Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae

W Quaedvlieg; M Binder; JZ Groenewald; BA Summerell; AJ Carnegie; TI Burgess; PW Crous

doi:10.3767/003158514X681981

. 2014 May 15;33:1–40. doi: 10.3767/003158514X681981

Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae

W Quaedvlieg ^1,^✉, M Binder ¹, JZ Groenewald ¹, BA Summerell ², AJ Carnegie ³, TI Burgess ⁴, PW Crous ^1,^5,⁶

PMCID: PMC4312929 PMID: 25737591

Abstract

The Teratosphaeriaceae represents a recently established family that includes numerous saprobic, extremophilic, human opportunistic, and plant pathogenic fungi. Partial DNA sequence data of the 28S rRNA and RPB2 genes strongly support a separation of the Mycosphaerellaceae from the Teratosphaeriaceae, and also provide support for the Extremaceae and Neodevriesiaceae, two novel families including many extremophilic fungi that occur on a diversity of substrates. In addition, a multi-locus DNA sequence dataset was generated (ITS, LSU, Btub, Act, RPB2, EF-1α and Cal) to distinguish taxa in Mycosphaerella and Teratosphaeria associated with leaf disease of Eucalyptus, leading to the introduction of 23 novel genera, five species and 48 new combinations. Species are distinguished based on a polyphasic approach, combining morphological, ecological and phylogenetic species concepts, named here as the Consolidated Species Concept (CSC). From the DNA sequence data generated, we show that each one of the five coding genes tested, reliably identify most of the species present in this dataset (except species of Pseudocercospora). The ITS gene serves as a primary barcode locus as it is easily generated and has the most extensive dataset available, while either Btub, EF-1α or RPB2 provide a useful secondary barcode locus.

Keywords: Eucalyptus, multi-locus, phylogeny, species concepts, taxonomy

INTRODUCTION

The current generic and family concepts of the Mycosphaerellaceae and the Teratosphaeriaceae (Capnodiales, Dothideomycetes) can be indirectly attributed to Crous (1998), who used morphological characteristics of cultures and asexual morphs to show that Mycosphaerella was polyphyletic. Crous (1998) suggested that the genus warranted subdivision into natural groups, defined by their asexual morphs. In contrast to these findings, the first phylogenetic trees published for Mycosphaerella (based on ITS nrDNA sequence data), showed it was monophyletic (Crous et al. 1999, 2000, 2001, Stewart et al. 1999, Goodwin et al. 2001). As more sequence data became available (especially of loci such as 28S nrDNA), this view gradually changed and Mycosphaerella is now recognised as polyphyletic (Braun et al. 2003, Schubert et al. 2007, Crous et al. 2007b, 2009b, Batzer et al. 2008, Dugan et al. 2008, Bensch et al. 2012). Although Mycosphaerella s.l. represents a complex (of genera and species) with more than 10 000 species names (Crous et al. 2000, 2001, 2004b, c, 2006, 2007a, 2009c, Crous & Braun 2003), several phylogenetic lineages remain poorly resolved due to limited sampling (Hunter et al. 2006, Crous et al. 2007a, 2009a,2009b,2009c,2009d, Quaedvlieg et al. 2011, 2012). A previous study by Verkley et al. (2004) showed that Mycosphaerella s.str. was limited to species with Ramularia asexual morphs, and that the remaining Mycosphaerella-like species were better placed in other genera.

The genus Teratosphaeria was separated from Mycosphaerella s.l. based on its ascomatal arrangement and periphysate ostioles (Müller & Oehrens 1982). Teratosphaeria was later placed in its own family, based on ascospores that turn brown and verruculose while still in their asci, the presence of pseudoparenchymatal remnants in ascomata, ascospores with mucoid sheaths, distinct asexual morphs and DNA phylogenetic data (Crous et al. 2007a). By 2012, 22 asexual extremophilic and plant pathogenic genera have been linked to the Teratosphaeriaceae, while 38 asexual genera were included in the Mycosphaerellaceae (Hyde et al. 2013). Another 11 genera have subsequently been added to the Mycosphaerellaceae (Crous et al. 2013, Quaedvlieg et al. 2013). Recent phylogenetic studies into extremophilic fungi collected by Friedman (1982) and Selbmann (2005, 2008) have shown that several genera of slow-growing melanised rock-inhabiting (extremophilic) fungi, isolated from harsh climatic conditions (e.g. the South Pole and high mountain peaks) either belong to the Teratosphaeriaceae and/or to a closely associated, unclassified, family referred to as either Teratosphaeriaceae ‘1’ or ‘2’ in Ruibal et al. (2009, 2011) and Egidi et al. (2014).

The original concept of Mycosphaerella has shifted as it became evident that the mycosphaerella-like morphology has evolved multiple times with taxa clustering in disparate families such as the Schizothyriaceae (Batzer et al. 2008), Cladosporiaceae (Schubert et al. 2007, Dugan et al. 2008, Bensch et al. 2010, 2012), Dissoconiaceae, Mycosphaerellaceae and Teratosphaeriaceae (Crous et al. 2009b, Li et al. 2012).

Numerous species are associated with Mycosphaerella leaf disease (MLD) and Teratosphaeria leaf disease (TLD) of Eucalyptus and the closely related genus Corymbia. The genus Eucalyptus (Myrtaceae) is primarily native to Australia and contains more than 700 species. Some species have exceptionally fast growth rates and relatively short rotation periods, making them ideally suited for hardwood timber, firewood, charcoal, essential oils and pulp production (Grattapaglia et al. 2012). For commercial purposes, Eucalyptus spp. have been introduced and cultivated in many other tropical, sub-tropical and temperate countries, where these species often prosper and even dominate a range of habitats, from heathlands to forests (Crous 1998, Turnbull 2000, Wingfield et al. 2001, Boland et al. 2006). Although Eucalyptus spp. exhibit many properties favourable for commercial forestry production, exotic plantations often suffer severe damage caused by the large numbers of native (host-shift) and introduced pathogens that may cause serious and epidemic diseases, often simultaneously on roots, stems or leaves (Park et al. 2000, Old et al. 2003, Slippers et al. 2005, Hunter et al. 2011). A good example of host shifting is the stem canker pathogen Teratosphaeria zuluensis, which most likely jumped from a native tree to introduced clones of E. grandis in South Africa and to E. camaldulensis in Ethiopia, where it is now a major pathogen (Wingfield et al. 1996, Gezahgne et al. 2003, Cortinas et al. 2010). Host jumping by fungal pathogens is relatively common and several other examples can be found among fungal species associated with MLD and TLD of eucalypts (Crous & Groenewald 2005, Burgess et al. 2007, Crous et al. 2007a, Arzanlou et al. 2008, Hunter et al. 2011, Pérez et al. 2013).

In total, more than 146 species in the Mycosphaerellaceae and Teratosphaeriaceae cultivated from leaf spots of eucalypts are included in this study. Species of this complex are assemblages of cryptic taxa that can co-inhabit the same lesions, making reliable species identification difficult (Crous 1998, Barnes et al. 2004, Crous et al. 2004b, c, Groenewald et al. 2005, Cheewangkoon et al. 2008, Stukenbrock et al. 2012). Species identification has been hampered by conserved sexual morphologies throughout the Mycosphaerellaceae and the Teratosphaeriaceae, turning the taxonomic and systematic focus mostly to asexual morphology (Crous et al. 2000, 2006, Verkley et al. 2013). However, similar asexual morphologies have also independently evolved in different taxa, further complicating the taxonomy of these pathogens (Crous et al. 2007a).

The introduction of routine DNA sequencing technology during the last decade has made it possible to mostly identify and classify these phytopathogens, although species boundary ambiguities still exist between phylogenetically closely related taxa. Several previous studies have used molecular sequencing techniques to analyse the diversity of MLD and TLD pathogens on Eucalyptus spp. However, these studies generally included a limited and frequently non-overlapping dataset of species and DNA loci (with ITS being used predominantly for species identification) (for example, Crous et al. 2006, Hunter et al. 2006).

We analyse 329 isolates representing 146 species of MLD- and TLD-associated fungi, using seven loci that have individually or in combination been used in the past to successfully identify species belonging to the Mycosphaerellaceae or Teratosphaeriaceae. These loci include partial sequences of the β-tubulin gene (Btub), the internal transcribed spacer regions and intervening 5.8S rDNA (ITS), actin (Act), translation elongation factor 1-alpha (EF-1α), 28S nrDNA (LSU), calmodulin (Cal) and RNA polymerase II second largest subunit gene (RPB2) (Crous et al. 2004c, Hunter et al. 2006, Quaedvlieg et al. 2011). An additional 172 isolates representing 125 species (mostly extremophiles linked to the Teratosphaeriaceae by Ruibal et al. (2009, 2011) and Egidi et al. (2014) were also investigated based on two loci, LSU and RPB2.

The primary goal of this study is to 1) resolve the main lineages in Teratosphaeriaceae into phylogenetic and morphological units, which can be assigned to single generic names using existing and newly generated LSU and RPB2 sequence data in combination with the LSU/RPB2 data of Teratosphaeriaceae associated extremophilic isolates generated by Ruibal et al. (2009, 2011) and Egidi et al. (2014). Secondary goals of this study are to 2) create a multi-locus DNA sequence dataset in order to rigorously distinguish the selected MLD- and TLD-associated fungal species; and 3) determine which loci provide the most reliable identification based on PCR efficiency and the size of the Kimura-2-parameter barcode gaps. Comparing the obtained results with existing literature, this study 4) describes novel species isolated from MLD and TLD symptoms; and 5) considers species boundaries of phylogenetically closely related taxa.

MATERIALS AND METHODS

Isolates

Isolates used for this study (Table 1) were obtained from the CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands (CBS), or from the working collection of Pedro Crous (CPC), housed at CBS. Fresh collections were made from leaves of diverse hosts by placing material in damp chambers for 1–2 d. Single conidial colonies were grown from sporulating conidiomata on Petri dishes containing 2 % malt extract agar (MEA) as described earlier by Crous et al. (1991). Leaf and stem tissue bearing ascomata were soaked in water for ± 2 h, after which they were placed in the bottom of Petri dish lids, with the top half of the dish containing MEA. Ascospore germination patterns were determined after 24 h, and single ascospore and conidial cultures were established according to Crous (1998). Colonies were sub-cultured onto potato-dextrose agar (PDA), oatmeal agar (OA) (see Crous et al. 2009e), MEA, and pine needle agar (PNA) (Smith et al. 1996), and incubated at 25 °C to promote sporulation.

Table 1.

Collection details and GenBank accession numbers of isolates included in this study.

Species	Isolate no.¹, ²	Host	Location	Collector	GenBank accession no.³
					LSU	Act	Cal	ITS	RPB2	EF-1α	Btub
Acidiella bohemica	CBS 132720	Highly acidic soil	Czech Republic	M. Hujslová	KF901984	–	–	–	KF902178	–	–
	CBS 132721^ET	Highly acidic soil	Czech Republic	M. Hujslová	KF901985	–	–	–	KF902179	–	–
Amycosphaerella africana	CBS 110500^{ET of Mycosphaerella aurantia}	Eucalyptus globulus	Australia: Western Australia	A. Maxwell	KF901837	KF903395	KF902554	KF901516	KF902223	KF903115	KF902818
	CBS 110843 = CPC 850^{ET of Mycosphaerella ellipsoidea}	Eucalyptus cladocalyx	South Africa	P.W. Crous	KF902049	KF903407	KF902557	KF901702	KF902226	KF903118	KF902821
	CBS 116154 = CPC 794^{ET of Mycosphaerella africana}	Eucalyptus viminalis	South Africa	P.W. Crous	KF902047	KF903480	KF902555	KF901700	KF902224	KF903116	KF902819
	CBS 680.95 = CPC 796^{ET of Mycosphaerella africana}	Eucalyptus viminalis	South Africa	P.W. Crous	KF902048	KF903589	KF902556	KF901701	KF902225	KF903117	KF902820
Apenidiella strumelloidea	CBS 114484^ET	Carex sp.	Russia	S. Ozerskaya	KF937229	–	–	–	KF937266	–	–
Aulographina pinorum	CBS 655.86	Pinus montana	Switzerland	E. Müller	KF902102	–	–	–	KF902180	–	–
Austroafricana associata	CBS 112224 = CPC 3116	Protea lepidocarpodendron	Australia: New South Wales	P.W. Crous & B. Summerell	KF901827	–	–	KF901510	KF902183	KF903090	KF902793
	CBS 120730 = CPC 13119^ET	Corymbia henryii	Australia: New South Wales	A.J. Carnegie	KF901824	KF903526	KF902528	KF901507	KF902177	KF903087	KF902790
	CBS 120731 = CPC 13128	Corymbia variegata	Australia: New South Wales	A.J. Carnegie	KF901828	KF903527	KF902531	KF901511	KF902184	KF903091	–
	CBS 120732 = CPC 13108	Eucalyptus dunnii	Australia: New South Wales	A.J. Carnegie	KF901829	–	KF902532	KF901512	KF902185	KF903092	KF902794
	CPC 13113	Eucalyptus dunnii	Australia: New South Wales	A.J. Carnegie	KF901825	–	KF902529	KF901508	KF902181	KF903088	KF902791
	CPC 13375	Eucalyptus tereticornis	Australia: New South Wales	B. Summerell	KF901826	–	KF902530	KF901509	KF902182	KF903089	KF902792
A. keanei	CBS 130524^ET	Eucalyptus globulus × camaldulensis	Australia: Queensland	A.J. Carnegie	KF901830	–	–	–	KF902187	–	–
A. parva	CBS 110503 = CMW 14459	Eucalyptus globulus	Australia: Western Australia	A. Maxwell	KF901831	KF903398	KF902534	KF901513	KF902189	KF903094	KF902797
	CBS 114761 = CPC 1217	Protea repens	South Africa	P.W. Crous	KF902087	–	KF902536	KF901740	KF902191	KF903096	KF902799
	CBS 116289 = CPC 10935	Eucalyptus sp.	South Africa	P.W. Crous	KF902025	KF903481	KF902535	KF901680	KF902190	KF903095	KF902798
	CBS 119901 = CMW 10189	Eucalyptus globulus	Ethiopia	A. Gezahgne	KF901986	KF903512	KF902537	KF901647	KF902192	KF903097	KF902800
	CBS 122892 = CPC 12421^EET	Eucalyptus globulus	Australia: Victoria	I. Smith	KF901832	KF903539	KF902538	KF901514	KF902193	KF903098	KF902801
	CBS 122893 = CPC 14898	Protea repens	South Africa	L. Mostert	KF902088	–	KF902539	KF901741	KF902194	KF903099	KF902802
	CPC 12249	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF902104	KF903612	KF902533	KF901750	KF902188	KF903093	KF902796
Austroafricana sp.	CBS 113059 = CPC 4313	Eucalyptus sp.	Chile	P.W. Crous	KF901813	KF903460	KF902527	KF901498	KF902186	KF903086	KF902795
Batcheloromyces alistairii	CBS 120035 = CPC 12730^ET	Protea repens	South Africa	P.W. Crous & A. Smith	KF937220	–	–	–	KF937252	–	–
B. leucadendri	CBS 111577 = CPC 1838^EET	Leucadendron laureolum	South Africa	L. Swart	KF937221	–	–	–	KF937253	–	–
B. proteae	CBS 110696 = CPC 1518 = CPC 18701	Protea cynaroides	South Africa	L. Swart	KF901833	–	–	–	KF902195	–	–
B. sedgefieldii	CBS 112119 = CPC 3026^ET	Protea repens	South Africa	J.E. Taylor	KF937222	–	–	–	KF937254	–	–
Camarosporula persooniae	CBS 112494 = CPC 3350	Persoonia sp.	Australia	P.W. Crous & B.A. Summerell	JF770460	–	–	–	KF937255	–	–
Capnodium coffeae	CBS 147.52	Coffea robusta	Zaire	–	KF902173	–	–	–	KF902196	–	–
Catenulostroma hermanusense	CBS 128768 = CPC 18276^ET	Phaenocoma prolifera	South Africa	K.L. Crous & P.W. Crous	KF902089	–	–	–	KF902197	–	–
Cat. protearum	CBS 125421 = CPC 15370^EET	Leucadendron tinctum	South Africa	F. Roets	KF902090	–	–	–	KF902198	–	–
Cercospora ariminensis	CBS 137.56	Hedysarum coronarium	Italy	M. Ribaldi	KF902004	–	–	–	KF902199	–	–
C. beticola	CBS 124.31 = CPC 5070	Beta vulgaris	Romania	E.W. Schmidt	KF902046	–	–	–	KF902200	–	–
C. capsici	CBS 118712	–	Fiji	P. Tyler	KF251800	–	–	–	KF252302	–	–
C. zebrina	CBS 118790	Trifolium subterraneum	Australia	M.J. Barbetti	KF251651	–	–	–	KF252305	–	–
Cladosporium allicinum	CBS 118854	soil of Perilla field	South Korea	S.B. Hong	KJ564335	–	–	–	–	–	–
Cla. chalastosporoides	CBS 125985 = CPC 13864^ET	Protea arborea	South Africa	P.W. Crous	KJ564332	–	–	–	–	–	–
Cla. fusiforme	CBS 119414^ET	hypersaline water of Secovlje salterns	Slovenia	L. Butinar	KJ564333	–	–	–	–	–	–
Cla. herbarum	CBS 121621 = CPC 12177^ET	Hordeum vulgare	The Netherlands	P.W. Crous	KJ564331	–	–	–	–	–	–
Cla. hillianum	CBS 125988 = CPC 15458^ET	Typha orientalis	New Zealand	R. Beever	KJ564334	–	–	–	–	–	–
Cla. iridis	CBS 138.40 = CPC 15458^ET	Iris sp.	The Netherlands	Boterenbrood	EU167591	–	–	–	–	–	–
Constantinomyces macerans	TRN440	Rock sample	Spain	–	KF310005	–	–	–	KF310081	–	–
Con. nebulosus	CBS 117941 = TRN262	Rock sample	Spain	–	KF310014	–	–	–	KF310068	–	–
Cystocoleus ebeneus	L348	Rock sample	Austria	Hafellner & Muggia	EU048580	–	–	–	–	–	–
Devriesia acadiensis	CBS 115874 = DAOM 232211	Heat-treated soil	Canada	N. Nickerson	EU040226	–	–	–	KF937251	–	–
D. agapanthi	CBS 132689 = CPC 19833^ET	Agapanthus africanus	South Africa	P.W. Crous	JX069859	–	–	–	KJ564346	–	–
D. americana	CBS 117726^ET	Air sample	USA	F.M. Dugan	EU040227	–	–	–	–	–	–
D. bulbillosae	CBS 118285 = TRN81	Rock sample	Spain: Mallorca	C. Ruibal	KF310029	–	–	–	KF310102	–	–
D. capensis	CBS 130602 = CPC 18299^ET	Protea sp.	South Africa	P.W. Crous	JN712569	–	–	JN712501	–	–	–
	CPC 13981	Protea repens	Portugal	M.F. Moura	JN712568	–	–	EU707887	–	–	–
D. compacta	CBS 118294 = TRN111^ET	Rock sample	Spain	C. Ruibal	GU323967	–	–	–	KF310095	–	–
D. knoxdaviesii	CBS 122898 = CPC 14960^ET	Protea sp.	South Africa	P.W. & M. Crous	EU707865	–	–	EU707865	–	–	–
	CPC 14905	Protea sp.	South Africa	P.W. & M. Crous	KJ564328	–	–	EU707866	–	–	–
D. lagerstroemiae	CBS 125422 = CPC 14403^ET	Lagerstroemia indica	USA: Louisiana	P.W. Crous & M.J. Wingfield	KF902149	–	–	–	KF902233	–	–
D. modesta	CBS 137182 = CCFEE 5672^ET	Rock sample	Italy	–	KF310026	–	–	–	KF310093	–	–
D. queenslandica	CBS 129527 = CPC 17306^ET	Scaevola taccada	Australia: Queensland	P.W. Crous, R.G. Shivas & A.R. McTaggart	KF901839	–	–	–	KF902234	–	–
D. shakazului	CBS 133579 = CPC 19784^ET	Aloe sp.	South Africa	P.W. Crous	KC005797	–	–	–	KJ564347	–	–
D. shelburniensis	CBS 115876 = DAOM 232217	Heat-treated soil	Canada	N. Nickerson	EU040228	–	–	–	KF937256	–	–
D. simplex	CBS 137183 = CCFEE 5681^ET	Rock sample	Italy	–	KF310027	–	–	–	KF310104	–	–
Devriesia sp.	CPC 11876	Avicermia sp.	South Africa	W. Gams	GQ852622	–	–	–	KJ564341	–	–
D. staurophora	CBS 375.81 = ATCC 200934 = CPC 3687	Soil sample	Colombia	H. Valencia	KF901963	–	–	–	KF902201	–	–
	CBS 117873 = CPC 11198	Amelanchier lamarckii	The Netherlands	G. Verkley	KF937223	–	–	–	KF937257	–	–
D. stirlingiae	CBS 133581 = CPC 19948^ET	Stirlingia latifolia	Australia	W. Gams	KC005799	–	–	–	–	–	–
D. strelitziae	CBS 122379 = X1037^ET	Strelitzia nicolai	South Africa	W. Gams & H. Glen	GU301810	–	–	EU436763	GU371738	GU349049	–
D. strelitziicola	CBS 122480^ET	Strelitzia sp.	South Africa	W. Gams & H. Glen	GU214417	–	–	–	–	–	–
D. thermodurans	CBS 115878 = DAOM 225330^ET	Heat-treated soil	Canada	N. Nickerson	EU040229	–	–	–	KF937258	–	–
	CBS 115879 = DAOM 226677	Heat-treated soil	Canada	N. Nickerson	KF937224	–	–	–	KF937259	–	–
Dothistroma pini	CBS 116483	Pinus nigra	USA	G. Adams	JX901825	–	–	–	JX901949	–	–
Doth. septosporum	CBS 383.74	Pinus coulteri	France	M. Morelet	KF251807	–	–	–	KF252308	–	–
Elasticomyces elasticus	CBS 122538 = CCFEE 5313^ET	Lichen thallus (Usnea antarctica)	Antarctica	L. Zucconi	KJ380894	–	–	FJ415474	–	–	–
	CCFEE 5474	Rock sample	Antarctica	–	KF309991	–	–	–	KF310046	–	–
	CCFEE 5490	Rock sample	Antarctica	–	KF309992	–	–	–	KF310047	–	–
	CCFEE 5505	Rock sample	Argentina	–	KF309996	–	–	–	–	–	–
	CCFEE 5506	Rock sample	Argentina	–	KF309997	–	–	–	KF310048	–	–
	CCFEE 5525	Rock sample	Antarctica	–	KF309998	–	–	–	KF310049	–	–
	CCFEE 5526	Rock sample	Antarctica	–	KF309999	–	–	–	KF310050	–	–
	CCFEE 5543	Rock sample	India	–	KF309993	–	–	–	KF310051	–	–
	CCFEE 5547	Rock sample	Antarctica	–	KF310012	–	–	–	KF310052	–	–
Eupenidiella venezuelensis	CBS 106.75^ET	Man, Tinea nigra	Venezuela	D. Borelli	KF902163	KF903393	KF902540	KF901802	KF902202	KF903100	KF902803
Euteratosphaeria verrucosiafricana	CBS 118496 = CPC 11167^ET	Eucalyptus sp.	Indonesia	M.J. Wingfield	–	–	–	DQ303056	–	–	–
	CBS 118497 = CPC 11169	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901992	KF903496	KF902541	KF901653	KF902204	KF903102	KF902804
	CBS 118498 = CPC 11170	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901993	KF903497	KF902542	KF901654	KF902205	KF903103	KF902805
Extremus adstrictus	CBS 118292 = TRN96^ET	Rock sample	Spain	C. Ruibal	KF310022	–	–	–	KF310103	–	–
Ex. antarcticus	CCFEE 5312	Rock sample	Antarctica	–	KF310020	–	–	–	KF310086	–	–
	CBS 136103 = CCFEE 451^ET	Rock sample	Antarctica	–	GU250360	–	–	–	KF310085	–	–
	CBS 136104 = CCFEE 5207	Rock sample	Antarctica	–	KF310021	–	–	–	KF310087	–	–
Extremus sp.	CCFEE 5551	–	–	–	KC315879	–	–	–	–	–	–
Extremus sp.	CBS 118300 = TRN137	Rock sample	Spain	C. Ruibal	GU323973	–	–	–	KF310098	–	–
Extremus sp.	CBS 119436 = CCFEE 5177	Rock sample	Antarctica	S. Onofri	KJ564326	–	–	–	–	–	–
Friedmanniomyces endolithicus	CCFEE 5199	Rock sample	Antarctica	–	KF310007	–	–	–	KF310093	–	–
	CCFEE 5283	Rock sample	Antarctica	–	KF310006	–	–	–	KF310053	–	–
	CCFEE 5328	Rock sample	Antarctica	–	JN885563	–	–	–	KF310055	–	–
Hortaea thailandica	CBS 125423 = CPC 16651^ET	Syzygium siamense	Thailand	P.W. Crous & K.D. Hyde	KF902125	–	–	–	KF902206	–	–
Lapidomyces hispanicus	CBS 118764 = TRN126	Rock sample	Spain	–	KF310016	–	–	–	KF310076	–	–
Lecanosticta brevispora	CBS 133601 = CPC 18092^ET	Pinus sp.	Mexico	M. de Jesús Yáñez-Morales	KF902021	–	–	–	KF902207	–	–
	CPC 18092	Pinus sp.	Mexico	M. de Jesús Yáñez-Morales	JX901855	–	–	–	JX901979	–	–
L. longispora	CBS 133602 = CPC 17940^EET	Pinus sp.	Mexico	M. de Jesús Yáñez-Morales & C. Méndez-Inocencio	KF902022	–	–	–	KF902208	–	–
	CPC 17940	Pinus sp.	Mexico	M. de Jesús Yáñez-Morales & C. Méndez-Inocencio	JX901857	–	–	–	JX901981	–	–
	CPC 17941	Pinus sp.	Mexico	M. de Jesús Yáñez-Morales & C. Méndez-Inocencio	JX901858	–	–	–	JX901982	–	–
Melanodothis caricis	CBS 860.72^ET	–	–	–	GU214431	–	–	–	–	–	–
Meristemomyces frigidum	CCFEE 5457	Rock sample	Italy	–	GU250389	–	–	–	KF310063	–	–
	CCFEE 5507	Rock sample	Argentina	–	KF310013	–	–	–	KF310066	–	–
	CCFEE 5508	Rock sample	Argentina	–	GU250401	–	–	–	KF310067	–	–
Microxyphium citri	CBS 451.66	Citrus sinensis	Spain	H.A. van der Aa	KF902094	–	–	–	KF902209	–	–
Monticola elongata	CCFEE 5394	Rock sample	Italy	–	KF309995	–	–	–	KF310062	–	–
	CCFEE 5492	Rock sample	Italy	–	KF309994	–	–	–	–	–	–
	CCFEE 5499	Rock sample	Italy	–	GU250398	–	–	–	KF310065	–	–
Mucomycosphaerella eurypotamii	JK 5586J	Juncus roemerianus	USA: North Carolina	B. & J. Kohlmeyer	GU301852	–	–	–	GU371722	–	–
Mycosphaerella irregulari	CBS 123242 = CPC 15408 = TH003^ET	Eucalyptus globulus	Thailand	R. Cheewangkoon	KF902126	KF903542	KF902543	KF901769	KF902213	KF903107	KF902809
My. laricis-leptolepidis	MAFF 410632	Larix leptolepis	Japan	T. Yokota	JX901863	–	–	–	JX901987	–	–
	MAFF 410081	Larix leptolepis	Japan	K. Ito	JX901862	–	–	–	JX901986	–	–
My. madeirae	CBS 112301 = CPC 3747^ET	Eucalyptus globulus	Portugal: Madeira	S. Denman	KF902033	KF903453	KF902544	KF901688	–	KF903108	–
	CBS 112895 = CPC 3745 = CMW 14458^ET	Eucalyptus globulus	Portugal: Madeira	S. Denman	KF902017	–	KF902545	KF901675	KF902214	KF903109	–
My. nootherensis	CBS 130522^ET	Corymbia intermedia	Australia	A.J. Carnegie	KF901835	–	–	–	KF902216	–	–
My. pseudomarksii	CBS 123241 = CPC 15410 = TH126^ET	Eucalyptus sp.	Thailand	R. Cheewangkoon	KF902127	KF903541	KF902547	KF901770	KF902217	KF903111	KF902811
My. pseudovespa	CBS 121159 = DAR 77432^ET	Eucalyptus biturbinata	Australia	A.J. Carnegie	KF901836	KF903535	KF902548	–	KF902218	KF903112	KF902812
My. quasiparkii	CBS 123243 = CPC 15409^ET	Eucalyptus sp.	Thailand	P. Suwannawong	KF902128	KF903543	KF902549	KF901771	KF902219	KF903113	KF902813
My. sumatrensis	CBS 118499 = CPC 11171^ET	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901994	KF903498	KF902550	KF901655	KF902220	–	KF902814
	CBS 118501= CPC 11175	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901995	KF903499	KF902551	KF901656	KF902221	–	KF902815
	CBS 118502= CPC 11178	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901996	KF903500	KF902552	KF901657	KF902222	–	KF902816
My. vietnamensis	CBS 119974 = CMW 23441 = MUCC 66^ET	Eucalyptus grandis hybrid	Vietnam	T.I. Burgess	KF902171	KF903514	KF902553	KF901809	–	KF903114	KF902817
Myrtapenidiella corymbia	CBS 124769 = CPC 14640^ET	Corymbia foelscheana	Australia: Northern Territory	B.A. Summerell	KF901838	KF903558	KF902558	KF901517	KF902227	KF903119	KF902822
	CPC 14641	Corymbia foelscheana	Australia: Northern Territory	B.A. Summerell	KF937225	–	–	–	KF937261	–	–
Myr. eucalypti	CBS 123245 = CPC 15449	Eucalyptus camaldulensis	Thailand	R. Cheewangkoon	KF902129	–	–	–	KF902228	–	–
	CBS 123246 = CPC 15411^ET	Eucalyptus camaldulensis	Thailand	P. Suwannawong	KF902130	KF903545	KF902559	KF901772	KF902229	KF903120	KF902823
Myr. tenuiramis	CBS 124993 = CPC 13692^ET	Eucalyptus tenuiramis	Australia: Tasmania	B.A. & P. Summerell	GQ852626	–	–	–	KF937262	–	–
	CPC 13692	Eucalyptus tenuiramis	Australia: Tasmania	B.A. & P. Summerell	KF901997	KF903658	KF902560	KF901658	KF902230	KF903121	KF902824
Neocatenulostroma abietis	CBS 110038	Painted outdoor wall	Sweden	N. Hallenberg	KF937226	–	–	–	KF937263	–	–
Neoc. germanicum	CBS 539.88^ET	Rock sample	Germany	J. Kuroczkin	KF901989	–	–	–	KF902231	–	–
Neoc. microsporum	CBS 101951 = CPC 1960^{ET of sexual morph}	Protea cynaroides	South Africa	J.E. Taylor & S. Denman	KF901814	–	KF902561	KF901499	KF902232	KF903122	KF902825
	CBS 110890 = CPC 1832^{ET of asexual morph}	Protea cynaroides	South Africa	J.E. Taylor & S. Denman	EU019255	JX500130	–	AY260097	–	–	–
	CBS 111031 = CPC 1848	Protea cynaroides	South Africa	J.E. Taylor & S. Denman	KF937227	–	–	–	KF937264	–	–
Neodevriesia hilliana	CBS 123187 = CPC 15382^ET	Macrozamia communis	New Zealand	C.F. Hill	GU214414	–	–	–	–	–	–
Neodevriesia xanthorrhoeae	CBS 128219 = CPC 17720^ET	Xanthorrhoea australis	Australia	P.W. Crous, I. Pascoe & J. Edwards	HQ599606	–	–	–	–	–	–
Neodevriesia sp.	CBS 118302 = TRN142	Rock sample	Spain: Mallorca	C. Ruibal	GU323975	–	–	–	KF310100	–	–
Neodevriesiaceae sp.	CPC 19594	mycoparasite of Myriangium sp.	Brazil	H.C. Evans	KJ564327	–	–	–	KJ564349	–	–
Neohortaea acidophila	CBS 113389^ET	Lignite rock	Germany	U. Hölker	GU323202	–	–	GU214636	GU357768	–	–
Neopenidiella nectandrae	CBS 734.87^ET	Nectandra coriacea	Cuba	R.F. Castañeda & G. Arnold	KF901982	–	–	–	KF902235	–	–
Neophaeothecoidea proteae	CBS 114129 = CPC 2831^ET	Protea repens	South Africa	S. Denman	KF937228	–	–	–	KF937265	–	–
Neotrimmatostroma excentricum	CBS 121102 = CPC 13092^ET	Eucalyptus agglomerata	Australia: New South Wales	G. Price	KF901840	KF903534	KF902562	KF901518	KF902236	KF903123	KF902826
Oleoguttula mirabilis	CCFEE 5522	Rock sample	Antarctica	–	KF310019	–	–	–	KF310070	–	–
Pallidocercospora acaciigena	CBS 112515 = CPC 3837^ET	Acacia mangium	Venezuela	M.J. Wingfield	KF902166	KF903455	KF902564	KF901805	KF902238	KF903125	KF902828
	CBS 112516 = CPC 3838^ET	Acacia mangium	Venezuela	M.J. Wingfield	KF902105	KF903456	KF902563	KF901751	KF902237	KF903124	KF902827
	CBS 115432 = CPC 3836^ET	Acacia mangium	Venezuela	M.J. Wingfield	KF902165	–	–	KF901804	KF902211	KF903105	KF902807
	CBS 120740 = CPC 13290	Eucalyptus sp.	Australia	B.A. Summerell	KF901834	–	–	KF901515	KF902212	KF903106	KF902808
	CPC 13350	Eucalyptus camaldulensis × Eucalyptus urophylla	Venezuela	M.J. Wingfield	KF902164	–	–	KF901803	KF902210	KF903104	KF902806
P. colombiensis	CBS 110967 = CPC 1104 = CMW 11255^ET	Eucalyptus urophylla	Colombia	M.J. Wingfield	KF901968	KF903413	KF902611	KF901633	KF902295	KF903178	KF902880
	CBS 110968 = CPC 1105^ET	Eucalyptus urophylla	Colombia	M.J. Wingfield	KF901969	KF903414	KF902612	KF901634	KF902296	KF903179	KF902881
	CBS 110969 = CPC 1106 = CMW 4944^ET	Eucalyptus urophylla	Colombia	M.J. Wingfield	KF901970	KF903415	KF902613	KF901635	KF902297	KF903180	KF902882
P. crystallina	CBS 110699 = CPC 2155	Leucospermum sp.	USA: Hawaii	P.W. Crous & M.E. Palm	KF902161	KF903400	KF902566	KF901801	KF902240	KF903127	KF902830
	CBS 111044 = CPC 1178	Leaf litter of Eucalyptus grandis × Eucalyptus camaldulensis	South Africa	M.J. Wingfield	KF902050	KF903423	KF902567	KF901703	KF902241	KF903128	KF902831
	CBS 111045 = CPC 1179	Leaf litter of Eucalyptus grandis × Eucalyptus camaldulensis	South Africa	M.J. Wingfield	KF902051	KF903424	KF902568	KF901704	KF902242	KF903129	KF902832
	CBS 681.95 = CPC 802 = CMW 3033^ET	Eucalyptus bicostata	South Africa	M.J. Wingfield	KF902052	KF903590	KF902569	KF901705	KF902243	KF903130	KF902833
	CPC 11453	Eucalyptus sp.	Brazil	A.C. Alfenas	KF901934	KF903601	KF902565	KF901609	KF902239	KF903126	KF902829
P. heimii	CBS 110682 = CPC 760 = CMW 4942^ET	Eucalyptus sp.	Madagascar	P.W. Crous	KF902013	KF903399	KF902575	KF901671	KF902249	KF903136	KF902839
	CPC 10992	Eucalyptus sp.	Colombia	M.J. Wingfield	KF901964	KF903593	KF902570	KF901629	KF902244	KF903131	KF902834
	CPC 11441	Eucalyptus sp.	Brazil	A.C. Alfenas	KF901935	KF903600	KF902571	KF901610	KF902245	KF903132	KF902835
	CPC 11548	Eucalyptus sp.	Brazil	A.C. Alfenas	KF901936	KF903602	KF902572	KF901611	KF902246	KF903133	KF902836
	CPC 11716	–	Brazil	A.C. Alfenas	KF901937	KF903605	KF902573	KF901612	KF902247	KF903134	KF902837
	CPC 11926	Acacia auriculiformis	Thailand	W. Himaman	KF902131	KF903607	KF902581	KF901773	KF902257	KF903144	KF902847
	CPC 13099	Eucalyptus dunnii	Australia	A.J. Carnegie	KF901841	KF903635	KF902574	KF901519	KF902248	KF903135	KF902838
P. heimioides	CBS 111190 = CPC 1312 = CMW 3046^ET	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901998	KF903440	KF902576	KF901659	KF902250	KF903137	KF902840
	CBS 111364 = CPC 1311 = CMW 14776	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901815	KF903446	KF902577	KF901500	KF902251	KF903138	KF902841
P. holualoana	CBS 110698 = CPC 2126^ET	Leucospermum sp.	USA: Hawaii	P.W. Crous & M.E. Palm	KJ380896	–	–	AY260087	KJ380900	–	–
P. irregulariramosa	CBS 111211 = CPC 1362 = CMW 5223^ET	Eucalyptus saligna	South Africa	M.J. Wingfield	KF902053	KF903441	KF902578	KF901706	KF902252	KF903139	KF902842
P. konae	CBS 111028 = CPC 2125^ET	Leucadendron cv. ‘Safari Sunset’	USA: Hawaii	P.W. Crous & M.E. Palm	KF902158	KF903422	–	KF901798	KF902253	KF903140	KF902843
	CBS 111261 = CPC 2123^ET	Leucadendron cv. ‘Safari Sunset’	USA: Hawaii	P.W. Crous & M.E. Palm	KF902159	KF903442	–	KF901799	KF902254	KF903141	KF902844
P. thailandica	CBS 116367 = CPC 10547^ET	Acacia mangium	Thailand	K. Pongpanich	KF902134	–	–	KF901776	KF902337	KF903221	KF902923
	CBS 120723 = CPC 13478	Eucalyptus camaldulensis	Thailand	W. Himaman	KF902135	KF903524	KF902648	KF901777	KF902338	KF903222	KF902924
	CBS 121389 = X882 = CIRAD 81	Musa sp.	Brazil	–	KF902023	–	–	KF901679	KF902339	KF903223	KF902925
	CBS 121390 = X883 = CIRAD 1165	Musa sp.	Cameroon	–	KF901956	–	–	KF901624	KF902340	KF903224	KF902926
Paramycosphaerella intermedia	CBS 114356 = CPC 10902 = NZFS 301 K/1	Eucalyptus saligna	New Zealand	L. Renney	KF902026	KF903466	KF902579	KF901681	KF902255	KF903142	KF902845
	CBS 114415 = CPC 10922 = NZFS 301.13	Eucalyptus saligna	New Zealand	L. Renney	KF902027	KF903468	KF902580	KF901682	KF902256	KF903143	KF902846
Pa. marksii	CBS 110693 = CPC 823	Eucalyptus grandis × saligna	South Africa	G. Kemp	DQ204758	–	–	DQ267597	–	–	–
	CBS 110750 = CPC 822 = CMW 14778	Eucalyptus grandis × saligna	South Africa	G. Kemp	KF902056	KF903404	KF902586	KF901709	KF902262	KF903149	KF902852
	CBS 110920 = CPC 935	Eucalyptus globulus	Australia: Victoria	A.J. Carnegie	KF901842	KF903410	KF902582	KF901520	KF902258	KF903145	KF902848
	CBS 110963 = CPC 4632	Musa sp.	South Africa	K. Surridge	KF902054	KF903411	KF902583	KF901707	KF902259	KF903146	KF902849
	CBS 110964 = CPC 4633	Musa sp.	South Africa	K. Surridge	KF902055	KF903412	KF902584	KF901708	KF902260	KF903147	KF902850
	CBS 110981 = CPC 1073	Eucalyptus sp.	Tanzania	M.J. Wingfield	KF902103	KF903417	KF902585	KF901749	KF902261	KF903148	KF902851
Parapenidiella pseudotasmaniensis	CBS 124991 = CPC 12400^ET	Eucalyptus globulus	Australia	I.W. Smith	KF901844	KF903562	KF902589	KF901522	KF902265	KF903152	KF902855
Para. tasmaniensis	CBS 111687 = CMW 14780 = CPC 1555^ET	Eucalyptus nitens	Australia: Tasmania	M.J. Wingfield	KF901843	KF903451	KF902587	KF901521	KF902263	KF903150	KF902853
	CBS 114556 = CMW 14663 = CPC 1556^ET	Eucalyptus nitens	Australia: Tasmania	M.J. Wingfield	KF902132	KF903469	KF902588	KF901774	KF902264	KF903151	KF902854
Parateratosphaeria altensteinii	CBS 123539 = CPC 15133^ET	Encephalartos altensteinii	South Africa	P.W. Crous, M.K. Crous, M. Crous & K. Raath	KF937230	–	–	–	KF937267	–	–
Pata. bellula	CBS 111700 = CPC 1821^EET	Protea eximia	South Africa	J.E. Taylor	KF937232	–	–	–	–	–	–
Pata. karinae	CBS 128774 = CPC 18255^ET	Phaenocoma prolifera	South Africa	K.L. Crous & P.W. Crous	KF902091	–	–	–	KF902266	–	–
Pata.cf. bellula	CBS 111699 = CPC 1816	Leucospermum sp.	South Africa	J.E. Taylor	KF937231	–	–	–	–	–	–
Pata. marasasii	CBS 122899 = CPC 14889^ET	Protea sp.	South Africa	P.W. & M. Crous	KF937233	–	–	–	KF937268	–	–
Pata. persoonii	CBS 122895 = CPC 13972^ET	Protea sp.	South Africa	P.W. Crous & L. Mostert	KF937234	–	–	–	–	–	–
	CBS 122896 = CPC 14846 = STE-U 6389	Euchaetis meridionalis	South Africa	A.R. Wood	KF937235	–	–	–	–	–	–
Passalora eucalypti	CBS 111318 = CPC 1457^ET	Eucalyptus saligna	Brazil	P.W. Crous & A.C. Alfenas	KF901938	KF903445	KF902590	KF901613	KF902267	KF903153	KF902856
Pas. intermedia	CBS 124154 = CPC 15745 = A39^ET	Eucalyptus camaldulensis	Madagascar	M.J. Wingfield	KF902014	KF903548	KF902591	KF901672	KF902268	KF903154	KF902857
Pas. leptophlebiae	CBS 129524 = CPC 18480^ET	Eucalyptus leptophlebia	Brazil	P.W. Crous, A.C. Alfenas, R. Alfenas & O.L. Pereira	KF901939	KF903580	–	KF901614	KF902269	KF903155	KF902858
Pas. zambiae	CBS 112970 = CPC 1228^ET	Eucalyptus globulus	Zambia	T. Coutinho	KF902175	KF903458	KF902593	KF901811	KF902271	KF903157	–
	CBS 112971 = CPC 1227^ET	Eucalyptus globulus	Zambia	T. Coutinho	KF902174	KF903459	KF902592	KF901810	KF902270	KF903156	KF902859
Penidiella columbiana	CBS 486.80^ET	Paepalanthus columbianus	Colombia	W. Gams	KF901965	KF903587	KF902594	KF901630	KF902272	KF903158	KF902860
Petrophila incerta	CBS 118287 = TRN77	Rock sample	Spain	C. Ruibal	GU323963	–	–	–	KF310101	–	–
	CBS 118608 = TRN139b^ET	Rock sample	Spain	C. Ruibal	KF310030	–	–	–	KF310091	–	–
Phaeophleospora eugeniae	CPC 15143	Eugenia uniflora	Brazil	A.C. Alfenas	KF901940	KF903674	KF902596	KF901615	KF902274	KF903160	KF902862
	CPC 15159	Eugenia uniflora	Brazil	A.C. Alfenas	KF902095	KF903675	KF902595	KF901742	KF902273	KF903159	KF902861
Pha. eugeniicola	CPC 2557^ET	Eugenia klotzschiana	Brazil	A.C. Alfenas	KF901845	–	–	KF901523	KF902275	–	–
Pha. gregaria	CBS 110501	Eucalyptus globulus	Australia	A. Maxwell	KF901846	KF903396	KF902597	KF901524	KF902276	KF903161	KF902863
	CBS 111166 = CPC 1224	Eucalyptus cladocalyx	South Africa	A.R. Wood	KF902057	KF903433	KF902598	KF901710	KF902277	KF903162	KF902864
	CBS 111167 = CPC 1225	Eucalyptus cladocalyx	South Africa	A.R. Wood	KF902058	KF903434	KF902599	KF901711	KF902278	KF903163	KF902865
	CBS 111519 = CPC 1191	Eucalyptus sp.	South Africa	P.W. Crous	KF902059	KF903448	KF902600	KF901712	KF902279	KF903164	KF902866
	CBS 114662 = CPC 1193^{ET of M. endophytica}	Eucalyptus sp.	South Africa	P.W. Crous	KF902060	KF903470	KF902601	KF901713	KF902280	KF903165	KF902867
Pha. scytalidii	CBS 118493 = CPC 10998^ET	Eucalyptus urophylla	Colombia	M.J. Wingfield	KF901966	KF903493	KF902603	KF901631	KF902282	KF903167	KF902869
	CBS 516.93 = CPC 653	Eucalyptus globulus	Brazil	F.A. Ferreira	KF901941	KF903588	KF902602	KF901616	KF902281	KF903166	KF902868
Pha. stonei	CBS 120830 = CPC 13330^ET	Eucalyptus sp.	Australia	P.W. Crous & J. Stone	KF901847	KF903645	KF902604	KF901525	KF902283	KF903168	KF902870
Pha. stramenti	CBS 118909 = CPC 11545^ET	Leaf litter of Eucalyptus sp.	Brazil	A.C. Alfenas	KF901942	KF903506	KF902605	KF901617	KF902284	KF903169	KF902871
Phaeothecoidea eucalypti	CBS 120831 = CPC 12918^ET	Eucalyptus botryoides	Australia: New South Wales	B.A. Summerell	KF901848	–	–	KF901526	KF902285	KF903170	KF902872
Phaeo. intermedia	CBS 124994 = CPC 13711^ET	Eucalyptus globulus	Australia: Bruny Island	B.A. Summerell, P. Summerell & A. Summerell	KF902106	KF903564	KF902606	KF901752	KF902286	KF903171	KF902873
	CPC 13711	Eucalyptus globulus	Australia: Bruny Island	B.A. Summerell, P. Summerell & A. Summerell	GQ852628	–	–	–	KF937269	–	–
Phaeo. minutispora	CBS 124995 = CPC 13710^ET	Eucalyptus globulus	Australia: Bruny Island	B.A. Summerell, P. Summerell & A. Summerell	KF902107	–	–	–	KF902287	–	–
	CPC 13710	Eucalyptus globulus	Australia: Bruny Island	B.A. Summerell, P. Summerell & A. Summerell	KF902108	KF903659	KF902607	KF901753	KF902288	KF903172	KF902874
Piedraia hortae var. hortae	CBS 480.64	Human hair	Brazil	A.C. Batista	KF901943	–	–	–	KF902289	–	–
Piedraia hortae var. paraguayensis	CBS 276.32	–	–	–	KF901816	–	–	–	–	–	–
Pie. quintanilhae	CBS 327.63^ET	Genetta tigrina	Central African Republic	N. van Uden	KF901957	–	–	–	–	–	–
Polychaeton citri	CBS 116435	Citrus aurantium	Iran	R. Zare & W. Gams	GU214469	–	–	–	–	–	–
Polyphialoseptoria tabebuiae-serratifoliae	CBS 112650 = CPC 3944^ET	Tabebuia serratifolia	Brazil	A.C. Alfenas	KF251716	–	–	–	KF252218	–	–
Pseudocercospora basiramifera	CBS 111072 = CPC 1266^ET	Eucalyptus pellita	Thailand	M.J. Wingfield	KF902028	KF903428	KF902608	KF901683	KF902291	KF903174	KF902876
	CBS 114757 = CPC 1267^ET	Eucalyptus pellita	Thailand	M.J. Wingfield	KF901817	KF903472	KF902609	KF901501	KF902292	KF903175	KF902877
Ps. basitruncata	CBS 114664 = CPC 1202 = CMW 14914	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901967	KF903471	KF902610	KF901632	KF902293	KF903176	KF902878
Ps. chiangmaiensis	CBS 123244 = CPC 15412^ET	Eucalyptus camaldulensis	Thailand	P. Suwannawong	KF902133	KF903544	–	KF901775	KF902294	KF903177	KF902879
Ps. crousii	CBS 119487 = Lynfield 1260	Eucalyptus sp.	New Zealand	C.F. Hill	KF902029	KF903511	KF902614	KF901684	KF902298	KF903181	KF902883
Ps. eucalyptorum	CBS 110722 = CPC 15	Eucalyptus nitens	South Africa	P.W. Crous	KF902061	KF903401	KF902618	KF901714	KF902302	KF903185	KF902887
	CBS 110723 = CPC 17	Eucalyptus nitens	South Africa	P.W. Crous	KF902062	KF903402	KF902619	KF901715	KF902303	KF903186	KF902888
	CBS 110776 = CPC 12	Eucalyptus nitens	South Africa	P.W. Crous	KF902063	KF903405	KF902620	KF901716	KF902304	KF903187	KF902889
	CBS 110777 = CPC 16 = CMW 5228^{ET of Ps. eucalyptorum}	Eucalyptus nitens	South Africa	P.W. Crous	KF901944	KF903406	KF902621	KF901618	KF902305	KF903188	KF902890
	CBS 110903 = CPC 14	Eucalyptus nitens	South Africa	P.W. Crous	KF902064	KF903408	KF902622	KF901717	KF902306	KF903189	KF902891
	CBS 111268 = CPC 1195	Eucalyptus grandis	Kenya	T. Coutinho	KF901818	KF903443	KF902623	KF901502	KF902307	KF903190	KF902892
	CBS 114242 = CPC 10390 = CMW 14908^{ET of Ps. pseudoeucalyptorum}	Eucalyptus globulus	Spain	J.P. Mansilla	KF902097	–	–	KF901744	KF902328	KF903212	KF902914
	CBS 114866 = CPC 11	Eucalyptus nitens	South Africa	P.W. Crous	KF902067	KF903474	KF902627	KF901720	KF902311	KF903195	KF902897
	CBS 116303 = CPC 13	Eucalyptus nitens	South Africa	P.W. Crous	KF902065	KF903482	KF902625	KF901718	KF902308	KF903192	KF902894
	CBS 116304 = CPC 10	Eucalyptus nitens	South Africa	P.W. Crous	KF902066	KF903483	KF902626	KF901719	KF902309	KF903193	KF902895
	CBS 116359 = CPC 3751	Eucalyptus sp.	Spain: Madeira	–	KF902018	KF903484	–	KF901676	KF902310	KF903194	KF902896
	CBS 132015 = CPC 11713	Eucalyptus globulus	Spain	P. Mansilla	KF902096	KF903604	KF902615	KF901743	KF902299	KF903182	KF902884
	CBS 132029 = CPC 12406	Eucalyptus globulus	Australia	I.W. Smith	KF901849	KF903615	KF902616	KF901527	KF902300	KF903183	KF902885
	CBS 132032 = CPC 12802	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF902034	KF903625	KF902634	KF901689	KF902322	KF903206	KF902908
	CBS 132033 = CPC 12957	Eucalyptus deanei	Australia	B.A. Summerell	KF901850	KF903630	KF902617	KF901528	KF902301	KF903184	KF902886
	CBS 132034 = CPC 13455	Eucalyptus sp.	Portugal	P.W. Crous	KF902035	KF903649	KF902638	KF901690	KJ564342	KF903210	KF902912
	CBS 132035 = CPC 13769	Eucalyptus punctata	South Africa	P.W. Crous	KF902071	KF903660	KF902635	KF901724	KF902323	KF903207	KF902909
	CBS 132105 = CPC 13926	Eucalyptus sp.	USA: California	S. Denman	KF902141	KF903669	KF902636	KF901783	KF902324	KF903208	KF902910
	CBS 132114 = CPC 13816	Eucalyptus glaucescens	United Kingdom	S. Denman	KF902140	KF903661	KF902639	KF901782	KF902327	KF903211	KF902913
	CBS 132309 = CPC 12568	Eucalyptus nitens	Australia: Tasmania	C. Mohammed	KF902109	KF903621	KF902637	KF901754	KF902325	KF903209	KF902911
Ps. flavomarginata	CBS 118824 = CMW 13594^ET	Eucalyptus camaldulensis	Thailand	M.J. Wingfield	KF901961	KF903505	–	KF901627	KF902312	KF903196	KF902898
Ps. fori	CBS 113285 = CMW 9095^ET	Eucalyptus grandis	South Africa	G.C. Hunter	KF902069	KF903462	KF902629	KF901722	KF902314	KF903198	KF902900
	CBS 113286 = CMW 9095	Eucalyptus sp.	South Africa	J. Roux	KF902068	KF903463	KF902628	KF901721	KF902313	KF903197	KF902899
Ps. gracilis	CBS 111189 = CPC 1315	Eucalyptus urophylla	Indonesia	M.J. Wingfield	KF902000	KF903439	KF902632	KF901661	KF902317	KF903201	KF902903
	CBS 116291 = CPC 10503	Eucalyptus globulus	China	A. Aptroot	KF901960	–	KF902624	–	–	KF903191	KF902893
	CPC 11144	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901971	KF903594	KF902630	KF901636	KF902315	KF903199	KF902901
	CPC 11181	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF901999	KF903595	KF902631	KF901660	KF902316	KF903200	KF902902
Ps. madagascariensis	CBS 124155 = CPC 14621^ET	Eucalyptus camaldulensis	Madagascar	M.J. Wingfield	KF902015	KF903549	–	KF901673	KF902318	KF903202	KF902904
Ps. marginalis	CBS 131582 = CPC 12497^ET	Fraxinus rhynchophylla	South Korea	H.D. Shin	KF902010	KF903618	KF902641	KF901668	KF902330	KF903214	KF902916
Ps. natalensis	CBS 111069 = CPC 1263 = CMW 14777^ET	Eucalyptus nitens	South Africa	T. Coutinho	KF902070	KF903427	–	KF901723	KF902319	KF903203	KF902905
Ps. norchiensis	CBS 120738 = CPC 13049^ET	Eucalyptus sp.	Italy	W. Gams	KF902005	KF903531	KF902633	KF901665	KF902320	KF903204	KF902906
Ps. paraguayensis	CBS 111286 = CPC 1459 = CMW 14779	Eucalyptus nitens	Brazil	P.W. Crous	KF901945	KF903444	–	KF901619	KF902321	KF903205	KF902907
Ps. pyracanthigena	CBS 131589 = CPC 10808^ET	Pyracantha angustifolia	South Korea	M.J. Park	KF902009	KF903591	–	KF901667	KF902290	KF903173	KF902875
Ps. robusta	CBS 111175 = CPC 1269 = CMW 5151^ET	Eucalyptus robur	Malaysia	M.J. Wingfield	KF902020	KF903437	KF902640	KF901678	KF902329	KF903213	KF902915
Ps. schizolobii	CBS 120029 = CPC 12962^ET	Schizolobium parahybum	Ecuador	M.J. Wingfield	KF251826	–	–	–	KF252326	–	–
Ps. sphaerulinae	CBS 112621 = CPC 4314	Eucalyptus sp.	Chile	P.W. Crous	KF901958	–	KF902642	KF901625	KF902331	KF903215	KF902917
Ps. subulata	CBS 118489 = CPC 10849	Eucalyptus botryoides	New Zealand	M. Dick	KF902030	KF903492	KF902643	KF901685	KF902332	KF903216	KF902918
Ps. tereticornis	CBS 124996 = CPC 12960	Eucalyptus nitens	Australia	A.J. Carnegie	KF901852	KF903565	KF902645	KF901530	KF902334	KF903218	KF902920
	CBS 125214 = CPC 13299^ET	Eucalyptus tereticornis	Australia	P.W. Crous & B. Summerell	KF901854	KF903641	KF902647	KF901532	KF902336	KF903220	KF902922
	CPC 13008	Eucalyptus tereticornis	Australia	A.J. Carnegie	KF901853	KF903631	KF902646	KF901531	KF902335	KF903219	KF902921
	CPC 13315	Eucalyptus tereticornis	Australia	P.W. Crous & B. Summerell	KF901851	KF903643	KF902644	KF901529	KF902333	KF903217	KF902919
Ps. vitis	CBS 132012 = CPC 11595	Vitis vinifera	South Korea	H.D. Shin	KF902011	KF903603	KF902649	KF901669	KF902341	KF903225	KF902927
Pseudoramichloridium brasilianum	CBS 283.92^ET	Forrest soil	Brazil	D. Atilli	EU041854	_	_	_	_	–	–
Pso. henryi	CBS 124775 = CPC 13121^ET	Corymbia henryi	Australia	A.J. Carnegie	KF901857	KF903559	KF902652	KF901535	KF902344	KF903227	KF902930
	CPC 13122	Corymbia henryi	Australia	A.J. Carnegie	KF901855	KF903639	KF902650	KF901533	KF902342	KF903226	KF902928
Pseudoteratosphaeria flexuosa	CBS 110743 = CPC 673	Eucalyptus globulus	Colombia	M.J. Wingfield	KF902098	KF903403	KF902653	KF901745	KF902345	KF903228	KF902931
	CBS 111012 = CPC 1109^ET	Eucalyptus globulus	Colombia	M.J. Wingfield	KF902110	KF903421	KF902654	KF901755	KF902346	–	KF902932
	CBS 111048 = CPC 1199	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901978	KF903425	KF902723	KF901643	KF902433	KF903309	KF903007
	CBS 111163 = CPC 1201	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901979	KF903430	KF902724	KF901644	KF902434	KF903310	KF903008
Pet. gamsii	CBS 118495 = CPC 11138^ET	Eucalyptus sp.	India	W. Gams & M. Arzanlou	KF901990	KF903494	KF902655	KF901650	KF902347	KF903229	KF902933
Pet. ohnowa	CBS 112896 = CPC 1004^ET	Eucalyptus grandis	South Africa	M.J. Wingfield	KF901946	KF903457	KF902656	KF901620	KF902348	KF903230	KF902934
	CBS 112973 = CPC 1005	Eucalyptus grandis	South Africa	M.J. Wingfield	GU214511	–	–	AF173299	–	–	–
	CBS 110949 = CPC 1006	Eucalyptus grandis	South Africa	M.J. Wingfield	–	–	–	AY725575	–	–	–
	CBS 113290 = CMW 9102	Eucalyptus smithii	South Africa	G.C. Hunter	KF937236	–	–	–	KF937270	–	–
Pet. perpendicularis	CBS 118367 = CPC 10983^ET	Eucalyptus eurograndis	Colombia	M.J. Wingfield	KF901972	KF903491	–	KF901637	KF902350	KF903232	KF902936
Pet. secundaria	CBS 111002 = CPC 1112	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901858	KF903420	KF902659	KF901536	KF902352	KF903234	KF902938
	CBS 115608 = CPC 504	Eucalyptus grandis	Brazil	A.C. Alfenas	KF901859	KF903476	KF902660	KF901537	KF902353	KF903235	KF902939
	CBS 118507 = CPC 11551^ET	Eucalyptus sp.	Brazil	A.C. Alfenas	KF901947	KF903503	KF902661	KF901621	KF902354	KF903236	KF902940
	CPC 10989	Eucalyptus sp.	Colombia	M.J. Wingfield	KF901973	KF903592	KF902658	KF901638	KF902351	KF903233	KF902937
Pet. stramenticola	CBS 118506 = CPC 11438^ET	Eucalyptus sp. leaf litter	Brazil	A.C. Alfenas	KF901948	KF903502	KF902662	KF901622	KF902355	KF903237	KF902941
	CBS 120737 = CPC 13373^ET	Eucalyptus urophylla	Venezuela	M.J. Wingfield	KF902167	KF903530	KF902657	KF901806	KF902349	KF903231	KF902935
Queenslandipenidiella kurandae	CBS 121715 = CPC 13333^ET	Exudates of bleeding stem cankers of unidentified trees	Australia: Queensland	P.W. Crous & J.K. Stone	KF901860	KF903538	KF902663	KF901538	KF902356	KF903238	KF902942
Ramichloridium apiculatum	CBS 400.76	Soil sample	Pakistan	A. Kamal	EU041851	–	–	–	KJ564337	–	–
Ramularia endophylla	CBS 113265^EET	Dead leaf of Quercus robur	Netherlands	G. Verkley	KF902072	KF903461	KF902665	KF901725	KF902358	KF903240	KF902944
Ram. eucalypti	CBS 120726 = CPC 13043^ET	Eucalyptus grandiflora	Italy	W. Gams	KF902006	KF903525	–	KF901666	KF902359	KF903241	KF902945
Ram. pratensis var. pratensis	CPC 11294	Rumex crispus	South Korea	H.D. Shin	KF902111	KF903599	–	KF901756	KF902360	KF903242	KF902946
Ramulispora sorghi	CBS 110579 = CPC 906	Sorghum bicolor	South Africa	D. Nowell	GQ852654	–	–	–	KF937271	–	–
Readeriella angustia	CBS 124997 = CPC 13608^ET	Eucalyptus delegatensis	Australia: Tasmania	B.A. Summerell	KF902114	KF903566	KF902669	KF901759	KF902364	KF903246	KF902950
	CBS 124998 = CPC 13618	Eucalyptus delegatensis	Australia: Tasmania	B.A. Summerell	KF902113	KF903567	KF902668	KF901758	KF902363	KF903245	KF902949
	CPC 13621	Eucalyptus regnans	Australia: Tasmania	B.A. Summerell, P. Summerell & A. Summerell	KF902112	KF903654	KF902666	KF901757	KF902361	KF903243	KF902947
	CPC 13630	Eucalyptus delegatensis	Australia: Tasmania	B.A. Summerell	KF901819	KF903655	KF902667	KF901503	KF902362	KF903244	KF902948
Read. callista	CBS 124986 = CPC 13615^EET	Eucalyptus sclerophylla	Australia: New South Wales	B.A. Summerell	KF442562	–	–	–	KF442602	–	–
	CPC 12841	Eucalyptus cannonii	Australia: New South Wales	B.A. Summerell	KF901862	KF903627	KF902670	KF901540	KF902365	KF903247	KF902951
	CPC 13605	Eucalyptus multicaulis	Australia: New South Wales	B.A. Summerell	KF901863	KF903652	KF902671	KF901541	KF902366	KF903248	KF902952
	CPC 13615	Eucalyptus sclerophylla	Australia: New South Wales	B.A. Summerell	KF901974	KF903653	KF902672	KF901639	KF902367	KF903249	KF902953
Read. deanei	CBS 134746 = CPC 12715^ET	Eucalyptus deanei	Australia: New South Wales	B.A. Summerell	KF901864	KF903583	KF902673	KF901542	KF902368	KF903250	KF902954
Read. dendritica	CBS 120032 = CPC 12709^ET	Eucalyptus deanei	Australia: New South Wales	B.A. Summerell	KF901865	KF903623	KF902674	KF901543	KF902369	KF903251	KF902955
Read. dimorphospora	CBS 120034 = CPC 12636^ET	Eucalyptus nitens	Australia: Tasmania	C. Mohammed	KF901866	KF903622	KF902675	KF901544	KF902370	KF903252	KF902956
Read. eucalypti	CBS 120079 = CPC 11184^EET	Eucalyptus globulus	Spain	M.J. Wingfield	KJ380898	–	–	–	KJ380903	–	–
	CPC 13401	Eucalyptus miniata	Australia	B.A. Summerell	KF901867	KF903647	–	KF901545	KF902371	KF903253	–
Read. eucalyptigena	CBS 124999 = CPC 13026^ET	Eucalyptus dives	Australia: New South Wales	B.A. Summerell	KF901868	KF903568	KF902676	KF901546	KF902372	KF903254	KF902957
Read. limoniforma	CBS 134745 = CPC 12727^ET	Eucalyptus sp.	Australia: New South Wales	B.A. Summerell	KF901869	KF903582	KF902677	KF901547	KF902373	KF903255	KF902958
Read. menaiensis	CBS 125003 = CPC 14447^ET	Eucalyptus oblonga	Australia: New South Wales	B.A. Summerell	KF901870	KF903572	KF902678	KF901548	KF902374	KF903256	KF902959
Read. mirabiliaffinis	CBS 134744 = CPC 13611^ET	Eucalyptus delegatensis	Australia: Tasmania	P. & B.A. Summerell	KF902115	–	KF902679	KF901760	KF902375	–	–
Read. mirabilis	CBS 125000 = CPC 12370^EET	Eucalyptus globulus	Australia: Victoria	I.W. Smith	KF901871	KF903569	KF902680	KF901549	KF902376	KF903257	KF902960
Read. nontingens	CPC 14444	Eucalyptus oblonga	Australia	B.A. Summerell	KF902073	KF903671	KF902682	KF901726	KF902378	KF903259	KF902962
Read. novaezelandiae	CBS 114357 = CPC 10895^ET	Eucalyptus botryoides	New Zealand	M.A. Dick	KF901820	KF903467	KF902683	KF901504	KF902379	KF903260	KF902963
Read. patrickii	CBS 124987 = CPC 13602^ET	Eucalyptus amygdalina	Australia: Tasmania	P. & B.A. Summerell	KF902001	KF903651	KF902684	KF901662	KF902380	KF903261	KF902964
Read. pseudocallista	CBS 125001 = CPC 13599^ET	Eucalyptus prominula	Australia	B.A. Summerell	KF901861	KF903570	KF902664	KF901539	KF902357	KF903239	KF902943
Read. readeriellophora	CBS 114240 = CPC 10375^ET	Eucalyptus globulus	Spain	J.P. Mansilla	KJ380899	–	–	AY725577	KJ380904	–	–
	CBS 120209 = CPC 12920	Eucalyptus sp.	Australia	A.J. Carnegie	KF901873	KF903628	KF902685	KF901551	KF902381	KF903262	KF902965
Readeriella sp.	CPC 12379	Eucalyptus sp.	Australia	R. Park	KF901872	KF903614	KF902681	KF901550	KF902377	KF903258	KF902961
Readeriella sp.	CBS 120733 = CPC 12820	Eucalyptus nitens	Australia: New South Wales	A.J. Carnegie	KJ380897	–	–	–	KJ380902	–	–
Read. tasmanica	CBS 125002	Eucalyptus delegatensis	Australia: Tasmania	B.A. Summerell	KF902116	KF903571	KF902687	KF901761	KF902383	KF903264	KF902967
	CBS 125002 = CPC 13631^ET	Eucalyptus delegatensis	Australia: Tasmania	B.A. Summerell	KF902074	KF903656	KF902686	KF901727	KF902382	KF903263	KF902966
Recurvomyces mirabilis	CBS 119434 = CCFEE 5264^ET	Sandstone sample	Antarctica	L. Zucconi	GU250372	–	–	–	KF310059	–	–
	CCFEE 5475	Rock sample	Italy	–	KC315876	–	–	–	KF310060	–	–
Recurvomyces sp.	CCFEE 5575	Rock sample	UK	–	KF310018	–	–	–	KF310072	–	–
Schizothyrium pomi	CBS 228.57	–	Italy	R. Ciferri	KF902007	–	–	–	KF902384	–	–
	CBS 486.50	Polygonum sachalinense	The Netherlands	J.A. von Arx	KF902024	–	–	–	KF902385	–	–
Scorias spongiosa	CBS 325.33	Aphid body	–	–	KF901821	–	–	–	–	–	–
Septoria eucalyptorum	CBS 118505 = CPC 11282^ET	Eucalyptus leaf litter	India	W. Gams & M. Arzanlou	KF901991	KF903501	KF902688	KF901651	KF902386	KF903265	KF902968
S. lysimachiae	CBS 123794	Lysimachia sp.	Czech Republic	G.J.M. Verkley	KF251972	–	–	–	KF252465	–	–
septoria-like sp.	CBS 134910 = CPC 19500	Tibouchina herbacea	Brazil	D.F. Parreira	KF302409	–	–	–	KF302397	–	–
Sonderhenia eucalypticola	CPC 11251	Eucalyptus globulus	Spain	M.J. Wingfield	KF902099	KF903596	KF902689	KF901746	KF902387	KF903266	KF902969
	CPC 11252	Eucalyptus globulus	Spain	M.J. Wingfield	KF902100	KF903597	KF902691	KF901747	KF902389	KF903268	KF902971
	CBS 112502 = CPC 3749	Eucalyptus sp.	Spain	P.W. Crous	KF902019	KF903454	KF902690	KF901677	KF902388	KF903267	KF902970
S. eucalyptorum	CBS 120220 = CPC 12553	Eucalyptus coccifera	Australia: Tasmania	C. Mohammed	KF901822	–	–	KF901505	KF902390	–	KF902972
Sphaerulina cercidis	CBS 118910 = CPC 12226^{ET of S. provincialis}	Eucalyptus sp.	France	P.W. Crous	KF901988	KF903507	KF902692	KF901649	KF902391	KF903269	KF902973
Sph. myriadea	CBS 124646 = JCM 15565	Quercus dentata	Japan	K. Tanaka	KF251754	–	–	–	KF252256	–	–
Staninwardia suttonii	CBS 120061 = CPC 13055^ET	Eucalyptus robusta	Australia	B.A. Summerell	KF901874	KF903517	KF902693	KF901552	KF902392	KF903270	KF902974
Stenella araguata	CBS 105.75 = ATCC 24788 = FMC 245^ET	Man, tinea nigra	Venezuela	D. Borelli	KF902168	–	–	–	KF902393	–	–
Suberoteratosphaeria pseudosuberosa	CBS 118911 = CPC 12085^ET	Eucalyptus sp.	Uruguay	M.J. Wingfield	KF902144	KF903508	–	KF901786	–	KF903275	KF902979
Sub. suberosa	CBS 436.92 = CPC 515^ET	Eucalyptus dunnii	Brazil	M.J. Wingfield	KF901949	KF903586	–	KF901623	KF902404	KF903282	–
	CPC 13090	Eucalyptus agglomerata	Australia: New South Wales	A.J. Carnegie	KF902117	KF903633	–	KF901762	KF902403	KF903281	–
	CPC 13091	Eucalyptus dunnii	Australia: New South Wales	A.J. Carnegie	KF901875	KF903634	–	KF901553	KF902398	KF903276	–
	CPC 13104	Eucalyptus dunnii	Australia: New South Wales	A.J. Carnegie	KF901878	KF903636	–	KF901556	KF902401	KF903279	–
	CPC 13106	Eucalyptus argophloia	Australia: New South Wales	A.J. Carnegie	KF901876	KF903637	–	KF901554	KF902399	KF903277	–
	CPC 13111	Eucalyptus dunnii	Australia: New South Wales	A.J. Carnegie	KF901877	KF903638	–	KF901555	KF902400	KF903278	–
Sub. xenosuberosa	CBS 134747 = CPC 13093^ET	Eucalyptus molucana	Australia: Queensland	A.J. Carnegie	KF901879	KF903584	–	KF901557	KF902402	KF903280	KF902980
Teratosphaeria agapanthi	CBS 129064 = CPC 18332	Agapanthus umbellatus	Portugal	P.W. Crous	KF902036	–	–	–	KF902406	–	–
Ter. alboconidia	CBS 125004 = CPC 14598^ET	Eucalyptus miniata	Australia: Northern Territory	B.A. Summerell	KF901881	KF903573	–	KF901558	–	KF903283	KF902981
Ter. alcornii	CBS 121100 = CPC 13384^EET	Corymbia variegata	Australia: New South Wales	G. Price	KF901882	KF903646	KF902698	KF901559	KF902407	–	KF902982
Ter. angophorae	CBS 120493 = DAR 77452^ET	Angophora floribunda	Australia: New South Wales	A.J. Carnegie	KF901883	KF903523	KF902699	KF901560	KF902408	–	KF902983
Ter. aurantia	CBS 125243 = MUCC 668^ET	Eucalyptus grandis	Australia: Queensland	G. Whyte	KF901884	KF903578	KF902700	KF901561	KF902409	KF903284	KF902984
Ter. australiensis	CBS 124580 = MUCC 695	Corymbia sp.	Australia: Western Australia	G.E.St.J. Hardy	KF901885	KF903553	KF902701	KF901562	KF902410	KF903285	KF902985
	CBS 125244 = MUCC 731	Eucalyptus ficifolia	Australia	V. Andjic	KF901886	KF903579	KF902702	KF901563	KF902411	KF903286	KF902986
Ter. biformis	CBS 124578 = MUCC 693^ET	Eucalyptus globulus	Australia: Queensland	G. Whyte	KF901887	KF903551	KF902703	KF901564	KF902412	KF903287	KF902987
Ter. blakelyi	CBS 120089 = CPC 12837^ET	Eucalyptus blakelyi	Australia: New South Wales	B.A. Summerell	KF901888	KF903518	KF902704	KF901565	KF902413	KF903288	KF902988
Ter. callophylla	CBS 124584 = MUCC 700^ET	Corymbia sp.	Australia: Western Australia	K. Taylor	KF901889	KF903557	KF902705	KF901566	KF902414	KF903289	–
Ter. capensis	CBS 130602^ET	Protea sp.	South Africa	P.W. Crous	JN712569	–	–	–	–	–	–
Ter. complicata	CBS 125216 = CPC 14535^ET	Eucalyptus miniata leaf litter	Australia: Northern Territory	B.A. Summerell	KF901890	–	–	–	KF902416	–	–
	CPC 14535	Eucalyptus miniata leaf litter	Australia: Northern Territory	B.A. Summerell	KF902139	KF903672	KF902706	KF901781	KF902415	KF903290	KF902989
Ter. considenianae	CBS 120087 = CPC 12840^ET	Eucalyptus consideniana	Australia: New South Wales	B.A. Summerell	KF937238	–	–	–	KF937272	–	–
	CPC 13032	Eucalyptus sp.	Australia: New South Wales	B.A. Summerell	KF901891	KF903632	KF902707	KF901567	KF902417	KF903291	KF902990
	CPC 14057	Eucalyptus stellulata	Australia: New South Wales	B.A. Summerell	KF901892	KF903670	KF902708	KF901568	KF902418	KF903292	KF902991
Ter. corymbiae	CBS 120496 = DAR 77446	Corymbia maculata	Australia: New South Wales	A.J. Carnegie	KF937239	–	–	–	KF937273	–	–
	CBS 124988 = CPC 13125	Corymbia henryi	Australia: New South Wales	A.J. Carnegie	KF901893	KF903560	–	KF901569	KF902419	KF903293	KF902992
Ter. crispata	CBS 130523^ET	Eucalyptus bridgesiana	Australia: New South Wales	A.J. Carnegie	KF901880	–	–	–	KF902405	–	–
Ter. cryptica	CBS 110975 = CMW 3279 = CPC 936	Eucalyptus globulus	Australia: Victoria	A.J. Carnegie	KF901897	KF903416	KF902714	KF901573	KF902425	KF903299	KF902998
	CBS 111663 = CPC 1558	–	–	–	KF901823	KF903449	KF902715	KF901506	KF902426	KF903300	KF902999
	CBS 111679 = CPC 1576	Eucalyptus nitens	Australia: Tasmania	M.J. Wingfield	KF902037	KF903450	KF902711	KF901691	KF902422	KF903296	KF902995
	CPC 12415	Eucalyptus globulus	Australia: Victoria	I.W. Smith	KF902118	KF903616	KF902709	KF901763	KF902420	KF903294	KF902993
	CPC 12424	Eucalyptus globulus	Australia: Victoria	I.W. Smith	KF901895	KF903617	KF902712	KF901571	KF902423	KF903297	KF902996
	CPC 12559	Eucalyptus nitens	Australia: Tasmania	C. Mohammed	KF901894	KF903620	KF902710	KF901570	KF902421	KF903295	KF902994
	CPC 13839	Eucalyptus globulus	Australia	I.W. Smith	KF901896	KF903667	KF902713	KF901572	KF902424	KF903298	KF902997
Ter. destructans	CBS 111369 = CPC 1366^ET	Eucalyptus grandis	Indonesia	M.J. Wingfield	EU019287	–	–	–	KF937274	–	–
	CBS 111370 = CPC 1368^ET	Eucalyptus grandis	Indonesia	M.J. Wingfield	KF901898	KF903447	KF902716	KF901574	KF902427	KF903301	KF903000
Ter. dimorpha	CBS 120085 = CPC 12798	Eucalyptus nitens	Australia: New South Wales	A.J. Carnegie	KF937240	–	–	–	KF937275	–	–
	CBS 124051 = CPC 14132	Eucalyptus caesia	Australia: New South Wales	B.A. Summerell	KF901899	KF903546	KF902717	KF901575	KF902428	KF903302	KF903001
Ter. eucalypti	CBS 111692 = CMW 14910 = CPC 1582	Eucalyptus sp.	New Zealand	M.J. Wingfield	KF902119	KF903452	KF902719	–	–	KF903304	–
	CPC 12552	Eucalyptus nitens	Australia: Tasmania	C. Mohammed	KF901900	KF903619	KF902718	KF901576	KF902429	KF903303	KF903002
Ter. fibrillosa	CBS 121707 = CPC 13960^EET	Protea sp.	South Africa	P.W. Crous & L. Mostert	KF902075	–	–	KF901728	–	KF903305	KF903003
Ter. fimbriata	CBS 120736 = CPC 13324^ET	Corymbia sp.	Australia: Queensland	P.W. Crous	KF901901	KF903529	KF902720	KF901577	KF902430	KF903306	KF903004
	CBS 120893 = CPC 13321	Corymbia sp.	Australia: Queensland	P.W. Crous	KF901902	KF903533	KF902721	KF901578	KF902431	KF903307	KF903005
	CPC 13321	Corymbia sp.	Australia	P.W. Crous	KF901903	KF903644	KF902722	KF901579	KF902432	KF903308	KF903006
Ter. foliensis	CBS 124581 = MUCC 670^ET	Eucalyptus globulus	Australia: New South Wales	S. Collins	KF901904	KF903554	KF902725	KF901580	KF902435	KF903311	KF903009
Ter. gauchensis	CBS 119465 = CMW 17545	Eucalyptus grandis	Uruguay	M.J. Wingfield	KF902145	KF903509	KF902726	KF901787	KF902436	KF903312	KF903010
	CBS 119468 = CMW 17558	Eucalyptus grandis	Uruguay	M.J. Wingfield	KF902146	KF903510	KF902727	KF901788	KF902437	KF903313	KF903011
	CBS 120303 = CMW 17331^ET	Eucalyptus grandis	Uruguay	M.J. Wingfield	KF902148	KF903521	KF902729	KF901790	KF902439	KF903315	KF903013
	CBS 120304 = CMW 17332^ET	Eucalyptus grandis	Uruguay	M.J. Wingfield	KF902147	KF903522	KF902728	KF901789	KF902438	KF903314	KF903012
Ter. hortaea	CBS 124156 = CPC 15716^ET	Eucalyptus camaldulensis	Madagascar	M.J. Wingfield	KF902016	KF903550	KF902730	KF901674	KF902440	KF903316	KF903014
Ter. juvenalis	CBS 110906 = CMW 13347 = CPC 40^ET	Eucalyptus cladocalyx	South Africa	P.W. Crous	KF902077	KF903409	–	KF901730	–	–	–
	CBS 111149 = CPC 23	Eucalyptus cladocalyx	South Africa	P.W. Crous	KF902012	KF903429	KF902731	KF901670	KF902441	KF903317	KF903015
	CBS 116427 = CPC 10941	Eucalyptus cladocalyx	South Africa	P.W. Crous	KF902076	KF903485	KF902732	KF901729	KF902442	KF903318	KF903016
Ter. knoxdaviesii	CPC 14905	Protea sp.	South Africa	P.W. Crous	EU707866	–	–	–	–	–	–
	CBS 122898 = CPC 14960^ET	Protea sp.	South Africa	P.W. Crous	EU707865	–	–	–	–	–	–
Ter. macowanii	CBS 122901 = CPC 13899^EET	Protea nitida	South Africa	P.W. Crous & L. Mostert	KF937241	–	–	–	KF937276	–	–
Ter. majorizuluensis	CBS 120040 = CPC 12712^ET	Eucalyptus botryoides	Australia: New South Wales	B.A. Summerell	KF901905	KF903516	KF902733	KF901581	KF902443	KF903319	KF903017
Ter. mareebensis	CBS 129529 = CPC 17272^ET	Eucalyptus alba	Australia: Queensland	P.W. Crous & R.G. Shivas	KF901906	KF903581	KF902734	KF901582	KF902444	KF903320	KF903018
Ter. maxii	CBS 112496 = CPC 3322	Protea sp.	Australia: New South Wales	P.W. Crous & B. Summerell	KF937242	–	–	–	KF937277	–	–
	CBS 120137 = CPC 12805^ET	Protea repens	South Africa	M. & P.W. Crous	KF937243	–	–	–	KF937278	–	–
Ter. mexicana	CBS 110502 = CMW 14461	Eucalyptus globulus	Australia: Western Australia	A. Maxwell	KF902176	KF903397	KF902735	KF901812	KF902445	KF903321	–
Ter. micromaculata	CBS 124582 = MUCC 647^ET	Eucalyptus globulus	Australia: Queensland	G. Whyte	KF901907	KF903555	–	KF901583	KF902446	KF903322	KF903019
Ter. miniata	CBS 125006 = CPC 14514^ET	Eucalyptus miniata leaf litter	Australia: Northern Territory	B.A. Summerell	KF901908	KF903574	KF902736	KF901584	KF902447	KF903323	KF903020
	CPC 14514	Eucalyptus miniata leaf litter	Australia: Northern Territory	B.A. Summerell	KF937244	–	–	–	KF937279	–	–
Ter. molleriana	CBS 110499 = CMW 14180^{ET of Mycosphaerella ambiphylla}	Eucalyptus globulus	Australia: Western Australia	A. Maxwell	KF901910	KF903394	KF902743	KF901586	KF902454	KF903330	KF903027
	CBS 111164 = CMW 4940 = CPC 1214^{ET of M. molleriana}	Eucalyptus globulus	Portugal	S. McCrae	KF902038	KF903431	KF902737	KF901692	KF902448	KF903324	KF903021
	CBS 111165 = CPC 1215^ET	Eucalyptus globulus	Portugal	S. McCrae	KF902039	KF903432	KF902738	KF901693	KF902449	KF903325	KF903022
	CBS 117924 = CMW 11588	Eucalyptus globulus	Australia: Tasmania	–	KF902078	KF903486	KF902739	KF901731	KF902450	KF903326	KF903023
	CBS 117925 = CMW 11559	Eucalyptus globulus	Australia	–	KF902121	KF903487	KF902744	KF901765	KF902455	KF903331	KF903028
	CBS 117926 = CMW 11563	Eucalyptus globulus	Australia	–	KF902122	KF903488	KF902745	KF901766	KF902456	KF903332	KF903029
	CBS 117927 = CMW 11564	Eucalyptus globulus	Australia: Tasmania	–	KF902123	KF903489	KF902746	KF901767	KF902457	KF903333	KF903030
	CBS 118359 = CMW 11560	Eucalyptus globulus	Australia: Tasmania	–	KF902120	KF903490	KF902740	KF901764	KF902451	KF903327	KF903024
	CBS 120746 = CPC 13398^{EET of T. molleriana}	Eucalyptus sp.	Portugal	P.W. Crous & A.J.L. Phillips	–	–	–	EF394844	–	–	–
	CBS 122905 = CMW 2732 = CPC 355^{ET of T. xenocryptica}	Eucalyptus sp.	Chile	M.J. Wingfield	KF901959	KF903540	KF902741	KF901626	KF902452	KF903328	KF903025
	CPC 12232	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF901909	KF903609	KF902742	KF901585	KF902453	KF903329	KF903026
Ter. multiseptata	CBS 121312 = DAR 77438^ET	Angophora subvelutia	Australia: New South Wales	A.J. Carnegie	KF901911	KF903537	KF902747	KF901587	KF902458	KF903334	KF903031
Ter. nubilosa	CBS 116005 = CMW 3282 = CPC 937	Eucalyptus globulus	Australia: Victoria	A.J. Carnegie	KF902031	KF903479	KF902749	KF901686	KF902460	KF903336	KF903033
	CPC 11879	Eucalyptus sp.	Portugal	A.J.L. Phillips	KF902040	KF903606	KF902750	KF901694	KF902461	KF903337	KF903034
	CPC 12235	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF902041	KF903610	KF902751	KF901695	KF902462	KF903338	KF903035
	CPC 12243	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF902042	KF903611	KF902752	KF901696	KF902463	KF903339	KF903036
	CPC 12830	Eucalyptus globulus	Portugal	A.J.L. Phillips	KF902043	KF903626	KF902753	KF901697	KF902464	KF903340	KF903037
	CPC 13452	Eucalyptus sp.	Portugal	P.W. Crous	KF902044	KF903648	KF902754	KF901698	KF902465	KF903341	KF903038
	CPC 13825	Eucalyptus globulus	Australia	I.W. Smith	KF901912	KF903662	KF902755	KF901588	KF902466	KF903342	KF903039
	CPC 13828	Eucalyptus globulus	Australia	I.W. Smith	KF901913	KF903663	KF902756	KF901589	KF902467	KF903343	KF903040
	CPC 13835	Eucalyptus globulus	Australia	I.W. Smith	KF902169	KF903666	KF902748	KF901807	KF902459	KF903335	KF903032
	CPC 13844	Eucalyptus globulus	Australia	I.W. Smith	KF901914	KF903668	KF902757	KF901590	KF902468	KF903344	KF903041
Ter. ovata	CBS 124052 = CPC 14632	Eucalyptus phoenicea	Australia: Northern Territory	B.A. Summerell	KF901915	KF903547	–	KF901591	KF902469	KF903345	KF903042
Ter. pluritubularis	CBS 118508 = CPC 11697^ET	Eucalyptus globulus	Spain	J.P. Mansilla	KF902101	KF903504	KF902758	KF901748	KF902470	KF903346	KF903043
Ter. profusa	CBS 125007 = CPC 12821^ET	Eucalyptus nitens	Australia	A.J. Carnegie	KF901916	–	KF902759	KF901592	KF902471	KF903347	KF903044
	CPC 12821	Eucalyptus nitens	Australia	A.J. Carnegie	KF937245	–	–	–	KF937280	–	–
Ter. proteae-arboreae	CPC 14963	Protea sp.	South Africa	P.W. & M. Crous	KF937246	–	–	–	KF937281	–	–
Ter. pseudocryptica	CBS 118504 = CPC 11267^ET	Eucalyptus sp.	New Zealand	J.A. Stalpers	KF902032	KF903598	KF902760	KF901687	KF902472	KF903348	KF903045
	CPC 11264	Corymbia henryi	Australia	A.J. Carnegie	KF901856	KF903640	KF902651	KF901534	KF902343	–	KF902929
Ter. pseudoeucalypti	CBS 124577 = MUCC 607^ET	Eucalyptus grandis × E. ca-maldulensis	Australia: Queensland	G.S. Pegg	KF901917	–	KF902761	KF901593	KF902473	KF903349	KF903046
Ter. pseudonubilosa	CPC 13831	Eucalyptus globulus	Australia	I.W. Smith	KF901918	KF903664	KF902762	KF901594	KF902474	KF903350	KF903047
	CPC 13833	Eucalyptus globulus	Australia	I.W. Smith	KF901919	KF903665	KF902763	KF901595	KF902475	KF903351	KF903048
Ter. rubidae	CBS 124579 = MUCC 658^{ET of T. rubidae}	Corymbia calophylla	Australia: Western Australia	P.A. Barber	KF901920	KF903552	KF902764	KF901596	KF902476	KF903352	KF903049
Ter. stellenboschiana	CBS 124989 = CPC 13767	Eucalyptus punctata	South Africa	P.W. Crous	KF902079	KF903561	KF902767	KF901732	KF902486	KF903355	KF903052
	CBS 125215 = CPC 13764	Eucalyptus punctata	South Africa	P.W. Crous	KF937247	–	–	–	KF937282	–	–
	CBS 125215	Eucalyptus punctata	South Africa	P.W. Crous	KF902080	KF903577	KF902768	KF901733	KF902487	KF903356	KF903053
	CPC 12283	Eucalyptus sp.	France: Corsica	J. Dijksterhuis	KF901981	KF903613	KF902766	KF901646	KF902485	KF903354	KF903051
Ter. suttonii	CBS 110907 = CPC 63	Eucalyptus grandis	South Africa	P.W. Crous	KF937248	–	–	–	KF937283	–	–
	CBS 119973 = CMW 23439^{ET of Mycosphaerella obscuris}	Eucalyptus pellita	Vietnam	T.I. Burgess	KF902142	KF903513	KF902771	KF901784	KF902489	KF903359	KF903055
	CPC 12218	Eucalyptus sp.	Indonesia	M.J. Wingfield	KF902003	KF903608	KF902769	KF901664	KF902488	KF903357	KF903054
	CPC 12352	Eucalyptus sp.	USA: Hawaii	W. Gams	KF902162	–	KF902770	–	–	KF903358	–
Ter. syncarpiae	CBS 121160 = DAR 77433^ET	Syncarpia glomulifera	Australia: New South Wales	A.J. Carnegie & M.J. Wingfield	KF901922	KF903536	KF902772	KF901598	KF902490	KF903360	KF903056
Ter. tinara	CBS 124583 = MUCC 666^ET	Corymbia sp.	Australia: Queensland	T.I. Burgess	KF901923	KF903556	KF902773	KF901599	KF902491	–	KF903057
Ter. toledana	CBS 113313 = CMW 14457^ET	Eucalyptus sp.	Spain	P.W. Crous & G. Bills	KF902081	KF903464	KF902774	KF901734	KF902492	KF903361	KF903058
	CBS 115513 = CPC 10840	Eucalyptus sp.	Spain	P.W. Crous & G. Bills	KF901924	KF903475	KF902775	KF901600	KF902493	KF903362	KF903059
Ter. veloci	CBS 124061 = CPC 14602^ET	Eucalyptus miniata	Australia: Northern Territory	B.A. Summerell	KF937249	–	–	–	KF937284	–	–
	CPC 14600	Eucalyptus miniata	Australia: Northern Territory	B.A. Summerell	KF901925	KF903673	KF902776	KF901601	–	KF903363	KF903060
Ter. verrucosa	CBS 113621 = CPC 42^ET	Eucalyptus cladocalyx	South Africa	P.W. Crous	KF901980	KF903465	KF902778	KF901645	KF902495	KF903365	KF903062
	CPC 12949	Eucalyptus sp.	South Africa	P.W. Crous	KF902124	KF903629	KF902777	KF901768	KF902494	KF903364	KF903061
Ter. viscidus	CBS 121157 = MUCC 453^ET	Eucalyptus grandis	Australia: Queensland	T.I. Burgess, G.E.St.J Hardy, A.J. Carnegie & G. Pegg	KF901927	–	–	–	–	KF903367	–
	CBS 124992 = CPC 13306	Eucalyptus sp.	Australia: Queensland	B.A. Summerell & P.W. Crous	KF901926	KF903563	KF902779	KF901602	KF902496	KF903366	KF903063
Ter. zuluensis	CBS 120301 = CMW 17321^EET	Eucalyptus grandis	South Africa	M.J. Wingfield	KF902082	KF903519	KF902780	KF901735	KF902497	KF903368	KF903064
	CBS 120302 = CMW 17322^EET	Eucalyptus grandis	South Africa	M.J. Wingfield	KF902083	KF903520	KF902781	KF901736	KF902498	KF903369	KF903065
Teratosphaericola pseudoafricana	CBS 111168 = CPC 1231	Eucalyptus globulus	Zambia	T. Coutinho	KF902045	KF903435	KF902782	KF901699	KF902499	KF903370	KF903066
	CBS 114782 = CPC 1230^ET	Eucalyptus globulus	Zambia	T. Coutinho	KF902084	KF903473	KF902783	KF901737	KF902500	KF903371	KF903067
Teratosphaeriopsis pseudoafricana	CBS 111171 = CPC 1261	Eucalyptus sp.	South Africa	P.W. Crous	KF902085	KF903436	KF902784	KF901738	KF902501	KF903372	KF903068
Teratosphaeriaceae sp.	CBS 117937 = TRN211	Rock sample	Spain	–	GU323978	–	–	–	KF310038	–	–
Teratosphaeriaceae sp.	CBS 120744 = CPC 12349	Eucalyptus sp.	USA: Hawaii	W. Gams	KF902160	KF903532	KF902546	KF901800	KF902215	KF903110	KF902810
Teratosphaeriaceae sp.	CBS 131961	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & pseudoafricana	KF902172	–	–	–	KF902478	–	–
Teratosphaeriaceae sp.	CBS 131960	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901950	–	–	–	KF902479	–	–
Teratosphaeriaceae sp.	CBS 131962	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901951	–	–	–	KF902480	–	–
Teratosphaeriaceae sp.	CBS 131963	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901952	–	–	–	KF902481	–	–
Teratosphaeriaceae sp.	CBS 131976	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901953	–	–	–	KF902482	–	–
Teratosphaeriaceae sp.	CBS 131977	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901954	–	–	–	KF902483	–	–
Teratosphaeriaceae sp.	CBS 131979	Ant body	Brazil	A.P.M. Duarte, N.C. Baron & D.A. de Angelis	KF901955	–	–	–	KF902484	–	–
Teratosphaeriaceae sp.	CCFEE 5569	Rock sample	Italy	–	KF310015	–	–	–	KF310071	–	–
Teratosphaeriaceae sp.	CPC 13680	Eucalyptus placita	Australia	B.A. Summerell	KF901921	KF903657	KF902765	KF901597	KF902477	KF903353	KF903050
Teratosphaeriaceae sp.	TRN232	Rock sample	Spain	–	KF310011	–	–	–	KF310079	–	–
Teratosphaeriaceae sp.	TRN450	Rock sample	Spain	–	KF937237	–	–	–	–	–	–
Toxicocladosporium irritans	CBS 128777 = CPC 18471^ET	Phaenocoma prolifera	South Africa	K. L. & P.W. Crous	JF499868	–	–	–	KJ564345	–	–
Tox. protearum	CBS 126499 = CPC 15254^ET	Protea burchellii	South Africa	F. Roets	HQ599587	–	–	–	KJ564344	–	–
Tox. rubrigenum	CBS 124158 = CPC 15735^ET	Eucalyptus camaldulensis	Madagascar	M. J. Wingfield	FJ790305	–	–	–	KJ564338	–	–
Tripospermum myrti	CBS 437.68	Citrus sp.	Java	J.H. van Emden	KF902008	–	–	–	KF902502	–	–
Undescribed species	CCFEE 5772	Rock sample	France	D. Tesei	KJ380895	–	–	–	KJ380901	–	–
Undescribed species	CBS 118301 = TRN138	Rock sample	Spain	C. Ruibal	GU323974	–	–	–	KJ564343	–	–
Undescribed species	CBS 118305 = TRN62	Rock sample	Spain	C. Ruibal	GU323961	–	–	–	KF310084	–	–
Undescribed species	CPC 16833	Pinus koraiensis	The Netherlands	W. Quaedvlieg	KJ564329	–	–	–	KJ564350	–	–
Undescribed species	CPC 16832	Pinus koraiensis	The Netherlands	W. Quaedvlieg	KJ564330	–	–	–	–	–	–
Undescribed species	CBS 136110 = CCFEE 5764	Rock sample	Italy	–	KF310028	–	–	–	–	–	–
Uwebraunia australiensis	CBS 120729 = CPC 13282^ET	Eucalyptus platyphylla	Australia	P.W. Crous	GQ852588	–	–	–	KJ564339	–	–
Uwe. commune	CBS 110809 = CPC 830^ET	Eucalyptus nitens	South Africa	P.W. Crous	KJ564336	–	–	–	KJ564351	–	–
Uwe. dekkeri	CPC 13264	Eucalyptus molucana	Australia	B.A. Summerell	GQ852593	–	–	–	KJ564340	–	–
Vermiconia foris	CBS 136106 = CCFEE 5459^ET	Rock sample	Italy	–	GU250390	–	–	–	KF310088	–	–
Von. antarctica	CBS 136107 = CCFEE 5488^ET	Rock sample	Antarctica	–	KJ564324	–	–	–	KF310089	–	–
	CBS 136108 = CCFEE 5489	Rock sample	Antarctica	–	GU250395	–	–	–	–	–	–
Von. flagrans	CBS 118283 = TRN124^ET	Rock sample	Spain	C. Ruibal	GU323971	–	–	–	–	–	–
	CBS 118284 = TRN104	Rock sample	Spain	C. Ruibal	KJ564325	–	–	–	KF310089	–	–
	CBS 118296 = TRN114^ET	Rock sample	Spain	C. Ruibal	KF310024	–	–	–	KF310096	–	–
Verrucisporota daviesiae	CBS 116002 = VPRI31767	Daviesia mimosoides (≡ D. cormybosa var. mimosoides)	Australia	V. & R. Beilharz	KF901928	KF903477	KF902785	KF901603	KF902503	KF903373	KF903069
Verr. proteacearum	CBS 116003 = VPRI31812	Grevillea sp.	Australia	V. Beilharz	KF901929	KF903478	–	KF901604	KF902504	–	KF903070
Xenomycosphaerella elongata	CBS 120735 = CPC 13378^ET	Eucalyptus camaldulensis × urophylla	Venezuela	M.J. Wingfield	KF902170	KF903528	KF902786	KF901808	KF902505	KF903374	KF903071
Xenom. yunnanensis	CBS 119975 = CMW 23443 = MUCC 410 = PAB 05.05 B2^ET	Eucalyptus urophylla	China	B. Dell	KF901962	KF903515	KF902787	KF901628	KF902506	KF903375	KF903072
Xenopenidiella rigidophora	CBS 314.95^ET	Smilax sp. leaf litter	Cuba	R.F. Castañeda	KF901983	–	–	–	KF902507	–	–
Xenophacidiella pseudocatenata	CBS 128776 = CPC 18472^ET	Phaenocoma prolifera	South Africa	K.L. & P.W. Crous	KF902092	–	–	–	KF902508	–	–
Xenoteratosphaeria jonkershoekensis	CBS 122897 = CPC 13984^EET	Protea sp.	South Africa	P.W. Crous & L. Mostert	KF937250	–	–	–	KF937285	–	–
Zasmidium aerohyalinosporum	CBS 125011 = CPC 14636^ET	Eucalyptus tectifica	Australia	B.A. Summerell	KF901930	KF903576	KF902788	KF901605	KF902509	KF903376	KF903073
Z. anthuriicola	CBS 118742^ET	Anthurium sp.	Thailand	C.F. Hill	FJ839662	–	–	–	KF252287	–	–
Z. citri	CBS 116366 = CPC 10522 = CMW 11730	Acacia mangium	Thailand	K. Pongpanich	KF902138	–	–	KF901780	KF902519	KF903386	KF903080
	CBS 116426	Musa sp.	USA: Florida	J. Cavaletto	KF901987	–	–	KF901648	KF902520	KF903387	KF903081
	CBS 122455	Citrus sp.	USA: Florida	R.C. Ploetz	KF902156	–	–	KF901797	KF902521	KF903388	KF903082
	CPC 10522	Acacia mangium	Thailand	K. Pongpanich	KF902136	–	–	KF901778	KF902511	KF903378	KF903074
	CPC 13467	Eucalyptus sp.	Thailand	W. Himaman	KF902137	KF903650	–	KF901779	KF902512	KF903379	KF903075
	CPC 15285	Citrus sp.	USA: Florida	–	KF902150	–	–	KF901791	KF902513	KF903380	KF903076
	CPC 15289	Citrus sp.	USA: Florida	–	KF902151	–	–	KF901792	KF902514	KF903381	–
	CPC 15291	Citrus sp.	USA: Florida	–	KF902152	KF903676	–	KF901793	KF902515	KF903382	KF903077
	CPC 15293	Citrus sp.	USA: Florida	–	KF902153	–	–	KF901794	KF902516	KF903383	–
	CPC 15294	Citrus sp.	USA: Florida	–	KF902154	–	–	KF901795	KF902517	KF903384	KF903078
	CPC 15296	Citrus sp.	USA: Florida	–	KF902155	–	–	KF901796	KF902518	KF903385	KF903079
	CPC 15300	Citrus sp.	Indonesia	–	KF902086	–	–	KF901739	KF902510	KF903377	–
Z. eucalypti	CBS 121101 = CPC 13302^ET	Eucalyptus tereticornis	Australia: Queensland	P.W. Crous	KF901931	KF903642	–	KF901606	KF902522	KF903389	KF903083
Z. eucalyptorum	CBS 118500 = CPC 11174^ET	Eucalyptus sp.	Indonesia	M.J. Wingfield	–	KF903495	–	KF901652	KF902203	KF903101	–
Z. lonicericola	CBS 125008 = CPC 11671^EET	Lonicera japonica	South Korea	H.D. Shin	KF902093	–	–	–	KF902523	–	–
Z. nabiacense	CBS 125010 = CPC 12748^ET	Eucalyptus sp.	Australia	A.J. Carnegie	KF901933	KF903575	–	KF901608	KF902525	KF903391	KF903085
	CPC 12748	Eucalyptus sp.	Australia	A.J. Carnegie	KF901932	KF903624	–	KF901607	KF902524	KF903390	KF903084
Z. nocoxi	CBS 125009 = CPC 14044^ET	Twig debris	USA: Virginia	P.W. Crous	KF902157	–	–	–	KF902526	–	–
Z. parkii	CBS 387.92 = CPC 353^ET	Eucalyptus grandis	Brazil	M.J. Wingfield	KF902143	KF903585	KF902789	KF901785	–	KF903392	–
Z. pseudoparkii	CBS 110988 = CPC 1090	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901975	KF903418	KF902694	KF901640	KF902394	KF903271	KF902975
	CBS 110999 = CPC 1087^ET	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901977	KF903419	KF902696	KF901642	KF902396	KF903273	KF902977
	CBS 111049 = CPC 1089	Eucalyptus grandis	Colombia	M.J. Wingfield	KF901976	KF903426	KF902695	KF901641	KF902395	KF903272	KF902976
Z. xenoparkii	CBS 111185 = CPC 1300^ET	Eucalyptus grandis	Indonesia	M.J. Wingfield	KF902002	KF903438	KF902697	KF901663	KF902397	KF903274	KF902978
Zymoseptoria verkleyi	CBS 133618	Poa annua	The Netherlands	S. Videira	KC005802	–	–	–	KJ564348	–	–

Open in a new tab

¹ ATCC: American Type Culture Collection, Virginia, USA; CBS: CBS Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CCFEE: Culture collection from extreme environments of the Dipartimento di Scienze Ambientali, University of Tuscia, Viterbo, Italy; CIRAD: Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR-BGPI, Montpellier, France; CMW: Culture collection of the Forestry and Agricultural Biotechnology Institute (FABI) of the University of Pretoria, Pretoria, South Africa; CPC: Collection Pedro Crous, housed at CBS; DAOM: Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; MAFF: NIAS Genebank, Microorganism Section, Japan; MUCC: Murdoch University Culture Collection, Murdoch, Australia; NZFS: Forest Research Culture Collection, Private Bag 3020, Rotorua, New Zealand; STE-U: Department of Plant Pathology, University of Stellenbosch, South Africa; TRN: T. Ruibal private collection; VPRI: Victorian Department of Primary Industries, Knoxfield, Australia; X: Working collection of Mahdi Arzanlou.

² EET: ex-epitype; ET: ex-type.

³ Act: Actin; Btub: β-tubulin; Cal: Calmodulin; EF-1α: Translation elongation factor 1-alpha; ITS: internal transcribed spacer regions of the nrDNA operon; LSU: 28S large subunit of the nrRNA gene; RPB2: RNA polymerase II second largest subunit.

Multi-locus DNA screening

Genomic DNA was extracted from mycelium growing on MEA (Table 1), using the UltraClean^TM Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, USA). All strains were screened for seven loci (ITS, LSU, Act, Cal, EF-1α, RPB2 and Btub) using the primer sets listed in Table 2. The PCR amplifications were performed in a total volume of 12.5 μL solution containing 10–20 ng of template DNA, 1× PCR buffer, 0.7 μL DMSO (99.9 %), 2 mM MgCl₂, 0.4 μM of each primer, 25 μM of each dNTP and 1.0 U BioTaq DNA polymerase (Bioline GmbH Luckenwalde, Germany). PCR conditions were set as follows: an initial denaturation temperature of 96 °C for 2 min, followed by 40 cycles of denaturation temperature of 96 °C for 45 s, primer annealing at the temperature stated in Table 2, primer extension at 72 °C for 90 s and a final extension step at 72 °C for 2 min. The resulting fragments were sequenced using the PCR primers and the BigDye Terminator Cycle Sequencing Kit v. 3.1 (Applied Biosystems, Foster City, CA, USA). Sequencing reactions were performed as described by Cheewangkoon et al. (2008).

Table 2.

Primer combinations used during this study for generic amplification and sequencing.

Locus	Primer	Primer sequence 5’ to 3’	Annealing temperature (°C)	Orientation	Reference
Translation elongation factor-1α	EF1-728F	CATCGAGAAGTTCGAGAAGG	52	Forward	Carbone & Kohn (1999)
	EF-2	GGARGTACCAGTSATCATGTT	52	Reverse	O’Donnell et al. (1998)
β-tubulin	T1	AACATGCGTGAGATTGTAAGT	52	Forward	O’Donnell & Cigelnik (1997)
	β-Sandy-R	GCRCGNGGVACRTACTTGTT	52	Reverse	Stukenbrock et al. (2012)
RNA polymerase II second largest subunit	fRPB2-5F	GAYGAYMGWGATCAYTTYGG	49	Forward	Liu et al. (1999)
	fRPB2-414R	ACMANNCCCCARTGNGWRTTRTG	49	Reverse	Quaedvlieg et al. (2011)
LSU	LSU1Fd	GRATCAGGTAGGRATACCCG	52	Forward	Crous et al. (2009a)
	LR5	TCCTGAGGGAAACTTCG	52	Reverse	Vilgalys & Hester (1990)
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	52	Forward	White et al. (1990)
	ITS4	TCCTCCGCTTATTGATATGC	52	Reverse	White et al. (1990)
Actin	ACT-512F	ATGTGCAAGGCCGGTTTCGC	52	Forward	Carbone & Kohn (1999)
	ACT2Rd	ARRTCRCGDCCRGCCATGTC	52	Reverse	Groenewald et al. (2013)
Calmodulin	CAL-235F	TTCAAGGAGGCCTTCTCCCTCTT	50	Forward	Quaedvlieg et al. (2012)
	CAL2Rd	TGRTCNGCCTCDCGGATCATCTC	50	Reverse	Groenewald et al. (2013)

Open in a new tab

Phylogenetic analysis

An initial alignment of the obtained sequence data was first done using MAFFT v. 7 (http://mafft.cbrc.jp/alignment/server/index.html; Katoh et al. 2002) and whenever indicated, manually improved in BioEdit v. 7.0.5.2 (Hall 1999). To check the congruency of the datasets, a 70 % Neighbour-Joining (NJ) reciprocal bootstrap method with maximum likelihood distance was performed on each individual locus (Mason-Gamer & Kellogg 1996) (resulting trees not shown). Bayesian analyses (critical value for the topological convergence diagnostic set to 0.01) were performed on the five locus (ITS, LSU, RPB2, EF-1α and Btub) TLD (Fig. 1) and MLD (Fig. 2) trees, as well as on the two-locus, Teratosphaeriaceae and families LSU/RPB2 (Fig. 3, 4) concatenated datasets using MrBayes v. 3.2.1 (Ronquist et al. 2011) as described by Crous et al. (2006). Appropriate gene models were selected using MrModeltest v. 2.3 (Nylander 2004) and applied to each gene partition. The substitution models for each locus are listed in Table 3. Staninwardia suttonii (CBS 120061) served as an outgroup for both MLD and TLD five-locus multigene phylogenetic analyses; Aulographina pinorum (CBS 655.86) was used as outgroup for the LSU/RPB2 Teratosphaeriaceae tree and Parastagonospora nodorum (CBS 110109) was used as an outgroup for the families tree.

Fig. 1 — A Bayesian 50 % majority rule consensus tree based on a combined ITS, LSU, RPB2, EF-1α and Btub alignment, containing all isolates associated with Teratosphaeria leaf disease of *Eucalyptus* available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to *Staninwardia suttonii*. The scale bar indicates 0.1 expected changes per site.

Fig. 2 — A Bayesian 50 % majority rule consensus tree based on a combined ITS, LSU, RPB2, EF-1α and Act alignment, containing all isolates associated with Mycosphaerella leaf disease of *Eucalyptus* available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to *Staninwardia suttonii*. The scale bar indicates 0.1 expected changes per site.

Fig. 3 — A Bayesian 50 % majority rule consensus tree based on the LSU/RPB2 alignment and containing all isolates associated with the *Teratosphaeriaceae* available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to *Aulographina pinorum*. The scale bar indicates 0.1 expected changes per site.

Fig. 4 — A Bayesian 50 % majority rule consensus tree based on a LSU/RPB2 alignment and containing isolates that where previously associated with ‘*Teratosphaeria* 1’ and ‘2’, plus representatives of closely related families, available at the CBS. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. The tree was rooted to *Parastagonospora nodorum.* The scale bar indicates 0.2 expected changes per site.

Table 3.

Amplification success, phylogenetic data and the substitution models used in the phylogenetic analyses, per locus.

Locus	Act	Cal	EF1	RPB2	Btub	ITS	LSU
Amplification succes (%)	90	84	98	95	97	100	100
Number of characters	558	593	490	340	306	594	758
Unique site patterns	334	386	388	195	211	334	174
Substitution model used	GTR-I-gamma	HKY-I-gamma	HKY-I-gamma	GTR-I-gamma	HKY-I-gamma	GTR-I-gamma	GTR-I-gamma

Open in a new tab

Kimura-2-parameter values

The available sequence data from the seven individual loci within the two Teratosphaeriaceae and single Mycosphaerellaceae datasets were individually pooled together and realigned using MAFFT to generate seven single locus alignments. MEGA v. 4.0 (Tamura et al. 2007) was then used to generate both inter- and intra-specific Kimura-2-parameter distance values for these seven datasets using the pair-wise deletion model. Microsoft Excel 2007 was then used to sort these distance values into distribution bins (from distance 0–1 with intervals of 0.05 between bins) and the frequency of entries for each individual bin was subsequently plotted against the Kimura-2-parameter distance of each bin (Fig. 5).

Fig. 5 — The frequency distribution graphs of the Kimura-2-parameter distances (barcoding gaps) for the seven individual gene loci. The grey asterix (*) marks the average interspecific variation per locus while red inverted chevrons (V) mark the average intraspecific variation per locus.

Genealogical concordance phylogenetic species recognition analysis

Phylogenetically related but ambiguous species were analysed separately using the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) model (as described by Taylor et al. 2000) by performing a pairwise homoplasy index (Φ_w) test. GCPSR is a pragmatic tool for the assessment of species limits, as the concordance of gene genealogies is a valuable method for evaluating the significance of gene flow between groups within an evolutionary timescale (Koufopanou et al. 1997, Geiser et al. 1998, Taylor et al. 2000, Starkey et al. 2007). A Pairwise homoplasy index (PHI) test (Philippe & Bryant 2006) was performed in SplitsTree4 (Huson 1998, Huson & Bryant 2006) (www.splitstree.org) in order to determine the recombination level within phylogenetically closely related species using a five-locus concatenated dataset of closely related species (Fig. 1 and 2, clade A–K). If the pairwise homoplasy index results were below a 0.05 threshold (Φ_w < 0.05), it was indicative for significant recombination present in the dataset. The relationships between these eleven, closely related, species groups were visualised by constructing splits graphs (Fig. 6) from the five-locus concatenated datasets, using both the LogDet transformation and splits decomposition options.

Fig. 6 — The results of the pairwise homoplasy index (PHI) test of closely related species using both LogDet transformation and splits decomposition. PHI test results (Φ_w) < 0.05 indicate significant recombination within the dataset.

Morphology

Morphological descriptions were made on slide preparations mounted in clear lactic acid from colonies sporulating on MEA, PDA and OA (noted in taxonomic descriptions). Observations were made with a Zeiss V20 Discovery stereo-microscope and with a Zeiss Axio Imager 2 light microscope using differential interference contrast (DIC) illumination and a MRc5 camera and ZEN imaging software. Colony characters and pigment production were noted after 1 mo of growth on MEA, PDA and OA incubated at 25 °C. Colony colours (surface and reverse) were rated according to the colour charts of Rayner (1970). Sequences derived in this study were lodged at GenBank, the alignment in TreeBASE (www.treebase.org) and taxonomic novelties in MycoBank (www.MycoBank.org; Crous et al. 2004a).

RESULTS

Amplification rate of test loci

The amplification success scores of the seven test loci varied from 100 % for LSU and ITS to 84 % for Cal. The remaining four test loci (Act, RPB2, Btub and EF-1α) produced PCR success scores of 90, 95, 97 and 98 %, respectively (Table 3).

Congruency testing

The results of the congruency test (trees not shown) showed that the seven gene regions were incongruent in both the MLD and TLD trees. In the TLD Teratosphaeriaceae tree (Fig. 1), the Act and Cal loci were incongruent with the other five loci, while in the MLD Mycosphaerellaceae tree (Fig. 2), the Btub and Cal loci were incongruent with the other five loci. In both these datasets, the terminal clades representing genera were the same for all gene regions, however the higher order clustering deviated for the incongruent loci. For this reason, the conflicting loci were not included in the published trees.

Kimura-2-parameter values

The Kimura-2-parameter (K2P) distribution graphs (Fig. 5) visualise the inter- and intraspecific distances per locus corresponding to the barcoding gap (Hebert et al. 2003). A useful barcoding locus should have no overlap between inter- and intraspecific K2P distances. The individual test loci showed varying degrees of overlap in their K2P distribution graphs. In this dataset, both ITS and LSU have a higher K2P overlap than the other five test loci suggesting they are more conserved making them less suitable to serve as a reliable identification locus for MLD and TLD pathogens across the whole scale of tested sequences. Of the remaining five loci (Btub, Act, RPB2, EF-1α and Cal), Btub, EF-1α and RPB2 have the lowest K2P overlap. Although these latter loci are less conserved, they show greater natural variation between different species than the other four loci.

Phylogenetic results

Based on the phylogenetic data (Fig. 1, 2, 3, 4) generated during this study, we were able to make a start at delineating the Teratosphaeriaceae. Recognised clades, as well as novel species, genera and families are described and discussed in the Taxonomy section below.

The four datasets consisted of 2 468 characters for the TLD tree (753 characters for LSU, 485 for EF-1α, 589 for ITS, 301 for Btub and 340 for RPB2), 2 950 characters for the MLD tree (563 characters for Act, 752 for LSU, 573 for EF-1α, 728 for ITS and 334 for RPB2), 1 129 characters for the Teratosphaeriaceae tree (817 characters for LSU and 312 for RPB2) and 956 characters for the families tree (688 for LSU and 268 for RPB2).

The respective alignments included 1 361 parsimony-informative characters for the TLD tree (223 for LSU, 388 for EF-1α, 334 for ITS, 221 for Btub and 195 for RPB2), 1 398 parsimony-informative characters for the MLD tree (293 for Act, 179 for LSU, 382 for EF-1α, 355 for ITS and 189 for RPB2), 647 parsimony-informative characters for the Teratosphaeriaceae tree (457 for LSU and 190 for RPB2) and 511 parsimony-informative characters for the families tree (287 for LSU and 224 for RPB2).

After topological convergence of the Bayesian runs at 0.01, the following numbers of trees where generated and subsequently sampled (using a burn in fraction of 0.25 and indicated after the slash) in order to generate the three Bayesian phylogenies, 960/720 for TLD, 1102/828 for MLD, 76126/57096 for Teratosphaeriaceae and 9172/6879 for the families tree. The resulting phylogenetic trees of all three individual combined datasets showed consistent clustering of all MLD and TLD taxa over all four trees, and these results are treated below. There were some problems with the clustering position of the Piedraiaceae, and this issue is addressed in the Discussion.

TAXONOMY

Extremaceae

Extremaceae Quaedvlieg & Crous,fam. nov. — MycoBank MB808049

Type genus. Extremus Quaedvlieg & Crous.

Asexual morphs variable, filamentous, lichenicolous or yeast-like. Conidiophores pigmented, solitary to sporodochial, proliferating sympodially, or with a terminal rachis that can be subdenticulate. Conidia brown, solitary or in short mostly unbranched chains, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, rarely with 1–2 transverse septa, frequently with mucoid sheath; hila not to slightly darkened, somewhat thickened and refractive or not.

Notes — Members of Extremaceae occur in extreme habitats, and are ecologically highly diverse, ranging from lichenocolous to epiphyllous, acidophilic, rock inhabiting, endophytic, saprobic or plant pathogenic, representing part of ‘Teratosphaeriaceae 2’ (now Neodevriesiaceae and Extremaceae) sensu Ruibal et al. (2009).

Extremus Quaedvlieg & Crous, gen. nov. — MycoBank MB808050

Type species. Extremus adstrictus (Egidi & Onofri) Quaedvlieg & Crous.

Etymology. Named after its ecologically extreme, rock-inhabiting habitat.

Hyphomycetous, rock-inhabiting. Colonies with brown, branched, thick-walled, septate hyphae. Conidiogenous cells integrated in hyphal chains, brown, subcylindrical to ellipsoid, smooth to rough, proliferating sympodially. Conidia medium brown, smooth to rough, subcylindrical to ellipsoid, thick-walled, in chains, with or without darkened median septa, at times with oblique septa; hila not to slightly darkened. Sexual morph unknown.

Notes — Extremus is introduced as novel genus to accommodate fungal species isolated from rocks. Presently its morphology is only known from culture, where it appears to be extremely slow-growing, forming brown hyphae with disarticulating conidial chains. It clusters as a sister clade that are devriesia-like in morphology, namely D. americana (isolated from air, USA) and D. compacta (isolated from rocks, Spain), suggesting that these rock-inhabiting species could be aerially dispersed.

Extremus adstrictus (Egidi & Onofri) Quaedvlieg & Crous, comb. nov. — MycoBank MB808051

Basionym. Devriesia adstricta Egidi & Onofri, Fung. Diversity 65: 150. 2014.

Specimen examined. SPAIN, Mallorca, from rock, holotype CBS 118292 = TRN96, preserved in liquid nitrogen and in dried condition.

Extremus antarcticus (Selbmann & de Hoog) Quaedvlieg & Crous, comb. nov. — MycoBank MB808052

Basionym. Devriesia antarctica Selbmann & de Hoog, Fung. Diversity 65: 150. 2014.

Specimen examined. ANTARCTICA, Linnaeus Terrace, from rock, holotype CBS 136103 = CCFEE 451, preserved in liquid nitrogen and in dried condition.

Incertae sedis (Capnodiales)

Mucomycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807791

Type species. Mucomycosphaerella eurypotami (Kohlm., Volkm.-Kohlm. & O.E. Erikss.) Quaedvlieg & Crous.

Etymology. Resembling the genus Mycosphaerella, except ascospores have mucoid sheaths.

Foliicolous. Ascomata pseudothecial, depressed ellipsoidal, immersed becoming erumpent, with central ostiole lacking periphyses, brown, dark brown at the ostiole, solitary or in clusters of two or more joined together; wall of textura angularis, consisting of 4–6 layers at the top, but only 2–3 layers at the sides and bottom. Hamathecium sparse, composed of branched and anastomosing septate pseudoparaphyses embedded in a gelatinous matrix. Asci ellipsoidal to ovoid, 8-spored, indistinctly pedicellate, bitunicate, fissitunicate, thick-walled, with a thin, tough ectotunica and a thick gelatinous, expanding endotunica. Ascospores bi- to triseriate, elongate ellipsoidal, sometimes inequilateral, 1-septate, with one additional pseudoseptum in each cell, slightly constricted at the septum, hyaline, guttulate, surrounded by a gelatinous sheath that is constricted around the septum.

Mucomycosphaerella eurypotami (Kohlm., Volkm.-Kohlm. & O.E. Erikss.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807792

Basionym. Mycosphaerella eurypotami Kohlm., Volkm.-Kohlm. & O.E. Erikss., Bot. Mar. 42, 6: 505. 1999.

Specimen examined. USA, North Carolina, Virginia, Carteret County, Broad Creek, N34°43', W76°55'07", on senescent leaves of Juncus roemerianus, 21 May 1996, B. & J. Kohlmeyer (holotype JK5586 in IMS, culture ex-type JK5586J).

Notes — Mucomycosphaerella is distinguished from Mycosphaerella s.str. by having well developed, persistent mucoid sheaths around its ascospores, and the absence of Ramularia asexual states. Its ascomata are depressed, and have a pale, thin-walled lower half, and a hamathecium of loosely branched, anastomosing hyphae in a hymenial gel, with hyaline ascospores (Kohlmeyer et al. 1999). Mucomycosphaerella eurypotami was included in Mycosphaerella as a temporary measure, until a formal revision of the genus (Kohlmeyer et al. 1999), which has been ongoing since the epitypification of the type species (Verkley et al. 2004), and the segregation of various allied genera and families (Crous et al. 2007b, 2009b).

The genus Mucomycosphaerella appears to represent a distinct family in the Capnodiales, sister to the Schizothyriaceae. More collections of additional taxa are needed to determine the extent of morphological variation before a formal family can be introduced.

Mycosphaerellaceae

Neopenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807778

Type species. Neopenidiella nectandrae (Crous, U. Braun & R.F. Castañeda) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Penidiella.

Foliicolous. Conidiophores erect, straight, filiform, pluriseptate throughout, brown, darker below and paler above, thin-walled, smooth, apex penicillate, terminal cell of the conidiophore with short denticle-like loci giving rise to sets of conidiogenous cells or ramoconidia that then form a sequence of new sets of ramoconidia at different levels. Conidiogenous loci terminal or subterminal, usually 1–3(–4), subdenticulate, conical, apically truncate, mostly unthickened, slightly darkened-refractive. Ramoconidia with truncate base, barely or distinctly attenuated at the truncate base, aseptate, with 2–3(–4) subdenticulate hila at the apex, subcylindrical, pale olivaceous to olivaceous-brown or brown, thin-walled, smooth to faintly verruculose. Conidia in long acropetal chains, narrowly ellipsoid-ovoid, fusiform to cylindrical aseptate, pale olivaceous to olivaceous-brown or brown, thin-walled, smooth to faintly rough-walled; hila unthickened or almost so, slightly darkened-refractive.

Neopenidiella nectandrae (Crous, U. Braun & R.F. Castañeda) Quaedvlieg & Crous, comb. nov. — MycoBank MB807779

Basionym. Penidiella nectandrae Crous, U. Braun & R.F. Castañeda, Stud. Mycol. 58: 20. 2007.

Specimen examined. CUBA, Matanzas, San Miguel de los Baños, isolated from living leaves of Nectandra coriacea (Lauraceae), 24 Jan. 1987, R.F. Castañeda & G. Arnold, holotype INIFAT C87/45, culture ex-type CBS 734.87, and HAL 2018F.

Notes — Similar to Penidiella, but distinct in that conidiophores are long and filiform, ending in a subdenticulate apical cell that gives rise to sets of penicillate conidiogenous cells or ramoconidia. Ramoconidia and conidia are aseptate, pale olivaceous and consistently narrow. Penidiella has penicillate conidiophores with well-developed apical branches, and wider, 0–1-septate ramoconidia and conidia.

Amycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807780

Type species. Amycosphaerellaafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after the genus Mycosphaerella, to which it is morphologically similar.

Foliicolous, plant pathogenic Ascomata pseudothecial, amphigenous, solitary, black, subepidermal, globose, with central apical ostioles, becoming papillate; walls of 2–3 layers of medium brown textura angularis, subhymenium of 1–2 layers of hyaline cells. Asci obovoid to broadly ellipsoidal, straight or incurved, 8-spored. Ascospores bi- to triseriate, overlapping, hyaline, guttulate, straight, fusoid-ellipsoidal with obtuse ends, widest in middle of apical cells, medianly 1-septate, tapering toward both ends, but more prominently toward base.

Notes — Similar to species of Mycosphaerella based on morphology, distinct in that it does not produce a Ramularia asexual morph. Amycosphaerella is reliably distinguished from other genera in the family based on its DNA phylogeny, and either ITS or LSU sequence data differentiates these genera.

Amycosphaerella africana (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807781

Basionym. Mycosphaerella africana Crous & M.J. Wingf., Mycologia 88, 3: 450. 1996.

≡Teratosphaeria africana (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 8. 2007.

= Mycosphaerella ellipsoidea Crous & M.J. Wingf., Mycologia 88: 452. 1996.

= Mycosphaerella aurantia A. Maxwell, Mycol. Res. 107: 353. 2003.

Specimens examined. AUSTRALIA, Western Australia, Bunbury, Summerlea plantation of Western Australian Chip and Pulp (WACAP), E115°37', S33°40', on E. globulus, 1 May 2000, A. Maxwell (holotype of M. aurantia, PERTH 05849543, culture ex-type CBS 110500). – SOUTH AFRICA, Western Cape Province, Stellenbosch, Stellenbosch Mountain, leaves of E. viminalis, Oct. 1994, P.W. Crous (holotype of M. africana, PREM 51917, cultures ex type CPC 794–796 = CBS 116154, 116155, 680.95); Western Cape Province, Pampoenvlei, on leaves of E. cladocalyx, Nov. 1994, P.W. Crous (holotype of M. ellipsoidea, PREM 51924, cultures ex-type CPC 849–851, 850 = CBS 110843).

Notes — Mycosphaerella ellipsoidea and M. aurantia are morphologically identical, and synonymous with Amycosphaerella africana. Amycosphaerella africana was originally described from small, 1–2 mm diam, pale brown leaf spots. Subsequent collections have shown that leaf spots can be 2–10 mm diam. Furthermore, ascospores were described as fusoid-ellipsoidal, constricted at its septum, (7–)8–10(–11) × (2–)2.5–3 μm, germinating at angles to the long axis of the spore, and turn brown and distorted upon germination (Crous & Wingfield 1996), though the latter observation appears to have been incorrect. Additional collections have shown ascospores to also be up to 15 μm in length, not always constricted at septa, and in some cases germinate from polar ends with germ tubes parallel to the long axis, remain hyaline, and develop lateral branches (Maxwell et al. 2003).

Paramycosphaerella Crous, Persoonia 31: 245. 2013.

Paramycosphaerella intermedia (M.A. Dick & K. Dobbie)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807782

Basionym. Mycosphaerella intermedia M.A. Dick & K. Dobbie, New Zealand J. Bot. 39: 272. 2001.

Specimen examined. NEW ZEALAND, Bay of Plenty, Rotoehu Forest, Kohekohe Road, on living leaves of E. saligna, 30 June 1998, L. Renney (holotype NZFR1-M 3831, cultures ex-type NZFS 301.10 = CBS 114356, 114415).

Notes — The synonymy of M. intermedia with M. marksii, as proposed by Hunter et al. (2006), is not supported. Although morphologically similar, these two species are phylogenetically distinct, and better accommodated as two separate species in the genus Paramycosphaerella (Crous et al. 2013).

Paramycosphaerella marksii (Carnegie & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807783

Basionym. Mycosphaerella marksii Carnegie & Keane, Mycol. Res. 98: 414. 1994.

Specimens examined. AUSTRALIA, Victoria, Briagolong, on leaves of E. globulus, 14 Oct. 1994, A. Carnegie, culture CPC 935 = CBS 110920. – SOUTH AFRICA, Northern Province, Tzaneen, Magoebaskloof, on leaves of E. grandis × saligna hybrid, Oct. 1994, G. Kemp (holotype of P. epispermogonia, PREM 51936, cultures of a Paramycosphaerella sp. possibly related to the asexual morph are CPC 822 = CBS 110750, CPC 823 = CBS 110693).

Notes — Paramycosphaerella marksii is a common pathogen of eucalypts. However, Pseudocercospora epispermogonia was found only once, sporulating on the outside of spermatogonia associated with leaf spots of Paramycosphaerella marksii on eucalypts (Crous & Wingfield 1996). Cultures of P. marksii are homothallic, and have failed to produce an asexual morph in culture, despite incubation on numerous media and under a range of growth conditions. The cultures associated with the type of Pseudocercospora epispermogonia were generated from ascospores of M. marksii. The synonymy proposed by Hunter et al. (2006) is premature, as it appears that there are no ex-type cultures of Pseudocercospora epispermogonia.

Phaeophleospora Rangel, Arq. Mus. Nac. Rio de Janeiro 18: 162. 1916

Notes — The genus Phaeophleospora is based on P. eugeniae, which occurs on leaf spots of Eugenia uniflora (Myrtaceae) in Brazil (Crous et al. 1997). For several years this genus represented species that are presently accommodated in Teratosphaeria (= Kirramyces) (Andjic et al. 2007, Crous et al. 2007a). The taxa allocated to Phaeophleospora here are sexual, and lack any asexual state, but are placed in Phaeophleospora based on phylogenetic inference.

Phaeophleospora gregaria (Carnegie & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807784

Basionym. Mycosphaerella gregaria Carnegie & Keane, Mycol. Res. 101: 843. 1997.

≡ Mycosphaerella aggregata Carnegie & Keane, Mycol. Res. 98: 415. 1994. Nom. illegit (Art. 53.1).

Specimen examined. AUSTRALIA, Victoria, Nowa Nowa, on leaves of E. grandis, 11 Nov. 1990, A.J. Carnegie (holotype IMI 353729b, isotype VPRI 20739a, culture ex-type DAR 72368).

Phaeophleospora scytalidii (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807785

Basionym. Mycosphaerella scytalidii Crous & M.J. Wingf., Stud. Mycol. 55: 120. 2006.

Specimen examined. COLOMBIA, Angela Maria, on leaves of E. urophylla, Jan. 2004, M.J. Wingfield (holotype CBS H-19696, culture ex-type CBS 118493 = CPC 10998).

Phaeophleospora stramenti (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807786

Basionym. Mycosphaerella stramenti Crous & Alfenas, Stud. Mycol. 55: 123. 2006.

Specimen examined. BRAZIL, Minas Gerais, Belo Oriente, on leaf litter of Eucalyptus sp., 24 Jan. 2004, A.C. Alfenas (holotype CBS H-19698, culture ex-type CBS 118909 = CPC 11545–11547).

Pseudocercospora eucalyptorum Crous, M.J. Wingf., Marasas & B. Sutton, Mycol. Res. 93: 394. 1989

= Pseudocercospora pseudoeucalyptorum Crous, Stud. Mycol. 50: 210. 2004.

Specimens examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, Stellenbosch Mountain, on leaves of E. nitens, 21 Dec. 1987, P.W. Crous (holotype of P. eucalyptorum, PREM 49112, cultures ex-type CPC 16 = CBS 110777). – SPAIN, Pontevedra, Lourizán, Areeiro, on leaves of E. globulus, 2003, J.P. Mansilla (holotype of P. pseudoeucalyptorum, CBS H-9893, culture ex-type CPC 10390 = CBS 114242).

Notes — The synonymy of P. pseudoeucalyptorum under P. eucalyptorum was discussed by Crous et al. (2013), and is again confirmed in the present study, which incorporates yet more gene loci.

Xenomycosphaerella Quaedvlieg & Crous, gen. nov. — MycoBank MB807787

Type species. Xenomycosphaerella elongata (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Resembling Mycosphaerella, but phylogenetically distinct.

Foliicolous, plant pathogenic. Ascomata pseudothecial, dark brown, subepidermal to erumpent, globose, with an apical ostiole; wall of 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoidal, straight to slightly curved, 8-spored. Ascospores bi- to multiseriate, overlapping, hyaline, thin- or thick-walled, straight to slightly curved, fusoid-ellipsoidal with obtuse ends, widest in middle of the apical cell, medianly or unequally 1-septate, tapering towards both ends, but more prominently towards the lower end. The genus Xenomycosphaerella is only distinguishable from Mycosphaerella based on DNA sequence data. Either ITS or LSU sequence data can easily differentiate between these genera.

Notes — Xenomycosphaerella is morphologically a typical species of Mycosphaerella s.l., but is phylogenetically distinct. Presently no asexual morphs are known, and the only distinguishing characters from Mycosphaerella are to be found in its DNA sequences.

Xenomycosphaerella elongata (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807788

Basionym. Mycosphaerella elongata Crous & M.J. Wingf., Fung. Diversity 26: 163. 2007.

Specimen examined. VENEZUELA, El Piñal Lotes farm near Acarigua, on leaves of Eucalyptus camaldulensis × urophylla, Oct. 2006, M.J. Wingfield (holotype CBS-H 19824, cultures ex-type CPC 13378 = CBS 120735, CPC 13379–13380).

Xenomycosphaerella yunnanensis (Barber & T.I. Burgess) Quaedvlieg & Crous, comb. nov. — MycoBank MB807789

Basionym. Mycosphaerella yunnanensis Barber & T.I. Burgess, Fung. Diversity 24: 150. 2007.

Specimen examined. CHINA, Yunnan, Lancang, leaves of Eucalyptus urophylla, May 2005, B. Dell (holotype MURU 407, culture ex-type CBS 119975 = CMW 23443).

Zasmidium Fr., Summa Veg. Scand., section Post. (Stockholm): 407. 1849

Zasmidium eucalyptorum (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807790

Basionym. Mycosphaerella eucalyptorum Crous & M.J. Wingf., Stud. Mycol. 55: 112. 2006.

Specimen examined. INDONESIA, on leaves of Eucalyptus sp., Mar. 2004, M.J. Wingfield (holotype CBS H-19689, culture ex-type CBS 118496 = CPC 11174).

Neodevriesiaceae

Neodevriesiaceae Quaedvlieg & Crous, fam. nov. — MycoBank MB807766

Type genus. Neodevriesia Quaedvlieg & Crous.

Ascomata when present pseudothecial, black, immersed, sub-stomatal on leaves; wall with 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoid, straight to slightly curved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, non-guttulate, thick-walled, straight, fusoid-ellipsoidal with obtuse ends, medianly 1-septate; germinating ascospores on MEA become brown and verruculose. Asexual morphs variable, filamentous. Conidiophores pigmented, proliferating sympodially. Conidia brown, solitary or in short mostly unbranched chains, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, rarely septate, solitary conidia composed of a central stalk and two lateral arms with 1–2 transverse septa.

Notes — Members of Neodevriesiaceae are foliicolous, saprobic or plant pathogenic, and form part of which Ruibal et al. (2009) referred to as ‘Teratosphaeriaceae 2’ (now Neodevriesiaceae), in their DNA phylogenies. Several genera await to be described in this family, pending further collections. Morphologically, Neodevriesiaceae is similar to Teratosphaeriaceae, but further sampling is needed to highlight the ecological differences between the two families.

Neodevriesia Quaedvlieg & Crous, gen. nov. — MycoBank MB807768

Type species. Neodevriesia hilliana (Crous & U. Braun) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to Devriesia.

Hyphomycetous, foliicolous. Conidiophores dimorphic or not, solitary, medium brown, unbranched, smooth- and thick-walled, flexuous, septate. Conidiogenous cells terminal, medium brown, subcylindrical, smooth, proliferating sympodially; hila flattened, unthickened, somewhat darkened. Ramoconidia 0(–1)-septate if present, guttulate, subcylindrical, smooth, pale brown; hila somewhat thickened and darkened. Conidia medium brown, smooth, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, apical conidium with obtuse apex, additional conidia with truncate ends, conidia straight to irregularly bent, mostly in unbranched chains; hila slightly darkened.

Notes — The genus Devriesia was introduced for a group of cladosporium-like heat tolerant hyphomycetes that are soil-inhabiting, with slightly darkened, planate, unthickened conidial scars, forming chlamydospores in culture (Seifert et al. 2004). Since then, several devriesia-like species were isolated from leaf litter or leaf spots, and placed in this genus based on molecular phylogenies, pending the sampling of more taxa, that would allow resolution of this generic complex.

Ecologically, the devriesia-like species do not exhibit heat resistance and also do not form chlamydospores (other than odd hyphal swellings in older cultures), which differs from Devriesia. Neodevriesia is also distinct from Devriesia s.str. in that conidiophores are medium brown and unbranched (pale brown and branched in Devriesia), conidia are thick-walled, medium brown, rarely septate, and conidial chains are short and mostly unbranched.

Neodevriesia hilliana (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807771

Basionym. Devriesia hilliana Crous & U. Braun, Stud. Mycol. 64: 37. 2009.

Specimen examined. NEW ZEALAND, Auckland, Auckland University Campus, Princes Street, on Macrozamia communis, 20 Apr. 2008, C.F. Hill, holotype CBS H-20340, culture ex-type CPC 15382 = CBS 123187.

Neodevriesia xanthorrhoeae (Crous, Pascoe & Jacq. Edwards) Quaedvlieg & Crous, comb. nov. — MycoBank MB808061

Basionym. Devriesia xanthorrhoeae Crous, Pascoe & Jacq. Edwards, Persoonia 25: 155. 2010.

Specimen examined. AUSTRALIA, Victoria, Grampians, S37°37'7.5" E142° 19'32.3" on leaves of Xanthorrhoea australis (Xanthorrhoeaceae), 21 Oct. 2009, P.W. Crous, I.G. Pascoe & J. Edwards, holotype CBS-H 20500, cultures ex-type CPC 17721, 17720 = CBS 128219.

Teratosphaeriaceae

Austroafricana Quaedvlieg & Crous, gen. nov. — MycoBank MB807793

Type species. Austroafricana associata (Crous & Carnegie) Quaedvlieg & Crous.

Etymology. Named after its occurrence in the Southern Hemisphere.

Foliicolous, plant pathogenic. Ascomata pseudothecial, black, subepidermal to erumpent, globose, with central apical ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci aparaphysate, but with remains of hamathecium visible, fasciculate, bitunicate, subsessile, obovoid to ellipsoidal, straight to slightly curved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, guttulate, thick-walled, straight, fusoid-ellipsoidal with obtuse ends, medianly 1-septate, tapering towards both ends, but more prominently towards the lower end; ascospores with or without persistent mucus sheath. Germinating ascospores become either verruculose, brown and distorted, or remain hyaline and undistorted.

Notes — Morphologically, Austroafricana resembles species of Teratosphaeria, and we have been unable to find characters to separate them. An ecological distinction is that species of Austroafricana co-colonise lesions of hosts with other ascomycetes, and have a wide host range. Austroafricana parva, for example, has been well documented as a pathogen of Eucalyptus and Proteaceae (Crous et al. 2008). Either ITS or LSU sequence data differentiate Austroafricana and Teratosphaeria.

Austroafricana associata (Crous & Carnegie) Quaedvlieg & Crous, comb. nov. — MycoBank MB807794

Basionym. Mycosphaerella associata Crous & Carnegie, Fung. Diversity 26: 159. 2007.

≡ Teratosphaeria associata (Crous & Carnegie) Crous & U. Braun, Stud. Mycol. 58: 9. 2007.

Specimen examined. AUSTRALIA, New South Wales, South Grafton, Grafton City Council Landfill Plantation, E152°54'38", S29°46'21", on leaves of Corymbia henryii, 16 Feb. 2006, A.J. Carnegie (holotype CBS-H 19833, isotype DAR 78031, cultures ex-type CPC 13119 = CBS 120730, CPC 13120, occurring with Lembosina sp.).

Austroafricana keanei (Carnegie & G.S. Pegg) Quaedvlieg & Crous, comb. nov.— MycoBank MB807795

Basionym. Teratosphaeria keanei Carnegie & G.S. Pegg, Australas.Pl. Pathol. 40: 368. 2011.

Specimen examined. AUSTRALIA, Queensland, Kingaroy, Berry’s Plantation, on living leaves of E. globulus × E. camaldulensis, 14 Feb. 2004, A.J. Carnegie (holotype BRIP 52593b, culture ex-type CBS 130524).

Austroafricana parva (R.F. Park & Keane) Quaedvlieg & Crous, comb. nov. — MycoBank MB807796

Basionym. Mycosphaerella parva R.F. Park & Keane, Trans. Brit. Mycol. Soc. 79: 99. 1982.

≡ Teratosphaeria parva (R.F. Park & Keane) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella grandis Carnegie & Keane, Mycol. Res. 98: 414. 1994.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, on leaves of Eucalyptus sp., Dec. 2003, P.W. Crous, CPC 10935 = CBS 116289.

Eupenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807797

Type species. Eupenidiella venezuelensis (Crous & U. Braun) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella.

Hyphomycetous, associated with opportunistic human infections. Mycelium consisting of branched, septate, smooth to finely verruculose, thin-walled, subhyaline, pale olivaceous to medium brown hyphae. Conidiophores solitary, erect, subcylindrical, straight to flexuous to once geniculate, septate, pale to medium olivaceous-brown or brown, thin-walled, terminally penicillate, branched portion composed of true branchlets and/or a single set or several sets of ramoconidia, branchlets; occasionally with a few additional conidiophores reduced to conidiogenous cells. Conidiogenous cells terminal and intercalary, unbranched, subcylindrical, medium brown, smooth to finely verruculose, with 1–3(–4) flat-tipped, loci slightly thickened and darkened-refractive loci, often subdenticulate. Conidia ellipsoid-ovoid, subcylindrical, pale to medium olivaceous-brown or brown, finely verruculose, in branched chains; ramoconidia 0–1(–3)-septate, with 1–3 subdenticulate apical hila; secondary conidia 0(–1)-septate, ellipsoid, obovoid to irregular, hila sometimes slightly thickened and darkened-refractive.

Notes — Eupenidiella is similar to Penidiella, but differs in having dimorphic conidiophores, and conidiogenous loci that are subdenticulate, and slightly darkened-refractive. In contrast, they are barely darkened-refractive in Penidiella, and not subdenticulate.

Eupenidiella venezuelensis (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807798

Basionym. Penidiella venezuelensis Crous & U. Braun, Stud. Mycol. 58: 24. 2007.

Specimen examined. VENEZUELA, isolated from man with tinea nigra, Jan. 1975, D. Borelli (holotype CBS H-19934, culture ex-type CBS 106.75).

Euteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807799

Type species. Euteratosphaeria verrucosiafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after the genus Teratosphaeria.

Foliicolous, plant pathogenic.Ascomata pseudothecial, solitary, black, immersed becoming erumpent, globose; ostiole apical, central; wall of 2–3 layers of medium brown textura angularis. Asciaparaphysate, fasciculate, bitunicate, subsessile, obovoid to narrowly ellipsoid, straight or slightly incurved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline, guttulate, thin-walled, straight, ellipsoid with obtuse ends, medianly 1-septate, tapering towards both ends, but more prominently towards the lower end.

Notes — Euteratosphaeria is morphologically similar to species of Teratosphaeria. The type species, E. verrucosiafricana, is distinct from species in Teratosphaeria in that ascospores turn brown and verruculose upon germination, but germinate with more than two germ tubes (which remain hyaline), and grow irregular to the long axis of the spore. More taxa need to be collected to determine if this is a feature of value at species or generic level. Colonies in culture remain sterile, have sparse aerial mycelium, and form chains of dark brown, thick-walled chlamydospores that aggregate into small microsclerotia.

Euteratosphaeria verrucosiafricana (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807800

Basionym. Mycosphaerella verrucosiafricana Crous & M.J. Wingf., Stud. Mycol. 55: 125. 2006.

Specimen examined. INDONESIA, Northern Sumatra, on leaves of Eucalyptus sp., Feb. 2004, M.J. Wingfield (holotype CBS H-19705, culture ex-type CBS 118496 = CPC 11167, CBS 118497 = CPC 11169, CBS 118498 = CPC 11170).

Myrtapenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807801

Type species. Myrtapenidiella tenuiramis (Crous & Summerell) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella and the host plant family, Myrtaceae.

Hyphomycetous, foliicolous, saprobic. Mycelium consisting of branched, septate, smooth to slightly verruculose or warty, pale to dark brown hyphae. Conidiophores dimorphic. Microconidiophores reduced to conidiogenous cells, lateral on hyphae, with or without a basal septum. Macroconidiophores erect, arising as lateral branches from superficial hyphae, or as terminal ends of creeping hyphae, variable in length, pale to dark brown, smooth to finely verruculose. Conidiogenous cells terminal, rarely intercalary, cylindrical, tapering to a flattened apical region, finely verruculose, medium brown, paler toward the apex, with up to two conidiogenous loci, often apical, sometimes situated on small lateral shoulders, loci truncate, not denticulate; scars slightly thickened, darkened, visible as small dark circles when viewed directly from above. Ramoconidia subcylindrical or obovoid, 0–3-septate, base subtruncate to slightly rounded, but not coronate, pale to medium brown, finely verruculose, slightly thick-walled; hila thickened and darkened. Conidia in branched acropetal chains, broadly fusiform to obovoid or subcylindrical, 0–1-septate, pale to medium brown; wing-like mucoid sheaths present in some species. Chlamydospores globose to subovoid, dark brown, thin-walled, terminal or intercalary, mostly 1-celled, rarely septate, produced from narrow hyphae.

Notes — Myrtapenidiella is distinguished from Penidiella by having dimorphic conidiophores with irregular branching patterns, septate ramoconidia, with hila that are slightly thickened and darkened. Some species of Myrtapenidiella form chlamydospores, or have wing-like mucoid sheaths on conidia, although these do not appear to be generic features shared by all taxa. All species presently known occur on members of the Myrtaceae.

Myrtapenidiella corymbia (Cheew. & Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807802

Basionym. Penidiella corymbia Cheew. & Crous, Persoonia 23: 72. 2009.

Specimen examined. AUSTRALIA, Northern Territory, Emerald Springs, S13°37'13.3" E131°36'40", on Corymbia foelscheana, 22 Sept. 2007, coll. B.A. Summerell, isol. P.W. Crous (holotype CBS H-20288, culture ex-type CPC 14640 = CBS 124769, CPC 14641, 14642).

Myrtapenidiella eucalypti (Cheew., K.D. Hyde & Crous)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807803

Basionym. Penidiella eucalypti Cheew., K.D. Hyde & Crous, Persoonia 21: 86. 2008.

Specimens examined. THAILAND, Payakpoompisai, Mahasarakam, on leaves of E. camaldulensis, July 2007, P. Suwannawong (holotype CBS H-20136, cultures ex-type CBS 123246 = CPC 15411, AGI064.1, AGI064.2; occurring on a lesion in association with Harknessia sp.); Satuk, Burirum, on leaves of E. camaldulensis, July 2007, R. Cheewangkoon, cultures CBS 123245, CPC 15449 (occurring on a lesion in association with several microfungi).

Myrtapenidiella tenuiramis (Crous & Summerell) Quaedvlieg & Crous, comb. nov. — MycoBank MB807804

Basionym. Penidiella tenuiramis Crous & Summerell, Persoonia 23: 127. 2009.

Specimen examined. AUSTRALIA, Tasmania, Tasman Peninsula, Brown Mountain walk, S43°11'13.9" E147°51'00.8", on leaves of E. tenuiramis, 14 Oct. 2006, coll. B.A. Summerell & P. Summerell (holotype CBS H-20253, isol. P.W. Crous, cultures ex-type CPC 13692 = CBS 124993, CPC 12693, 13694).

Neocatenulostroma Quaedvlieg & Crous, gen. nov. — MycoBank MB807805

Type species. Neocatenulostroma microsporum (Joanne E. Taylor & Crous) Quaedvlieg & Crous.

Etymology. Named after the genus Catenulostroma.

Plant pathogenic (foliicolous) and saprobic. Mycelium immersed, pale brown, septate, smooth. Ascomata amphigenous, immersed, substomatal, subepidermal, with small or no papilla, globose to slightly subglobose, with periphysate central ostiole. Peridium comprising two strata, the outer stratum of thick-walled, medium brown small-celled textura angularis, becoming thinner-walled and hyaline in the inner stratum. Asci obclavate to globose, bitunicate, sessile, narrowing to a rounded apex, 8-spored. Ascospores broadly fusiform, medianly 1-septate, hyaline to pale brown, smooth, eguttulate, with obtuse apices, with or without a mucilaginous sheath. Colonies sporodochial, pulvinate, dry, dark brown to black. Conidiophores macronematous, mainly straight, caespitose, closely packed, emerging through stomata forming the sporodochia, short, smooth, olivaceous-brown. Conidiogenous cells irregularly cylindrical, terminal, holoblastic, delimitation of conidium by a single septum, with retrogressive delimitation of next conidium, giving an unconnected chain of conidia, secession schizolytic. Conidia variously shaped, cylindrical, Y-shaped, ellipsoidal, straight or curved, with rounded or truncated apices, catenate in branched basipetal chains, which are schizogenous, olivaceous to red-brown, multiseptate, with transverse and often longitudinal or oblique septa.

Notes — Species of Trimmatostroma s.str. are genetically distinct from Catenulostroma. Furthermore, they are also ecologically different, in that Trimmatostroma includes taxa that are saprobic, and occur on dead twigs and branches, and not associated with leaf spots (Crous et al. 2007a). Catenulostroma presently contains several undescribed genera in the Teratosphaeriaceae. They share colonies that are sporodochial, pulvinate, dry, dark brown to black, giving rise to chains of multiseptate, brown conidia.

Neocatenulostroma includes species that are plant pathogenic (N. abietis, N. microsporum) or occur on rocks (N. germanicum). Although N. abietis and N. microsporum were considered plant pathogenic (Butin et al. 1996, Taylor & Crous 2000), N. abietis has since been isolated from a range of substrates, commonly as either a saprobe or endophyte in pine needles. The genus Catenulostroma is based on C. protearum, which is associated with dead leaves of Proteaceae, and probably is not plant pathogenic (Crous et al. 2009b). Morphologically, Catenulostroma s.str. contains colonies that produce muriform eu- or distoseptate conidia in branched chains. Neocatenulostroma on the other hand, has chains of irregularly branched conidia with transverse, longitudinal or oblique septa, variously shaped, from cylindrical to Y-shaped or ellipsoidal.

Neocatenulostroma abietis (Butin & Pehl) Quaedvlieg & Crous, comb. nov. — MycoBank MB807806

Basionym. Trimmatostroma abietis Butin & Pehl, Antonie van Leeuwenhoek 69: 204. 1996.

≡ Catenulostroma abietis (Butin & Pehl) Crous & U. Braun, Stud. Mycol. 58: 15. 2007.

Specimen examined. SWEDEN, Götenborg, isolated from outdoor painted walls, culture CBS 110038.

Neocatenulostroma germanicum (Crous & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807807

Basionym. Catenulostroma germanicum Crous & U. Braun, Stud. Mycol. 58: 16. 2007.

Specimen examined. GGERMANY (former West-Germany), isolated from stone, Oct. 1988, J. Kuroczkin (holotype CBS H-19936, culture ex-type CBS 539.88).

Neocatenulostroma microsporum (Joanne E. Taylor & Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807808

Basionym. Trimmatostroma microsporum Joanne E. Taylor & Crous, Mycol. Res. 104: 631. 2000.

≡ Catenulostroma microsporum (Joanne E. Taylor & Crous) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Teratosphaeria microspora Joanne E. Taylor & Crous, Mycol. Res. 104: 631. 2000.

Specimens examined. SOUTH AFRICA, Western Cape Province, Somerset West, Hilly Lands Farm, on a living leaf of a Protea cynaroides, 21 July 1998, S. Denman & J.E. Taylor (holotype of Teratosphaeria microspora, PREM 56207a, culture ex-type CPC 1960 = CBS 101951; holotype of Trimmatostroma microspora, PREM 56207b, CPC 1832 = CBS 110890).

Neohortaea Quaedvlieg & Crous, gen. nov. — MycoBank MB807809

Type species. Neohortaea acidophila (Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Hortaea.

Colonies smooth, mucilaginous, black. Mycelium consisting of pale olivaceous, thin-walled hyphae that become dark brown with thick walls, producing copious mucus. Conidiogenous cells integrated on hyphae, reduced to conidiogenous loci, with several minute percurrent proliferations. Conidia initially subhyaline, smooth, thin-walled, ellipsoidal, becoming dark brown, broadly ellipsoid to clavate, septum median, hilum truncate with minute marginal frill; conidiation microcyclic.

Notes — Morphologically similar to Hortaea (Teratosphaeriaceae), except that the latter has prominently annellate conidiogenous loci, and conidia that develop several septa, forming chlamydospores with age (de Hoog et al. 2000, Plemenitas et al. 2008).

Neohortaea acidophila (Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog) Quaedvlieg & Crous, comb. nov. — MycoBank MB807810

Basionym. Hortaea acidophila Hölker, Bend, Pracht, Tetsch, Tob. Müll., M. Höfer & de Hoog, Antonie van Leeuwenhoek 86: 293. 2004.

Specimen examined. GERMANY, Bergheim, from lignite, May 2001, U. Hölker, culture ex-type CBS 113389.

Neophaeothecoidea Quaedvlieg & Crous, gen. nov. — MycoBank MB807811

Type species. Neophaeothecoidea proteae (Crous) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Phaeothecoidea.

Hyphomycetous, saprobic. Hyphaein vitro creeping, brown, verruculose, branched, septate, becoming swollen, verruculose, dark brown, or forming a mucoid capsule filled with endoconidia derived from hyphal cells that turn brown and become thick-walled; end cells divide into several endoconidia, which are released upon rupture of the cell wall. Endoconidia medium to dark brown, verruculose to verrucose to warty, thick-walled, ellipsoid to obovoid or obclavate; after liberation swelling, becoming transversely 1-septate, or with several oblique septa, again forming endoconidia, becoming warty with age, the outer layer peels off after endoconidia are released.

Notes — Neophaeothecoidea proteae was initially described in Phaeothecoidea as it clustered close to other species of Phaeothecoidea s.str. However, N. proteae was originally isolated as a coelomycete. In culture, it grew like a yeast, and was thought to represent Coniothyrium leucospermi (= Coniozyma leucospermi; Swart et al. 1998, Taylor & Crous 2001, Marincowitz et al. 2008). Based on present data, it appears to represent a distinct genus.

Neophaeothecoidea proteae (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807812

Basionym. Phaeothecoidea proteae Crous, Persoonia 20: 71. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, Elsenburg Farm, on leaves of Protea repens, 23 July 1999, S. Denman (holotype CBS H-20092, cultures ex-type CPC 2828–2830, 2831 = CBS 114129).

Neotrimmatostroma Quaedvlieg & Crous, gen. nov. — MycoBank MB807813

Type species. Neotrimmatostroma excentricum (B. Sutton & Ganap.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Trimmatostroma.

Foliicolous, plant pathogenic. Ascomata pseudothecial, separate, dark brown, subepidermal, becoming erumpent, globose; ostiole apical, central, frequently opening by irregular rupture; wall of 2–3 layers of dark brown, thick-walled textura angularis. Asci fasciculate, bitunicate, aparaphysate (remains of the hamathecium observed in some ascomata), 8-spored, obovoid to broadly ellipsoidal, straight to slightly incurved. Ascospores tri- to multiseriate, fusoid-ellipsoidal with obtuse ends, hyaline, smooth, pale brown and verruculose in old asci, becoming 3-septate, not constricted at median septum, thick-walled, guttulate, widest in the middle of the apical cell, with persistent mucous sheath. Conidiomata sporodochial, at times concentrically arranged, dark brown to black, dry, powdery, confined to the lesions. Conidiophores branched at base, pale brown, smooth, loosely aggregated, pale brown. Conidiogenous cells terminal, cylindrical to doliiform, holothallic, pale brown. Conidia formed in basipetal chains, smooth, medium brown, 4-celled, consisting of two basal cells with truncate lateral sides (adhesion scars present when catenulate), each giving rise to a secondary globose apical cell, that may extend and develop two additional septa; septa dark brown and thick-walled between the primary and secondary cells.

Notes — Neotrimmatostroma is distinguished from Teratosphaeria in that its ascospores become brown and up to 3-septate in older asci, have a persistent mucoid sheath, and frequently have remnants of the hamathecium in the ascomatal cavity. The asexual morph is distinguished from Trimmatostroma in that it is plant pathogenic, and conidiogenous cells give rise to 4-celled conidia with two basal cells that have truncate lateral sides and two globose apical cells, separated by dark brown, thick-walled septa. Although there are presently no cultures available of Trimmatostroma bifarium, which is also pathogenic to Eucalyptus, the latter fungus is clearly congeneric with N. excentricum.

Neotrimmatostroma bifarium (Gadgil & M.A. Dick) Quaedvlieg & Crous, comb. nov. — MycoBank MB807814

Basionym. Trimmatostroma bifarium Gadgil & M.A. Dick, New Zealand J. Bot. 21: 49. 1983.

Description and illustration — Gadgil & Dick 1983, Park et al. 2000.

Specimen examined. NEW ZEALAND, Kinleith, on leaves of E. regnans, Sept. 1981, D.J. Rawcliffe (holotype NZFRI, isotype PDD 42845).

Neotrimmatostroma excentricum (B. Sutton & Ganap.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807815

Basionym. Trimmatostroma excentricum B. Sutton & Ganap., New Zealand J. Bot. 16: 529. 1978.

≡ Catenulostroma excentricum (B. Sutton & Ganap.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella excentrica Crous & Carnegie, Fung. Diversity 26: 164. 2007.

≡ Teratosphaeria excentrica (Crous & Carnegie) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Description and illustration — Sutton & Ganapathi 1978, Crous et al. 2007c.

Specimen examined. AUSTRALIA, New South Wales, Mackenzie Creek Road, Kempsey, Byrne Plantation, E152°27'47" S30°53'15", on leaf spots of E. agglomerata, 13 Apr. 2005, G. Price (holotype of sexual morph CBS H-19829, isotype DAR 78033, culture ex-type CPC 13092 = CBS 121102).

Apenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807816

Type species. Apenidiella strumelloidea (Milko & Dunaev) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Penidiella.

Hyphomycetous, saprobic. Mycelium consisting of branched, septate, smooth, hyaline to pale olivaceous, hyphae, sometimes constricted at dark septa. Conidiophores solitary, erect, arising from superficial mycelium, reduced to conidiogenous cells or macronematous, subcylindrical, straight to slightly curved, sometimes attenuated towards the apex, septate, medium brown, smooth, apex with a terminal conidiogenous cell giving rise to a single set of ramoconidia. Conidiogenous cells terminal, integrated, subcylindrical, straight, pale brown, thin-walled, smooth, apex obtusely rounded to somewhat clavate; loci terminal, occasionally subterminal or lateral, unthickened to slightly thickened and darkened, not refractive. Conidia in branched chains; ramoconidia subcylindrical, with 1–3 terminal loci, olivaceous-brown, smooth; secondary conidia ellipsoidal, with one side straight and the other convex, straight to slightly curved, subhyaline to olivaceous-brown, smooth, thin-walled; hila unthickened to slightly thickened and darkened, not refractive.

Notes — Apenidiella is distinct from Penidiella in that conidiophores end with a solitary conidiogenous cell that gives rise to a single set of ramoconidia (thus not penicillate with branches as in Penidiella s.str.). Ramoconidia and conidia are aseptate, smooth and thin-walled, subhyaline to olivaceous-brown. Nosrati et al. (2010) reported this fungus to be pathogenic to greenhouse cucumbers in Iran. However, based on their illustrations, they appear to have been working with a species of Cladosporium (brown conidia with darkened, thickened, refractive scars; see Bensch et al. 2012).

Apenidiella strumelloidea (Milko & Dunaev) Quaedvlieg & Crous, comb. nov. — MycoBank MB807817

Basionym. Cladosporium strumelloideum Milko & Dunaev, Novosti Sist. Nizsh. Rast. 23: 134. 1986.

≡ Penidiella strumelloidea (Milko & Dunaev) Crous & U. Braun, Stud. Mycol. 58: 23. 2007.

Specimen examined. RUSSIA, Yaroslavl Region, Rybinsk Reservoir, mouth of Sutka River, isolated from leaf of Carex sp. (Cyperaceae), from stagnant water, S. Ozerskaya (holotype BKMF-2534, culture ex-type CBS 114484).

Parateratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807818

Type species. Parateratosphaeria bellula (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata amphigenous, immersed, substomatal, black, singular, gregarious; pyriform or globose, with a non-periphysate to periphysate papillate ostiole, becoming erumpent through the stomatal pore. Peridium with 3–4 layers of compressed textura angularis that comprise an outer stratum of dark brown thick-walled cells with large lumina that become hyaline and thin-walled in the inner stratum. Paraphyses absent. Asci obclavate to cylindrical, pedicel short, straight, tapering to a narrow rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscence. Ascospores overlapping bi- to multiseriate, 1-septate, fusiform to ellipsoidal, with obtuse ends, straight, hyaline, guttulate, surrounded by an inconspicuous mucilaginous sheath. Germinating ascospores become brown and verruculose.

Notes — Parateratosphaeria is morphologically indistinguishable from Teratosphaeria. Ascospores turn brown and verruculose during germination and some species also have a mucoid sheath, though these features also occur in some taxa of Teratosphaeria s.str. The genus Parateratosphaeria is only distinguishable from Teratosphaeria based on DNA sequence data. Either ITS or LSU sequence data differentiates these genera.

Parateratosphaeria altensteinii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807819

Basionym. Teratosphaeria altensteinii Crous, Persoonia 21: 139. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Kirstenbosch Botanical Garden, on living leaves of Encephalartos altensteinii, 6 Jan. 2008, P.W. Crous, M.K. Crous, M. Crous & K. Raath (holotype CBS H-20162, culture ex-type CPC 15133 = CBS 123539, CPC 15134–15135).

Parateratosphaeria bellula (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807820

Basionym. Mycosphaerella bellula Crous & M.J. Wingf., Mycotaxon 46: 20. 1993.

≡ Teratosphaeria bellula (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Western Cape Province, Stellenbosch, J.S. Marais Botanical Garden, on leaves of Protea eximia, Apr. 1998, J.E. Taylor (epitype CBS H-20094, culture ex-epitype CPC 1821 = CBS 111700).

Parateratosphaeria karinae (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807821

Basionym. Teratosphaeria karinae Crous, Persoonia 26: 80. 2011.

Specimen examined. SOUTH AFRICA, Western Cape Province, Hermanus, Fernkloof Nature Reserve, S34°23'38" E19°16'9.7", on leaf bracts of Phaenocoma prolifera, 2 May 2010, K.L. Crous & P.W. Crous (holotype CBS H-20534, cultures ex-type CPC 18256, 18255 = CBS 128774).

Parateratosphaeria marasasii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807822

Basionym. Teratosphaeria marasasii Crous, Persoonia 20: 79. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Kirstenbosch Botanical Garden, on living leaves of Protea sp., 6 Jan. 2008, P.W. Crous & M. Crous (holotype CBS H-20105, cultures ex-type CBS 122899 = CPC 14889, CPC 14890, 14891; on leaf spots in association with Coleroa senniana).

Parateratosphaeria persoonii (Crous & L. Mostert) Quaedvlieg & Crous, comb. nov. — MycoBank MB807823

Basionym. Teratosphaeria persoonii Crous & L. Mostert, Persoonia 20: 80. 2008.

Specimen examined. SOUTH AFRICA, Western Cape Province, Jonkershoek, S33°59'4.2" E18°57'16.1", on living leaves of Protea sp., 1 Apr. 2007, P.W. Crous & L. Mostert (holotype CBS H-20102, cultures ex-type CPC 13972 = CBS 122895, CPC 13973, 13974; on leaf spots in association with T.jonkershoekensis = Xenoteratosphaeria jonkershoekensis).

Pseudoteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807824

Type species. Pseudoteratosphaeria perpendicularis (Crous & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic or saprobic. Ascomata pseudothecial, epiphyllous, single, black, subepidermal, globose; ostiole central, apical; wall of 2–3 layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, obovoid to broadly ellipsoid, slightly incurved, 8-spored. Ascospores multiseriate, overlapping, hyaline, guttulate, thin-walled, straight, fusoid-ellipsoidal, ellipsoidal or obovoid with obtuse ends, medianly 1-septate, widest in the middle of the apical cell, constricted at the septum, tapering towards both ends, but more prominently towards the lower end.

Notes — Pseudoteratosphaeria is morphologically similar to species of Teratosphaeria and can only be distinguished based on DNA phylogeny. No asexual morphs are presently known for Pseudoteratosphaeria. Either ITS or LSU sequence data differentiates these genera.

Pseudoteratosphaeria flexuosa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807825

Basionym. Mycosphaerella flexuosa Crous & M.J. Wingf., Mycol. Mem. 21: 58. 1998.

≡ Teratosphaeria flexuosa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. COLOMBIA, La Selva, leaves of E. globulus, May 1995, M.J. Wingfield (holotype PREM 54401, cultures ex-type STE-U 1107– 1109 = CBS 111012).

Pseudoteratosphaeria gamsii (Crous) Quaedvlieg & Crous, comb. nov. — MycoBank MB807826

Basionym. Mycosphaerella gamsii Crous, Stud. Mycol. 55: 113. 2006.

≡ Teratosphaeria gamsii (Crous) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. INDIA, Palampur, on leaves of Eucalyptus sp., Mar. 2004, W. Gams & M. Arzanlou (holotype CBS H-19690, culture ex-type CBS 118495 = CPC 11138–11140).

Pseudoteratosphaeria ohnowa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807827

Basionym. Mycosphaerella ohnowa Crous & M.J. Wingf., Stud. Mycol. 50: 206. 2004.

≡ Teratosphaeria ohnowa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Mpumalanga, Hazy View, on leaves of E. grandis, 27 Mar. 1995, M.J. Wingfield (holotype PREM 51912, cultures ex-type CPC 1004 = CBS 112896, CPC 1005 = CBS 112973, CPC 1006 = CBS 110949).

Pseudoteratosphaeria perpendicularis (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807828

Basionym. Mycosphaerella perpendicularisCrous & M.J. Wingf., Stud. Mycol. 55: 113. 2006.

≡ Teratosphaeria perpendicularis (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. COLOMBIA, Suiza, on leaves of Eucalyptus eurograndis, Jan. 2004, M.J. Wingfield (holotype CBS H-19691, cultures ex-type CBS 118367 = CPC 10983–10985).

Pseudoteratosphaeria secundaria (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807829

Basionym. Mycosphaerella secundaria Crous & Alfenas, Stud. Mycol. 55: 122. 2006.

≡ Teratosphaeria secundaria (Crous & Alfenas) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. BRAZIL, Bahia, Teixeira de Freitas, on leaves of Eucalyptus sp., 8 June 2004, A.C. Alfenas (holotype CBS H-19697, culture ex-type CBS 118507 = CPC 11551–11553).

Pseudoteratosphaeria stramenticola (Crous & Alfenas) Quaedvlieg & Crous, comb. nov. — MycoBank MB807830

Basionym. Mycosphaerella stramenticola Crous & Alfenas, Stud. Mycol. 55: 123. 2006.

≡ Teratosphaeria stramenticola (Crous & Alfenas) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

= Mycosphaerella parkiiaffinis Crous & M.J. Wingf., Fung. Diversity 26: 168. 2007.

≡ Teratosphaeria parkiiaffinis (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimens examined. BRAZIL, Bahia, Eunapolis, on leaf litter of Eucalyptus sp., 23 May 2004, A.C. Alfenas (holotype of M. stramenticola, CBS H-19699, cultures ex-type CBS 118506 = CPC 11438–11440). – VENEZUELA, near Acarigua, on leaves of Eucalyptus urophylla, Oct. 2006, M.J. Wingfield (holotype of M. parkiiaffinis, CBS H-19823, cultures ex-type CPC 13373 = CBS 120737, CPC 13374).

Notes — Pseudoteratosphaeria stramenticola was isolated from leaf litter of a Eucalyptus sp. in Brazil (Crous et al. 2006). Ascospores were fusoid-ellipsoidal, (8–)9–10(–11) × 3(–3.5) μm. In contrast, Mycosphaerella parkiiaffinis was associated with well-defined leaf spots of E. urophylla in Venezuela, and its ascospores were fusoid-ellipsoidal, (8–)9–10 × 3(–3.5) μm (Crous et al. 2007c). These two species are also identical based on their DNA phylogeny, which provides further evidence that some of these pathogens are endophytes.

Queenslandipenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807831

Type species. Queenslandipenidiella kurandae (Crous & J.K. Stone) Quaedvlieg & Crous.

Etymology. Named after its occurrence in Queensland, Australia, and morphological similarity to the genus Penidiella.

Hyphomycetous. Mycelium consisting of smooth, brown, thick-walled, branched, hyphae. Conidiophores macronematous, erect, arising from superficial hyphae, branching penicillate, septate. Conidiogenous apparatus consisting of several sets of branches; primary branches subcylindrical, brown, smooth, 0–1-septate, giving rise to 1–2 conidiogenous cells or secondary branches; secondary branches 0–1-septate. Conidiogenous cells doliiform to subcylindrical, brown, smooth, with 1–2 apical scars that are flattened, not darkened, refractive nor thickened. Ramoconidia brown, smooth, with 2–3 apical loci, narrowly ellipsoidal to subcylindrical. Conidia occurring in short chains, brown, smooth, ellipsoidal, apex obtuse, base subtruncate with or without a flattened inconspicuous hilum.

Notes — Queenslandipenidiella was placed in Penidiella based on having penicillate conidiophores that produce brown conidia with inconspicuous hila, as well as phylogenetic placement in the Teratosphaeriaceae (Crous et al. 2007c). Ecologically it is very interesting, as it colonises the exudates of bleeding cankers that are common on many of the trees lining a rainforest walking trail at Kuranda in northern Queensland. Whether it is the cause of the cankers, or simply a secondary invader on the exudates, remains unknown. Queenslandipenidiella can be distinguished from Penidiella s.str. by its well defined penicillate conidiophores, with clear branching structure, which is less apparent in species of Penidiella s.str. (Crous et al. 2007a, c).

Queenslandipenidiella kurandae (Crous & J.K. Stone)

Quaedvlieg & Crous, comb. nov. — MycoBank MB807832

Basionym. Penidiella kurandae Crous & J.K. Stone, Fungal Planet 16. 2007.

Specimens examined. AUSTRALIA, Queensland, Cairns, Kuranda, Kuranda walking trail, S16°49'24.6" E145°38'2.6", from exudates of stem cankers on unidentified rainforest tree, 30 Aug. 2006, P.W. Crous & J.K. Stone (holotype CBS H-19932, culture ex-type CPC 13333 = CBS 121715, CPC 13334; ditto, S16°49'29" E145°38'28.6", paratype CBS H-19924, CPC 13335).

Readeriella Syd. & P. Syd., Ann. Mycol. 6, 5: 484. 1908

Readeriella deanei Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807833; Fig. 7

Etymology. Name refers to the host from which it was isolated, Eucalyptus deanei.

Description on OA. Conidiomata pycnidial, brown, globose to subglobose, up to 250 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells, or with a supporting cell. Conidiogenous cells discrete, doliiform to ampulliform, pale brown, finely verruculose, proliferating several times percurrently near apex, 5–8 × 4–6 μm. Conidia solitary, aseptate, ellipsoid to limoniform, tapering towards a bluntly rounded, subobtuse, thickened apex, base subtruncate and thickened, hyaline becoming medium to golden brown, finely verruculose, (8–)9–10(–11) × 4(–5) μm.

Culture characteristics — Colonies erumpent, spreading, with lobate, feathery margins and sparse aerial mycelium on OA and PDA; fluffy to woolly on MEA, 5 cm diam after 2 wk. On MEA surface olivaceous-grey, reverse iron-grey. On PDA and OA, surface and reverse iron-grey.

Specimen examined. AUSTRALIA, New South Wales, Wollemi National Park, on leaves of Eucalyptus deanei, 9 Feb. 2006, B. Summerell (holotype CBS H-21136, culture ex-type CPC 12715 = CBS 134746).

Notes — Morphologically similar to R. readeriellophora (conidiomata up to 130 μm diam, conidiogenous cells 8–15 × 3–4 μm, conidia (5–)6–7(–9) × (3–)4(–4.5) μm; Crous et al. 2004b). However, conidiomata of R. deanei are larger, conidiogenous cells wider and conidia longer and wider.

Readeriella limoniforma Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807834; Fig. 8

Etymology. Name refers to its conidia, which are characteristically limoniform in shape.

Description on OA. Conidiomata pycnidial, brown, globose to subglobose, up to 150 μm diam, ostiole central, up to 60 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells discrete, doliiform to subcylindrical, hyaline to pale brown, smooth to finely verruculose, monophialidic, proliferating several times percurrently near apex, 5–8 × 3–4 μm. Conidia solitary, aseptate, ellipsoid to limoniform, tapering towards a bluntly rounded, subobtuse, thickened apex, base subtruncate, hyaline becoming medium to golden brown, finely verruculose, (6–)7–8(–10) × 3(–4) μm.

Culture characteristics — Colonies erumpent, spreading, with lobate, feathery margins and moderate to fluffy aerial mycelium, reaching 4 cm diam after 2 wk. On MEA surface smoke-grey, outer region purplish grey, reverse fuscous-black. On PDA surface iron-grey, and pale olivaceous-grey in centre; reverse iron-grey.

Specimen examined. AUSTRALIA, New South Wales, Wollemi National Park, on leaves of Eucalyptus sp., 9 Feb. 2006, B. Summerell (holotype CBS H-21135, cultures ex-type CPC 12727–12729 = CBS 134745).

Notes — Morphologically R. limoniforma is similar to R. callista (conidia ellipsoid to fusoid, 7–11 × 3–5.5 μm; Crous et al. 2009d), but conidia are more limoniform in shape and slightly wider than those of R. callista.

Readeriella mirabiliaffinis Quaedvlieg, Summerell & Crous, sp. nov. — MycoBank MB807835; Fig. 9

Etymology. Name refers to its similarity to R. mirabilis.

Description on OA. Conidiomata pycnidial, brown, globose, up to 300 μm diam; wall consisting of 2–3 layers of brown textura angularis. Conidiophores 0–1-septate, pale brown, finely verruculose, ampulliform to doliiform, 10–20 × 4–6 μm. Conidiogenous cells pale brown, finely verruculose, ampulliform to doliiform, proliferating several times percurrently near apex, mono- or polyphialidic, 8–10 × 4–6 μm. Conidia solitary, medium brown, aseptate, smooth, granular, base truncate, with three apical, lateral, obtuse projections, deltoid, thick-walled, with darker pigmentation in the lateral projections, but with more prominent constriction between the projections and the base, (9–)10–11(–12) μm long, (8–)9–10(–11) μm wide at apex.

Culture characteristics — Colonies spreading, erumpent with lobate, feathery margins and moderate aerial mycelium. On OA, MEA and PDA surface olivaceous-grey with patches of pale olivaceous-grey; reverse iron-grey; after 2 wk reaching 55 mm diam.

Specimen examined. AUSTRALIA, Tasmania, Tasman Peninsula, Brown Mountain walk, S43°11'13.9" E147°50'50.7", on leaves of E. delegatensis, 14 Oct. 2006, P. Summerell & B. Summerell (holotype CBS H-21134, culture ex-type CPC 13611 = CBS 134744).

Notes — Morphologically similar to R. mirabilis (conidia (7–)9–10(–11) μm long, (7–)8–9(–10) μm wide at apex), although the conidia of R. mirabiliaffinis are larger.

Suberoteratosphaeria Quaedvlieg & Crous, gen. nov. — MycoBank MB807836

Type species. Suberoteratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria and association with corky leaf spots.

Foliicolous and caulicolous, plant pathogenic. Ascomata pseudothecial, solitary or aggregated, black, superficial to subepidermal, globose, glabrous; ostiole apical, central, papillate, lined with periphyses; wall of 3–4 layers of medium brown textura angularis, subhymenium of 3–5 layers of hyaline cells. Asci fasciculate, bitunicate, aparaphysate, subsessile, 8-spored, ellipsoid to obclavate, straight or curved. Ascospores bi- to triseriate or irregularly arranged, oblique, overlapping, straight ellipsoidal, obtuse at each end, hyaline to pale brown, smooth, 1-septate, guttulate, with or without mucoid sheath. Germinating ascospores become brown and verruculose.

Notes — Suberoteratosphaeria is plant pathogenic, associated with corky leaf spots, but also on stems and leaf petioles. The genus has ascospores that are hyaline to pale brown (as found in several species of Teratosphaeria s.str.). Suberoteratosphaeria is distinguished from Teratosphaeria by its corky lesions, and less so by ascospores that become brown, verruculose and germinate by two or multiple germ tubes.

Suberoteratosphaeria pseudosuberosa (Crous & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807838

Basionym. Mycosphaerella pseudosuberosa Crous & M.J. Wingf., Stud. Mycol. 55: 118. 2006.

≡ Teratosphaeria pseudosuberosa (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. URUGUAY, on leaves and petioles of Eucalyptus sp., Apr. 2005, M.J. Wingfield (holotype CBS H-19695, culture ex-type CBS 118911 = CPC 12085).

Suberoteratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807839

Basionym. Mycosphaerella suberosa Crous, F.A. Ferreira, Alfenas & M.J. Wingf., Mycologia 85, 4: 707. 1993.

≡ Teratosphaeria suberosa (Crous, F.A. Ferreira, Alfenas & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. BRAZIL, Espírito Santo, Santa Catarina, on leaves of E. dunnii, Aug. 1992, M.J. Wingfield (holotype PREM 51082, culture ex type CPC 515 = CBS 436.92).

Suberoteratosphaeria xenosuberosa Quaedvlieg, Carnegie & Crous, sp. nov. — MycoBank MB807840; Fig. 10

Etymology. Name refers to its similarity to Suberoteratosphaeria suberosa.

Leaf spots similar to those reported for T. suberosa, corky, and erumpent. Description on PDA (homothallic). Ascomata black, erumpent, punctiform, globose, up to 150 μm diam; apical ostiole 10–15 μm diam; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved, 50–75 × 10–12 μm. Ascospores bi- to triseriate, hyaline, ellipsoidal with rounded ends, medianly 1-septate, constricted at the septum, straight to slightly curved, guttulate, thick-walled, widest in middle of apical cell, (10–)11–13(–15) × (4–)4.5(–5) μm. Ascospores brown and verruculose at germination.

Culture characteristics — Colonies spreading, erumpent, with sparse aerial mycelium and feathery margins, reaching 15 mm diam after 2 mo on PDA; surface olivaceous-grey, reverse iron-grey.

Specimen examined. AUSTRALIA, Queensland, Coolabunia Plantation, Kingaroy, on E. mollucana, 14 Feb. 2004, A.J. Carnegie (holotype CBS H-21138, culture ex-type CPC 13093 = CBS 134747 = NSWF 005175).

Notes — Teratosphaeria xenosuberosa was originally identified as T. suberosa based on the similar corky leaf spots it induces on E. mollucana. Although the specimen was lost, the fungus can be described morphologically, as it is homothallic and sporulates in culture. Teratosphaeria xenosuberosa is distinguished from T. suberosa (ascospores 10–)12–16(–17) × (3–)3.5–5(–6) μm (Crous et al. 1993) by a mean ascospore length that is shorter than found in T. suberosa.

Teratosphaeria molleriana (Thüm.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007

Basionym. Sphaerella molleriana Thüm., Revista Inst. Sci. Lit. Coimbra 28: 31. 1881.

Mycosphaerella molleriana (Thüm) Lindau, Nat. Pfanzenfam. 1: 424. 1897.

= Colletogloeopsis molleriana Crous & M.J. Wingf., Canad. J. Bot. 75: 670. 1997.

Readeriella molleriana (Crous & M.J. Wingf.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

= Mycosphaerella vespa Carnegie & Keane, Mycol. Res. 102: 1275. 1998.

= Mycosphaerella ambiphylla A. Maxwell, Mycol. Res. 107: 354. 2003.

= Teratosphaeria xenocryptica Crous & M.J. Wingf., Persoonia 23: 139. 2009.

Specimens examined. AUSTRALIA, Tasmania, on leaves of E. globulus, BOT 2823 = CBS 117924 (identified as M. vespa); Western Australia, Manjimup, Boorara plantation of WACAP, E116°10' S34°45', on E. globulus, 16 Feb. 2000, A. Maxwell (holotype of M. ambiphylla, PERTH 05849608, culture ex-type CBS 110499). – CHILE, on leaves of Eucalyptus sp., 1994, M.J. Wingfield (holotype of T. xenocryptica deposited at PREM, culture ex-type CPC 355 = CBS 122905). – PORTUGAL, Lisbon, N40°00'39" W8°'2.3", 77 m, on leaves of Eucalyptus sp., 13 Oct. 2006, P.W. Crous & A.J.L. Phillips (epitype of T. molleriana, CBS H-19826, cultures ex-epitype CPC 13398 = CBS 120746, CPC 13399–13400).

Notes — Hunter et al. (2006) reduced M. vespa and M. ambiphylla to synonymy under M. molleriana (= Teratosphaeria). Based on the multigene data generated here, T. xenocryptica (Wingfield et al. 1995, Crous et al. 2009b) also falls within the variation observed in T. molleriana.

Teratosphaericola Quaedvlieg & Crous, gen. nov. — MycoBank MB807841

Type species. Teratosphaericola pseudoafricana (Crous & T.A. Cout.) Quaedvlieg & Crous.

Etymology. Named after its similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata pseudothecial, solitary, black, immersed becoming erumpent, globose; ostiole apical, central; wall of 2–3 cell layers of medium brown textura angularis. Asci aparaphysate, fasciculate, bitunicate, subsessile, narrowly ellipsoid to subcylindrical, slightly incurved, 8-spored. Ascospores tri- to multiseriate, overlapping, hyaline to pale brown, guttulate, thin-walled, straight to slightly curved, smooth to finely roughened, fusoid-ellipsoidal with subobtuse ends, medianly 1-septate. Spermatogonia similar to the ascomata in morphology. Spermatia hyaline, smooth, rod-shaped with rounded ends.

Notes — Teratosphaericola is similar to Teratosphaeria in morphology, and can only be distinguished based on DNA phylogeny. Ascospores become darkened and verruculose at germination, but this is also known for several species of Teratosphaeria. Either ITS or LSU sequence data differentiate these genera.

Teratosphaericola pseudoafricana (Crous & T.A. Cout.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807842

Basionym. Mycosphaerella pseudoafricana Crous & T.A. Cout. (as pseudafricana), Stud. Mycol. 55: 115. 2006.

≡ Teratosphaeria pseudoafricana (Crous & T.A. Cout.) Crous & U. Braun, Stud. Mycol. 58: 11. 2007.

Specimen examined. ZAMBIA, on leaves of E. globulus, Aug. 1995, T. Coutinho (holotype PREM 54973, culture ex-type CPC 1229, 1231, 1230 = CBS 114782).

Teratosphaeriopsis Quaedvlieg & Crous, gen. nov. — MycoBank MB807843

Type species. Teratosphaeriopsis pseudoafricana Quaedvlieg & Crous.

Etymology. Named after its morphological similarity to the genus Teratosphaeria.

Foliicolous, plant pathogenic. Ascomata black, erumpent, globose, solitary or in clusters of up to three, with papillate apex and central ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved. Ascospores tri- to multiseriate, hyaline, obovoid with rounded ends, medianly 1-septate, slightly constricted at the septum, straight to slightly curved, guttulate, thin-walled, widest in middle of apical cell; ascospores brown and verruculose at germination.

Notes — Teratosphaeriopsis is best distinguished from Teratosphaeria based on phylogenetic data, as several species in Teratosphaeria are morphologically similar.

Teratosphaeriopsis pseudoafricana Quaedvlieg & Crous, sp. nov. — MycoBank MB807844; Fig. 11

Etymology. Name refers to its morphological similarity to M. africana.

Description on OA (homothallic). Ascomata black, erumpent, globose, solitary or in clusters of up to three, up to 120 μm diam, with papillate apex and central ostiole; wall consisting of 2–3 layers of medium brown textura angularis. Asci obovoid to broadly ellipsoid, aparaphysate, fasciculate, subsessile, bitunicate, 8-spored, straight to slightly incurved; apical chamber 1.5–2 μm diam, 25–50 × 8–10 μm. Ascospores tri- to multiseriate, hyaline, obovoid with rounded ends, medianly 1-septate, slightly constricted at the septum, straight to slightly curved, guttulate, thin-walled, widest in middle of apical cell, (8–)9(–10) × (3–)3.5(–4) μm. Ascospores brown and verruculose at germination.

Culture characteristics — Colonies on OA iron-grey, spreading with moderate aerial mycelium in centre. On MEA and PDA erumpent, spreading, with folded surface, and moderate aerial mycelium, and even, lobed margin; centre olivaceous-grey, outer region iron-grey, reverse iron-grey; reaching 40 mm diam after 1 mo.

Specimen examined. SOUTH AFRICA, KwaZulu-Natal, on leaves of Eucalyptus sp., 23 Nov. 1995, P.W. Crous (holotype CBS H-21137, culture ex-type CBS 111171 = CPC 1261).

Notes — Teratosphaeriopsis pseudoafricana was originally identified as Amycosphaerella africana (= Mycosphaerella africana) based on morphology. Phylogenetically it is distinct from the taxa presently known to occur on eucalypts. Although the specimen has been lost, the fungus can still be described morphologically, as it is homothallic and sporulates in culture. Ascospores of T. pseudoafricana are obovoid, and shorter and wider than those of Amycosphaerella africana, which are fusoid-ellipsoidal, (7–)8–10(–11) × (2–)2.5–3 μm (Crous & Wingfield 1996).

Xenopenidiella Quaedvlieg & Crous, gen. nov. — MycoBank MB807845

Type species. Xenopenidiella rigidophora (Crous, R.F. Castañeda & U. Braun) Quaedvlieg & Crous.

Etymology. Named after the genus Penidiella, but distinct in having dimorphic conidiophores.

Hyphomycetous, saprobic on leaf litter. Mycelium consisting of strongly branched, septate, smooth, pale olivaceous to medium brown, guttulate, hyphae. Conidiophores dimorphic. Macronematous conidiophores separate, erect, subcylindrical, predominantly straight to slightly curved, terminally loosely branched; base neither lobed nor swollen, lacking rhizoids, septate, medium to dark brown. Micronematous conidiophores erect, subcylindrical, septate, pale to medium brown (concolorous with hyphae). Conidiogenous cells predominantly terminal, rarely intercalary, medium brown, smooth, subcylindrical, but frequently swollen at apex, loci flat-tipped, sub-denticulate or not, barely to slightly thickened and darkened-refractive. Conidia in branched chains, medium brown, verruculose, ellipsoid to cylindrical-oblong, turning dark with age; hila sometimes slightly thickened and darkened, not refractive.

Notes — Xenopenidiella is superficially similar to Penidiella, but distinct in that conidiophores are dimorphic, not truly penicillate (rather loosely branched at apex), and conidiogenous cells often appear subdenticulate.

Xenopenidiella rigidophora(Crous, R.F. Castañeda & U. Braun) Quaedvlieg & Crous, comb. nov. — MycoBank MB807846

Basionym. Penidiella rigidophora Crous, R.F. Castañeda & U. Braun, Stud. Mycol. 58: 21. 2007.

Specimen examined. CUBA, isolated from leaf litter of Smilax sp. (Smilacaceae), 6 Nov. 1994, R.F. Castañeda (holotype CBS H-19938, culture ex-type CBS 314.95).

XenoteratosphaeriaQuaedvlieg & Crous, gen. nov. — MycoBank MB807847

Type species. Xenoteratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Quaedvlieg & Crous.

Etymology. Resembling the genus Teratosphaeria, but with distinct culture characteristics.

Foliicolous, plant pathogenic. Ascomata immersed, substomatal, black, singular, gregarious, immersed, becoming erumpent through the stomatal pore, pyriform or globose with a papillate periphysate ostiole. Asci obclavate, straight, subsessile or with a small pedicel, narrowing slightly to a rounded apex with a distinctive ocular chamber, 8-spored, bitunicate with fissitunicate dehiscence. Ascospores bi- to multiseriate, fusiform, tapering gradually to the rounded ends, widest in the middle of the upper cell, with the lower cell slightly narrower and longer, straight, hyaline, becoming pale brown with age, medianly septate.

Notes — Xenoteratosphaeria is morphologically similar to Teratosphaeria (also with ascospores becoming brown and verruculose in asci), but distinct in that in culture hyphae terminate in brown, multicellular chlamydospore-like structures, not observed in Teratosphaeria s.str. (see Crous et al. 2000, f. 18, 19, 25).

Xenoteratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Quaedvlieg & Crous, comb. nov. — MycoBank MB807848

Basionym. Mycosphaerella jonkershoekensis P.S. van Wyk, Marasas & Knox-Dav., S. African J. Bot. 41: 234. 1975.

≡ Teratosphaeria jonkershoekensis (P.S. van Wyk, Marasas & Knox-Dav.) Crous & U. Braun, Stud. Mycol. 58: 10. 2007.

Specimen examined. SOUTH AFRICA, Western Cape Province, Jonkershoek, S33°59'4.2" E18°57'16.1", on living leaves of Protea sp., 1 Apr. 2007, P.W. Crous & L. Mostert (epitype CBS H-20095, culture ex-epitype CBS 122897 = CPC 13984).

DISCUSSION

The genus Mycosphaerella s.l. is one of the largest genera of ascomycetes with thousands of species (Crous 2009). However, the Mycosphaerella morphology evolved in many lineages independently, and the separation of the Teratosphaeriaceae from the Mycosphaerellaceae (Crous et al. 2007a) was an important step towards delimitation of taxa within the Mycosphaerella complex.

Mycosphaerella Leaf Disease

Mycosphaerella Leaf Disease is a serious impediment for the cultivation of eucalypts worldwide (Crous et al. 2009d, Hunter et al. 2011). Throughout the years numerous species of Mycosphaerellaceae and Teratosphaeriaceae have been described from eucalypt leaves, several of which have been associated with MLD and TLD. The present study provides a multigene DNA comparison of more than 146 taxa isolated from eucalypt leaves, and is the most comprehensive multigene DNA phylogeny generated to date for these fungi, following a previous study by Hunter et al. (2006). Numerous species examined here were originally described without isolation or preservation of ex-type strains, and consequently had to be recollected to enable DNA comparisons. Even though partial gene sequences of the ITS and LSU loci have been obtained for many of these fungi in recent years comprehensive multigene phylogenetic comparisons have mostly been lacking.

Lineages within the Teratosphaeriaceae

Schoch et al. (2006) placed the Piedraiaceae in the Dothideomycetes, and Crous et al. (2009b) showed it clustered within the Teratosphaeriaceae. Ruibal et al. (2011) discussed this placement in depth and suggested that it was possibly due to long branch attraction and poor taxon sampling (these long branches are clearly visible in Fig. 3 derived from our LSU/RPB2 dataset). Although we have been unable to resolve the placement of the Piedraiaceae in the present study, we still regard it as a separate family based on its unique morphology and ecology. Furthermore, the Piedraiaceae clade was the only unstable clade in this dataset; e.g. it clustered as sister to different clades within the Teratosphaeriaceae depending on the addition/deletion of additional families to the dataset (results not shown) and was the only Teratosphaeriaceae-associated clade which actually clustered outside of the Teratosphaeriaceae while running preliminary Neighbour joining trees on our LSU/RPB2 dataset (results not shown). We await further insights on the correct placement of the Piedraiaceae, which appears to be sensitive to sampling and different algorithms used for phylogenetic reconstruction.

Not all extremophiles could previously be accommodated in the Teratosphaeriaceae as some isolates clustered in closely related, but undescribed, separate families. Ruibal et al. (2009) resorted to referring to these rock-inhabiting isolates as being members of Teratosphaeriaceae (‘clade 2’). Although the introduction of the Neodevriesiaceae and Extremaceae (Fig. 5) within the present study provide families for many of these extremophilic genera, the resulting Teratosphaeriaceae LSU/RPB2 tree (Fig. 3) is still not fully resolved. Overall, these results underline the fact that the Teratosphaeriaceae (Fig. 3) is still too broadly defined. A more robust dataset is needed to address this issue, within the wider context of what is now seen as the Capnodiales.

With the narrow circumscriptions of Ramularia (= Mycosphaerella) and Teratosphaeria (= Kirramyces), 23 novel genera have to be introduced to accommodate other monophyletic lineages in this complex. Although the present study presents a sound road map for future work on the Teratosphaeriaceae, it also illustrates that we are approaching the limits of purely morphology-based classification for species and genera within the Mycosphaerellaceae and Teratosphaeriaceae. Several genera that are readily identifiable based even on a single locus, are virtually impossible to distinguish by morphological means (e.g. Parateratosphaeria and Teratosphaeria) and this will pose problems for forest pathologists wanting to identify these taxa in the field.

Best genes to distinguish species in Mycosphaerellaceae and Teratosphaeriaceae

From the DNA sequence data we conclude that any of the five coding loci tested in this study (Btub, Act, RPB2, EF-1α and Cal) will reliably identify most of the species studied. The only exception was species of Pseudocercospora, which were difficult to identify based on a single locus, although this had already been demonstrated (Crous et al. 2013). The Act, Cal and Btub genes were incongruent with the other loci in the two five-locus datasets. However, this does not exclude these genes as barcoding loci for species identification within the MLD and TLD complexes, as these loci resolve the terminal clades in their derived trees, if not their higher order clustering. These ‘aberrant’ loci should not be combined with other loci within these two datasets, if the intention is to draw taxonomic conclusions about the relationships of these species to one another. This incongruency can be caused by several factors, including differing rates of evolution, and different selection pressures.

As none of the coding gene loci had a 100 % amplification success rate, none of these loci alone are ideal for species identification in a generic protocol. The two loci that did have a 100 % success rate (LSU and ITS) lack species resolution power for a large number of species, and are thus not independently reliable as an identification tool. The Btub and EF-1α loci have the highest Kimura-2-parameter distances, with RPB2 in the third place (i.e. they show the highest natural variation between species) for the species used in this dataset, but these loci have the disadvantage that they only have amplification success rates of 97, 98 and 95 %, respectively (Table 3).

To compensate for both this lack of amplification success and the limited amount of available reference data for these protein coding loci in public databases, we recommend a combination of a primary and a secondary locus to provide a more reliable identification result. The ITS locus is a prime candidate as the primary locus as the ITS locus has recently been proposed as the primary fungal barcoding locus (Schoch et al. 2012), and ITS sequence data are easily obtained and are a good starting point to rapidly identify genera and often species. If an unknown genus or species is not represented in a curated database such as Q-bank (www.q-bank.eu), then GenBank should be used to supplement the data. As a secondary identification locus, either Btub, EF-1α or even RPB2, suffice for many species of Mycosphaerellaceae or Teratosphaeriaceae. We recommend EF-1α, followed by Btub and then RPB2, as the most effective way of identifying many species within these genera. As with all molecular-based identification approaches, care needs to be taken with the interpretation of results arising from such analyses, as many mistakes occur in uncurated public nucleotide databases such as GenBank.

Species concepts within the fungal kingdom

Ever since Darwin (1859) published his species concept in ‘On the Origin of Species’, scientists have been struggling with how to define and recognise species, i.e., when has a lineage diverged far enough to be considered a species. Numerous authors have since considered a multitude of taxonomic characters as essential elements to define novel species. Authors com-monly disagree about species numbers and species boundaries. Species delimitation and conceptualisation has become increasingly confused by disagreements about species concepts (de Queiroz 2007, Costello et al. 2013).

Some of the more ambiguous phylogenetic conclusions in the present study demonstrate the problems experienced when defining species. For example, Fig. 1, clade C reveals that the four tested T. gauchensis isolates (Cortinas et al. 2006) have extensive natural variation within the seven loci tested, which causes them to overlap with two other, morphologically distinct species, T. stellenboschiana and T. foliensis. Does this mean that these eight Teratosphaeria isolates belong to one, two or more different taxa?

Traditionally, five previously described species concepts have been used in mycology to distinguish taxa. The Biological Species Concept (BSC) emphasizes reproductive isolation (Wright 1940, Mayr 1942), the Morphological Species Concept (MSC) emphasizes morphological divergence, the Ecological Species Concept (ESC) emphasizes adaptation to a particular ecological niche (van Valen 1976), the Phylogenetic Species Concept (PSC) emphasizes nucleotide (non) divergence (Hennig 1966) and the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) (an adaptation of the PSC) uses the phylogenetic concordance of unlinked genes to indicate a lack of genetic exchange and thus, evolutionary independence of lineages (O’Donnell et al. 1998, Taylor et al. 2000, Dettman et al. 2003a, 2003b, de Queiroz 2007).

During the last decade a sixth, polyphasic approach to species recognition has evolved within the mycological community. This polyphasic method grades the MSC, ESC and PSC characteristics with a variable weight in order to reach a conclusion on the proposition that a taxon represents a separate species. Conclusions based on the molecular similarity between different taxa in a robust multi-locus DNA dataset (PSC) are generally unbiased and warrant a high weight in any CSC analysis conclusion. Differences in morphology (MSC) and ecology (ESC) are given less weight in reaching a CSC conclusion. This approach has become generally accepted during the last decade as a functional species concept within the mycological community, without ever officially having been described as such (Frisvad & Samson 2004, Crous & Groenewald 2005, Samson et al. 2006, Leslie & Summerell 2006, Cai et al. 2009, Groenewald et al. 2013). To remedy this, we propose to formally name this widely used, polyphasic method for identifying species within the fungal kingdom, as the Consolidated Species Concept (CSC) (derived from a discussion with Keith Seifert about how to describe the polyphasic identification approach at the ‘One Fungus = Which Name’ symposium, held in Amsterdam in April 2012).

Even with the use of these six species concepts, successfully distinguishing between two or more closely related taxa can still be daunting and open to debate. The generated phylogenetic trees (Fig. 1, 2, 3, 4) show several of these closely related isolates (clades A–K) that have previously been identified as belonging to different taxa. These clades will therefore be discussed in more detail under the listed species concepts.

As we did not perform mating compatibility tests on this dataset, we have no data regarding the BSC concept for most of these isolates. However, we can discuss the implications of the five remaining species concepts (MSC, ESC, PSC, GCPSR and CSC) on this dataset.

Different conclusions can be drawn about speciation, when applying these five species concepts individually to clade C (Fig. 1). Clade C contains seven isolates that were previously identified as either one of two closely related Teratosphaeria species (T. gauchensis or T. stellenboschiana). Each one of these two species has a distinct morphology (Crous et al. 2004b, 2009a, Andjic et al. 2010), was isolated from a different host (E. grandis and E. punctata) and collected from different continents (Africa and South America). So, according to both the MSC and the ESC concepts, there is very good support for the proposition that they should be regarded as separate species. However, the PSC concept is inconclusive in this case as the four T. gauchensis isolates show a wide genetic drift while the T. stellenboschiana isolates are relatively conserved.

When applying the GCPSR concept to this dataset, the taxa within this dataset are tested for genetic exchange to indicate their evolutionary independence (a pairwise homoplasy index (PHI or Φ_w) score below 0.05 is considered proof for the presence of significant recombination within the dataset). The GCPSR test revealed that there was no significant genetic recombination within this dataset (Φ_w = 0.1) (Fig. 6c). There are still common (but not significant) recombination events present within this dataset, as is apparent by the relative low Φ_w and the conflicting phylogenetic splits (another indicator of recombination) observed in the split tree decomposition network for the T. gauchensis and T. stellenboschiana isolates (Fig. 6c). According to the GCPSR species concept, there is no support for the proposition that these isolates belong to the same species, as there was no significant recombination between T. gauchensis and T. stellenboschiana.

When applying the CSC concept to clade C, we can take into account that the phylogenetic data regarding T. stellenboschiana and T. gauchensis is ambiguous as the variation within the T. gauchensis isolates more or less overlaps with the T. stellenboschiana isolates, but the ecological and morphological criteria support the proposition that these isolates belong to two distinct taxa. So when combining the MSC, ESC and PSC characteristics into a CSC conclusion on speciation, we can conclude that there is good support for the proposition that these isolates actually belong to two distinct taxa.

We can now also apply the CSC concept to the rest of the clades, marked A to K, in Fig. 1 and 2.

Clade A

contains 12 isolates previously identified as either belonging to closely related Teratosphaeria nubilosa or T. pseudonubilosa (including the ex-type of T. nubilosa, CBS 116005) and were isolated from either Eucalyptus globulus or Eucalyptus sp. hosts from the same continent (Australia). These two species show very little morphological variation and cannot be separated by morphological characteristics. Differentiation of these species is based on SNPS in 29, seperatly anaysed gene regions, and on four nucleotide characters in the ITS and six nucleotides in the Btub loci (Pérez et al. 2013). These two species are phylogenetically distinct over the five test loci (Fig. 1) (which also includes the ITS and Btub loci). When applying the GCPSR concept to these 12 isolates, we detect no significant recombination events shared between these isolates (Φ_w = 0.07) (Fig. 6a). This lack of significant recombination does not mean that there are no shared recombination events. As the Φ_w value approximates 0.05, this indicates that there are some shared insignificant recombination events between these isolates. This example also shows the limitations of the GCPSR concept, which looks for significant recombination events in a black and white way, ignoring borderline cases. When applying the CSC concept to clade A, we conclude that there is reasonable support for the proposition that these isolates belong to different taxa even as the morphological and ecological criteria are inconclusive as we have a clear phylogenetic separation between these two Teratosphaeria taxa.

Clade B

contains three isolates that were previously classified as either closely related to T. destructans (ex-type CBS 111370) or T. viscidus (ex-type CBS 124992), which were isolated from either Eucalyptus grandis or E. nitens, from two different continents (Indonesia and Australia). These two species can be separated by morphological characteristics (Andjic et al. 2007). Both species are phylogenetically (Fig. 1) distinct over the five test loci and when applying the GCPSR concept to these isolates, we did not detect significant recombination between the isolates (Φ_w = 1) (Fig. 6b). Because the Φ_w test requires a minimum of four isolates, an isolate of T. eucalypti was added to this dataset. When applying the CSC concept to clade B, we can take into account that the MSC, ESC and PSC characteristics all support the two species proposition so we conclude that there is full support for the proposition that T. destructans and T. viscidus represent two different taxa.

Clade D

contains two isolates that were previously identified as either belonging to the closely related T. pluritubularis and T. profusa (including the respective ex-type isolates CBS 118508 and CBS 125007; Crous et al. 2006), which were isolated from either E. globulus or E. nitens from different continents (Spain and Australia). Both species have distinct morphological variation and can be separated based on morphological characteristics (Crous et al. 2009b). These two species are phylogenetically (Fig. 1D) very closely related but distinct over the five test loci. However, when applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φ_w = < 0.001) (Fig. 6d). To obtain a minimum of four isolates, isolates of T. complicata and T. caesia were added to this dataset. Multiple combinations of closely related Teratosphaeria species were tested, but only the combinations that included both the T. pluritubularis and T. profusa isolates showed significant recombination in their Φ_w (results not shown). When applying the CSC concept to clade D, the MSC, ESC and PSC characteristics all support the two species proposition so we conclude that there is full support for the proposition that T. pluritubularis and T. profusa represent two different taxa. These results conflict, as we have two morphologically and ecologically distinct taxa that have very strong and recent family ties (as shown by the GCPSR test results). It is possible that these two species recently underwent speciation and that the loci selected for molecular comparison have not evolved sufficiently individually to provide higher phylogenetic support.

Clade E

contains eight isolates that were previously identified as Austroafricana parva (= T. parva) based on limited morphology and ITS sequence data. Strains were isolated from both Eucalyptus and Protea hosts located on three different continents (Australia, Egypt, Portugal, South Africa). Although these isolates are morphologically very similar and have a high degree of conservation in their ITS sequences, they are phylogenetically very distinct over the five test loci and even form four to five subclades (indicating that this might actually be a species complex). When applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φ_w = < 0.001) (Fig. 6e). Multiple combinations of these eight isolates were tested and significant recombination was detected within two separate groups. Group one consists of CBS 119901, 116289, 122892 and CPC 12249, while group two consists of CBS 122893 and 114761 (results not shown). These results correspond to the phylogenetic tree (Fig. 1E) in which the isolates within these two groups are closely related. When applying the CSC concept to clade E, we see only limited (MSC) support for the single species proposition and much stronger (ESC and PSC) support for the proposition that these isolates actually represent four to five different taxa. But more detailed morphological future work is needed to confirm this proposition.

Clade F

contains six isolates that had previously been identified as Austroafricana associata (= A. associata) based on limited morphological characters and ITS sequence data. These isolates were isolated from different Eucalyptus and Corymbia hosts in Australia and they are phylogenetically highly distinct over the five test loci, and even form five to six subclades (indicating that this might actually be a species complex). When applying the GCPSR concept to these isolates, we detect significant recombination between these isolates (Φ_w = < 0.001) (Fig. 6f). Multiple combinations of these six isolates were tested and this significant recombination was limited between two isolates (CBS 112224 and CPC 13113) (results not shown). When applying the CSC concept to clade F, we see only limited (MSC) support for the single species proposition and much stronger (ESC and PSC) support for the proposition that these isolates actually represent five or six different taxa. But more detailed morphological future work is needed to confirm this proposition.

Clade G

contains two isolates that had previously been identified as Pseudoteratosphaeria parkiiaffinis (ex-type CBS 120737) or Pet. stramenticola (ex-type CBS 118506). Both strains were isolated from Eucalyptus hosts (E. urophylla and Eucalyptus sp.) from South America (Venezuela and Brazil). Both species are morphologically similar to one another (Crous et al. 2006, 2007c), and are phylogenetically indistinguishable over the five test loci (Fig. 1). When applying the GCPSR concept to these isolates, we detect significant recombination between these two isolates (Φ_w = 0.03) (Fig. 6g). Because the Φ_w test requires a minimum of four isolates, isolates of Pet. perpendicularis and Pet. gamsii were added to this dataset. Multiple combinations of closely related Pseudoteratosphaeria species were tested, but only the combinations that included both the Pet. parkiiaffinis and Pet. stramenticola isolates showed significant recombination in their Φ_w (results not shown). When applying the CSC concept to clade G, we get full support for the proposition that these isolates actually belong to the same taxon. The CSC data suggests that these two isolates actually belong to the same taxon and this could be confirmed with more detailed morphological work and these species are subsequently synonymised.

Clade H

contains six isolates that were previously identified as either belonging to closely related Pallidocercospora thailandica (ex-type CBS 120723) or P. colombiensis (ex-type CBS 110967). All P. colombiensis isolates where isolated from E. urophylla in Colombia while the P. thailandica isolates had a mixed host range from Acacia and Musa to E. camaldulensis in Thailand, Brazil and Cameroon. Both species are morphologically distinct (Crous et al. 2004c) but are phylogenetically difficult to distinguish over the five tested loci (Fig. 2H). When applying the GCPSR concept to these isolates, we detect no significant recombination among these isolates (Φ_w = 1.0) (Fig. 6h). When applying the CSC concept to clade H, we see no support for the single species proposition and stronger (ESC and MSC) support for the proposition that these isolates indeed represent two different taxa.

Clade I

contains three isolates previously identified as either closely related (Crous et al. 2013) Pseudocercospora fori (ex-type CBS 113285) or Ps. natalensis (ex-type CBS 111069). Both taxa were described from Eucalyptus species (E. grandis and E. nitens) collected in South Africa. Morphologically, they are distinguishable based on the number of conidial septa (Crous 1998, Hunter et al. 2004) but phylogenetically they are difficult to distinguish over the five tested loci (Fig. 2i). Application of the GCPSR concept, showed no significant recombination (Φ_w = 0.11) (Fig. 6i). Because the Φ_w test requires a minimum of four isolates, an isolate of Ps. subulata was added to this dataset. When applying the GCPSR concept to clade I, we see no support for the single species proposition and good support (ESC, PSC and MSC) for the proposition that these isolates indeed represent two different taxa.

Clade J

contains 24 isolates that were previously identified as either belonging to Pseudocercospora gracilis (ex-type CBS 111189) or Ps. eucalyptorum (ex-type CBS 114866). Both species were described from several Eucalyptus hosts. While Ps. eucalyptorum occurs in Europe, Africa and Australia, Ps. gracilis is only known from South-East Asia. The two species are morphologically distinct based on differences in their conidial morphology (Crous et al. 1989, Crous & Alfenas 1995) and also phylogenetically distinguishable over the five tested loci (Fig. 2J). When applying the GCPSR concept to these isolates, we detect no significant recombination between these isolates (Φ_w = 0.8) (Fig. 6j). When applying the CSC concept to clade J, we see full (MSC, ESC and PSC) support for the two species, so we conclude that there is full support for the proposition that P. eucalyptorum and P. gracilis represent two different taxa.

Clade K

contains 12 isolates previously identified as Zasmidium citri based on limited morphology and ITS sequence data. These isolates where isolated from a mixed host range (Acacia, Musa, Citrus and Eucalyptus) from both South-East Asia and North America. These isolates are phylogenetically distinct over the five test loci and even form five to six subclades (indicating that this is actually a species complex) (Fig 2K). When applying the GCPSR concept to these 12 isolates, we detect significant recombination between these isolates (Φ_w = < 0.001) (Fig. 6k). However, Φ_w testing of multiple isolate combinations within the 12 species dataset showed that the significant recombination in the pairwise homoplasy index were limited to four isolates most likely comprising two separate species (CPC 15289 / CPC 15296 and CPC 10522 / CBS 116366) (data not shown). When applying the CSC concept to clade K, we only see low (MSC) support for the proposition that these isolates actually belong to the same taxon, and much higher (PSC and ESC) support for the proposition that these isolates actually belong to the different taxa, but more detailed morphological work is needed to confirm this proposition.

In the present study we introduced the Consolidated Species Concept to distinguish species of Teratosphaeriaceae identified via a polyphasic approach, combining morphological, ecological and phylogenetic species concepts. We also tried to provide a better phylogenetic backbone for the Teratosphaeriaceae, which contains numerous plant and human pathogens, but also saprobes, endophytes, and rock-inhabiting fungi. Although we were able to introduce the Extremaceae and Neodevriesiaceae to accommodate a group of extremophilic fungi that occur on a range of diverse substrates, we were unable to resolve the phylogenetic position of the Piedraiaceae in relation to the Teratosphaeriaceae. At a generic level, Mycosphaerella and Teratosphaeria are now well defined, with an additional 23 genera being introduced for distinct phylogenetic lineages. Many lineages remain yet unresolved and are treated as either Teratosphaeria sp. or Teratosphaeriaceae, awaiting further collections to hopefully add additional morphological characters to these unnamed generic clades, many which remain poorly understood, and greatly undersampled.

Acknowledgments

We thank the technical staff, Arien van Iperen (cul-tures) and Marjan Vermaas (photographic plates) for their invaluable assistance. Numerous forest pathologists and mycologists have made material available to us for examination, without which this study would not have been possible.

REFERENCES

Andjic V, Barber PA, Carnegie AJ, Pegg GS, Hardy GE, et al. 2007. Kirramyces viscida sp. nov, a new eucalypt pathogen from tropical Australia closely related to the serious leaf pathogen, Kirramyces destructans. Australasian Plant Pathology 36: 478–487. [Google Scholar]
Andjic V, Whyte G, Hardy G, Burgess T. 2010. New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27–38. [Google Scholar]
Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. 2008. Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphs on banana. Persoonia 20: 19–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
Barnes I, Crous PW, Wingfield BD, Wingfield MJ. 2004. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551–565. [Google Scholar]
Batzer JC, Arias MMD, Harrington TC, Gleason ML, Groenewald JZ, Crous PW. 2008. Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple. Mycologia 100: 246–258. [DOI] [PubMed] [Google Scholar]
Bensch K, Braun U, Groenewald JZ, Crous PW. 2012. The genus Cladosporium. Studies in Mycology 72: 1–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, et al. 2010. Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Studies in Mycology 67: 1–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
Boland DJ, Brooker IH, Chippendale GM, McDonald MW. 2006. Forest trees of Australia: CSIRO Publishing. [Google Scholar]
Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de . 2003. Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s.str. Mycological Progress 2: 3–18. [Google Scholar]
Burgess TI, Barber PA, Sufaati S, Xu D, Hardy GES, Dell B. 2007. Mycosphaerella spp. on Eucalyptus in Asia: new species, new hosts and new records. Fungal Diversity 24: 135–157. [Google Scholar]
Butin H, Pehl L, Hoog GS de, Wollenzien U. 1996. Trimmatostroma abietis sp. nov. (hyphomycetes) and related species. Antonie Van Leeuwenhoek 69: 203–209. [DOI] [PubMed] [Google Scholar]
Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller JM, et al. 2009. A polyphasic approach for studying Colletotrichum. Fungal Diversity 39: 183–204. [Google Scholar]
Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553–556. [Google Scholar]
Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C. 2008. Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 21: 77–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cortinas MN, Barnes I, Wingfield MJ, Wingfield BD, 2010. Genetic diversity in the Eucalyptus stem pathogen Teratosphaeria zuluensis. Australasian Plant Pathology 39: 383–393. [Google Scholar]
Cortinas MN, Crous PW, Wingfield BD, Wingfield MJ. 2006. Multi-gene phylogenies and phenotypic characters distinguish two species within the Colletogloeopsis zuluensis complex associated with Eucalyptus stem cankers. Studies in Mycology 55: 133–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
Costello MJ, May RM, Stork NE. 2013. Can we name earth’s species before they go extinct? Science 339: 413–416. [DOI] [PubMed] [Google Scholar]
Crous PW. 1998. Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170 APS Press, MN, USA. [Google Scholar]
Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Diversity 38: 1–24. [Google Scholar]
Crous PW, Alfenas AC. 1995. Mycosphaerella gracillis and other species of Mycosphaerella associated with leaf spot of Eucalyptus in Indonesia. Mycologia 87: 121–126. [Google Scholar]
Crous PW, Aptroot A, Kang JC, Braun U, Wingfield MJ. 2000. The genus Mycosphaerella and its anamorphs. Studies in Mycology 45: 107–121. [Google Scholar]
Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. CBS Biodiversity Series No 1. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]
Crous PW, Braun U, Groenewald JZ. 2007a. Mycosphaerella is polyphyletic. Studies in Mycology 58: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, et al. 2013. Phylogenetic lineages in Pseudocercospora. Studies in Mycology 75: 37–114. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Braun U, Schubert K, Groenewald JZ. 2007b. Delimiting Cladosporium from morphologically similar genera. Studies in Mycology 58: 33–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Ferreira FA, Alfenas A, Wingfield MJ. 1993. Mycosphaerella suberosa associated with corky leaf spots on Eucalyptus in Brazil. Mycologia 85: 705–710. [Google Scholar]
Crous PW, Ferreira FA, Sutton BC. 1997. A comparison of the fungal genera Phaeophleospora and Kirramyces (coelomycetes). South African Journal of Botany 63: 111–115. [Google Scholar]
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G. 2004a. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50: 19–22. [Google Scholar]
Crous PW, Groenewald JZ. 2005. Hosts, species and genotypes: opinions versus data. Australasian plant pathology 34: 463–470. [Google Scholar]
Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingfield MJ. 2004b. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 50: 195–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M, Wingfield MJ. 2004c. Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457–469. [Google Scholar]
Crous PW, Groenewald JZ, Summerell BA, Wingfield BD, Wingfield MJ. 2009a. Co-occurring species of Teratosphaeria on Eucalyptus. Persoonia 22: 38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Hong L, Wingfield MJ, Wingfield BD, Kang JC. 1999. Uwebraunia and Dissoconium, two morphologically similar anamorph genera with different teleomorph affinity. Sydowia 51: 155–166. [Google Scholar]
Crous PW, Kang JC, Braun U. 2001. A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93: 1081–1101. [Google Scholar]
Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, Hoog GS de, Groenewald JZ. 2009b. Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald JZ. 2007c. Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia and Eucalyptus. Fungal Diversity 26: 143–185. [Google Scholar]
Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ. 2009c. Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23: 119–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. 2009d. Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Summerell BA, Mostert L, Groenewald JZ. 2008. Host specificity and speciation of Mycosphaerella and Teratosphaeria species associated with deaf spots of Proteaceae. Persoonia 20: 59–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Verkley GJM, Groenewald JZ, Samson RA. (eds). 2009e. Fungal Biodiversity. CBS Laboratory Manual Series 1: 1–269 Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]
Crous PW, Wingfield MJ. 1996. Species of Mycosphaerella and their anamorphs associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia 88: 441–458. [Google Scholar]
Crous PW, Wingfield MJ, Mansilla J, Alfenas AC, Groenewald JZ. 2006. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 55: 99–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
Crous PW, Wingfield MJ, Marasas WFO, Sutton BC. 1989. Pseudocercospora eucalyptorum sp. nov. on Eucalyptus leaves. Mycological Research 93: 394–398. [Google Scholar]
Crous PW, Wingfield MJ, Park RF. 1991Mycosphaerella nubilosa, a synonym of M. molleriana. Mycological Research 95: 628–632. [Google Scholar]
Darwin C. 1859. On the origin of species. London, John Murray. [Google Scholar]
Dettman JR, Jacobson DJ, Taylor JW. 2003a. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution 57: 2703–2720. [DOI] [PubMed] [Google Scholar]
Dettman JR, Jacobson DJ, Turner E, Pringle A, Taylor JW. 2003b. Reproductive isolation and phylogenetic divergence in Neurospora: Comparing methods of species recognition in a model eukaryote. Evolution 57: 2721–2741. [DOI] [PubMed] [Google Scholar]
Dugan FM, Braun U, Groenewald JZ, Crous PW. 2008. Morphological plasticity in Cladosporium sphaerospermum. Persoonia 21: 9–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
Egidi E, Hoog GS de, Isola D, Onofri S, Stielow B, Quaedvlieg W, Zucconi L, Selbmann L. 2014. Phylogeny and taxonomy of meristematic rock-inhabiting black fungi in the Dothidemycetes based on multi-locus phylogenies. Fungal Diversity 65: 127–165. [Google Scholar]
Friedmann EI. 1982. Endolithic microorganisms in the Antarctic cold desert. Science 215: 1045–1053. [DOI] [PubMed] [Google Scholar]
Frisvad JC, Samson RA. 2004. Polyphasic taxonomy of Penicillium subgenus Penicillium – A guide to identification of food and air-borne terverticillate penicillia and their mycotoxins. Studies in Mycology 49: 1–173. [Google Scholar]
Gadgil PD, Dick M. 1983. Fungi Eucalyptorum novazelandiae: Septoria pulcherrima sp. nov. and Trimmatostroma bifarium sp. nov. New Zealand Journal of Botany 21: 49–52. [Google Scholar]
Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences of the United States of America 95: 388–393. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gezahgne A, Roux J, Wingfield MJ. 2003. Diseases of exotic Eucalyptus and Pinus species in Ethiopian plantations. South African Journal of Science 99: 29–33. [Google Scholar]
Goodwin SB, Dunkle LD, Zismann VL. 2001. Phylogenetic analysis of Cercospora and Mycosphaerella based on the internal transcribed spacer region of ribosomal DNA. Phytopathology 91: 648–658. [DOI] [PubMed] [Google Scholar]
Grattapaglia D, Vaillancourt R, Shepherd M, Thumma B, Foley W, et al. 2012. Progress in Myrtaceae genetics and genomics: Eucalyptus as the pivotal genus. Tree Genetics & Genomes 8: 463–508. [Google Scholar]
Groenewald JZ, Nakashima C, Nishikawa J, Shin H-D, Park J-H, et al. 2013. Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
Groenewald M, Groenewald JZ, Crous PW. 2005. Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951–959. [DOI] [PubMed] [Google Scholar]
Hall TA. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
Hebert PDN, Cywinska A, Ball SL, DeWaard JR. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B-Biological Sciences 270: 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hennig W. 1966. Phylogenetic systematics.University of Illinois Press, Urbana, USA. [Google Scholar]
Hoog GS de, Guarro J, Gené J, Figueras MJ. 2000. Atlas of clinical fungi, 2nd ed Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; University Rovira i Virgili, Reus, Spain. [Google Scholar]
Hunter GC, Crous PW, Carnegie AJ, Burgess TI, Wingfield MJ. 2011. Mycosphaerella and Teratosphaeria diseases of Eucalyptus; easily confused and with serious consequences. Fungal Diversity 50: 145–166. [Google Scholar]
Hunter GC, Roux J, Wingfield BD, Crous PW, Wingfield MJ. 2004. Mycosphaerella species causing leaf disease in South African Eucalyptus plantations. Mycological Research 108: 672–681. [DOI] [PubMed] [Google Scholar]
Hunter GC, Wingfield BD, Crous PW, Wingfield MJ. 2006. A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in Mycology 55: 147–161. [DOI] [PMC free article] [PubMed] [Google Scholar]
Huson DH. 1998. SplitsTree: analyzing and visualizing evolutionary data. Bioinformatics 14: 68–73. [DOI] [PubMed] [Google Scholar]
Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254–267. [DOI] [PubMed] [Google Scholar]
Hyde KD, Jones EBG, Lui J-K, Ariyawansa H, Boehm E, et al. 2013. Families of Dothideomycetes. Fungal Diversity 63: 1–313. [Google Scholar]
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kohlmeyer J, Volkmann-Kohlmeyer B, Eriksson OE. 1999. Fungi on Juncus roemerianus 12. Two new species of Mycosphaerella and Paraphaeosphaeria (Ascomycotina). Botanica Marina 42: 505–511. [Google Scholar]
Koufopanou V, Burt A, Taylor JW. 1997. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proceedings of the National Academy of Sciences of the United States of America 94: 5478–5482. [DOI] [PMC free article] [PubMed] [Google Scholar]
Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames, USA. [Google Scholar]
Li HY, Sun GY, Zhai XR, Batzer JC, Mayfield DA, Crous PW, Groenewald JZ, Gleason ML. 2012. Dissoconiaceae associated with sooty blotch and flyspeck on fruits in China and the United States. Persoonia 28: 113–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ. 2008. Microfungi occurring on Proteaceae in the Fynbos. CBS Biodiversity Series 7: 1–166 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. [Google Scholar]
Mason-Gamer RJ, Kellogg EA. 1996. Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 524–545. [Google Scholar]
Maxwell A, Dell B, Neumeister-Kemp HG, Hardy GEStJ. 2003. Mycosphaerella species associated with Eucalyptus in south-western Australia: new species, new records and a key. Mycological Research 107: 351–359. [DOI] [PubMed] [Google Scholar]
Mayr E. 1942. Systematics and the origin of species. Columbia University Press, New York, USA. [Google Scholar]
Müller E, Oehrens E. 1982. On the genus Teratosphaeria (Ascomycetes). Sydowia 35: 38–42. [Google Scholar]
Nosrati S, Esmailzadeh-Hosseini SA, Sarpeleh A. 2010. First report of Penidiella strumelloidea as a pathogen of greenhouse cucumbers in Iran. Phytoparasitica 38: 95–97. [Google Scholar]
Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre Uppsala University; 2: 1–2. [Google Scholar]
O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116. [DOI] [PubMed] [Google Scholar]
O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95: 2044–2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
Old KM, Wingfield MJ, Yuan ZQ. 2003. A manual of diseases of eucalypts in South-East Asia. Centre for International Forestry Research, Jakarta, Indonesia. [Google Scholar]
Park RF, Keane PJ, Wingfield MJ, Crous PW. 2000. Fungal diseases of eucalypt foliage. In: Keane PJ, Kile GA, Podger FD, Brown BN. (eds), Diseases and pathogens of eucalypts: 153–239 CSIRO Publishing, Australia. [Google Scholar]
Pérez G, Burgess T, Slippers B, Carnegie A, Wingfield B, Wingfield M. 2013. Teratosphaeria pseudonubilosa sp. nov., a serious Eucalyptus leaf pathogen in the Teratosphaeria nubilosa species complex. Australasian Plant Pathology 43: 67–77. [Google Scholar]
Philippe H, Bryant D. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665–2681. [DOI] [PMC free article] [PubMed] [Google Scholar]
Plemenitas A, Vaupotic T, Lenassi M, Kogej T, Gunde-Cimerman N. 2008. Adaptation of extremely halotolerant black yeast Hortaea werneckii to increased osmolarity: a molecular perspective at a glance. Studies in Mycology 61: 67–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M de, Crous PW. 2012. DNA barcoding of Mycosphaerella species of quarantine importance to Europe. Persoonia 29: 101–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, et al. 2011. Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26: 57–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
Quaedvlieg W, Verkley GJM, Shin H-D, Barreto RW, Alfenas AC, et al. 2013. Sizing up Septoria. Studies in Mycology 75: 307–390. [DOI] [PMC free article] [PubMed] [Google Scholar]
Queiroz K de. 2007. Species concepts and species delimitation. Systematic Biology 56: 879–886. [DOI] [PubMed] [Google Scholar]
Rayner RW. 1970. A mycological colour chart. Commonwealth Mycological Institute and British Mycological Society, Surrey, UK. [Google Scholar]
Ronquist F, Teslenko M, Mark P van der, Ayres DL, Darling A, et al. 2011. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ruibal C, Gueidan C, Selbmann L, Gorbushina AA, Crous PW, et al. 2009. Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123–133S7. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ruibal C, Millanes AM, Hawksworth DL. 2011. Molecular phylogenetic studies on the lichenicolous Xanthoriicola physciae reveal Antarctic rock-inhabiting fungi and Piedraia species among closest relatives in the Teratosphaeriaceae. IMA Fungus 2: 97–103. [DOI] [PMC free article] [PubMed] [Google Scholar]
Samson RA, Hong S-B, Frisvad JC. 2006. Old and new concepts of species differentiation in Aspergillus. Medical Mycology 44: S133–S148. [DOI] [PubMed] [Google Scholar]
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041–1052. [DOI] [PubMed] [Google Scholar]
Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, et al. 2007. Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics. Studies in Mycology 58: 105–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ. 2004. Devriesia, a new hyphomycete genus to accommodate heat-resistant, cladosporium-like fungi. Canadian Journal of Botany 82: 914–926. [Google Scholar]
Selbmann L, Hoog GS de, Zucconi L, Isola D, Ruisi S, et al. 2008. Drought meets acid: three new genera in a dothidealean clade of extremotolerant fungi. Studies in Mycology 61: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
Selbmann L, Hoog GS de, Mazzaglia A, Friedmann EI, Onofri S. 2005. Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert. Studies in Mycology 51: 1–32. [Google Scholar]
Slippers B, Stenlid J, Wingfield MJ. 2005. Emerging pathogens: fungal host jumps following anthropogenic introduction. Trends in Ecology & Evolution 20: 420–421. [DOI] [PubMed] [Google Scholar]
Smith H, Wingfield MJ, Crous PW, Coutinho TA. 1996. Sphaeropsis sapinea and Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. South African Journal of Botany 62: 86–88. [Google Scholar]
Starkey DE, Ward TJ, Aoki T, Gale LR, Kistler HC, et al. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology 44: 1191–1204. [DOI] [PubMed] [Google Scholar]
Stewart EL, Liu ZW, Crous PW, Szabo LJ. 1999. Phylogenetic relationships among some cercosporoid anamorphs of Mycosphaerella based on rDNA sequence analysis. Mycological Research 103: 1491–1499. [Google Scholar]
Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, McDonald BA. 2012. Zymoseptoria ardabilia and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola). Mycologia 104: 1397–1407. [DOI] [PubMed] [Google Scholar]
Sutton BC, Ganapathi A. 1978. Trimmatostroma excentricum sp. nov. on Eucalyptus from New-Zealand and Fiji. New Zealand Journal of Botany 16: 529–533. [Google Scholar]
Swart L, Crous PW, Denman S, Palm ME. 1998. Fungi occurring on Proteaceae. South African Journal of Botany 64: 137–145. [Google Scholar]
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. [DOI] [PubMed] [Google Scholar]
Taylor JE, Crous PW. 2000. Fungi occurring on Proteaceae: new anamorphs for Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated with leaf spots and cankers of proteaceous hosts. Mycological Research 104: 618–636. [Google Scholar]
Taylor JE, Crous PW. 2001. Morphological variation and cultural characteristics of Coniothyrium leucospermi associated with leaf spots of Proteaceae. Mycoscience 42: 265–271. [Google Scholar]
Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. [DOI] [PubMed] [Google Scholar]
Turnbull JW. 2000. Economic and social importance of eucalypts. CSIRO Publishing, Australia. [Google Scholar]
Valen L van. 1976. Ecological species, multispecies and oaks. Taxon 25: 233–239. [Google Scholar]
Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A. 2004. Mycosphaerella punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the genus Mycosphaerella (Dothideales, Ascomycota). Mycological Research 108: 1271–1282. [DOI] [PubMed] [Google Scholar]
Verkley GJM, Quaedvlieg W, Shin H-D, Crous PW. 2013. A new approach to species delimitation in Septoria. Studies in Mycology 75: 213–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. [DOI] [PMC free article] [PubMed] [Google Scholar]
White TJ, Bruns T, Lee J, Taylor SB. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (eds), PCR protocols: a guide to methods and applications: 315–322 Academic Press, San Diego, California, USA. [Google Scholar]
Wingfield MJ, Crous PW, Coutinho TA. 1996. A serious canker disease of Eucalyptus in South Africa caused by a new species of Coniothyrium. Mycopathologia 136: 139–145. [DOI] [PubMed] [Google Scholar]
Wingfield MJ, Crous PW, Peredo HL. 1995. A preliminary, annotated list of foliar pathogens of Eucalyptus spp. in Chile. South African Forestry Journal 173: 53–57. [Google Scholar]
Wingfield MJ, Roux J, Coutinho T, Govender P, Wingfield BD. 2001. Plantation disease and pest management in the next century. South African Forestry Journal 190: 67–71. [Google Scholar]
Wright S.1940The new systematics.Oxford University Press, London, UK. [Google Scholar]

[R1] Andjic V, Barber PA, Carnegie AJ, Pegg GS, Hardy GE, et al. 2007. Kirramyces viscida sp. nov, a new eucalypt pathogen from tropical Australia closely related to the serious leaf pathogen, Kirramyces destructans. Australasian Plant Pathology 36: 478–487. [Google Scholar]

[R2] Andjic V, Whyte G, Hardy G, Burgess T. 2010. New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27–38. [Google Scholar]

[R3] Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. 2008. Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphs on banana. Persoonia 20: 19–37. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] Barnes I, Crous PW, Wingfield BD, Wingfield MJ. 2004. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551–565. [Google Scholar]

[R5] Batzer JC, Arias MMD, Harrington TC, Gleason ML, Groenewald JZ, Crous PW. 2008. Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple. Mycologia 100: 246–258. [DOI] [PubMed] [Google Scholar]

[R6] Bensch K, Braun U, Groenewald JZ, Crous PW. 2012. The genus Cladosporium. Studies in Mycology 72: 1–401. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, et al. 2010. Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). Studies in Mycology 67: 1–94. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R8] Boland DJ, Brooker IH, Chippendale GM, McDonald MW. 2006. Forest trees of Australia: CSIRO Publishing. [Google Scholar]

[R9] Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de . 2003. Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s.str. Mycological Progress 2: 3–18. [Google Scholar]

[R10] Burgess TI, Barber PA, Sufaati S, Xu D, Hardy GES, Dell B. 2007. Mycosphaerella spp. on Eucalyptus in Asia: new species, new hosts and new records. Fungal Diversity 24: 135–157. [Google Scholar]

[R11] Butin H, Pehl L, Hoog GS de, Wollenzien U. 1996. Trimmatostroma abietis sp. nov. (hyphomycetes) and related species. Antonie Van Leeuwenhoek 69: 203–209. [DOI] [PubMed] [Google Scholar]

[R12] Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller JM, et al. 2009. A polyphasic approach for studying Colletotrichum. Fungal Diversity 39: 183–204. [Google Scholar]

[R13] Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553–556. [Google Scholar]

[R14] Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C. 2008. Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 21: 77–91. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] Cortinas MN, Barnes I, Wingfield MJ, Wingfield BD, 2010. Genetic diversity in the Eucalyptus stem pathogen Teratosphaeria zuluensis. Australasian Plant Pathology 39: 383–393. [Google Scholar]

[R16] Cortinas MN, Crous PW, Wingfield BD, Wingfield MJ. 2006. Multi-gene phylogenies and phenotypic characters distinguish two species within the Colletogloeopsis zuluensis complex associated with Eucalyptus stem cankers. Studies in Mycology 55: 133–146. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] Costello MJ, May RM, Stork NE. 2013. Can we name earth’s species before they go extinct? Science 339: 413–416. [DOI] [PubMed] [Google Scholar]

[R18] Crous PW. 1998. Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170 APS Press, MN, USA. [Google Scholar]

[R19] Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Diversity 38: 1–24. [Google Scholar]

[R20] Crous PW, Alfenas AC. 1995. Mycosphaerella gracillis and other species of Mycosphaerella associated with leaf spot of Eucalyptus in Indonesia. Mycologia 87: 121–126. [Google Scholar]

[R21] Crous PW, Aptroot A, Kang JC, Braun U, Wingfield MJ. 2000. The genus Mycosphaerella and its anamorphs. Studies in Mycology 45: 107–121. [Google Scholar]

[R22] Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. CBS Biodiversity Series No 1. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]

[R23] Crous PW, Braun U, Groenewald JZ. 2007a. Mycosphaerella is polyphyletic. Studies in Mycology 58: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, et al. 2013. Phylogenetic lineages in Pseudocercospora. Studies in Mycology 75: 37–114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] Crous PW, Braun U, Schubert K, Groenewald JZ. 2007b. Delimiting Cladosporium from morphologically similar genera. Studies in Mycology 58: 33–56. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] Crous PW, Ferreira FA, Alfenas A, Wingfield MJ. 1993. Mycosphaerella suberosa associated with corky leaf spots on Eucalyptus in Brazil. Mycologia 85: 705–710. [Google Scholar]

[R27] Crous PW, Ferreira FA, Sutton BC. 1997. A comparison of the fungal genera Phaeophleospora and Kirramyces (coelomycetes). South African Journal of Botany 63: 111–115. [Google Scholar]

[R28] Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G. 2004a. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50: 19–22. [Google Scholar]

[R29] Crous PW, Groenewald JZ. 2005. Hosts, species and genotypes: opinions versus data. Australasian plant pathology 34: 463–470. [Google Scholar]

[R30] Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingfield MJ. 2004b. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 50: 195–214. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R31] Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M, Wingfield MJ. 2004c. Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457–469. [Google Scholar]

[R32] Crous PW, Groenewald JZ, Summerell BA, Wingfield BD, Wingfield MJ. 2009a. Co-occurring species of Teratosphaeria on Eucalyptus. Persoonia 22: 38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] Crous PW, Hong L, Wingfield MJ, Wingfield BD, Kang JC. 1999. Uwebraunia and Dissoconium, two morphologically similar anamorph genera with different teleomorph affinity. Sydowia 51: 155–166. [Google Scholar]

[R34] Crous PW, Kang JC, Braun U. 2001. A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93: 1081–1101. [Google Scholar]

[R35] Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, Hoog GS de, Groenewald JZ. 2009b. Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17–47. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald JZ. 2007c. Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia and Eucalyptus. Fungal Diversity 26: 143–185. [Google Scholar]

[R37] Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ. 2009c. Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23: 119–146. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. 2009d. Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] Crous PW, Summerell BA, Mostert L, Groenewald JZ. 2008. Host specificity and speciation of Mycosphaerella and Teratosphaeria species associated with deaf spots of Proteaceae. Persoonia 20: 59–86. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] Crous PW, Verkley GJM, Groenewald JZ, Samson RA. (eds). 2009e. Fungal Biodiversity. CBS Laboratory Manual Series 1: 1–269 Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. [Google Scholar]

[R41] Crous PW, Wingfield MJ. 1996. Species of Mycosphaerella and their anamorphs associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia 88: 441–458. [Google Scholar]

[R42] Crous PW, Wingfield MJ, Mansilla J, Alfenas AC, Groenewald JZ. 2006. Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 55: 99–131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] Crous PW, Wingfield MJ, Marasas WFO, Sutton BC. 1989. Pseudocercospora eucalyptorum sp. nov. on Eucalyptus leaves. Mycological Research 93: 394–398. [Google Scholar]

[R44] Crous PW, Wingfield MJ, Park RF. 1991Mycosphaerella nubilosa, a synonym of M. molleriana. Mycological Research 95: 628–632. [Google Scholar]

[R45] Darwin C. 1859. On the origin of species. London, John Murray. [Google Scholar]

[R46] Dettman JR, Jacobson DJ, Taylor JW. 2003a. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution 57: 2703–2720. [DOI] [PubMed] [Google Scholar]

[R47] Dettman JR, Jacobson DJ, Turner E, Pringle A, Taylor JW. 2003b. Reproductive isolation and phylogenetic divergence in Neurospora: Comparing methods of species recognition in a model eukaryote. Evolution 57: 2721–2741. [DOI] [PubMed] [Google Scholar]

[R48] Dugan FM, Braun U, Groenewald JZ, Crous PW. 2008. Morphological plasticity in Cladosporium sphaerospermum. Persoonia 21: 9–16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] Egidi E, Hoog GS de, Isola D, Onofri S, Stielow B, Quaedvlieg W, Zucconi L, Selbmann L. 2014. Phylogeny and taxonomy of meristematic rock-inhabiting black fungi in the Dothidemycetes based on multi-locus phylogenies. Fungal Diversity 65: 127–165. [Google Scholar]

[R50] Friedmann EI. 1982. Endolithic microorganisms in the Antarctic cold desert. Science 215: 1045–1053. [DOI] [PubMed] [Google Scholar]

[R51] Frisvad JC, Samson RA. 2004. Polyphasic taxonomy of Penicillium subgenus Penicillium – A guide to identification of food and air-borne terverticillate penicillia and their mycotoxins. Studies in Mycology 49: 1–173. [Google Scholar]

[R52] Gadgil PD, Dick M. 1983. Fungi Eucalyptorum novazelandiae: Septoria pulcherrima sp. nov. and Trimmatostroma bifarium sp. nov. New Zealand Journal of Botany 21: 49–52. [Google Scholar]

[R53] Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences of the United States of America 95: 388–393. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] Gezahgne A, Roux J, Wingfield MJ. 2003. Diseases of exotic Eucalyptus and Pinus species in Ethiopian plantations. South African Journal of Science 99: 29–33. [Google Scholar]

[R55] Goodwin SB, Dunkle LD, Zismann VL. 2001. Phylogenetic analysis of Cercospora and Mycosphaerella based on the internal transcribed spacer region of ribosomal DNA. Phytopathology 91: 648–658. [DOI] [PubMed] [Google Scholar]

[R56] Grattapaglia D, Vaillancourt R, Shepherd M, Thumma B, Foley W, et al. 2012. Progress in Myrtaceae genetics and genomics: Eucalyptus as the pivotal genus. Tree Genetics & Genomes 8: 463–508. [Google Scholar]

[R57] Groenewald JZ, Nakashima C, Nishikawa J, Shin H-D, Park J-H, et al. 2013. Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115–170. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R58] Groenewald M, Groenewald JZ, Crous PW. 2005. Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951–959. [DOI] [PubMed] [Google Scholar]

[R59] Hall TA. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]

[R60] Hebert PDN, Cywinska A, Ball SL, DeWaard JR. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B-Biological Sciences 270: 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] Hennig W. 1966. Phylogenetic systematics.University of Illinois Press, Urbana, USA. [Google Scholar]

[R62] Hoog GS de, Guarro J, Gené J, Figueras MJ. 2000. Atlas of clinical fungi, 2nd ed Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; University Rovira i Virgili, Reus, Spain. [Google Scholar]

[R63] Hunter GC, Crous PW, Carnegie AJ, Burgess TI, Wingfield MJ. 2011. Mycosphaerella and Teratosphaeria diseases of Eucalyptus; easily confused and with serious consequences. Fungal Diversity 50: 145–166. [Google Scholar]

[R64] Hunter GC, Roux J, Wingfield BD, Crous PW, Wingfield MJ. 2004. Mycosphaerella species causing leaf disease in South African Eucalyptus plantations. Mycological Research 108: 672–681. [DOI] [PubMed] [Google Scholar]

[R65] Hunter GC, Wingfield BD, Crous PW, Wingfield MJ. 2006. A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in Mycology 55: 147–161. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] Huson DH. 1998. SplitsTree: analyzing and visualizing evolutionary data. Bioinformatics 14: 68–73. [DOI] [PubMed] [Google Scholar]

[R67] Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254–267. [DOI] [PubMed] [Google Scholar]

[R68] Hyde KD, Jones EBG, Lui J-K, Ariyawansa H, Boehm E, et al. 2013. Families of Dothideomycetes. Fungal Diversity 63: 1–313. [Google Scholar]

[R69] Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R70] Kohlmeyer J, Volkmann-Kohlmeyer B, Eriksson OE. 1999. Fungi on Juncus roemerianus 12. Two new species of Mycosphaerella and Paraphaeosphaeria (Ascomycotina). Botanica Marina 42: 505–511. [Google Scholar]

[R71] Koufopanou V, Burt A, Taylor JW. 1997. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis. Proceedings of the National Academy of Sciences of the United States of America 94: 5478–5482. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R72] Leslie JF, Summerell BA. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames, USA. [Google Scholar]

[R73] Li HY, Sun GY, Zhai XR, Batzer JC, Mayfield DA, Crous PW, Groenewald JZ, Gleason ML. 2012. Dissoconiaceae associated with sooty blotch and flyspeck on fruits in China and the United States. Persoonia 28: 113–125. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R74] Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ. 2008. Microfungi occurring on Proteaceae in the Fynbos. CBS Biodiversity Series 7: 1–166 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. [Google Scholar]

[R75] Mason-Gamer RJ, Kellogg EA. 1996. Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 524–545. [Google Scholar]

[R76] Maxwell A, Dell B, Neumeister-Kemp HG, Hardy GEStJ. 2003. Mycosphaerella species associated with Eucalyptus in south-western Australia: new species, new records and a key. Mycological Research 107: 351–359. [DOI] [PubMed] [Google Scholar]

[R77] Mayr E. 1942. Systematics and the origin of species. Columbia University Press, New York, USA. [Google Scholar]

[R78] Müller E, Oehrens E. 1982. On the genus Teratosphaeria (Ascomycetes). Sydowia 35: 38–42. [Google Scholar]

[R79] Nosrati S, Esmailzadeh-Hosseini SA, Sarpeleh A. 2010. First report of Penidiella strumelloidea as a pathogen of greenhouse cucumbers in Iran. Phytoparasitica 38: 95–97. [Google Scholar]

[R80] Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre Uppsala University; 2: 1–2. [Google Scholar]

[R81] O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116. [DOI] [PubMed] [Google Scholar]

[R82] O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95: 2044–2049. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R83] Old KM, Wingfield MJ, Yuan ZQ. 2003. A manual of diseases of eucalypts in South-East Asia. Centre for International Forestry Research, Jakarta, Indonesia. [Google Scholar]

[R84] Park RF, Keane PJ, Wingfield MJ, Crous PW. 2000. Fungal diseases of eucalypt foliage. In: Keane PJ, Kile GA, Podger FD, Brown BN. (eds), Diseases and pathogens of eucalypts: 153–239 CSIRO Publishing, Australia. [Google Scholar]

[R85] Pérez G, Burgess T, Slippers B, Carnegie A, Wingfield B, Wingfield M. 2013. Teratosphaeria pseudonubilosa sp. nov., a serious Eucalyptus leaf pathogen in the Teratosphaeria nubilosa species complex. Australasian Plant Pathology 43: 67–77. [Google Scholar]

[R86] Philippe H, Bryant D. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665–2681. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R87] Plemenitas A, Vaupotic T, Lenassi M, Kogej T, Gunde-Cimerman N. 2008. Adaptation of extremely halotolerant black yeast Hortaea werneckii to increased osmolarity: a molecular perspective at a glance. Studies in Mycology 61: 67–75. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R88] Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M de, Crous PW. 2012. DNA barcoding of Mycosphaerella species of quarantine importance to Europe. Persoonia 29: 101–115. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R89] Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, et al. 2011. Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26: 57–69. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R90] Quaedvlieg W, Verkley GJM, Shin H-D, Barreto RW, Alfenas AC, et al. 2013. Sizing up Septoria. Studies in Mycology 75: 307–390. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R91] Queiroz K de. 2007. Species concepts and species delimitation. Systematic Biology 56: 879–886. [DOI] [PubMed] [Google Scholar]

[R92] Rayner RW. 1970. A mycological colour chart. Commonwealth Mycological Institute and British Mycological Society, Surrey, UK. [Google Scholar]

[R93] Ronquist F, Teslenko M, Mark P van der, Ayres DL, Darling A, et al. 2011. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R94] Ruibal C, Gueidan C, Selbmann L, Gorbushina AA, Crous PW, et al. 2009. Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123–133S7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R95] Ruibal C, Millanes AM, Hawksworth DL. 2011. Molecular phylogenetic studies on the lichenicolous Xanthoriicola physciae reveal Antarctic rock-inhabiting fungi and Piedraia species among closest relatives in the Teratosphaeriaceae. IMA Fungus 2: 97–103. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R96] Samson RA, Hong S-B, Frisvad JC. 2006. Old and new concepts of species differentiation in Aspergillus. Medical Mycology 44: S133–S148. [DOI] [PubMed] [Google Scholar]

[R97] Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R98] Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041–1052. [DOI] [PubMed] [Google Scholar]

[R99] Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, et al. 2007. Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics. Studies in Mycology 58: 105–156. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R100] Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ. 2004. Devriesia, a new hyphomycete genus to accommodate heat-resistant, cladosporium-like fungi. Canadian Journal of Botany 82: 914–926. [Google Scholar]

[R101] Selbmann L, Hoog GS de, Zucconi L, Isola D, Ruisi S, et al. 2008. Drought meets acid: three new genera in a dothidealean clade of extremotolerant fungi. Studies in Mycology 61: 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R102] Selbmann L, Hoog GS de, Mazzaglia A, Friedmann EI, Onofri S. 2005. Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert. Studies in Mycology 51: 1–32. [Google Scholar]

[R103] Slippers B, Stenlid J, Wingfield MJ. 2005. Emerging pathogens: fungal host jumps following anthropogenic introduction. Trends in Ecology & Evolution 20: 420–421. [DOI] [PubMed] [Google Scholar]

[R104] Smith H, Wingfield MJ, Crous PW, Coutinho TA. 1996. Sphaeropsis sapinea and Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. South African Journal of Botany 62: 86–88. [Google Scholar]

[R105] Starkey DE, Ward TJ, Aoki T, Gale LR, Kistler HC, et al. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology 44: 1191–1204. [DOI] [PubMed] [Google Scholar]

[R106] Stewart EL, Liu ZW, Crous PW, Szabo LJ. 1999. Phylogenetic relationships among some cercosporoid anamorphs of Mycosphaerella based on rDNA sequence analysis. Mycological Research 103: 1491–1499. [Google Scholar]

[R107] Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, McDonald BA. 2012. Zymoseptoria ardabilia and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola). Mycologia 104: 1397–1407. [DOI] [PubMed] [Google Scholar]

[R108] Sutton BC, Ganapathi A. 1978. Trimmatostroma excentricum sp. nov. on Eucalyptus from New-Zealand and Fiji. New Zealand Journal of Botany 16: 529–533. [Google Scholar]

[R109] Swart L, Crous PW, Denman S, Palm ME. 1998. Fungi occurring on Proteaceae. South African Journal of Botany 64: 137–145. [Google Scholar]

[R110] Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. [DOI] [PubMed] [Google Scholar]

[R111] Taylor JE, Crous PW. 2000. Fungi occurring on Proteaceae: new anamorphs for Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated with leaf spots and cankers of proteaceous hosts. Mycological Research 104: 618–636. [Google Scholar]

[R112] Taylor JE, Crous PW. 2001. Morphological variation and cultural characteristics of Coniothyrium leucospermi associated with leaf spots of Proteaceae. Mycoscience 42: 265–271. [Google Scholar]

[R113] Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. [DOI] [PubMed] [Google Scholar]

[R114] Turnbull JW. 2000. Economic and social importance of eucalypts. CSIRO Publishing, Australia. [Google Scholar]

[R115] Valen L van. 1976. Ecological species, multispecies and oaks. Taxon 25: 233–239. [Google Scholar]

[R116] Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A. 2004. Mycosphaerella punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the genus Mycosphaerella (Dothideales, Ascomycota). Mycological Research 108: 1271–1282. [DOI] [PubMed] [Google Scholar]

[R117] Verkley GJM, Quaedvlieg W, Shin H-D, Crous PW. 2013. A new approach to species delimitation in Septoria. Studies in Mycology 75: 213–305. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R118] Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R119] White TJ, Bruns T, Lee J, Taylor SB. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (eds), PCR protocols: a guide to methods and applications: 315–322 Academic Press, San Diego, California, USA. [Google Scholar]

[R120] Wingfield MJ, Crous PW, Coutinho TA. 1996. A serious canker disease of Eucalyptus in South Africa caused by a new species of Coniothyrium. Mycopathologia 136: 139–145. [DOI] [PubMed] [Google Scholar]

[R121] Wingfield MJ, Crous PW, Peredo HL. 1995. A preliminary, annotated list of foliar pathogens of Eucalyptus spp. in Chile. South African Forestry Journal 173: 53–57. [Google Scholar]

[R122] Wingfield MJ, Roux J, Coutinho T, Govender P, Wingfield BD. 2001. Plantation disease and pest management in the next century. South African Forestry Journal 190: 67–71. [Google Scholar]

[R123] Wright S.1940The new systematics.Oxford University Press, London, UK. [Google Scholar]

PERMALINK

Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae

W Quaedvlieg

M Binder

JZ Groenewald

BA Summerell

AJ Carnegie

TI Burgess

PW Crous

Abstract

INTRODUCTION

MATERIALS AND METHODS

Isolates

Table 1.

Multi-locus DNA screening

Table 2.

Phylogenetic analysis

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Table 3.

Kimura-2-parameter values

Fig. 5.

Genealogical concordance phylogenetic species recognition analysis

Fig. 6.

Morphology

RESULTS

Amplification rate of test loci

Congruency testing

Kimura-2-parameter values

Phylogenetic results

TAXONOMY

Extremaceae

Incertae sedis (Capnodiales)

Mycosphaerellaceae

Neodevriesiaceae

Teratosphaeriaceae

Fig. 7.

Fig. 8.

Fig. 9.

Fig. 10.

Fig. 11.

DISCUSSION

Mycosphaerella Leaf Disease

Lineages within the Teratosphaeriaceae

Best genes to distinguish species in Mycosphaerellaceae and Teratosphaeriaceae

Species concepts within the fungal kingdom

Acknowledgments

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases