Skip to main content
PMC home page
The Scientific World Journal logoLink to The Scientific World Journal
. 2014 Nov 18;2014:814109. doi: 10.1155/2014/814109

Virulence Genotyping of Pasteurella multocida Isolated from Multiple Hosts from India

Laxmi Narayan Sarangi 1,2, Adyasha Priyadarshini 1, Santosh Kumar 1, Prasad Thomas 1,3, Santosh Kumar Gupta 1,*, Viswas Konasagara Nagaleekar 1, Vijendra Pal Singh 1
PMCID: PMC4251079  PMID: 25485303

Abstract

In this study, 108 P. multocida isolates recovered from various host animals such as cattle, buffalo, swine, poultry (chicken, duck, and emu) and rabbits were screened for carriage of 8 virulence associated genes. The results revealed some unique information on the prevalence of virulence associated genes among Indian isolates. With the exception of toxA gene, all other virulence associated genes were found to be regularly distributed among host species. Association study between capsule type and virulence genes suggested that pfhA, nanB, and nanH genes were regularly distributed among all serotypes with the exception of CapD, whereas toxA gene was found to be positively associated with CapD and CapA. The frequency of hgbA and nanH genes among swine isolates of Indian origin was found to be less in comparison to its equivalents around the globe. Interestingly, very high prevalence of tbpA gene was observed among poultry, swine, and rabbit isolates. Likewise, very high prevalence of pfhA gene (95.3%) was observed among Indian isolates, irrespective of host species origin.

1. Introduction

Pasteurella multocida belonging to family Pasteurellaceae is a ubiquitous organism affecting multihost species, thus causing several diseases like haemorrhagic septicaemia in cattle and buffalo, enzootic bronchopneumonia in cattle, sheep, and goats, atrophic rhinitis in swine, fowl cholera in poultry and snuffles in rabbits [1, 2]. These diseases are known to cause severe financial loss to livestock industry, especially in tropical countries. Conventional vaccines have been used for several decades as a control strategy, but major limitation of these vaccines is their ineffectiveness in inducing long acting cross protective immunity [3, 4]. Therefore, several outer membrane proteins (OMPs) have been proposed as candidate antigen for subunit vaccine [3, 5].

The OMPs of Gram negative bacteria play an essential role in the disease process. They are involved in the process of nutrient uptake, transport of molecules in and out of the cell, colonization and invasion of the host, evasion of host immune response, injury to host tissue, and so forth, required for productive infection [6]. These proteins are subjected to different selection pressures, thereby exhibiting varying degree of interstrain heterogeneity. Therefore, these virulence associated genes can be used to assess intraspecies diversity and also to obtain epidemiological relationships [7]. In addition, these OMPs are good immunogens and can be used as vaccine components to provide protection [8–10]. Hence, virulence profiling can be used as a typing method for characterization of bacterial pathogens [11] and also for development of subunit vaccine in vaccine strain selection. For the first time, virulence profiling of P. multocida isolates was carried out by Ewers et al. [12], and subsequently it has been used by many workers to understand the diversity of the pathogen recovered from different host origin [13–19].

The previous study carried out in our laboratory on carriage of 19 virulence genes among P. multocida isolates, recovered from small ruminants, revealed some novel information on the frequency of virulence genes like very high prevalence of pfhA gene, 48.9% prevalence of toxA gene with the highest prevalence among serotype A followed by serotype D, and in one isolate each of capsular types B and F (Sarangi et al., submitted for publication). These findings from small ruminant isolates encouraged sampling of more isolates of Indian origin from various hosts to have a clear understanding on the heterogeneity of the bacteria. Therefore, this study was extended to P. multocida isolates recovered from multiple host species for 8 important virulence associated genes, encoding proteins involved in bacterial survival and pathogenesis. It included genes encoding transferrin binding protein (TbpA) and haemoglobin binding protein (HgbA, HgbB) associated with iron acquisition, filamentous haemagglutinin (PfhA), subunit of type IV fimbriae (PtfA), sialidases (NanB, NanH) involved in initial colonization and adhesion, and dermonecrotoxin (ToxA).

2. Materials and Methods

2.1. Bacterial Strains

In the present study, 108 P. multocida isolates recovered from large ruminants (buffalo, n = 23, cattle, n = 18), avians (chicken, n = 18, duck, n = 8, and emu, n = 4), swine (n = 34), and rabbit (n = 3), maintained at Division of Bacteriology & Mycology, Indian Veterinary Research Institute, Izatnagar, were used. Selections of isolates were carried out on the basis of host origin, year and place of isolation in order to incorporate isolates from all over India. The details of the isolates (isolate number, host origin, capsular type, year and place of isolation, and disease symptom (if available)) are given in Table 1.

Table 1.

Details of the isolates (host origin, serotype detected, place of isolation, year of isolation, symptom, presence/absence of individual virulence genes).

Sample id Species Serotype Place Year Disease/symptom tbpA hgbA hgbB pfhA ptfA toxA nanB nanH
10 Cattle F Pune 1992 N.A. P P P P P A P P
11 Cattle F Pune 1992 N.A. P P P P P A P P
51 Pig A UP 1995 N.A. P P P P P P P A
53 Buffalo B Pune 1996 N.A. A P P P P A P A
98 Duck A Tripura 2001 N.A. P P P P P A P P
117 Cattle B Bhubaneswar 2001 N.A. P P P P P A P P
118 Cattle B Bhubaneswar 2001 N.A. P P P P P A P P
120 Cattle B Bhubaneswar 2001 N.A. P P P P P A P P
128 Cattle B Bangalore 2001 N.A. P P P P P A P P
132 Buffalo A Palampur 2001 N.A. P P P P P A P P
133 Buffalo A Palampur 2001 N.A. A A P P P A P A
134 Buffalo A Palampur 2001 N.A. P P P P P A P P
141 Chicken A Chennai 2001 N.A. P P P P P A P P
202 Chicken A Chennai 2002 N.A. A P P P P A P A
206 Chicken B Chennai 2002 N.A. P P P P P A P A
222 Buffalo A Mathura 2002 N.A. P P A P P A P P
258 Chicken A Nasik 2002 N.A. P P P P P A P P
330 Chicken B Anand 2002 N.A. P P P P P A P P
288 Buffalo B Bhubaneswar 2003 N.A. P P P P P A P P
291 Pig B Guwahati 2003 N.A. P P A P P A P P
292 Pig B Guwahati 2003 N.A. P P P P P A P A
366 Cattle B Palampur 2004 N.A. P A A P P A P P
390 Buffalo B Palampur 2005 N.A. P P P P P A P P
400 Buffalo B Ludhiana 2005 N.A. P P P P P A P P
407 Chicken B Ludhiana 2005 N.A. P P P P P A P P
409 Buffalo B Jammu 2005 N.A. P P P P P A P P
410 Buffalo B Jammu 2005 N.A. P P P P P A P P
425 Duck B Chennai 2005 N.A. P P P P P P P P
448 Rabbit B Palampur 2006 N.A. P P A P P A P P
456 Chicken A Chennai 2006 N.A. P P P P P A P P
460 Chicken A Chennai 2006 N.A. A A A P P A P A
464 Chicken A Chennai 2006 N.A. A P P P P A P P
569 Chicken A Chennai 2007 N.A. P A A P P A P A
537 Pig A Guwahati 2007 N.A. A A A P P A A P
540 Pig A Guwahati 2007 N.A. P P P P P P P P
543 Pig D Guwahati 2007 N.A. P P P P P P P A
550 Duck A Guwahati 2007 N.A. P A P P P P P P
555 Buffalo B Anand 2007 N.A. P P A P P A P A
559 Rabbit B Palampur 2007 Nasal discharge P P A P P A P P
563 Cattle B Anand 2007 N.A. P P A P P A P P
585 Pig A Guwahati 2008 N.A. P P A P P P P P
587 Pig A Guwahati 2008 N.A. P P P P P P P P
602 Buffalo B Palampur 2008 N.A. P P P P P A P P
608 Rabbit A Palampur 2008 Nasal discharge P P P P P A P P
610 Buffalo B Ludhiana 2008 N.A. A A A P P A P A
618 Chicken B Palampur 2008 N.A. P P P P P A P P
632 Buffalo B Anand 2008 N.A. A A A P P A P P
633 Chicken B Bangalore 2008 N.A. P A P P P A P P
655 Buffalo D Guwahati 2008 N.A. P P P P P A P P
701 Pig A Guwahati 2009 N.A. P P A P P P P P
702 Pig A Guwahati 2009 N.A. P P P P P A P P
703 Pig D Guwahati 2009 N.A. P P P P P P P A
704 Cattle B Guwahati 2009 N.A. P P A A P A P P
720 Pig B UP 2009 N.A. P P P P P A P P
721 Pig B UP 2009 N.A. P P P P P A P P
722 Pig B UP 2009 N.A. P P A P P P P P
725 Buffalo A Ludhiana 2009 N.A. P P P P P P P A
733 Pig D Guwahati 2009 N.A. P A P P P P P A
736 Pig D Guwahati 2009 N.A. P P P A P A P A
737 Pig D Guwahati 2009 N.A. P P P A P A P A
749 Cattle A Palampur 2009 N.A. P P P P P A P P
746 Cattle A Palampur 2009 N.A. P P P P P A P P
747 Cattle A Palampur 2009 N.A. P P P P A A P P
754 Cattle A Palampur 2009 N.A. P P P P P A P P
782 Chicken A Anand 2009 N.A. A P A P P A P A
794 Chicken A Thrissur 2009 Necrotic foci in liver and haemorrhage in heart P P P P P A P A
652 Buffalo B Guwahati 2010 N.A. P P P P P A P P
653 Buffalo B Guwahati 2010 N.A. P P P P P A P P
784 Chicken A Anand 2010 N.A. P P P P P A P P
803 Chicken A Chennai 2010 N.A. P P P P P A P P
804 Chicken A Anand 2010 N.A. P P P P P A P P
811 Cattle A Palampur 2010 N.A. P P P P P A P P
852 Pig A Guwahati 2011 Diseased P P P P P P P P
860 Pig B Guwahati 2011 Diseased P P P P P A P P
876 Pig A Thrissur 2011 Fever A A A P P A A P
877 Pig A Thrissur 2011 Fever A A P P P A P P
879 Pig A Thrissur 2011 Fever A P A P P A P A
890 Emu A Chennai 2011 N.A. P P P P P A P P
2751 Cattle B Palampur 2011 Nasal discharge P P A P P A P P
2766 Cattle B Palampur 2011 Nasal discharge P P P P P A P P
3324 Cattle B Palampur 2011 Nasal discharge P P A P P A P P
4312 Cattle B Palampur 2011 Nasal discharge P P A P P A P P
BP23 Pig B Guwahati 2011 N.A. P A A P P A P P
BP28 Pig A Guwahati 2011 N.A. P A P P P P P P
BP37 Pig A Guwahati 2011 N.A. P P A P P P P P
EMU 2 Emu A Chennai 2011 N.A. P P P P P A P P
JP18 Pig A Guwahati 2011 N.A. P P P P P P P P
NP23 Pig B Guwahati 2011 N.A. P P P P P A P P
NP37 Pig B Guwahati 2011 N.A. P P P P P A P P
PP1A Pig A Thrissur 2011 N.A. P P P P P A P P
PP2A Pig A Thrissur 2011 N.A. P P P P P P P P
PP4A Pig A Thrissur 2011 N.A. P P P P P A P P
914 Duck A Thrissur 2012 N.A. P P P P P A P P
920 Emu A Anand 2012 N.A. P P P P P A P P
922 Emu A Anand 2012 N.A. P P P P P A P P
DP53 Duck A Thrissur 2013 N.A. P P P P P A P A
DP54 Duck A Thrissur 2013 N.A. P P P P P P P A
DP55 Duck A Thrissur 2013 N.A. A P P P P A P A
DP56 Duck A Thrissur 2013 N.A. P P P P P A P A
P14 Pig D Guwahati 2013 N.A. A A A A P P A A
P15 Pig A Guwahati 2013 N.A. A A A A P A P A
P16 Pig D Guwahati 2013 N.A. A A P A P A A A
PAB 78 Buffalo B Anand 2013 N.A. P P A P P A P P
PAB 80 Buffalo B Anand 2013 N.A. P P A P P A P P
PAB 86 Buffalo B Anand 2013 N.A. A A A A A A P P
PAP 88 Chicken A Anand 2013 N.A. P P P P P A P A
LDHB 106 Buffalo B Ludhiana 2014 N.A. A P A P P A P P
MSRB 108 Buffalo B Ludhiana 2014 N.A. A P P P P A P P
Open in a new tab

(N.A. = not available; A = absence of virulence gene; P = presence of virulence gene as detected in PCR reaction).

2.2. Confirmation of P. multocida Isolates

The isolates were revived in brain heart infusion broth by 18–24 h incubation at 37°C and plated subsequently onto blood agar to study cultural characteristics. The cultures were then tested for purity by biochemical tests as per standard techniques [20]. The genomic DNA of the isolates was extracted by CTAB method [21], and the isolates were reconfirmed as P. multocida by PM-PCR followed by determination of capsular type by multiplex PCR [22, 23].

2.3. Detection of Virulence Associated Genes by PCR

The isolates were then subjected to screening of 8 virulence genes encoding iron binding proteins (TbpA, HgbA, HgbB), colonization and adhesion related protein (PfhA, PtfA), sialidases (NanB, NanH), and dermonecrotoxin (ToxA) by individual PCR reactions, utilizing oligonucleotide primers described previously. The details of the virulence genes, sequences of the oligonucleotide primers, and citations used are listed in Table 2.

Table 2.

Details of primers and citations used for the detection of capsular type and virulence associated genes in strains of Pasteurella multocida.

Gene Primer Primer sequence (5′-3′) Reference
PM-PCR and Capsular serotypes
KMT1 PMPCR-F
PMPCR-R		 ATCCGCTATTTACCCAGTGG
GCTGTAAACGAACTCGCCAC		 [22]
hyaD-hyaC capA F
capA R		 GATGCCAAAATCGCAGTCAG
TGTTGCCATCATTGTCAGTG		 [23]
bcbD capB F
capB R		 CATTTATCCAAGCTCCACC
GCCCGAGAGTTTCAATCC		 [23]
dcbF capD F
capD R		 TTACAAAAGAAAGACTAGGAGCCC
CATCTACCCACTCAACCATATCAG		 [23]
ecbJ capE F
capE R		 TCCGCAGAAAATTATTGACTC
GCTTGCTGCTTGATTTTGTC		 [23]
fcbD capF F
capF R		 AATCGGAGAACGCAGAAATCAG
TTCCGCCGTCAATTACTCTG		 [23]
Iron acquisition genes
tbpA tbpA F
tbpA R		 GGACAGTGCATATAACTTGTT
GGACAGTGCATATAACTTGTTTACTA 		[32]
hgbA hgbA F
hgbA R		 CATATCGGATCCTTGAAACCAGAGGAAGCAAAAA
GAATCGGAGCTCACGACCTGGTGAGTAAAAACGAT		 In-house [33]
hgbB HgbB F
HgbB R		 ACCGCGTTGGAATTATGATTG
CATTGAGTACGGCTTGACAT		 [12]
Adhesins
ptfA ptfA F
ptfA R		 AGGATCCATGAAAAAAGCCATTT
GGAGCTCTTATGCGCAAAATCCTG		 In-house
pfhA pfhA F
pfhA R		 TAAGCCTATCGGTTCAAGTCG
GATAAATCTACCCCGTCCTCT		 In-house
Sialidases
NanB NanB F
NanB R		 GTCCTATAAAGTGACGCCGA
ACAGCAAAGGAAGACTGTCC		 [12]
nanH nanH F
nanH R		 CACTGCCTTATAGCCGTATTC
AGCACTGTTACCCGAACCC		 [12]
Dermonecrotoxin
ToxA ToxA F
ToxA R		 TCTTAGATGAGCGACAAGG
GAATGCCACACCTCTATAG		 [34]
Open in a new tab

2.4. Statistical Analysis

Statistical analysis of the data generated from the study was performed with SPSS 16.0 (SPSS Inc., Chicago). P values of <0.05 were considered as statistically significant.

3. Results and Discussion

P. multocida is an economically important veterinary pathogen, causing wide range of diseases in livestock and poultry. The bacteria have been classified into five capsular types (A, B, D, E, and F) based on capsular typing, with each capsule type being predominantly associated with a particular disease in a host species. But isolation of other capsular types from such hosts by cross species infection is not uncommon [2, 7]. Ability of the bacteria to infect and survive in several hosts as commensal exposes it to various selection pressures, resulting in emergence of divergent strains in field scenario. Molecular epidemiological study by employing REP-PCR, ERIC-PCR, MLST analysis, and so forth has confirmed the diversity of P. multocida circulating in India and also the possibility of transboundary spread of strains across evolutionary time [24, 25]. Therefore, a detailed study on the presence of virulence associated genes recovered from different host species in Indian subcontinent will be helpful to understand the disease process and to develop disease control measures in future.

In this study, P. multocida isolates recovered from various host species were screened for presence of 8 important virulence associated genes (tbpA, hgbA, hgbB, pfhA, ptfA, nanB, nanH, and toxA) involved in bacterial pathogenesis. The results confirmed that, with the exception of toxA gene, all other virulence associated genes are regularly distributed among the isolates of different host origin. The result of individual PCR reaction for each isolate is presented in Table 1. Among the genes encoding iron binding proteins, tbpA gene was present in 82.4% of isolates which range from 69.6% in buffalo to 100% in cattle, emu, and rabbits (Table 3). Similarly, hgbA gene was found to be regularly distributed among all isolates affecting different hosts with the lowest prevalence among swine isolates (73.5%). Gene hgbB has the lowest prevalence among the three iron binding proteins screened in this study and was found in 72.2% of the isolates. The percentage prevalence of this gene was found to be more among avian isolates (90%) in comparison to large ruminants (65.9%) and swine (67.6%) isolates. Of the two sialidases present in P. multocida isolates, the percentage prevalence of nanB gene was found to be more than nanH gene. Overall very high prevalence of pfhA gene (93.5%) was observed in this study with 100% prevalence among avian isolates. Dermonecrotoxin gene (toxA) was found only in 17.6% of strains with majority of the isolates belonging to porcine origin. One buffalo and 3 duck isolates were also found to carry toxA gene (Table 3).

Table 3.

Prevalence of virulence associated genes among Pasteurella multocida isolates recovered from various host species of India.

Host origin/capsular type No. of strains tbpA (%) hgbA (%) hgbB (%) pfhA (%) ptfA (%) nanB (%) nanH (%) toxA (%)
Buffalo 23 69.6 82.6 65.2 95.7 95.7 100 78.3 4.3
Cap type A 5 80.0 80.0 80.0 100 100 100 60.0 20.0
Cap type B 17 64.7 82.3 58.8 94.1 94.1 100 82.3 0.0
Cap type D 1 100 100 100 100 100 100 100 0.0
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cattle 18 100 94.4 66.7 94.4 94.4 100 100 0.0
Cap type A 5 100 100 100 100 80.0 100 100 0.0
Cap type B 11 100 90.9 45.4 90.9 100 100 100 0.0
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 2 100 100 100 100 100 100 100 0.0
Large ruminants (cattle + buffalo) 41 82.9 87.8 65.9 95.1 95.1 100 87.8 2.4
Cap type A 10 90.0 90.0 90.0 100 90.0 100 80.0 10.0
Cap type B 28 78.5 85.7 53.5 92.8 96.4 100 89.2 0.0
Cap type D 1 100 100 100 100 100 100 100 0.0
Cap type F 2 100 100 100 100 100 100 100 0.0
Chicken 18 77.8 83.3 83.3 100 100 100 61.1 0.0
Cap type A 13 69.2 84.6 76.9 100 100 100 53.8 0.0
Cap type B 5 100 80.0 100 100 100 100 80.0 0.0
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Duck 8 87.5 87.8 100 100 100 100 50.0 37.5
Cap type A 7 85.7 85.7 100 100 100 100 42.8 28.5
Cap type B 1 100 100 100 100 100 100 100 100
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Emu 4 100 100 100 100 100 100 100 0.0
Cap type A 4 100 100 100 100 100 100 100 0.0
Cap type B 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Avian (chicken + duck + emu) 30 83.3 86.7 90.0 100 100 100 63.3 10.0
Cap type A 24 79.1 87.5 87.5 100 100 100 58.3 8.3
Cap type B 6 100 83.3 100 100 100 100 83.3 16.6
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Rabbit 3 100 100 33.3 100 100 100 100 0.0
Cap type A 1 100 100 100 100 100 100 100 0.0
Cap type B 2 100 100 0.0 100 100 100 100 0.0
Cap type D 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Pig 34 79.4 73.5 67.6 85.3 100 88.2 67.6 44.1
Cap type A 18 72.2 72.2 61.1 94.4 100 88.8 83.3 44.2
Cap type B 9 100 88.8 66.6 100 100 100 88.8 11.1
Cap type D 7 71.4 57.1 85.7 42.8 100 71.4 0.0 57.1
Cap type F 0 N.A. N.A. N.A. N.A. N.A. N.A. N.A. N.A.
Total (all isolates) 108 82.4 83.3 72.2 93.5 98.1 96.3 75.0 17.6
Cap type A 53 79.2 83.0 79.2 98.0 98.0 96.2 71.7 24.5
Cap type B 45 86.7 86.7 60.0 95.6 97.8 100 88.9 4.4
Cap type D 8 75.0 62.5 87.5 50.0 100 75.0 12.5 50.0
Cap type F 2 100 100 100 100 100 100 100 0.0
Open in a new tab

Iron acquisition and uptake are essential for bacterial survival, and many bacteria have developed different iron sequestering system for uptake of iron. The expression of iron acquisition proteins increases under iron limiting condition, as well as in vivo condition (reviewed in [5]). P. multocida utilizes various receptors for adapting to variations in supply of different haem iron sources [5]. Among these, TbpA protein is necessary for extraction of iron from transferrin and has been reported to be an important virulence factor and epidemiological marker in cattle [12, 19, 26]. Previous studies reported that tbpA gene is either absent or rarely present in poultry, swine, and rabbit isolates (Table 4) [12–16]. In contrast to these findings, we observed a very high occurrence of tbpA gene among poultry (83.3%), swine (79.4%), and rabbit (100%) isolates (Tables 3 and 4). Among the host species, the prevalence of this gene was found to be lowest (69.6%) in buffalo (Table 3). The difference in prevalence of this gene among isolates of cattle and buffalo origin was found to be statistically significant (P < 0.05), which is quite unexpected. Therefore more number of isolates from both host origins should be carried out before reaching any conclusion. In this study, tbpA gene was found to be frequently distributed among four capsule types, including CapF (Table 3). This is in contrast to Ewers et al. [12], who observed tbpA gene in 70% of CapB strains, followed by 37% of CapA, 9.5% of CapD strains and nil in CapF strains. Similarly, Katsuda et al. [18] reported positive association of CapA strain with tbpA gene.

Table 4.

Comparison of the distribution of virulence associated genes among Pasteurella multocida isolates recovered from various host species across the globe.

Gene/host Cattle Buffalo Poultry Pig Rabbit
Country (reference) No. of strains tested Prevalence (%) Country (reference) No. of strains tested Prevalence (%) Country (reference) No. of strains tested Prevalence (%) Country (reference) No. of strains tested Prevalence (%) Country (reference) No. of strains tested Prevalence (%)
tbpA India (this study) 18 100 India (this study) 23 69.6 India (this study) 30 83.3 India (this study) 34 79.4 India (this study) 03 100
Germany [12] 104 70.2 Germany [12] 07 57.1 Germany [12] 20 0.0 Germany [12] 52 0.0 Germany [12] 20 0.0
Japan [18] 378 76.2             Spain [15] 205 0.0 Brazil [16] 46 8.6
India [19] 23 100             Germany [13] 382 0.0      
hgbA India (this study) 18 94.4 India (this study) 23 82.6 India (this study) 30 86.7 India (this study) 34 73.5 India (this study) 03 100
Germany [12] 104 95.2 Germany [12] 07 100 Germany [12] 20 90.0 Germany [12] 52 98.1 Germany [12] 20 100
Japan [18] 378 95.5       Brazil [17] 25 100 Spain [15] 205 100 Brazil [16] 46 73.9
India [19] 23 100             Germany [13] 382 100      
                  China [14] 233 96.6      
hgbB India (this study) 18 66.7 India (this study) 23 65.2 India (this study) 30 90.0 India (this study) 34 67.6 India (this study) 03 33.3
Germany [12] 104 57.7 Germany [12] 07 85.7 Germany [12] 20 85.0 Germany [12] 52 86.5 Germany [12] 20 100
Japan [18] 378 61.4       Brazil [17] 25 100 Spain [15] 205 60.5 Brazil [16] 46 30.4
India [19] 23 26.1             Germany [13] 382 84.3      
ptfA India (this study) 18 94.4 India (this study) 23 95.7 India (this study) 30 100 India (this study) 34 100 India (this study) 03 100
Germany [12] 104 99.0 Germany [12] 07 100 Germany [12] 20 100 Germany [12] 52 100 Germany [12] 20 100
Japan [18] 378 94.7       Brazil [17] 25 92.0 Spain [15] 205 100 Brazil [16] 46 93.4
India [19] 23 86.9             Germany [13] 382 100      
                  China [14] 233 93.6      
pfhA India (this study) 18 94.4 India (this study) 23 95.7 India (this study) 30 100 India (this study) 34 85.3 India (this study) 03 100
Germany [12] 104 46.2 Germany [12] 07 100 Germany [12] 20 45.0 Germany [12] 52 21.2 Germany [12] 20 75.0
Japan [18] 378 52.4       Brazil [17] 25 60.0 Spain [15] 205 40.5 Brazil [16] 46 0.0
India [19] 23 100             Germany [13] 382 20.9      
                  China [14] 233 15.0      
nanB India (this study) 18 100 India (this study) 23 100 India (this study) 30 100 India (this study) 34 88.2 India (this study) 03 100
Germany [12] 104 100 Germany [12] 07 100 Germany [12] 20 100 Germany [12] 52 100 Germany [12] 20 100
Japan [18] 378 100       Brazil [17] 25 100 Spain [15] 205 100 Brazil [16] 46 95.6
India [19] 23 0.0             Germany [13] 382 100      
                  China [14] 233 81.5      
nanH India (this study) 18 100 India (this study) 23 78.3 India (this study) 30 63.3 India (this study) 34 67.6 India (this study) 03 100
Germany [12] 104 88.5 Germany [12] 07 100 Germany [12] 20 65.0 Germany [12] 52 98.1 Germany [12] 20 100
Japan [18] 378 88.4       Brazil [17] 25 96.0 Spain [15] 205 100 Brazil [16] 46 67.3
India [19] 23 100             Germany [13] 382 100      
                  China [14] 233 97.0      
toxA India (this study) 18 0.0 India (this study) 23 4.3 India (this study) 30 10.0 India (this study) 34 44.1 India (this study) 03 0.0
Germany [12] 104 5.8 Germany [12] 07 0.0 Germany [12] 20 5.0 Germany [12] 52 36.5 Germany [12] 20 0.0
India [19] 23 0.0       Brazil [17] 25 0.0 Spain [15] 205 7.8 Brazil [16] 46 0.0
                  Germany [13] 382 3.4      
                  China [14] 233 4.7      
Open in a new tab

P. multocida utilizes two proteins (HgbA and HgbB) for acquiring iron directly from haem component. Morton et al. [27] reported that the presence of both proteins might provide increased uptake of iron and protection against negative effects of mutation in one of the encoding genes. Between these two proteins, hgbA gene was found to be regularly distributed (>95% prevalence) among isolates [12–15, 17, 18]. In the present study, 73.5% of porcine isolates were found to carry this gene, which is lower in comparison to previous findings, that is, nearly 100% prevalence (Table 4) [12–15]. The frequency of hgbB gene varies among strains of different host origin and also with disease status of the animal [12, 15, 16, 18, 19]. In this study, 72.2% of the isolates were found to carry this gene with highest frequency observed among avian strains (90%), which is in agreement with previous reports (Table 4) [12, 17].

Among the genes encoding proteins involved in bacterial colonization and adhesion, ptfA gene has the highest (98.1%) prevalence (Table 3). This gene encodes type 4 fimbria subunit and has been associated with bovine diseases [19]. Worldwide, this gene is regularly distributed with more than 85% prevalence among P. multocida isolates, irrespective of host origin and capsule type (Table 4).

pfhA gene encoding filamentous haemagglutinin is an important epidemiological marker and the presence of this gene has been correlated with occurrence of disease in cattle, swine and sheep [12, 13, 18, 19, 28]. Almost all previous studies reported low prevalence of this gene with varying frequencies in between 46–52%, 45–60%, and 15–40.5% among isolates of cattle, poultry, and pig origin, respectively (Table 4) [12–15]. But interestingly, very high prevalence, 85.3% (pig) to 100% (avian), of this gene was observed among Indian isolates (Table 3). This suggests pfhA gene might be providing survival advantage to the bacterium in the host and the occurrence of horizontal gene transfer has led to such high prevalence among Indian strains/clones.

Sialidases play an important role in colonization to epithelial surface. They enhance bacterial virulence by unmasking key host receptor and by reducing the effectiveness of mucin [5, 29]. Of the two sialidases (NanB and NanH) present in P. multocida isolates, the nanB gene was found in almost all isolates, whereas the prevalence of nanH varied according to host origin and geographical location. In this study, the frequency of nanH gene among poultry isolates was found to be low (63.3%), which is in contrast to the report of Furian et al. [17] (Table 4). Similarly, the carriage of nanH gene among isolates of pig origin from India was also found to be lower (67.6%) in comparison to isolates from other parts of the globe, which reported higher (>97%) frequency (Table 4) [12–15].

Dermonecrotoxin (sometimes called P. multocida toxin) is encoded by toxA gene. This gene was initially detected in serotype D isolates and was found to be associated with atrophic rhinitis in pigs. Later on, it was detected in strains of serotype A from pigs and other hosts [30]. In this study, toxA gene was detected in 44.1% of pig isolates. Further, one buffalo and three duck isolates were also found positive for toxA gene (Table 3). Two serotype B isolates were found to carry this gene which is in agreement with our previous findings (Sarangi et al., submitted for publication). A lysogenic bacteriophage infection of P. multocida resulting in horizontal gene transfer could be the reason [31].

The association of virulence associated genes with particular capsular type and host origin was assessed by the Chi-square and Fisher's exact test. Out of the 8 virulence associated genes studied toxA, pfhA, nanB, and nanH were found to be associated (positive or negative) with capsular type. pfhA, nanB, and nanH genes were found to be regularly distributed among all serotypes with the exception of serotype D. Negative association of pfhA gene with CapD strains has been reported previously [12, 14, 18]. Dermonecrotoxin encoded by toxA gene was found to be positively associated with capD and CapA. Ewers et al. [12] observed clear association of toxA gene with CapD strains which was later supported by similar reports from other workers [13, 14]. Among cattle isolates, a significant difference (P = 0.021) was observed in the distribution of hgbB gene among serotypes (Table 3). Similarly, for pig isolates the frequency of pfhA and nanH gene among serotypes was found to be statistically significant (Table 3). However, as the number of strains tested under each serotype was less, more number of samples should be tested before reaching any definite conclusion. In order to ascertain any trend in the distribution of virulence genes over time period, the strains used in the study were divided into two groups, contemporary (2009–2014) and archived (1992–2008), and statistical analysis was carried out. But no statistically significant difference was observed between the two groups with respect to virulence gene distribution (Table 1).

The prevalence of virulence associated genes was found to vary among P. multocida isolates recovered from various host species. Significant association between toxA and nanH genes with host origin was also observed. Dermonecrotoxin gene was found to be positively associated with porcine isolates, whereas nanH gene was found to be positively associated with large ruminant isolates, more specifically with cattle isolates, which agrees well with the findings of Ewers et al. [12].

The combination of genes among P. multocida isolates was assessed by the Chi-square and Fisher's exact test. Significant association was observed between tbpA-hgbA, tbpA-hgbB, tbpA-pfhA, tbpA-nanB, tbpA-nanH, hgbA-hgbB, hgbA-pfhA, hgbA-nanB, hgbA-nanH, pfhA-nanB, and pfhA-nanH. Similar association among iron acquisition genes, as well as between various virulence associated genes, has been reported previously by Ewers et al. [12].

To sum up, the present study revealed some unique epidemiological information on the prevalence of virulence associated genes among Indian strains in comparison to its equivalents in other parts of the globe. The result shows that with the exception of toxA gene the virulence associated genes are regularly distributed among P. multocida isolates. The occurrence of ptfA, hgbA, and nanH genes among swine isolates of Indian origin was found to be less in comparison to other countries. Gene encoding dermonecrotoxin was observed in 17.6% of the total isolates studied. This gene is present mostly among swine isolates, with few occurrences in buffalo and duck isolates. Interestingly, very high prevalence of tbpA gene was observed among poultry, swine, and rabbit isolates. Likewise, very high prevalence of pfhA gene was observed among Indian isolates, irrespective of host species origin. As proper history of majority of the isolates with respect to its disease status was not available, it was not possible to perform association study between virulence gene and disease status of the animal, which could have enhanced the significance of this study. Therefore, more number of isolates with proper history on disease status of the host should be carried out in future, which will be helpful to make a more definite conclusion, to provide insight into mechanism of pathogenesis, association of genes with outcome of the disease, and in future vaccine strategies.

Acknowledgments

Authors are thankful to Indian Council of Agricultural Research (ICAR), New Delhi, for providing financial support under “All India Network Programme on Haemorrhagic Septicaemia” and the Director, Indian Veterinary Research Institute (IVRI), Izatnagar, for providing facilities to conduct this study. The authors sincerely thank all the scientists and staff involved in AINP-HS project at IVRI and other collaborating centres who have been instrumental in isolating or maintaining the Pasteurella multocida isolates.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Harper M., Boyce J. D., Adler B. Pasteurella multocida pathogenesis: 125 years after pasteur. FEMS Microbiology Letters. 2006;265(1):1–10. doi: 10.1111/j.1574-6968.2006.00442.x. [DOI] [PubMed] [Google Scholar]
  • 2.Dziva F., Muhairwa A. P., Bisgaard M., Christensen H. Diagnostic and typing options for investigating diseases associated with Pasteurella multocida . Veterinary Microbiology. 2008;128(1-2):1–22. doi: 10.1016/j.vetmic.2007.10.018. [DOI] [PubMed] [Google Scholar]
  • 3.Shivachandra S. B., Viswas K. N., Kumar A. A. A review of hemorrhagic septicemia in cattle and buffalo. Animal Health Research Reviews. 2011;12(1):67–82. doi: 10.1017/S146625231100003X. [DOI] [PubMed] [Google Scholar]
  • 4.Verma R., Jaiswal T. N. Haemorrhagic septicaemia vaccines. Vaccine. 1998;16(11-12):1184–1192. doi: 10.1016/S0264-410X(98)80118-7. [DOI] [PubMed] [Google Scholar]
  • 5.Hatfaludi T., Al-Hasani K., Boyce J. D., Adler B. Outer membrane proteins of Pasteurella multocida . Veterinary Microbiology. 2010;144(1-2):1–17. doi: 10.1016/j.vetmic.2010.01.027. [DOI] [PubMed] [Google Scholar]
  • 6.Lin J., Huang S., Zhang Q. Outer membrane proteins: key players for bacterial adaptation in host niches. Microbes and Infection. 2002;4(3):325–331. doi: 10.1016/S1286-4579(02)01545-9. [DOI] [PubMed] [Google Scholar]
  • 7.Davies R. L., MacCorquodale R., Reilly S. Characterisation of bovine strains of Pasteurella multocida and comparison with isolates of avian, ovine and porcine origin. Veterinary Microbiology. 2004;99(2):145–158. doi: 10.1016/j.vetmic.2003.11.013. [DOI] [PubMed] [Google Scholar]
  • 8.Confer A. W. Immunogens of Pasteurella . Veterinary Microbiology. 1993;37(3-4):353–368. doi: 10.1016/0378-1135(93)90034-5. [DOI] [PubMed] [Google Scholar]
  • 9.Confer A. W., Nutt S. H., Dabo S. M., Panciera R. J., Murphy G. L. Antibody responses of cattle to outer membrane proteins of Pasteurella multocida A:3. The American Journal of Veterinary Research. 1996;57(10):1453–1457. [PubMed] [Google Scholar]
  • 10.Dabo S. M., Confer A. W., Murphy G. L. Outer membrane proteins of bovine Pasteurella multocida serogroup A isolates. Veterinary Microbiology. 1997;54(2):167–183. doi: 10.1016/S0378-1135(96)01274-6. [DOI] [PubMed] [Google Scholar]
  • 11.Blume V., Luque I., Vela A. I., Borge C., Maldonado A., Domínguez L., Tarradas C., Fernández-Garayzábal J. F. Genetic and virulence-phenotype characterization of serotypes 2 and 9 of Streptococcus suis swine isolates. International Microbiology. 2009;12(3):161–166. doi: 10.2436/20.1501.01.94. [DOI] [PubMed] [Google Scholar]
  • 12.Ewers C., Lübke-Becker A., Bethe A., Kiebling S., Filter M., Wieler L. H. Virulence genotype of Pasteurella multocida strains isolated from different hosts with various disease status. Veterinary Microbiology. 2006;114(3-4):304–317. doi: 10.1016/j.vetmic.2005.12.012. [DOI] [PubMed] [Google Scholar]
  • 13.Bethe A., Wieler L. H., Selbitz H.-J., Ewers C. Genetic diversity of porcine Pasteurella multocida strains from the respiratory tract of healthy and diseased swine. Veterinary Microbiology. 2009;139(1-2):97–105. doi: 10.1016/j.vetmic.2009.04.027. [DOI] [PubMed] [Google Scholar]
  • 14.Tang X., Zhao Z., Hu J., et al. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida strains from swine in China. Journal of Clinical Microbiology. 2009;47(4):951–958. doi: 10.1128/JCM.02029-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.García N., Fernández-Garayzábal J. F., Goyache J., Domínguez L., Vela A. I. Associations between biovar and virulence factor genes in Pasteurella multocida isolates from pigs in Spain. Veterinary Record. 2011;169(14):362. doi: 10.1136/vr.d4869. [DOI] [PubMed] [Google Scholar]
  • 16.Ferreira T. S. P., Felizardo M. R., Sena de Gobbi D. D., Gomes C. R., Filsner P. H. D. L. N., Moreno M., Paixão R., Pereira J. D. J., Micke Moreno A. Virulence genes and antimicrobial resistance profiles of Pasteurella multocida strains isolated from rabbits in Brazil. The Scientific World Journal. 2012;2012 doi: 10.1100/2012/685028.685028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Furian T. Q., Borges K. A., Rocha S. L. S., et al. Detection of virulence-associated genes of Pasteurella multocida isolated from cases of fowl cholera by multiplex-PCR. Pesquisa Veterinária Brasileira. 2013;33(2):177–182. doi: 10.1590/S0100-736X2013000200007. [DOI] [Google Scholar]
  • 18.Katsuda K., Hoshinoo K., Ueno Y., Kohmoto M., Mikami O. Virulence genes and antimicrobial susceptibility in Pasteurella multocida isolates from calves. Veterinary Microbiology. 2013;167(3-4):737–741. doi: 10.1016/j.vetmic.2013.09.029. [DOI] [PubMed] [Google Scholar]
  • 19.Verma S., Sharma M., Katoch S., Verma L., Kumar S., Dogra V., Chahota R., Dhar P., Singh G. Profiling of virulence associated genes of Pasteurella multocida isolated from cattle. Veterinary Research Communications. 2013;37(1):83–89. doi: 10.1007/s11259-012-9539-5. [DOI] [PubMed] [Google Scholar]
  • 20.Cowan S. T., Steel K. J. Manual for the Identification of Medical Bacteria. Cambridge, UK: Cambridge University Press; 1970. [Google Scholar]
  • 21.Wilson K. Preparation of genomic DNA from bacteria. In: Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A., Struhl K., editors. Current Protocols in Molecular Biology. Vol. 1. Brooklyn, NY, USA: Wiley-Interscience; 1987. pp. 2.4.1–2.4.5. [Google Scholar]
  • 22.Townsend K. M., Frost A. J., Lee C. W., Papadimitriou J. M., Dawkins H. J. S. Development of PCR assays for species- and type-specific identification of Pasteurella multocida isolates. Journal of Clinical Microbiology. 1998;36(4):1096–1100. doi: 10.1128/jcm.36.4.1096-1100.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Townsend K. M., Boyce J. D., Chung J. Y., Frost A. J., Adler B. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. Journal of Clinical Microbiology. 2001;39(3):924–929. doi: 10.1128/JCM.39.3.924-929.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Shivachandra S. B., Kumar A. A., Gautam R., Joseph S., Saxena M. K., Chaudhuri P., Srivastava S. K. Characterization of avian strains of Pasteurella multocida by restriction endonuclease and amplified fragment length polymorphism. Research in Veterinary Science. 2006;81(1):8–18. doi: 10.1016/j.rvsc.2005.10.009. [DOI] [PubMed] [Google Scholar]
  • 25.Sarangi L. N., Thomas P., Gupta S. K., Kumar S., Viswas K. N., Singh V. P. Molecular epidemiology of Pasteurella multocida circulating in India by Multilocus sequence typing. Transboundry and Emerging Diseases. 2014 doi: 10.1111/tbed.12270. [DOI] [PubMed] [Google Scholar]
  • 26.Cox A. J., Hunt M. L., Boyce J. D., Adler B. Functional characterization of HgbB, a new hemoglobin binding protein of Pasteurella multocida . Microbial Pathogenesis. 2003;34(6):287–296. doi: 10.1016/S0882-4010(03)00062-7. [DOI] [PubMed] [Google Scholar]
  • 27.Morton D. J., Whitby P. W., Jin H., Ren Z., Stull T. L. Effect of multiple mutations in the hemoglobin- and hemoglobin- haptoglobin-binding proteins, HgpA, HgpB, and HgpC, of Haemophilus influenzae type b. Infection and Immunity. 1999;67(6):2729–2739. doi: 10.1128/iai.67.6.2729-2739.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Shayegh J., Atashpaz S., Hejazi M. S. Virulence genes profile and typing of ovine Pasteureila multocida . Asian Journal of Animal and Veterinary Advances. 2008;3(4):206–213. doi: 10.3923/ajava.2008.206.213. [DOI] [Google Scholar]
  • 29.Vimr E., Lichtensteiger C. To sialylate, or not to sialylate: that is the question. Trends in Microbiology. 2002;10(6):254–257. doi: 10.1016/S0966-842X(02)02361-2. [DOI] [PubMed] [Google Scholar]
  • 30.Jaglic Z., Kucerova Z., Nedbalcova K., Pavlik I., Alexa P., Bartos M. Characterisation and comparison of Pasteurella multocida isolated from different species in the Czech Republic: capsular PCR typing, ribotyping and dermonecrotoxin production. Veterinarni Medicina. 2005;50(8):345–354. [Google Scholar]
  • 31.Pullinger G. D., Bevir T., Lax A. J. The Pasteurella multocida toxin is encoded within a lysogenic bacteriophage. Molecular Microbiology. 2004;51(1):255–269. doi: 10.1046/j.1365-2958.2003.03829.x. [DOI] [PubMed] [Google Scholar]
  • 32.Ogunnariwo J. A., Schryvers A. B. Characterization of a novel transferrin receptor in bovine strains of Pasteurella multocida . Journal of Bacteriology. 2001;183(3):890–896. doi: 10.1128/JB.183.3.890-896.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Jain A., Thomas P., Viswas K. N., Singh V. P., Gupta S. K. Cloning and sequence analysis of outer membrane protein genes of Pasteurella multocida serotype B:2. Indian Journal of Comparative Microbiology Immunology Infectious Diseases. 2013;34(1):24–28. [Google Scholar]
  • 34.Lichtensteiger C. A., Steenbergen S. M., Lee R. M., Polson D. D., Vimr E. R. Direct PCR analysis for toxigenic Pasteurella multocida . Journal of Clinical Microbiology. 1996;34(12):3035–3039. doi: 10.1128/jcm.34.12.3035-3039.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Scientific World Journal are provided here courtesy of Wiley

RESOURCES