATAT
    HIS1 3’ TCAATTATGTTGATTAGCTACAGTCA
    LEU2 5’ TTCCCTTTAGTGAGGGTTAAACAGTATATACAGTAGTTAGCATTT
    LEU2 3’ TTTATACCACGTGGTGACGAA
        Fusion primers
    ARG4 5’ CATAACAGCTATCAAGAATAATCAATTAATAACGACTCACTATAGGGCGA
    ARG4 3’ ATACTGTGATTATTATATGACTATTTATAAAATAACCCTCACTAAAGGGAA
    HIS1 5’ TTACTTAACCACCAACTACCGATAACGACTCACTATAGGGCG
    HIS1 3’ ATATTTATGAGAAACTATCACTTCTTTTAACCCTCACTAAAGGGAA
    LEU2 5’ TCTTTTAAAACCAATATCCAAAAAACACGACTCACTATAGGGCGA
    LEU2 3’ AAATGCTAACTACTGTATATACTGTTTAACCCTCACTAAAGGGAA
    HygB 5’ CTGGAATTGGCAAAGCAGCAGAAGCA
    HygB 3’ TCAGCTGCTGTTTGGACTGATGGTTGT
    Nours 5’ GTTCTCAGCATCCAATGTTTCCGCCA
    Nours 3’ CTTCAAGTCTCGAACGAAACAGCGAT
        Verification Primers
    ARG4 5’ GGTTCCTGGATTTGCGCAGCCTTATA
    ARG4 3’ CGCGATTAGAACTTGTGGACCTATCCT
    ARG4 3’A CGTGTGATGTCAGTTGTTCAAGGTTGACT
    ARG4 3’B GCAGTTCCAAAGATTGAAGCGTCTTCGT
    ARG4 3’C GCTACATTACCCTCTGTTGCCACAAGCAT
    ARG4 3’D GTCTTTGGATCGGTAGTACTGTGGCA
    HIS1 5’ AGGAAGGTCACAGCTTGGGGTTTGAT
    HIS1 3’ GATTGGGTGGCCATATTGTTCAAGGACA
    LEU2 5’ TGCCAGACATATGCAAGATGAAGGGT
    LEU2 3’ ACCCACCATTACGCAGAAGAAAGTCA
Open in a new tab

Figure 1.

Figure 1

Open in a new tab

Restriction map of the ACT1-regulated expression plasmid pYM70. Abbreviations: CaARS2 = autonomously-replicating sequence; ACT1pt = ACT1 promoter; TEF2tm = TEF2 terminator; ori = origin of replication; bla = beta lactamase; TEF2pt = TEF2 promoter; CaHygB = synthetic hygromycin B resistance gene; and ACT1tm = ACT1 terminator.

Plasmids pAU34-CaHygB and pAU15-CaHygB were constructed by inserting the CaHygB marker into the XhoI and BamHI sites in the ACT1-regulated integrating vector pAU34 and the MAL2-regulated integrating vector pAU15, respectively (Uhl and Johnson, 2001).

The nourseothricin-conferring SAT-1 cassette consists of a synthetic SAT-1 gene with optimal C. albicans codons flanked by the C. albicans ACT1 promoter and the PCK1 terminator (Roemer et al., 2003).

Plasmids were introduced into C. albicans using the lithium acetate method (Walther and Wendland, 2003), and transformants were selected on minimal media lacking uridine or on YP or buffered YNB media containing hygromycin B or nourseothricin.

Strain construction by double fusion PCR

The double fusion PCR strategy (Amberg et al., 1995) was adapted to replace one chromosomal ARG4, HIS1 and LEU2 allele in C. albicans with the CaHygB marker and the second allele of each gene with the SAT-1 marker. Briefly, we used PCR to amplify (i) approximately 1 kb of C. albicans SC5314 genomic DNA from the 5’ region flanking each ORF of interest, (ii) the CaHygB or the SAT-1 marker, and (iii) approximately 1 kb of C. albicans SC5314 genomic DNA from the 3’ region flanking the ORF. The oligonucleotides used for these PCRs (Table 3) were designed so that the 3’ end of each 5’ flanking region and the 5’ end of each 3’ flanking region were complementary to the 5’ and 3’ ends, respectively, of the CaHygB and SAT-1 markers. Therefore, a PCR reaction that uses approximately equal amounts of the three gel-purified amplicons of interest as templates and primers complementary to the 5’ terminus of the 5’ flanking DNA and the 3’ terminus of the 3’ flanking DNA should generate a single fusion of the 5’ flanking region, the selectable marker of interest, and the 3’ flanking region. The adequacy of each final PCR reaction was assessed by agarose gel electrophoresis, and conditions were adjusted to maximize the yield of the desired products.

Once PCR conditions were optimized to yield the desired full-length amplicons, the C. albicans strains were transformed directly with the PCR products using the lithium acetate method (Walther and Wendland, 2003), and transformants were selected on the appropriate antibiotic-containing media.

Genomic DNA was amplified by PCR with the verification primers in Table 3 to determine (i) if the ORFs of interest were present or absent, (ii) the overall sizes of the chromosomal loci of interest, and (iii) if the CaHygB and/or the SAT-1 markers had integrated homologously into the chromosomal loci of interest. Several verification primers derived from the 3’ end of ARG4 were required to generate diagnostic amplicons from different C. albicans strains.

Phenotypic analyses

C. albicans transformants were tested for drug resistance by testing for growth at 30°C on solid YP-glucose, YNB-glucose or buffered YNB-glucose containing hygromycin B and/or nourseothricin, and they were tested for nutritional auxotrophies on buffered YNB-glucose lacking histidine, arginine or leucine.

RESULTS

Susceptibility of C. albicans strains to hygromycin B and nourseothricin

C. albicans strains SC5314, CAI4, WO-1, B311, CT98001-5001, CT98004-5004 and CT98009-5009 did not grow in YP-glucose containing 600 μg hygromycin B per ml. All of these strains grew well in YNB-glucose containing 1200 μg hygromycin B per ml, but they did not grow in buffered YNB-glucose (pH 7.0, 0.15 M Hepes-NaOH) containing 1000 μg hygromycin B per ml. All of the C. albicans strains were inhibited by 400 μg nourseothricin per ml in YP-glucose or in buffered YNB-glucose.

Properties of CaHygB-containing plasmids

To determine if multicopy plasmids encoding the CaHygB marker would confer hygromycin B resistance, C. albicans CAI4 was transformed with plasmid pYM70. The resulting transformants grew well in YP-glucose + 600 μg hygromycin B per ml (Fig 2). We used two approaches to determine if pYM70 replicated in C. albicans as extrachromosomal episomes. First, the stability of pYM70 in the absence of hygromycin B selection was examined (i) by culturing 12 independent pYM70 transformants for 40 generations in liquid YP-glucose or in YP-glucose + hygromycin B and (ii) by plating serial dilutions of each cell suspension onto solid YP-glucose or YP-glucose + hygromycin B. After 40 generations in YP-glucose without hygromycin B, there were 0.71 ± 0.02 as many colonies on YP-glucose + hygromycin B as there were on YP-glucose without hygromycin B. In controls cultured for 40 generations in YP-glucose + hygromycin, there were 1.03 ± 0.05 times as many colonies on YP-glucose + hygromycin B as there were on YP-glucose without hygromycin B. Second, we transformed E. coli DH5α with DNA extracted from 25 independent C. albicans pYM70 transformants, and the E. coli transformants were plated on LB-ampicillin media. Plasmids capable of conferring ampicillin resistance to E. coli were obtained from 14 of 25 (56%) C. albicans transformants.

Figure 2.

Figure 2

Open in a new tab

Growth of C. albicans on hygromycin B and nourseothricin. C. albicans CAI4, C. albicans YPT1 (which contains the SAT-1 marker), and C. albicans CAI4 transformed with pAU34, pAU34-CaHygB, pAU15, pAU15-CaHygB, pYM70, or both pYM70 and pSEC4 were incubated at 30°C for 48 h on solid YP-glucose, YP-maltose or buffered YNB-glucose containing either no antibiotic, hygromycin B, or nourseothricin. Strains in which CaHygB was expressed constitutively (pAU34-CaHygB, pYM70) or was induced by maltose (pAU15-CaHygB) grew in the presence of hygromycin B, and there was no cross-resistance between hygromycin B and nourseothricin.

Properties of C. albicans integrative transformants

To determine if a single copy of the CaHygB marker would confer hygromycin B resistance, C. albicans CAI4 was transformed with the ACT1-regulated integrating vector pAU34, pAU34-CaHygB, the MAL2-regulated integrating vector pAU15, or pAU15-CaHygB. The resulting transformants were isolated and purified on minimal media lacking uridine, and they were tested for growth on hygromycin B. All of the pAU34-CaHygB transformants tested grew well on YP-glucose + 600 μg hygromycin per ml and on buffered YNB-glucose + 1000 μg hygromycin B per ml, whereas the pAU34-transformed controls did not. Also, all of the pAU15-CaHygB transformants tested grew on inducing (YP-maltose) medium + 600 μg hygromycin B per ml but not on repressing (YP-glucose) medium + 600 μg hygromycin B per ml, whereas pAU15-transformed controls grew on neither medium (Fig 2).

Compatibility of CaHygB with other markers

Whether the CaHygB marker would confer resistance to nourseothricin was examined by testing C. albicans CAI4 transformed with pAU34-HygB, pAU15-CaHygB or pYM70 for growth on nourseothricin; none of these transformants grew on YP-glucose or buffered YNB-glucose containing 200-600 μg nourseothricin per ml. Whether the SAT-1 marker would confer resistance to hygromycin B was examined by testing C. albicans strain YPT1 (Roemer et al, 2003) for growth on hygromycin B; this strain did not grow on YP-glucose + 600 μg hygromycin B per ml or on buffered YNB-glucose + 1000 μg hygromycin B per ml (Fig 2). Also, whether pYM70 and URA3-containing plasmids were compatible in C. albicans was assessed by transforming C. albicans CAI4 with pYM70 and with pSEC4 [which carries the C. albicans URA3 and SEC4 genes (Mao et al., 1999)]. C. albicans transformed with both plasmids grew well on YNB-glucose + hygromycin B, whereas controls transformed only with pYM70 did not grow in the absence of uridine (Fig 2).

Targeted disruption of HIS1, LEU2 and ARG4 in wild-type C. albicans

Since integration of single-copy vectors containing the CaHygB marker conferred hygromycin B resistance in C. albicans and since the CaHygB and SAT-1 markers did not cross-react with each other, we reasoned that it should be possible to construct null mutants in wild-type C. albicans strains by disrupting one chromosomal allele of a gene of interest with the CaHygB marker and the other allele with the SAT-1 marker. To test this hypothesis, we used fusion PCR to construct linear gene-targeting molecules consisting of the CaHygB or the SAT-1 markers flanked by the 5’ and 3’ noncoding regions of C. albicans SC5314 ARG4, HIS1 and LEU2, and we introduced the CaHygB-containing amplicons into C. albicans strains SC5314, WO-1, B311, CT98001-5001, CT98004-5004 and CT98009-5009. Transformants derived from each host strain were selected and purified on YP-glucose + hygromycin B, and clones in which one chromosomal allele of each gene of interest had been replaced by homologous targeting were identified by PCR. Next, these heterozygous mutants were transformed again with the corresponding SAT-1-containing amplicons, and the resulting transformants were selected and purified on YP-glucose + hygromycin B + nourseothricin. PCR and phenotypic analyses showed that the second allele of all three genes of interest had been replaced by homologous targeting in all 6 wild-type C. albicans strains, with homologous targeting frequencies of approximately 50-70 percent. For example, homologous replacement of the second chromosomal alleles of ARG4, HIS1 and LEU2 in C. albicans SC5314 was demonstrated by PCR in 6 of 10, 7 of 10 and 6 of 10 transformants, respectively. Disruption of both chromosomal alleles of these genes was verified by showing that all 6 arg4 null mutants did not grow in the absence of arginine, all 7 his1 null mutants did not grow in the absence of histidine, and all 6 leu2 null mutants did not grow in the absence of leucine (Fig 3).

Figure 3.

Figure 3

Open in a new tab

Targeted disruption of ARG4, HIS1 and LEU2. When the two ARG4, HIS1 and LEU2 alleles were replaced in C. albicans SC5314, WO-1 and B311 with the CaHygB and SAT-1 markers, the resulting mutants acquired the ability to grow on rich medium (YP-glucose) + hygromycin B + nourseothricin. Homologous replacement of the genes of interest was verified by PCR (not shown) and by inability of the arg4 Δ/Δ, his1 Δ/Δ and leu2 Δ/Δ mutants, respectively, to grow on minimal medium (buffered YNB-glucose) containing hygromycin B and nourseothricin without arginine (CSM-Arg), histidine (CSM-His) or leucine (CSM-Leu). Abbreviations: Hyg. = hygromycin B; Nours. = nourseothricin; CSM = complete synthetic medium.

DISCUSSION

The objectives of this study were to generate a synthetic hygromycin B resistance gene that functions in C. albicans and to develop multicopy expression plasmids and gene targeting strategies that employ this new marker. The key findings were that (i) all of the C. albicans strains tested were inhibited by 600 μg of hygromycin B per ml of YPD and by 1000 μg of hygromycin B in YNB buffered to pH 7.0 and (ii) the synthetic CaHygB marker conferred hygromycin B resistance when it was expressed under the control of the C. albicans TEF2 promoter in an ars2-containing plasmid and also when it was expressed under the control of the C. albicans ACT1, MAL2 or TEF2 promoters in linearized single-copy integrating vectors or in linear gene-targeting constructs. One important finding is that hygromycin B could be used in minimal media only when the medium was buffered to neutral pH.

The ACT1-regulated expression plasmid pYM70 conferred hygromycin B resistance to C. albicans transformants. When we incubated pYM70-transformed C. albicans without hygromycin B for 40 generations, a substantial minority of the transformants lost their plasmids. Moreover, plasmids that could replicate in E. coli were recoverable from most pYM70-transformed C. albicans. We concluded from these results that pYM70 can replicate in C. albicans as episomes. However, that plasmids that replicated in E. coli could not be recovered from a substantial minority of C. albicans transformants suggests that that pYM70 either integrated into the genome of the C. albicans host strain (as might be expected for a plasmid containing substantial amounts of C. albicans genomic DNA) or underwent structural alterations [e.g., concatenation into large multimers (Goshorn et al., 1992)] that resulted in limited abilities to replicate in E. coli. Nevertheless, the usefulness of pYM70 as an expression vector was shown in a recent study in which we used pYM70 to overexpress the C. albicans CDR1, CDR2 and MDR1 genes in a C. albicans cdr1 cdr2 mdr1 null mutant. The resulting C. albicans transformants were more resistant to fluconazole and several other azole antifungals, and they had lower intracellular [3H]-fluconazole concentrations than, did empty-vector controls (Basso et al., 2010).

The observation that all uridine prototrophs obtained by transforming C. albicans CAI4 with pAU34-CaHygB or with pAU15-CaHygB were also resistant to hygromycin B established that integration of a single copy of the CaHygB marker into the genome was sufficient to confer hygromycin B resistance in C. albicans. Since this suggested that the CaHygB marker could be used for homologous gene disruption, a convenient fusion PCR method for generating gene targeting molecules containing the CaHygB and SAT-1 markers was developed, and the resulting amplicons were used sequentially to disrupt both chromosomal alleles of the ARG4, HIS1 and LEU2 genes in 6 wild-type C. albicans strains, including three laboratory strains and three bloodstream isolates from fungemic patients. That homologous targeting was demonstrated at frequencies of approximately 50-70 percent among antibiotic-resistant transformants generated from 6 different wild-type C. albicans strains suggests that the strain construction method described in this report may be very useful for analyzing the importance of potential virulence-associated genes in multiple wild-type C. albicans strains.

In summary, we have shown that the synthetic CaHygB marker confers resistance to hygromycin B in single and multiple copies in multiple strains of C. albicans. An ACT1-regulated expression plasmid containing CaHygB as a selectable marker replicates in C. albicans and can be used to overexpress C. albicans genes (Basso et al., 2010). Also, arg4, his1 and leu2 null mutants were constructed in 6 wild-type C. albicans strains by sequential disruption of both chromosomal alleles with fusion PCR products containing the CaHygB and SAT-1 selection markers. The CaHygB marker described here should be a useful addition to the tools available for studying the important human pathogen C. albicans.

Table 2.

Plasmids used in this study

Plasmid Marker Description Reference
pAU34 URA3 ACT1-regulated integrating vector Uhl and Johson, 2001
pAU34-CaHygB URA3 CaHygB under control of ACT1 promoter This study
pAU15 URA3 MAL2-regulated integrating vector Uhl and Johson, 2001
pAU15-CaHygB URA3 CaHygB under control of MAL2 promoter This study
pSEC4 URA3 pYM1 derivative Mao et al., 1999
pYM70 CaHygB pUC18 derivative with CaHygB under control of TEF2 promoter and ACT1 terminator This study
pBSII-CaHygB CaHygB CaHygB marker under control of TEF2 promoter and MAL2 terminator This study
SAT-1 cassette SAT-1 SAT-1 marker under control of ACT1 promoter and PCK1 terminator in pBluescriptII. Roemer et al., 2003
Open in a new tab

ACKNOWLEDGEMENTS

We thank P.T. Magee for C. albicans WO-1, H. Buckley for C. albicans B311, W. Fonzi for C. albicans SC5314 and CAI4, and T. Roemer for C. albicans YPT1 and the SAT-1 marker. This work was supported by the Department of Veterans’ Affairs and by NIH Grants R01 AI-64085 and U54 AI-081680.

REFERENCES

  1. Amberg DC, Botstein D, Beasley EM. Precise gene disruption in Saccharomyces cerevisiae by double fusion polymerase chain reaction. Yeast. 1995;11(13):1275–1280. doi: 10.1002/yea.320111307. [DOI] [PubMed] [Google Scholar]
  2. Basso LR, Jr, Gast CE, Mao Y, Wong B. Fluconazole transport into Candida albicans secretory vesicles by the membrane proteins Cdr1p, Cdr2p and Mdr1p. Eukaryotic Cell. 2010;9(6):960–970. doi: 10.1128/EC.00355-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beckerman J, Chibana H, Turner J, Magee PT. Single-copy IMH3 allele is sufficient to confer resistance to mycophenolic acid in Candida albicans and to mediate transformation of clinical Candida species. Infect Immun. 2001;69(1):108–114. doi: 10.1128/IAI.69.1.108-114.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brand A, MacCallum DM, Brown AJ, Gow NA, Odds FC. Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus. Eukaryotic Cell. 2004;3(4):900–909. doi: 10.1128/EC.3.4.900-909.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cannon RD, Jenkinson HF, Shepherd MG. Isolation and nucleotide sequence of an autonomously replicating sequence (ARS) element functional in Candida albicans and Saccharomyces cerevisiae. Mol Gen Genet. 1990;221(2):210–218. doi: 10.1007/BF00261723. [DOI] [PubMed] [Google Scholar]
  6. Cormack BP, Bertram G, Egerton M, Gow NA, Falkow S, Brown AJ. Yeast-enhanced green fluorescent protein (yEGFP)a reporter of gene expression in Candida albicans. Microbiology. 1997;143(Pt 2):303–311. doi: 10.1099/00221287-143-2-303. [DOI] [PubMed] [Google Scholar]
  7. Fonzi WA, Irwin MY. Isogenic strain construction and gene mapping in Candida albicans. Genetics. 1993;134(3):717–728. doi: 10.1093/genetics/134.3.717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Giordano TJ, McAllister WT. Optimization of the hygromycin B resistance-conferring gene as a dominant selectable marker in mammalian cells. Gene. 1990;88(2):285–288. doi: 10.1016/0378-1119(90)90045-s. [DOI] [PubMed] [Google Scholar]
  9. Goshorn AK, Grindle SM, Scherer S. Gene isolation by complementation in Candida albicans and applications to physical and genetic mapping. Infect. Immun. 1992;60(3):876–884. doi: 10.1128/iai.60.3.876-884.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gritz L, Davies J. Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene. 1983;25(2-3):179–188. doi: 10.1016/0378-1119(83)90223-8. [DOI] [PubMed] [Google Scholar]
  11. Hajjeh RA, Sofair AN, Harrison LH, Lyon GM, Arthington-Skaggs BA, Mirza SA, Phelan M, Morgan J, Lee-Yang W, Ciblak MA, Benjamin LE, Sanza LT, Huie S, Yeo SF, Brandt ME, Warnock DW. Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998 to 2000 in a population-based active surveillance program. J Clin Microbiol. Apr. 2004;42(4):1519–27. doi: 10.1128/JCM.42.4.1519-1527.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hara A, Ueda M, Misawa S, Matsui T, Furuhashi K, Tanaka A. A mutated hygromycin resistance gene is functional in the n-alkane-assimilating yeast Candida tropicalis. Arch Microbiol. 2000;173(3):187–92. doi: 10.1007/s002039900125. [DOI] [PubMed] [Google Scholar]
  13. Hasenclever HF, Mitchell WO. Production in mice of tolerance to the toxic manifestations of Candida albicans. J. Bacteriol. 1962;84:402–409. doi: 10.1128/jb.84.3.402-409.1962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kaster KR, Burgett SG, Rao RN, Ingolia TD. Analysis of a bacterial hygromycin B resistance gene by transcriptional and translational fusions and by DNA sequencing. Nucleic Acids Res. 1983;11(19):6895–6911. doi: 10.1093/nar/11.19.6895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Köhler GA, White TC, Agabian N. Overexpression of a cloned IMP dehydrogenase gene of Candida albicans confers resistance to the specific inhibitor mycophenolic acid. J Bacteriol. 1997;179(7):2331–2338. doi: 10.1128/jb.179.7.2331-2338.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mao Y, Kalb VF, Wong B. Overexpression of a dominant-negative allele of SEC4 inhibits growth and protein secretion in Candida albicans. J Bacteriol. 181(23):7235–7242. doi: 10.1128/jb.181.23.7235-7242.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pesole G, Lotti M, Alberghina L, Saccone C. Evolutionary origin of nonuniversal CUG Ser codon in some Candida species as inferred from a molecular phylogeny. Genetics. 1995;141(3):903–907. doi: 10.1093/genetics/141.3.903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Reuss O, Vik A, Kolter R, Morschhäuser J. The SAT-1 flipper, an optimized tool for gene disruption in Candida albicans. Gene. 2004;341:119–127. doi: 10.1016/j.gene.2004.06.021. [DOI] [PubMed] [Google Scholar]
  19. Roemer T, Jiang B, Davison J, Ketela T, Veillette K, Breton A, Tandia F, Linteau A, Sillaots S, Marta C, Martel N, Veronneau S, Lemieux S, Kauffman S, Becker J, Storms R, Boone C, Bussey H. Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Mol Microbiol. 2003;50(1):167–181. doi: 10.1046/j.1365-2958.2003.03697.x. [DOI] [PubMed] [Google Scholar]
  20. Sasnauskas K, Jomantienè R, Lebedienè E, Lebedys J, Januska A, Janulaitis A. Molecular cloning and analysis of autonomous replicating sequence of Candida maltosa. Yeast. 1992;8(4):253–259. doi: 10.1002/yea.320080403. [DOI] [PubMed] [Google Scholar]
  21. Shen J, Guo W, Köhler JR. CaNAT1, a heterologous dominant selectable marker for transformation of Candida albicans and other pathogenic Candida species. Infect Immun. 2005;73(2):1239–1242. doi: 10.1128/IAI.73.2.1239-1242.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Shimamoto K, Miyazaki C, Hashimoto H, Izawa T, Itoh K, Terada R, Inagaki Y, Iida S. Trans-activation and stable integration of the maize transposable element Ds cotransfected with the Ac transposase gene in transgenic rice plants. Mol Gen Genet. 1993;239(3):354–360. doi: 10.1007/BF00276933. [DOI] [PubMed] [Google Scholar]
  23. Singh K, Sun S, Vézina C. Rapamycin (AY-22,989), a new antifungal antibiotic. IV. Mechanism of action. J Antibiot (Tokyo) 1979;32(6):630–645. doi: 10.7164/antibiotics.32.630. [DOI] [PubMed] [Google Scholar]
  24. Staab JF, Sundstrom P. URA3 as a selectable marker for disruption and virulence assessment of Candida albicans genes. Trends Microbiol. 2003;11(2):69–73. doi: 10.1016/s0966-842x(02)00029-x. Review. [DOI] [PubMed] [Google Scholar]
  25. Uhl MA, Johnson AD. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida albicans. Microbiology. 2001;147(Pt 5):1189–1195. doi: 10.1099/00221287-147-5-1189. [DOI] [PubMed] [Google Scholar]
  26. Walther A, Wendland J. An improved transformation protocol for the human fungal pathogen Candida albicans. Curr Genet. 2003;42:339–343. doi: 10.1007/s00294-002-0349-0. [DOI] [PubMed] [Google Scholar]

RESOURCES