LETTER
Yersinia enterocolitica, a cause of emerging enteric infections, is a foodborne pathogen associated with various enteric and systemic syndromes, e.g., diarrhea, enteritis, and enterocolitis. Therefore, the detection of this pathogen has important significance. Previous real-time PCR for detection of Y. enterocolitica was primarily based on the ail gene; biotype 1A nonpathogenic strains were not included (1–3). However, recent studies (4, 5) showed that biotype 1A ystB-positive strains are potentially pathogenic and related outbreaks were reported. We therefore designed a TaqMan real-time PCR method for detection of both pathogenic and nonpathogenic Y. enterocolitica strains.
Using data from sequence analysis of the ail and foxA genes from many Y. enterocolitica strains (6), we designed TaqMan probes and primers (Table 1).
TABLE 1.
Primers and probes used in this study
| Primer or probe | Sequence from 5′ to 3′a | Position | GenBank no. | Amplicon length (bp) |
|---|---|---|---|---|
| ail-F | TTTGGAAGCGGGTTGAATTG | 17797–17778 | FR729477.2 | 101 |
| ail-R | GCTCACGGAAAGGTTAAGTCATCT | 17697–17720 | ||
| ail probe | FAM-CTGCCCCGTATGCCATTGACGTCTTA-BHQ | 17747–17772 | ||
| foxA-F | ACGGCGGTGATGTGAACAA | 386606–386624 | AM286415.1 | 85 |
| foxA-R | GGGTCCACTTGCAGCACATT | 386690–386671 | ||
| foxA probe | FAM-ACCTTCCTTGATGGGCTGCGCTTACTC-BHQ | 386626–386652 | ||
| IAC-F | GCAGCCACTGGTAACAGGAT | 1216–1235 | L09137 | 118 |
| IAC-R | GCAGAGCGCAGATACCAAAT | 1314–1333 | ||
| IAC probe | HEX-AGAGCGAGGTATGTAGGCGG-TAMRA | 1240–1259 |
BHQ, black hole quencher; FAM, 6-carboxyfluorescein; HEX, 5-hexachloro-fluorescein; TAMRA, 6-carboxytetramethylrhodamine.
An experiment using the entire reaction system was performed using a 20-μl volume containing 10 μl premix (TaKaRa; China), 7.2 μl ultrapure distilled water, 0.2 μl ROXII, and 0.2 μl (100 nmol/liter) of each primer and probe. A two-step method was adopted. The cycling conditions for the use of a Rotor-Gene Q system consisted of 1 cycle of initial denaturation at 95°C for 10 s followed by 40 cycles of melting at 95°C for 5 s and elongation at 60°C for 30 s. And for the use of a ABI 7500 Fast system, cycling was performed using one initial denaturation at 95°C for 20 s followed by 40 cycles of melting at 95°C for 3 s and elongation at 60°C for 30 s.
A total of 168 pathogenic Y. enterocolitica strains (3 ail sequence patterns and 8 foxA sequence patterns) and a total of 41 nonpathogenic Y. enterocolitica strains (13 foxA sequence patterns) were used to assess the sensitivity and specificity of the method. Most of these strains were isolated from animals, mainly swine and mice, in China. Furthermore, 258 non-Y. enterocolitica strains were used to test the specificity of the two detection systems. Most of the strains were Gram-negative bacteria of various genera. All the strains were isolated from patients and identified by using a Vitek Compact 2 biochemical identification instrument (bioMérieux). The results showed that both the ail and foxA gene detection systems have 100% specificity.
Standard curves and sensitivity data were obtained by amplifying standard plasmid that had been serially diluted 10-fold. In parallel, we detected the sensitivity of conventional PCR. The results suggested that the slope was −3.09 and the R2 was 0.99 for the ail system and that the slope was −3.16 and the R2 was 0.99 for the foxA system. The detection limit was 102 copies/μl for both detection systems. This represented sensitivity 10 times greater than that of the conventional PCR detection.
To exclude false-negative results caused by potential inhibitors, we used the internal amplification control (IAC) developed by Fricker et al. (7). A total of 15 pathogenic Y. enterocolitica strains were used to test the IAC with the ail and foxA detection systems. When the ail and foxA detection systems were mixed with the IAC, both of them amplified well with IAC and also had no nonspecific amplification, thus showing that the IAC that we used was suitable for our detection systems.
In our laboratory, combining conventional PCR and culture isolation achieves good results; currently, we first employ PCR screening to find positive samples with the Y. enterocolitica conserved foxA gene or pathogenic ail gene and then inoculate positive samples onto cefsulodin-irgasan-novobiocin isolation media (CIN agar; Difco).
To compare real-time PCR detection, conventional PCR detection, and culture isolation methods, we tested 228 separate animal and patient specimens. DNA was extracted from 228 animal and patient specimens by the use of a DNA nucleic acid extraction kit (Tiangen; China). The specimens were tested by using the ail and foxA real-time PCR detection system and conventional PCR. Then, all the specimens were inoculated onto the CIN media for identification. The determinations of the primers and amplification profile for conventional PCR used the method of Huang et al. (6), and culture isolation was performed using the method of Duan et al. (8). Positive or negative results for real-time PCR were defined as follows. For the ail real-time PCR detection system, a threshold cycle (CT) value of <31.7 represented a positive result; a CT value of >35 represented a negative result; and the “gray area” was between 31.7 and 35. For foxA, a CT value of <32.8 represented a positive result; a CT value of >36 represented a negative result; and the gray area was between 32.8 and 36. If results fell in the gray area, the test was repeated twice. If one or two results still fell in the gray area, we defined them as positive; otherwise, we defined them as negative.
The detection rates for real-time PCR and conventional PCR were different (Table 2). Real-time PCR detections were 59.6% (136/228) for the ail gene and 86.4% (197/228) for the foxA gene; those values are higher than those measured for conventional PCR at 25.0% (57/228) and 60.1% (137/228), respectively. Further, all specimens positive for the ail gene by the use of conventional PCR were amplified by real-time PCR. However, 99.3% of the specimens positive for the foxA gene by the use of conventional PCR were amplified by real-time PCR detection whereas only one specimen (GX2013-D35) was positive by conventional PCR but negative by real-time PCR. We sequenced the foxA gene of that specimen and found that its pattern was different from other foxA patterns we have found. When aligned to primers and probes, it had multiple mismatches.
TABLE 2.
Detection of ail and foxA genes by the use of real-time PCR and conventional PCRa
| Real-time PCR result | No. of samples: |
No. of samples: |
||||
|---|---|---|---|---|---|---|
| With indicated conventional PCR result for ail gene |
Total | With indicated conventional PCR result for foxA gene |
Total | |||
| + | − | + | − | |||
| + | 57 | 79 | 136 | 136 | 61 | 197 |
| − | 0 | 92 | 92 | 1 | 30 | 31 |
| Total | 57 | 171 | 228 | 137 | 91 | 228 |
χ2(ail gene) = 51.4 > χ20.05, 1 = 3.84; χ2(foxA gene) = 48.4 > χ20.05, 1 = 3.84.
In conclusion, these results indicate that the real-time PCR method has 100% specificity and is more sensitive than the conventional method. Additionally, its results are consistent with those of the conventional culture method and conventional PCR method. Therefore, there are advantages to replacing the conventional PCR method with the real-time TaqMan PCR method for preliminary screening before Y. enterocolitica culture isolation.
ACKNOWLEDGMENTS
This work was supported by the National Natural Science Foundation of China (General Project, no. 31100101) and the National Sci-Tech Key Project (2012ZX10004201, 2013ZX10004203-002, and 2013ZX10004-101).
We thank Liuying Tang and Jim Nelson for critical reading of and helpful comments on our manuscript.
Footnotes
Published ahead of print 22 October 2014
REFERENCES
- 1.Jourdan AD, Johnson SC, Wesley IV. 2000. Development of a fluorogenic 5′ nuclease PCR assay for detection of the ail gene of pathogenicYersinia enterocolitica. Appl. Environ. Microbiol. 66:3750–3755. 10.1128/AEM.66.9.3750-3755.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Boyapalle S, Wesley IV, Hurd HS, Reddy PG. 2001. Comparison of culture, multiplex, and 5′nuclease polymerase chain reaction assays for the rapid detection of Yersinia enterocolitica in swine and pork products. J. Food Prot. 64:1352–1361. [DOI] [PubMed] [Google Scholar]
- 3.Lambertz ST, Nilsson C, Hallanvuo S, Lindblad M. 2008. Real-time PCR method for detection of pathogenic Yersinia enterocolitica in food. Appl. Environ. Microbiol. 74:6060–6067. 10.1128/AEM.00405-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Singh I, Virdi JS. 2004. Production of Yersinia stable toxin (YST) and distribution of yst genes in biotype 1A strains of Yersinia enterocolitica. J. Med. Microbiol. 53:1065–1068. 10.1099/jmm.0.45527-0. [DOI] [PubMed] [Google Scholar]
- 5.Singh I, Virdi JS. 2005. Interaction of Yersinia enterocolitica biotype 1A strains of diverse origin with cultured cells in vitro. Jpn. J. Infect. Dis. 58:31–33. [PubMed] [Google Scholar]
- 6.Huang Y, Wang X, Cui Z, Yang Y, Xiao Y, Tang L, Kan B, Xu J, Jing H. 2010. Possible use of ail and foxA polymorphisms for detecting pathogenic Yersinia enterocolitica. BMC Microbiol. 10:211. 10.1186/1471-2180-10-211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Fricker M, Messelhäußer U, Busch U, Scherer S, Ehling-Schulz M. 2007. Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl. Environ. Microbiol. 73:1892–1898. 10.1128/AEM.02219-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Duan R, Liang J, Shi G, Cui Z, Hai R, Wang P, Xiao Y, Li K, Qiu H, Gu W, Du X, Jing H, Wang X. 2014. Homology analysis of pathogenic Yersinia species Yersinia enterocolitica, Yersinia pseudotuberculosis, and Yersinia pestis based on multilocus sequence typing. J. Clin. Microbiol. 52:20–29. 10.1128/JCM.02185-13. [DOI] [PMC free article] [PubMed] [Google Scholar]