Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2014 Nov 10;143(4):679–691. doi: 10.1111/imm.12353

Inhibition of CD1d-mediated antigen presentation by the transforming growth factor-β/Smad signalling pathway

Jennifer C Bailey 1,†, Abhirami K Iyer 1,†, Gourapura J Renukaradhya 1, Yinling Lin 1, Hoa Nguyen 2, Randy R Brutkiewicz 1,✉
PMCID: PMC4253516  PMID: 24990409

Abstract

CD1d-mediated lipid antigen presentation activates a subset of innate immune lymphocytes called invariant natural killer T (NKT) cells that, by virtue of their potent cytokine production, bridge the innate and adaptive immune systems. Transforming growth factor (TGF-β) is a known immune modulator that can activate the mitogen-activated protein kinase p38; we have previously shown that p38 is a negative regulator of CD1d-mediated antigen presentation. Several studies implicate a role for TGF-β in the activation of p38. Therefore, we hypothesized that TGF-β would impair antigen presentation by CD1d. Indeed, a dose-dependent decrease in CD1d-mediated antigen presentation and impairment of lipid antigen processing was observed in response to TGF-β treatment. However, it was found that this inhibition was not through p38 activation. Instead, Smads 2, 3 and 4, downstream elements of the TGF-β canonical signalling pathway, contributed to the observed effects. In marked contrast to that observed with CD1d, TGF-β was found to enhance MHC class II-mediated antigen presentation. Overall, these results suggest that the canonical TGF-β/Smad pathway negatively regulates an important arm of the host’s innate immune responses – CD1d-mediated lipid antigen presentation to NKT cells.

Keywords: antigen presentation/processing, rodent, signal transduction

Introduction

CD1d is a member of the CD1 family of antigen-presenting molecules and a non-polymorphic, MHC class I-like cell surface glycoprotein, expressed on many haematopoietic cells and non-haematopoeitic tissues.1 Unlike MHC class I molecules that present peptide antigens, CD1d presents lipid antigens to a subpopulation of T lymphocytes called natural killer T (NKT) cells.2 There are two types of NKT cells: Type I (or ‘invariant’) NKT cells express an invariant T-cell receptor (TCR) α-chain (Vα14 Jα18 paired with Vβ8, Vβ7 or Vβ2 in mice, and Vα24 Jα18 paired with Vβ11 in humans). Type II NKT cells have a diverse TCR repertoire.3 Activated NKT cells produce both pro- and anti-inflammatory cytokines and can thereby cross-talk with other cells of the innate and adaptive immune responses. Therefore, NKT cells are important immunoregulatory cells that can influence the outcome of diverse immune responses.4

Transforming growth factor-β (TGF-β) is a potent cytokine that contributes to immune homeostasis via its pleiotropic effects on diverse immune cells, such as professional antigen-presenting cells (APC) [dendritic cells (DC), macrophages, B cells], T cells, natural killer (NK) cells and granulocytes.5 TGF-β1 is the predominant isoform produced by the immune system.6 It mediates its biological effects via type I and type II transmembrane serine/threonine kinase receptors and intracellular transcription factors known as Smads (the receptor regulated Smads 2, 3 and the common Smad, Smad4).7–9

We have previously reported that CD1d-mediated antigen presentation is regulated by several cell signalling pathways.10–16 Vesicular stomatitis virus and vaccinia virus impair antigen presentation by CD1d via activation of the p38 mitogen-activated protein kinase (MAPK) pathway.15,16 However, it is not known how p38 is activated to induce this regulation. Interestingly, besides the activation of Smads, TGF-β can also stimulate numerous other signalling pathways, including the p38 MAPK.17 Furthermore, several pathogens (bacteria, parasites, viruses) are known to use the TGF-β pathway to establish an infection and evade the host’s immune response.18 Of additional importance, TGF-β signalling also enables tumour cells to evade immune surveillance; for example, over-expression of TGF-β at the tumour site is associated with poor prognosis in several human cancers.19 Given the pleiotropic effect of TGF-β on different immune cells and evidence that TGF-β can activate p38, a negative regulator of CD1d-mediated antigen presentation,16 it was possible that TGF-β may control antigen presentation by CD1d. Therefore, in this study, we sought to determine whether TGF-β could impact CD1d-mediated antigen presentation to NKT cells.

Materials and methods

Mice

Female C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and were used from 6 to 8 weeks of age. All procedures were approved by the Institutional Animal Care and Use Committee of the Indiana University School of Medicine.

Cell lines and other reagents

Murine LMTK-CD1d120 and L-CD1d1-DR4 cells21 (the latter kindly provided by Dr J. Blum, Indiana University School of Medicine, Indianapolis, IN) have been described, and were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (BioWhittaker/Lonza, Walkersville, MD) supplemented with 10% bovine growth serum (BGS; Hyclone, Logan, UT), 2 mm l-glutamine and 500 μg/ml G418. The TCR Vα14+ mouse CD1d-specific type I NKT cell hybridomas, DN32.D322 and N38-2C12, N38-3C3 and the TCR Vα5+ type II NKT cell hybridoma N37-1A12 (kindly provided by Dr K. Hayakawa, Fox Chase Cancer Center, Philadelphia, PA) have all been previously described23,24 and were cultured in Iscove’s modified Dulbecco’s medium (BioWhittaker/Lonza) supplemented with 5% fetal bovine serum (FBS; Hyclone) and 2 mm l-glutamine. The 17.9 T-cell hybridoma specific for the epitope HSA64–76 from human serum albumin25 was a kind gift from Dr J. Blum (Indiana University School of Medicine, Indianapolis, IN) and was cultured in RPMI-1640 medium (BioWhittaker/Lonza) supplemented with 10% FBS, 2 mm l-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin and 50 μm 2-mercaptoethanol. Wild-type (WT) and dominant-negative (DN) p38 cDNA were cloned into the pcDNA3.1-neo vector and kindly provided by Dr D. Donner (Indiana University School of Medicine, Indianapolis, IN) with permission from Dr Jiahuai Han (The Scripps Research Institute, La Jolla, CA). LMTK-CD1d1 (mouse cd1d1 in pcDNA3.1-zeo vector) cells were transfected with p38 WT or DN vectors, grown in 500 µg/ml G418-containing medium, and resistant cells were used as stable transfectants. HEK 293T cells were kindly provided by Dr P. Cohen (University of Dundee, UK) and were cultured in DMEM supplemented with 10% BGS, 2 mm l-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. Recombinant human TGF-β1 was purchased from Peprotech, Inc. (Rocky Hill, NJ). Recombinant murine interleukin-2 (IL-2) and IL-13 used as standards in the ELISA were also purchased from Peprotech. Avidin peroxidase (Sigma-Aldrich, St Louis, MO) and 2,2-azino-bis-(3-ethyl-benzthiazoline-6-sulphonic acid) chromogenic substrate (MP Biomedicals, Solon, OH) were used for the detection of cytokines by ELISA as described previously.20

Antibodies

Anti-mouse CD1d (1H6),20 an isotype control for 1H6 [anti-vaccinia protein (TW2.3)],11 anti-mouse MHC Class I (T1B126; American Type Culture Collection, Manassas, VA), pan-anti-HLA-DR Purified antibody (BD Biosciences, San Jose, CA), phycoerythrin-conjugated rabbit anti-mouse IgG (Dako, Carpinteria, CA) and phycoerythrin-conjugated donkey anti-rat IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) were used for flow cytometry. For Western blotting, antibodies specific for p38 (phospho- and total-p38), Smad2, Smad3, Smad4 (total Smads) and GAPDH were purchased from Cell Signaling Technology (Danvers, MA) and peroxidase-conjugated anti-rabbit IgG (BioRad, Hercules, CA) was used as a secondary antibody. Purified and biotinylated monoclonal antibodies specific for the murine IL-2 ELISA were purchased from BD Biosciences (Bedford, MA) and those for the murine IL-13 ELISA were purchased from eBioScience, Inc. (San Diego, CA).

Generation of bone marrow-derived dendritic cells

Bone marrow-derived DC (BMDC) were generated as previously described.10 Briefly, femurs and tibias were flushed with 10 ml RPMI-1640 medium containing 1% FBS using a 27-gauge needle attached to a 10-ml syringe. The bone marrow cells were then cultured in RPMI-1640 medium supplemented with 10% FBS, 2 mm l-glutamine, 50 µm 2-mercaptoethanol, and antibiotics, as well as 10 ng/ml of murine granulocyte–macrophage colony-stimulating factor and IL-4. On day 6, BMDC were treated with 10 ng/ml lipopolysaccharide for 24 hr. On day 7, the plates were gently flushed (three or four times) to remove the loosely adherent cells, which were subsequently used as APC in an NKT cell co-culture assay.

Lentivirus-mediated knockdown of Smads 2, 3 and 4

Small hairpin RNAs (shRNAs) against Smads 2, 3 and 4 or a negative control (NC; all validated constructs in the pLKO.1 vector) were purchased from Sigma-Aldrich. The hairpin sequence for the NC shRNA was (5′-TCAGTCACGTTAATGGTCGTT-3′). The other constructs were as follows: Smad2 928 shRNA (Clone ID-NM_010754.2-928s1c1; hairpin sequence: 5′-CCGGTGGTGTTCAATCGCATACTATCTCGAGATAGTATGCGATTGAACACCATTTTTG-3′), Smad3 1137 shRNA (Clone ID- NM_016769.2-1137s1c1; hairpin sequence: 5′-CCGGCTGTCCAATGTCAACCGGAATCTCGAGATTCCGGTTGACATTGGACAGTTTTTG-3′) and Smad4 1925 shRNA (Clone ID- NM_008540.2-1925s1c1; hairpin sequence: 5′- CCGGGCGATTGTGCATTCTCAGGATCTCGAGATCCTGAGAATGCACAATC GCTTTTT-3′). All of these target the coding DNA sequence (CDS) of mouse Smad2, Smad3 and Smad4 mRNA, respectively. The Smad2 shRNA plasmid construct was transformed into the DH5α strain of Escherichia coli. Ampicillin-selected clones for Smad2 and ampicillin-resistant glycerol stocks for Smad3 and Smad4 were propagated and large plasmid preps were made (GenElute™ HP Plasmid Maxiprep Kit; Sigma-Aldrich). Lentiviral particles were generated by co-transfecting HEK 293T cells with NC or Smad shRNAs (2, 3 or 4) encoding plasmids and virus packaging plasmids (VSV-G Lenti, pRSV-Rev and pMDLg/pRRE). The virus-containing supernatant was harvested 48 hr after transfection, filtered, divided into aliquots and stored at −80° until infection. Twenty-four hours before infection, 2 × 105 L-CD1d1-DR4 cells were seeded in six-well plates in DMEM supplemented with 10% BGS, 2 mm l-glutamine and 500 µg/ml G418. On the day of infection, cells were infected with NC, Smad2, Smad3 or Smad4 shRNA lentiviral particles with polybrene (5 µg/ml; Sigma-Aldrich) for 18–24 hr, after which, the medium was replaced with DMEM supplemented with 10% BGS, 2 mm l-glutamine, 500 μg/ml G418 and 10 μg/ml puromycin (Sigma-Aldrich). Stable transductants were generated by selecting cells resistant to puromycin. The cell lines are indicated as L-CD1d1-DR4 NC, L-CD1d1-DR4 Smad2, L-CD1d1-DR4 Smad3 and L-CD1d1-DR4 Smad4 for the respective shRNAs that they express.

Antigen presentation assays

LMTK-CD1d1 cells or BMDC were treated with different concentrations (1, 5, 10 and 20 ng/ml) of TGF-β for 24 hr. Cells treated with vehicle only (Hanks’ balanced salt solution/0·1% bovine serum albumin) served as the negative control. The cells were then washed with PBS, fixed in 0·05% paraformaldehyde and co-cultured with the indicated NKT cell hybridomas for 20–22 hr. LMTK-CD1d1 cells transfected with control vector, p38 WT or p38 DN constructs were treated with vehicle or 20 ng/ml TGF-β and co-cultured with NKT cell hybridomas as above.

L-CD1d1-DR4 NC, Smads 2-, 3- or 4-shRNA cells were treated with vehicle or 20 ng/ml TGF-β for 18 hr to study CD1d-mediated endogenous antigen presentation; alternatively, the cells were treated with human serum albumin (HSA, 10 μm; Sigma-Aldrich) or HSA (10 μm) + 20 ng/ml TGF-β for 18 hr to study MHC class II-mediated antigen presentation. To measure CD1d-mediated exogenous antigen presentation, L-CD1d1-DR4 cells that expressed either NC or the Smad-specific shRNAs were pulsed with either of the two exogenous lipid antigens: α-galactosylceramide (α-GalCer, 100 ng/ml; Enzo Life Sciences, Farmingdale, NY) or Gal(α1→2) galactosylceramide (α-GalGalCer, 100 ng/ml, kindly provided by Dr P. Savage, Brigham Young University, Provo, UT) in the presence or absence of 20 ng/ml TGF-β. All treatments were carried out at 37° for the indicated duration. The cells were then washed, fixed and co-cultured with the indicated NKT cell hybridomas (or with the 17.9 T-cell hybridoma for the analysis of MHC class II antigen presentation) for 20–22 hr. The NKT cell co-culture supernatants were harvested and stored at −20° until further analysis. Interleukin-2 or IL-13 secreted by the NKT cell hybridomas and IL-2 secreted by the 17.9 T-cell hybridoma were quantified by ELISA20 and used as a functional read-out for antigen presentation (CD1d and MHC class II, respectively).

Western blotting

LMTK-CD1d1 (control, p38 WT- and p38 DN-expressing) or L-CD1d1-DR4 (NC, Smad 2, 3 or 4) shRNA-expressing cells were treated with the indicated concentrations of TGF-β. The cells were lysed in lysis buffer [10 mm Tris pH 7·4, 150 mm NaCl, 0·5 mm EDTA pH 8·0, 2% CHAPS, 0·02% sodium azide, protease inhibitor (Roche Diagnostics, Indianapolis, IN) and phosphatase inhibitors – 1 mm sodium fluoride, 1 mm sodium orthovanadate]. The protein concentration in the cell lysates was determined using a Coomassie Protein Assay Reagent (ThermoScientific, Rockford, IL). Equal amounts of protein lysate were mixed with SDS loading buffer, boiled and resolved on an 8% SDS–PAGE gel, and subsequently transferred to a PVDF membrane (Millipore, Bedford, MA). The blots were probed with the indicated antibodies and the bands were developed by chemiluminescence followed by exposure on film. Equal loading of protein was determined using GAPDH as a control. Images were quantified using ImageJ software (1.46v; National Institutes of Health, Bethesda, MD).

Flow cytometry

L-CD1d1-DR4 NC or Smad shRNA cells were washed with PBS and fixed in 1% paraformaldehyde. Surface staining with specific mAb was carried out in Hanks’ balanced salt solution/0·1% bovine serum albumin (FACS Buffer). Cells were then washed three times with the FACS buffer. This was followed by staining with phycoerythrin-conjugated anti-mouse or anti-rat IgG. The cells were again washed three times and finally resuspended in FACS buffer until data acquisition. The stained cells were analysed using a FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA).

Confocal microscopy

LMTK-CD1d1 cells (1 × 105 cells)were plated in 35-mm sterile glass-bottom dishes coated with collagen (MatTek, Ashland, MA). After the cells became 50–80% confluent, cells were treated with the indicated concentrations of TGF-β for 24 hr. The cells were permeabilized and stained with the 1H6 antibody (for CD1d) and 1D4B (for lysosome-associated membrane protein 1; LAMP-1) followed by Alexa488-conjugated anti-mouse (Invitrogen, Carlsbad, CA) and Texas Red-conjugated anti-rat (Jackson ImmunoResearch Laboratories, Inc.) secondary antibodies, respectively. The images were acquired from a Bio-Rad MRC-1024 confocal laser-scanning microscope (Bio-Rad, Hercules, CA) as described previously.20,21 The correlation coefficient of CD1d and LAMP-1 co-localization was determined using metamorph software (version 5; Molecular Devices, Sunnyvale, CA).

Statistical analysis

All data sets are normally distributed as determined by tests of normality using IBM SPSS statistics (IBM SPSS statistics for Windows, version 21.0, IBM Corp., Armonk, NY). Graphs were generated and analysed with a one-way or two-way analysis of variance with Bonferroni’s post-tests as appropriate, using GraphPad prism software (version 5.0 for Windows; GraphPad Software, La Jolla, CA). The error bars represent the standard error from the mean of triplicate samples. Each experiment was performed three times and shown here is one representative data set. A P-value < 0·05 was considered to be significant.

Results

TGF-β inhibits CD1d-mediated antigen presentation

Transforming growth factor-β has been shown previously to down-regulate CD1d expression in in vitro monocyte-derived human Langerhans cells and DC.26 In a separate study, CD1d expression on liver DC was decreased in a mouse model of a subcutaneous colon tumour and this was attributed to increased levels of serum TGF-β in these mice. Surgical reduction of tumour mass led to the recovery of CD1d expression on liver DC with a concomitant reduction of serum TGF-β.27 This and the knowledge that TGF-β can activate p38,17 a known inhibitor of CD1d-mediated antigen presentation,16 led us to speculate that TGF-β could impair CD1d-mediated antigen presentation. To test this, we treated mouse LMTK fibroblasts transfected with the mouse cd1d1 cDNA (LMTK-CD1d1 cells) with various concentrations of TGF-β for 24 hr. After treatment, the cells were used as APC and co-cultured with murine NKT cell hybridomas. It was found that as the concentration of TGF-β increased, the level of IL-2 produced by the NKT cells decreased (Fig. 1a). Therefore, TGF-β inhibited CD1d-mediated antigen presentation in a dose-dependent manner.

Figure 1.

Figure 1

Open in a new tab

Transforming growth factor-β (TGF-β) inhibits CD1d-mediated antigen presentation. (a) LMTK-CD1d1 cells and (b) bone marrow-derived dendritic cells (BMDC) were treated with 0 (vehicle), 1, 5, 10 and 20 ng/ml of TGF-β for 24 hr. The cells were then co-cultured with the indicated natural killer T (NKT) cell hybridomas for 22–24 hr and interleukin-2 (IL-2) produced by activated NKT cells was quantified by ELISA. As a control in (b), LMTK-CD1d1 cells (white bars) were also treated in parallel with the BMDC (black bars). *P < 0·05, ***P < 0·0001. P-value by one-way analysis of variance with Bonferroni’s post-tests, antigen presentation by CD1d in each concentration of TGF-β-treated antigen-presenting cells (APC) compared with that in vehicle-treated APC. Shown here are data from one representative experiment out of three repeats.

To analyse the effect of TGF-β on CD1d-mediated antigen presentation in primary APC, we generated mouse BMDC, treated them with TGF-β and tested antigen presentation in an NKT cell assay as above. As was observed with the LMTK-CD1d1 cells, TGF-β also inhibited CD1d-mediated antigen presentation in BMDC (Fig. 1b). It was possible that the down-regulation of antigen presentation by CD1d was simply due to altered cell surface expression of CD1d. However, TGF-β treatment caused no change in CD1d cell surface expression on either LMTK-CD1d1 cells or BMDC (data not shown). Therefore, these data suggest that TGF-β inhibits CD1d-mediated antigen presentation in APC without having an effect on CD1d cell surface expression.

p38 has no role in TGF-β-induced inhibition of CD1d-mediated antigen presentation

We have previously reported that the p38 MAPK is an inhibitor of CD1d-mediated antigen presentation16 and TGF-β has been shown to activate p38 in several studies.17,28 Because our data had shown that TGF-β is also an inhibitor of CD1d-mediated antigen presentation, we predicted that TGF-β was causing inhibition through activation of the p38 MAPK pathway. Therefore, we first wanted to confirm that TGF-β could activate p38 in our CD1d+ cells. To do this, LMTK-CD1d1 cells were treated with vehicle or 20 ng/ml TGF-β for 0, 15, 30, 60 and 120 min. After treatment, the cells were analysed by Western blot for the levels of phosphorylated and total p38. As expected, TGF-β was able to increase the level of activated p38 in LMTK-CD1d1 cells (Fig. 2a).

Figure 2.

Figure 2

Open in a new tab

Transforming growth factor-β (TGF-β) does not inhibit CD1d-mediated antigen presentation by signalling through p38. (a) Western blot analysis of phosphorylated and total p38 in LMTK-CD1d1 cells treated with vehicle or 20 ng/ml TGF-β for 0, 15, 30, 60 and 120 min, or 0 and 10 ng/ml of anisomycin [A] for 30 min. The bar graph shows the ratio of phospho-p38 over total p38. (b) LMTK-CD1d1 cells transfected with pcDNA3.1 vectors encoding either an empty vector (black bars), wild-type (WT; grey bars) or dominant negative (DN; white bars) p38 cDNA were treated with 0 (vehicle), 1, 5, 10 and 20 ng/ml TGF-β for 24 hr and then co-cultured with the indicated natural killer T (NKT) cell hybridomas for 20–22 hr. Interleukin-2 production was measured by ELISA. *P < 0·05, **P < 0·01 and ***P < 0·001 by one-way analysis of variance with Bonferroni’s post-tests. Each concentration of TGF-β treatment was compared with vehicle treatment. (c) LMTK-CD1d1 vector control, p38 WT and p38 DN cells were treated with 0 and 10 ng/ml of anisomycin [A] for 30 min. Lysates were analysed by Western blot for phosphorylated and total p38. Each experiment was carried out three times; shown here are data from one representative experiment.

Because TGF-β activated p38 in our system, we wanted to determine whether p38 was essential for the TGF-β-mediated inhibition of antigen presentation by CD1d. To do this, we treated LMTK-CD1d1 cells that expressed either an empty pcDNA3.1 vector or a pcDNA3.1 vector encoding the WT or DN p38 cDNA. Not surprisingly, empty control vector and p38 WT-expressing cells had reduced levels of CD1d-mediated antigen presentation when treated with TGF-β. Unexpectedly, p38 DN-expressing cells also had decreased levels of CD1d-mediated antigen presentation in response to TGF-β (Fig. 2b). p38 expression and activation in response to a known stimulator, anisomycin, was confirmed by Western blot analysis in the transfected LMTK-CD1d1 cells (Fig. 2c). Therefore, these data suggest that TGF-β inhibits CD1d-mediated antigen presentation, but via a p38-independent mechanism(s).

TGF-β does not alter intracellular CD1d localization in lysosomes

CD1d constantly recycles between the cell surface and different compartments of the endolysosomal system, eventually accumulating in late endosomes/lysosomes for efficient lipid antigen exchange and loading, followed by re-expression on the cell surface for activating NKT cells.29 This process has been shown to be regulated independently by a tyrosine-based endosomal targeting motif (YXXZ) within the cytoplasmic tail of CD1d or by association with invariant chain.20,30 Therefore, we speculated that TGF-β may alter CD1d trafficking to these compartments, which would potentially explain how TGF-β inhibits CD1d-mediated antigen presentation. To investigate this, LMTK-CD1d1 cells were treated with TGF-β for 24 hr, fixed, permeabilized and stained for CD1d and LAMP-1 (a late endosome and lysosomal marker). The cells were then analysed by confocal microscopy. It was found that, at steady state, CD1d localization in LAMP-1+ compartments was not altered by TGF-β treatment (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Transforming growth factor-β (TGF-β) does not alter the intracellular localization of CD1d. LMTK-CD1d1 cells were treated with 0 (vehicle), 1, 5, 10 and 20 ng/ml of TGF-β for 24 hr and then stained for CD1d (green) and LAMP-1 (red) to determine CD1d localization in LAMP-1+ compartments. The cells were visualized by confocal microscopy and the co-localization coefficient (not shown) was determined by Metamorph. There was no difference in CD1d/LAMP-1 co-localization between vehicle and TGF-β-treated cells. Shown here are data from one representative experiment out of three repeats.

Smads 2, 3 and 4 play a role in the inhibition of CD1d-mediated antigen presentation by TGF-β

Transforming growth factor-β signals via a heteromeric complex of two transmembrane type I and type II (a serine/threonine kinase) receptors. This signal is further propagated in the canonical signalling pathway by phosphorylation of the receptor-regulated Smads (R-Smads) 2 and 3 by the type I receptor.31 Activated Smads 2 and 3 then associate with the common Smad4, translocate to the nucleus and cause transcriptional activation or repression of target genes.32 Because our data suggested that TGF-β inhibits CD1d-mediated antigen presentation independently of the p38 MAPK, we next sought to determine whether the canonical TGF-β/Smad signalling pathway was responsible for this inhibition. To address this question, a lentiviral shRNA-based approach was employed to knockdown Smads 2, 3 or 4 in APC. L-CD1d1-DR4 cells were infected with lentiviruses expressing shRNAs specific for Smads 2, 3 or 4 shRNA or an NC shRNA; stable transductants were generated by selecting drug-resistant cells. Knockdown of Smads in these cells was confirmed by Western blotting (Fig. 4a). Surface CD1d expression was assessed in NC and the Smad shRNA-transduced L-CD1d1-DR4 cells by flow cytometry and no substantial differences were observed (Fig. 4b). These L-CD1d1-DR4 cells were then treated with vehicle or 20 ng/ml TGF-β for 18 hr to compare endogenous antigen presentation by CD1d. It was found that endogenous CD1d-mediated antigen presentation was significantly enhanced in Smad 2, 3 and 4 shRNA-expressing cells compared with the NC in both vehicle and TGF-β-treated cells (Fig. 4c). In each cell line, TGF-β further reduced antigen presentation by CD1d than that which occurred in the corresponding vehicle-treated cells. We reasoned that this could be due to incomplete knockdown of Smad proteins in the cell line; however, it is noteworthy that this reduction occurred to a lesser extent in Smad shRNA-expressing cells than in NC cells. These data suggest that Smads 2, 3 and 4 are negative regulators of antigen presentation by CD1d and are important contributors in the TGF-β-mediated inhibition of this antigen presentation pathway.

Figure 4.

Figure 4

Open in a new tab

Smads 2, 3 and 4 participate in the transforming growth factor-β (TGF-β) -mediated inhibition of antigen presentation by CD1d. (a) Western blot of lysates from L-CD1d1-DR4 cells transduced with Smad 2, 3 or 4 short hairpin RNAs (shRNAs) showing the knockdown in the level of total Smad 2, 3 and 4, respectively, as compared with negative control (NC) shRNA L-CD1d1-DR4 cells. The bar graph shows the ratio of the indicated Smad over GAPDH in each specific cell line. (b) Surface CD1d expression in control and Smad shRNA-transduced L-CD1d1-DR4 cells. Open histogram: isotype control; filled histogram: anti-mouse CD1d (1H6) antibody. (c) CD1d-mediated endogenous antigen presentation assay. L-CD1d1-DR4 NC, Smad2, Smad3, Smad4 shRNA expressing cells were treated with vehicle or 20 ng/ml TGF-β for 18 hr, washed, fixed and co-cultured with the indicated natural killer T (NKT) cell hybridomas. Interleukin-13 (IL-13) production was measured by ELISA. *P < 0·05, **P < 0·01, ***P < 0·001 and ****P < 0·0001 by two-way analysis of variance with Bonferroni’s post-tests. Shown here is one representative data set from three experimental repeats.

TGF-β/Smads 2, 3 and 4 impair lipid antigen processing

Similar to peptide antigens generated from proteins that are presented by MHC class II molecules, some glycolipid antigens with large hydrophilic head groups undergo processing in late endocytic compartments before being loaded onto CD1d molecules and recognized by NKT cells.33 Glycolipid processing is mediated by enzymes present in the late endosomes and lysosomes. α-Galactosylceramide (α-GalCer), the prototypic NKT cell ligand2,34 derived from an aquatic marine sponge, is a lipid antigen that does not require processing for loading onto CD1d.35 Gal(α1→2) galactosylceramide (α-GalGalCer), a synthetic analogue of α-GalCer, is a lipid antigen that requires processing by α-galactosidase A to remove the terminal sugar group and form the NKT cell agonist, α-GalCer.35 To determine if TGF-β plays any role in lipid antigen processing, we tested the ability of L-CD1d1-DR4 cells expressing specific shRNAs against Smad 2, 3 or 4 to present α-GalCer or α-GalGalCer to murine NKT cells in the presence or absence of TGF-β. The cells were pulsed with either α-GalCer or α-GalGalCer in the presence of either vehicle or 20 ng/ml TGF-β for 3 hr; the cells were then washed, fixed and co-cultured with murine NKT cell hybridomas. As observed with the endogenous antigen presentation assay (Fig. 4), Smad 2, 3 and 4 shRNA-expressing L-CD1d1-DR4 cells were better at presenting α-GalGalCer to NKT cells compared with the control (Fig. 5a). Further, TGF-β treatment caused a reduction in the presentation of α-GalGalCer compared with vehicle treatment, albeit to a lesser extent in Smad shRNA cells than in NC cells. In contrast, presentation of α-GalCer was comparable in control and Smad shRNA-expressing cells in the presence or absence of TGF-β (Fig. 5b). Therefore, these data strongly indicate that TGF-β can impair lipid antigen processing via the canonical Smad signalling pathway.

Figure 5.

Figure 5

Open in a new tab

Transforming growth factor-β (TGF-β) impairs exogenous lipid antigen processing and presentation. L-CD1d1-DR4 cells expressing control or Smad short hairpin RNAs (shRNAs) were pulsed for 3 hr with (a) α-GalGalCer (100 ng/ml) or (b) α-GalCer (100 ng/ml) in the presence or absence of TGF-β (20 ng/ml). Antigen-presenting cells (APC) without any exogenous antigen pulse and APC treated with only TGF-β (20 ng/ml) were used as additional controls. The cells were then washed, fixed and co-cultured with the indicated natural killer T (NKT) cell hybridomas. Interleukin-2 (IL-2) produced by the NKT cell hybridomas was quantified by ELISA. **P < 0·01, ***P < 0·001 and ****P < 0·0001 by two-way analysis of variance with Bonferroni’s post-tests. The experiment was carried out three times; shown here is one representative data set.

TGF-β and Smads differentially regulate CD1d- and MHC class II-mediated antigen presentation pathways

We had just shown in Fig. 5 that TGF-β treatment impairs glycolipid antigen processing and presentation by CD1d. CD1d and MHC class II localize in some of the same endolysosomal compartments and, as such, several studies suggest similarities between the two antigen presentation pathways.36 Moreover, we have previously shown that certain cell signalling cascades can impact both CD1d and MHC class II antigen presentation pathways.10–13 The L-CD1d1-DR4 cell line allowed us to perform a side-by-side comparative analysis of the effect of TGF-β on CD1d and MHC class II-mediated antigen presentation pathways in the same APC. To understand if TGF-β/Smad signalling regulates MHC class II-mediated antigen presentation, L-CD1d1-DR4 cells were pulsed for 18 hr with whole HSA protein in the presence or absence of TGF-β; these cells were then washed, fixed and co-cultured with the HLA-DR4-specific 17.9 T-cell hybridoma. To our surprise, in contrast to antigen presentation by CD1d, we found that TGF-β enhanced MHC class II-mediated antigen presentation. It was clearly apparent that Smads 2, 3 and 4 significantly contributed to this process in a positive manner, as TGF-β could not enhance antigen presentation by MHC class II in the Smad shRNA-transduced cells to the extent observed in NC cells (Fig. 6a). Surface HLA-DR4 levels were not significantly different in Smad shRNA-expressing cells compared with NC cells (Fig. 6b).

Figure 6.

Figure 6

Open in a new tab

Transforming growth factor-β (TGF-β) differentially regulates MHC class II antigen presentation. (a) L-CD1d1-DR4 NC and Smad short hairpin RNA (shRNA) cells were pulsed for 18 hr with whole human serum albumin (HSA) protein (10 μm) in the presence or absence of TGF-β (20 ng/ml). The cells were then washed, fixed and co-cultured with the 17.9 T-cell hybridoma. Interleukin-2 (IL-2) production was measured by ELISA. **P < 0·01, ***P < 0·001 and ****P < 0·0001 by two-way analysis of variance with Bonferroni’s post-tests. (b) Surface MHC class II expression in control and Smad shRNA-transduced L-CD1d1-DR4 cells. Open histogram: isotype control; filled histogram: anti-pan-HLA-DR antibody. These experiments were carried out three times; shown here is one representative data set.

Discussion

Transforming growth factor-β is a critical regulator of immune function with an effect on multiple components of the immune system. In myeloid cells, TGF-β can be stimulatory or inhibitory depending on the differentiation state of the cells. For resting monocytes, TGF-β acts as a chemoattractant,37 induces up-regulation of adhesion molecules38 and pro-inflammatory cytokines such as IL-1 or IL-6.36 TGF-β functions as an inhibitory molecule for activated macrophages, causing a down-regulation of molecules required for phagocytosis, and also inhibits MHC class II, co-stimulatory molecule and inflammatory cytokine expression; this impairs macrophage antigen presentation function. Similarly, TGF-β promotes the generation of immature DC with low MHC class II, CD1d and co-stimulatory molecules.39 These effects on myeloid cells – and in fact, all professional APC – would enable TGF-β to impact the ability of a host to control pathogens or eliminate transformed cells, Certainly, this would have a greater effect on those immune responses dependent upon the CD1d/NKT cell axis. TGF-β also affects T-cell proliferation via suppression of IL-2 transcription and also limits the expansion of antigen-specific effector T cells (both CD4+ and CD8+) from naive T cells. It also impairs the cytolytic functions of CD8+ T cells by inhibiting perforin, granzyme and interferon-γ expression, and of NK cells, by reducing the expression of interferon-γ and NK cell cytotoxicity receptors.40 TGF-β also plays a role in B-cell biology, promoting B-cell maturation and differentiation by regulating expression of several cell surface molecules, including MHC class II molecules on pre-B and mature B cells.41 Apart from the contribution of TGF-β to immune homeostasis, several pathogens and tumour cells are known to exploit the TGF-β signalling pathway to evade the host’s immune responses.18,19 TGF-β is clearly a key regulator of immune function, impacting both antigen-specific and non-specific immunity. In this study, we found an additional, important immune modulating effect of TGF-β: inhibition of CD1d-mediated antigen presentation to NKT cells.

Canonical TGF-β signalling occurs via a heterodimeric complex of type I and type II receptor serine/threonine kinases, which transduce the signal further by phosphorylating downstream R-Smads (Smads 2,3) that associate with the Co-Smad (Smad 4). The Smads then move to the nucleus as a complex and drive target gene expression. Additionally, TGF-β can activate the Rho-like GTPase signalling pathways, several MAPK pathways, and the phosphoinositide 3-kinase/Akt pathway, among others.42 Hence, the TGF-β signalling pathway is very diverse and complex with the outcome of signalling being dependent upon the cellular context and microenvironment.42 Our initial hypothesis was that TGF-β inhibits antigen presentation by CD1d via activation of the p38 MAPK; however, our data instead showed the involvement of the canonical signalling elements of the TGF-β pathway, Smads 2, 3 and 4. Enhanced endogenous and exogenous (α-GalGalCer) lipid antigen processing and presentation in the Smad shRNA-expressing L-CD1d1-DR4 cells could not be attributed to increased surface expression of CD1d in these cells compared with control cells. Moreover, there was also no difference in surface CD1d in TGF-β-treated BMDC, which were impaired in antigen presentation by CD1d. We did not observe any differences in intracellular CD1d localization or CD1d recycling (data not shown) in vehicle or TGF-β-treated LMTK-CD1d1 cells. Importantly, it was found that TGF-β treatment impaired lipid antigen processing. This could be due to an effect on lipid antigen loading and/or on antigen processing by the TGF-β/Smad pathway. We believe it is more likely due to an effect on lipid antigen processing, as no differences were observed in the presentation of an exogenously provided monosaccharide glycolipid antigen, α-GalCer. Certainly, there are numerous components involved in lipid antigen internalization, trafficking, processing and ultimately, loading onto CD1d molecules33 and it will be interesting in future studies to understand their potential contributions to our observations reported here.

Remarkably, we found that TGF-β differentially regulates MHC class II- and CD1d-mediated antigen presentation, as we have previously reported for the ROCK/actin pathway.11 In contrast to that observed with CD1d molecules, TGF-β was found to enhance MHC class II-mediated antigen presentation. Further, knocking down Smads 2, 3 or 4 had a much higher impact on MHC class II-mediated antigen presentation than on that by CD1d, based on the observation that Smad knockdown substantially inhibited MHC class II-mediated antigen presentation, and TGF-β treatment had no impact on antigen presentation by MHC class II in Smad shRNA-expressing APC. Several studies have reported inhibition of MHC class II expression by TGF-β via attenuation of the Class II transactivator (CIITA), the master regulator of MHC class II expression.43,44 However, TGF-β has also been reported to induce the expression of MHC class II molecules in B cells at different maturation stages.45 In our system, we did not observe significant changes in surface MHC class II levels by TGF-β treatment (Fig. 6). Despite similarities in the CD1d and MHC class II antigen presentation pathways, the two pathways also differ somewhat in terms of molecules that mediate antigen trafficking, processing, exchange and loading,33,46 which could be a basis for the observed differences in the regulation of CD1d and MHC class II-mediated antigen processing and presentation by the TGF-β/Smad pathway.

Natural killer T cells rapidly produce both T helper type 1 (e.g. interferon-γ, granulocyte–macrophage colony-stimulating factor) and T helper type 2 (e.g. IL-4, IL-13) cytokines upon recognition of lipid antigens presented in the context of CD1d. Owing to their potent cytokine production, NKT cells participate in a wide range of immune responses, including host defence against several different microbes, autoimmunity, tumour immunity, allergy and inflammation. In each of these immune responses, studies have shown NKT cells to either confer protective immunity or contribute to immune pathology.4 Therefore, CD1d-mediated lipid antigen presentation to NKT cells represents a central aspect of innate immunity. Numerous studies in TGF-β type II receptor knockout mouse models have implicated an important role for TGF-β signalling at different stages of NKT cell development.47–49 Focusing on the APC side, in this report, we have shown that the potent cytokine TGF-β negatively regulates antigen presentation by CD1d to NKT cells via the canonical Smad signalling pathway (Fig. 7). Although different functional roles have been implicated for type I and type II NKT cells in several animal models and human diseases,50 in the current study, we found that TGF-β impaired antigen presentation by CD1d to both type I and type II NKT cells. This is consistent with our earlier studies on the regulation of CD1d-mediated antigen presentation by the MAPKs p38 and extracellular signal-regulated kinase, and the protein kinase C family member, protein kinase Cδ.10,16 The observed effects of TGF-β in APC could be a possible explanation for the impaired CD1d/NKT cell axis under conditions where TGF-β is the major cytokine in the microenvironment; this could be exploited to increase the effectiveness of immunotherapy or combinatorial therapies to restore NKT cell numbers and/or function in a variety of disease states.

Figure 7.

Figure 7

Open in a new tab

Transforming growth factor-β (TGF-β) and the canonical Smad pathway negatively regulate CD1d-mediated antigen presentation. The presented model implicates TGF-β and the canonical Smad signalling pathway in an inhibitory role in CD1d-mediated lipid antigen processing and presentation. Treatment with TGF-β causes a decrease in antigen presentation by CD1d. Additionally, knockdown of Smads 2, 3 and 4 in antigen-presenting cells (APC) increases natural killer T (NKT) cell activation, which suggests that they are negative regulators of CD1d-mediated antigen presentation. In contrast to the regulation of antigen presentation by CD1d, TGF-β enhances MHC class II-mediated antigen presentation via Smads 2, 3 and 4.

Acknowledgments

We thank Drs D. Donner and J. Han for the WT and DN p38 constructs; Dr Paul B. Savage for the α-GalGalCer; Dr Janice Blum for L-CD1d1-DR4 cells and the 17.9 T-cell hybridoma; Dr P. Cohen for HEK 293T cells; Dr R.M. Gallo for help with lentivirus infections and Dr J. Liu for helpful input and suggestions on the manuscript. We would like to especially thank Dr L. Quilliam for his help and advice on generating lentiviruses expressing shRNAs. Both Dr Kristin Hollister and Ms Cindy Calley (Biostatistician, Department of Biostatistics, IU School of Medicine) provided important help with statistical analyses. JCB and AKI performed the experiments and JCB, AKI and RRB wrote the manuscript. GJR performed experiments and participated in data interpretation. YL generated p38 WT and DN expressing LMTK-CD1d1 cells. HN generated shRNA expressing lentiviruses used in this study. RRB designed the study, led the interpretation of results and reviewed the manuscript. This work was supported by NIH grants R01 CA89026, R01 CA161178, R56 AI 46455 and P01 AI056097 to R.R.B.

Glossary

APC

antigen-presenting cells

α-GalCer

α-galactosylceramide

α-GalGalCer

α-galactosyl-(1→2)-galactosylceramide

BGS

bovine growth serum

BMDC

bone marrow-derived dendritic cells

DC

dendritic cells

DMEM

Dulbecco’s modified Eagle’s medium

DN

dominant negative

FBS

fetal bovine serum

HBSS

Hank’s Balanced Salt Solution

HSA

human serum albumin

IL

interleukin

LAMP-1

lysosome-associated membrane protein 1

MAPK

mitogen-activated protein kinase

NC

negative control

NKT cells

natural killer T cells

shRNA

short hairpin RNA

TCR

T-cell receptor

TGF-β

transforming growth factor-β

WT

wild type

Disclosure

The authors have no conflicts of interest.

References

  1. Dougan SK, Kaser A, Blumberg RS. CD1 expression on antigen-presenting cells. Curr Top Microbiol Immunol. 2007;314:113–41. doi: 10.1007/978-3-540-69511-0_5. [DOI] [PubMed] [Google Scholar]
  2. Barral DC, Brenner MB. CD1 antigen presentation: how it works. Nat Rev Immunol. 2007;7:929–41. doi: 10.1038/nri2191. [DOI] [PubMed] [Google Scholar]
  3. Brennan PJ, Brigl M, Brenner MB. Invariant natural killer T cells: an innate activation scheme linked to diverse effector functions. Nat Rev Immunol. 2013;13:101–17. doi: 10.1038/nri3369. [DOI] [PubMed] [Google Scholar]
  4. Berzins SP, Smyth MJ, Baxter AG. Presumed guilty: natural killer T cell defects and human disease. Nat Rev Immunol. 2011;11:131–42. doi: 10.1038/nri2904. [DOI] [PubMed] [Google Scholar]
  5. Travis MA, Sheppard D. TGF-β activation and function in immunity. Annu Rev Immunol. 2014;32:51–82. doi: 10.1146/annurev-immunol-032713-120257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Prud’homme GJ. Pathobiology of transforming growth factor β in cancer, fibrosis and immunologic disease, and therapeutic considerations. Lab Invest. 2007;87:1077–91. doi: 10.1038/labinvest.3700669. [DOI] [PubMed] [Google Scholar]
  7. Schmierer B, Hill CS. TGFβ-SMAD signal transduction: molecular specificity and functional flexibility. Nat Rev Mol Cell Biol. 2007;8:970–82. doi: 10.1038/nrm2297. [DOI] [PubMed] [Google Scholar]
  8. Souchelnytskyi S, ten Dijke P, Miyazono K, Heldin CH. Phosphorylation of Ser165 in TGF-β type I receptor modulates TGF-β1-induced cellular responses. EMBO J. 1996;15:6231–40. [PMC free article] [PubMed] [Google Scholar]
  9. Wrana JL, Attisano L, Carcamo J, Zentella A, Doody J, Laiho M, Wang XF, Massague J. TGF β signals through a heteromeric protein kinase receptor complex. Cell. 1992;71:1003–14. doi: 10.1016/0092-8674(92)90395-s. [DOI] [PubMed] [Google Scholar]
  10. Brutkiewicz RR, Willard CA, Gillett-Heacock KK, et al. Protein kinase C δ is a critical regulator of CD1d-mediated antigen presentation. Eur J Immunol. 2007;37:2390–5. doi: 10.1002/eji.200737124. [DOI] [PubMed] [Google Scholar]
  11. Gallo RM, Khan MA, Shi J, Kapur R, Wei L, Bailey JC, Liu J, Brutkiewicz RR. Regulation of the actin cytoskeleton by Rho kinase controls antigen presentation by CD1d. J Immunol. 2012;189:1689–98. doi: 10.4049/jimmunol.1101484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Khan MA, Gallo RM, Brutkiewicz RR. Anthrax lethal toxin impairs CD1d-mediated antigen presentation by targeting the extracellular signal-related kinase 1/2 mitogen-activated protein kinase pathway. Infect Immun. 2010;78:1859–63. doi: 10.1128/IAI.01307-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Khan MA, Gallo RM, Renukaradhya GJ, Du W, Gervay-Hague J, Brutkiewicz RR. Statins impair CD1d-mediated antigen presentation through the inhibition of prenylation. J Immunol. 2009;182:4744–50. doi: 10.4049/jimmunol.0804311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Khan MA, Sriram V, Renukaradhya GJ, Du W, Gervay-Hague J, Brutkiewicz RR. Apoptosis-induced inhibition of CD1d-mediated antigen presentation: different roles for caspases and signal transduction pathways. Immunology. 2008;125:80–90. doi: 10.1111/j.1365-2567.2008.02823.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Renukaradhya GJ, Khan MA, Shaji D, Brutkiewicz RR. Vesicular stomatitis virus matrix protein impairs CD1d-mediated antigen presentation through activation of the p38 MAPK pathway. J Virol. 2008;82:12535–42. doi: 10.1128/JVI.00881-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Renukaradhya GJ, Webb TJ, Khan MA, Lin YL, Du W, Gervay-Hague J, Brutkiewicz RR. Virus-induced inhibition of CD1d1-mediated antigen presentation: reciprocal regulation by p38 and ERK. J Immunol. 2005;175:4301–8. doi: 10.4049/jimmunol.175.7.4301. [DOI] [PubMed] [Google Scholar]
  17. Yu L, Hebert MC, Zhang YE. TGF-β receptor-activated p38 MAP kinase mediates Smad-independent TGF-β responses. EMBO J. 2002;21:3749–59. doi: 10.1093/emboj/cdf366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Carlson CM, Turpin EA, Moser LA, et al. Transforming growth factor-beta: activation by neuraminidase and role in highly pathogenic H5N1 influenza pathogenesis. PLoS Pathog. 2010;6:e1001136. doi: 10.1371/journal.ppat.1001136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pickup M, Novitskiy S, Moses HL. The roles of TGFβ in the tumour microenvironment. Nat Rev Cancer. 2013;13:788–99. doi: 10.1038/nrc3603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Roberts TJ, Sriram V, Spence PM, et al. Recycling CD1d1 molecules present endogenous antigens processed in an endocytic compartment to NKT cells. J Immunol. 2002;168:5409–14. doi: 10.4049/jimmunol.168.11.5409. [DOI] [PubMed] [Google Scholar]
  21. Sriram V, Cho S, Li P, O’Donnell PW, Dunn C, Hayakawa K, Blum JS, Brutkiewicz RR. Inhibition of glycolipid shedding rescues recognition of a CD1+ T cell lymphoma by natural killer T (NKT) cells. Proc Natl Acad Sci USA. 2002;99:8197–202. doi: 10.1073/pnas.122636199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lantz O, Bendelac A. An invariant T cell receptor α chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4–8– T cells in mice and humans. J Exp Med. 1994;180:1097–106. doi: 10.1084/jem.180.3.1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Burdin N, Brossay L, Koezuka Y, et al. Selective ability of mouse CD1 to present glycolipids: α-galactosylceramide specifically stimulates Vα14+ NK T lymphocytes. J Immunol. 1998;161:3271–81. [PubMed] [Google Scholar]
  24. Gui M, Li J, Wen LJ, Hardy RR, Hayakawa K. TCR β chain influences but does not solely control autoreactivity of Vα14J281T cells. J Immunol. 2001;167:6239–46. doi: 10.4049/jimmunol.167.11.6239. [DOI] [PubMed] [Google Scholar]
  25. Pathak SS, Blum JS. Endocytic recycling is required for the presentation of an exogenous peptide via MHC class II molecules. Traffic. 2000;1:561–9. doi: 10.1034/j.1600-0854.2000.010706.x. [DOI] [PubMed] [Google Scholar]
  26. Ronger-Savle S, Valladeau J, Claudy A, Schmitt D, Peguet-Navarro J, Dezutter-Dambuyant C, Thomas L, Jullien D. TGFβ inhibits CD1d expression on dendritic cells. J Invest Dermatol. 2005;124:116–8. doi: 10.1111/j.0022-202X.2004.23315.x. [DOI] [PubMed] [Google Scholar]
  27. Tatsumi T, Takehara T, Yamaguchi S, et al. Decreased expressions of CD1d molecule on liver dendritic cells in subcutaneous tumor bearing mice. J Hepatol. 2008;49:779–86. doi: 10.1016/j.jhep.2008.06.011. [DOI] [PubMed] [Google Scholar]
  28. Yue J, Mulder KM. Activation of the mitogen-activated protein kinase pathway by transforming growth factor-β. Methods Mol Biol. 2000;142:125–31. doi: 10.1385/1-59259-053-5:125. [DOI] [PubMed] [Google Scholar]
  29. Salio M, Silk JD, Cerundolo V. Recent advances in processing and presentation of CD1 bound lipid antigens. Curr Opin Immunol. 2010;22:81–8. doi: 10.1016/j.coi.2009.12.008. [DOI] [PubMed] [Google Scholar]
  30. Jayawardena-Wolf J, Benlagha K, Chiu YH, Mehr R, Bendelac A. CD1d endosomal trafficking is independently regulated by an intrinsic CD1d-encoded tyrosine motif and by the invariant chain. Immunity. 2001;15:897–908. doi: 10.1016/s1074-7613(01)00240-0. [DOI] [PubMed] [Google Scholar]
  31. Kang JS, Liu C, Derynck R. New regulatory mechanisms of TGF-β receptor function. Trends Cell Biol. 2009;19:385–94. doi: 10.1016/j.tcb.2009.05.008. [DOI] [PubMed] [Google Scholar]
  32. Massague J. TGFb signalling in context. Nat Rev Mol Cell Biol. 2012;13:616–30. doi: 10.1038/nrm3434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. De Libero G, Mori L. Novel insights into lipid antigen presentation. Trends Immunol. 2012;33:103–11. doi: 10.1016/j.it.2012.01.005. [DOI] [PubMed] [Google Scholar]
  34. Kobayashi E, Motoki K, Uchida T, Fukushima H, Koezuka Y. KRN7000, a novel immunomodulator, and its antitumor activities. Oncol Res. 1995;7:529–34. [PubMed] [Google Scholar]
  35. Prigozy TI, Naidenko O, Qasba P, et al. Glycolipid antigen processing for presentation by CD1d molecules. Science. 2001;291:664–7. doi: 10.1126/science.291.5504.664. [DOI] [PubMed] [Google Scholar]
  36. Gelin C, Sloma I, Charron D, Mooney N. Regulation of MHC II and CD1 antigen presentation: from ubiquity to security. J Leukoc Biol. 2009;85:215–24. doi: 10.1189/jlb.0308206. [DOI] [PubMed] [Google Scholar]
  37. Wahl SM, Hunt DA, Wakefield LM, McCartney-Francis N, Wahl LM, Roberts AB, Sporn MB. Transforming growth factor type β induces monocyte chemotaxis and growth factor production. Proc Natl Acad Sci USA. 1987;84:5788–92. doi: 10.1073/pnas.84.16.5788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wahl SM, Allen JB, Weeks BS, Wong HL, Klotman PE. Transforming growth factor β enhances integrin expression and type IV collagenase secretion in human monocytes. Proc Natl Acad Sci USA. 1993;90:4577–81. doi: 10.1073/pnas.90.10.4577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor β in human disease. N Engl J Med. 2000;342:1350–8. doi: 10.1056/NEJM200005043421807. [DOI] [PubMed] [Google Scholar]
  40. Wrzesinski SH, Wan YY, Flavell RA. Transforming growth factor-β and the immune response: implications for anticancer therapy. Clin Cancer Res. 2007;13:5262–70. doi: 10.1158/1078-0432.CCR-07-1157. [DOI] [PubMed] [Google Scholar]
  41. Lebman DA, Edmiston JS. The role of TGF-β in growth, differentiation, and maturation of B lymphocytes. Microbes Infect. 1999;1:1297–304. doi: 10.1016/s1286-4579(99)00254-3. [DOI] [PubMed] [Google Scholar]
  42. Andrieux G, Le Borgne M, Theret N. An integrative modeling framework reveals plasticity of TGF-β signaling. BMC Syst Biol. 2014;8:30. doi: 10.1186/1752-0509-8-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Lee YJ, Han Y, Lu HT, et al. TGF-β suppresses IFN-γ induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J Immunol. 1997;158:2065–75. [PubMed] [Google Scholar]
  44. Dong Y, Tang L, Letterio JJ, Benveniste EN. The Smad3 protein is involved in TGF-β inhibition of class II transactivator and class II MHC expression. J Immunol. 2001;167:311–9. doi: 10.4049/jimmunol.167.1.311. [DOI] [PubMed] [Google Scholar]
  45. Cross D, Cambier JC. Transforming growth factor β 1 has differential effects on B cell proliferation and activation antigen expression. J Immunol. 1990;144:432–9. [PubMed] [Google Scholar]
  46. Berger AC, Roche PA. MHC class II transport at a glance. J Cell Sci. 2009;122:1–4. doi: 10.1242/jcs.035089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Li MO, Sanjabi S, Flavell RA. Transforming growth factor-β controls development, homeostasis, and tolerance of T cells by regulatory T cell-dependent and -independent mechanisms. Immunity. 2006;25:455–71. doi: 10.1016/j.immuni.2006.07.011. [DOI] [PubMed] [Google Scholar]
  48. Marie JC, Liggitt D, Rudensky AY. Cellular mechanisms of fatal early-onset autoimmunity in mice with the T cell-specific targeting of transforming growth factor-β receptor. Immunity. 2006;25:441–54. doi: 10.1016/j.immuni.2006.07.012. [DOI] [PubMed] [Google Scholar]
  49. Doisne JM, Bartholin L, Yan KP, et al. iNKT cell development is orchestrated by different branches of TGF-β signaling. J Exp Med. 2009;206:1365–78. doi: 10.1084/jem.20090127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Kumar V, Delovitch TL. Different subsets of natural killer T cells may vary in their roles in health and disease. Immunology. 2014;142:321–36. doi: 10.1111/imm.12247. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES