Polymyxin B Resistance and Biofilm Formation in Vibrio cholerae Are Controlled by the Response Regulator CarR

Abstract

Two-component systems play important roles in the physiology of many bacterial pathogens. Vibrio cholerae's CarRS two-component regulatory system negatively regulates expression of vps (Vibrio polysaccharide) genes and biofilm formation. In this study, we report that CarR confers polymyxin B resistance by positively regulating expression of the almEFG genes, whose products are required for glycine and diglycine modification of lipid A. We determined that CarR directly binds to the regulatory region of the almEFG operon. Similarly to a carR mutant, strains lacking almE, almF, and almG exhibited enhanced polymyxin B sensitivity. We also observed that strains lacking almE or the almEFG operon have enhanced biofilm formation. Our results reveal that CarR regulates biofilm formation and antimicrobial peptide resistance in V. cholerae.

INTRODUCTION

Vibrio cholerae, a Gram-negative enteric pathogen, is the causative agent of the diarrheal disease cholera. To establish infection, V. cholerae senses and responds to host defenses encountered during the infection cycle. As an enteric pathogen, V. cholerae needs to launch a defense against antimicrobial peptides (APs), such as bactericidal permeability-increasing cationic protein (BPI), β-defensins, α-defensins, and cathelicidin (LL-37) produced in the human intestine (1, 2). It was shown that the outer membrane protein OmpU confers resistance to the P2 peptide derived from BPI and to pentacationic cyclic lipodecapeptides, synthesized by bacteria, known as polymyxin B (PMB). It does so by modulating the expression and activity of the alternative sigma factor sigma-E, which regulates the extracytoplasmic stress response (3, 4). Both BPI and polymyxin B are thought to interact with the lipid A moiety of lipopolysaccharide (LPS). In fact, lipid acylation catalyzed by MsbA/LpxN (VC0212), the genes for which encode a lipid A secondary hydroxyacyltransferase, and glycine and diglycine modification catalyzed by AlmG (VC1577), AlmF (VC1578), and AlmE (VC1579) were found to be critical for V. cholerae polymyxin B resistance (5, 6). It is proposed that a decrease in cell surface negative charge and membrane fluidity resulting from the glycine modification could impact antimicrobial peptide resistance. In addition to cell surface modifications, V. cholerae RND (resistance-nodulation-division) family efflux systems, in particular VexAB, contribute to polymyxin B resistance (7).

Two-component signal transduction systems (TCSs) play important roles in the physiology of many bacterial pathogens. A TCS is a phosphorelay-based signaling mechanism (8–10). The prototypical TCS consists of a membrane-bound histidine kinase (HK), which senses environmental signals, and a corresponding response regulator (RR), which mediates a cellular response. TCSs have been shown to contribute to increased resistance to antimicrobial peptides. The Salmonella enterica serovar Typhimurium PhoPQ TCS contributes to increased resistance to antimicrobial peptides. The response regulator PhoP regulates expression of genes, including pagP, lpxO, and pagL, which encode proteins involved in palmitoylation, hydroxylation, and deacetylation of lipid A, respectively (11–13). PhoPQ also activates pmrAB genes, which encode a TCS. PmrAB positively regulates expression of pmrE and pmrHFIJKLM genes, which are required for the addition of 4-amino-4-deoxy-l-arabinose (Ara4N) and phosphoethanolamine (PEtN) to the lipid A of LPS, and these modifications provide polymyxin B resistance (14, 15). In Pseudomonas aeruginosa, PhoPQ, PmrAB, and ParRS regulate polymyxin B resistance by upregulating the expression of the LPS modification operon arnBCADTEF. The proteins encoded by the arn genes catalyze the modification of LPS with Ara4N (16, 17). In V. cholerae, the regulatory mechanisms controlling resistance to antimicrobial peptides are not well understood.

We previously identified CarRS as negative regulators of biofilm formation in V. cholerae and here demonstrate that this TCS additionally plays a role in resistance to antimicrobial peptides (18). Biofilms—matrix-enclosed, surface-associated communities—are critical for environmental survival, transmission, and infectivity of V. cholerae. Extracellular matrix components, including polysaccharides (Vibrio polysaccharides [VPS]) (19) and matrix proteins (RbmA, RbmC, and Bap1) (20–22), connect cells and attach biofilms to environmental and host surfaces. V. cholerae biofilm formation is regulated by a complex network of interconnected regulatory elements (23, 24). VpsR is required for biofilm formation, as disruption of vpsR abolishes biofilm formation (25). The second positive regulator of biofilm formation is VpsT; its disruption reduces the biofilm-forming capacity of V. cholerae (26). CarR negatively regulates expression of vpsR and vpsT (18). V. cholerae biofilm formation is negatively regulated by HapR, a master quorum sensing regulator, and cyclic AMP (cAMP) and cAMP binding protein (CRP) (27–30). Our previous work showed that the CarRS system acts in parallel with HapR to repress biofilm formation. Whole-genome expression profiling of carR and carS mutants revealed that CarRS regulates the transcription of the almEFG operon (18), whose products are involved in the synthesis of glycine-modified lipid A species in V. cholerae (5, 18) and in polymyxin B resistance.

In this study, we report that CarR positively regulates almEFG by directly binding to the regulatory region of the almEFG operon. Expression of almEFG, in turn, promotes polymyxin B resistance. We also provide evidence that similarly to CarR, AlmE contributes to repression of biofilm formation in V. cholerae and that CarR contributes to intestinal colonization in a strain-specific manner.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. All V. cholerae and Escherichia coli strains were grown aerobically, at 30°C and 37°C, respectively, unless otherwise noted. All cultures were grown in Luria-Bertani (LB) broth (1% tryptone, 0.5% yeast extract, 1% NaCl), pH 7.5, unless otherwise noted. LB agar medium contains 1.5% (wt/vol) granulated agar (BD Biosciences, Franklin Lakes, NJ). Concentrations of antibiotics and inducers used, when appropriate, were as follows: ampicillin, 100 μg/ml; rifampin, 100 μg/ml; streptomycin, 100 μg/ml; gentamicin, 50 μg/ml; chloramphenicol, 20 μg/ml (E. coli) or 5 μg/ml (V. cholerae); and arabinose, 0.2% (wt/vol). In-frame deletion and green fluorescent protein (GFP)-tagged strains were generated according to protocols previously published (20, 21).

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant genotype	Reference or source
Strains
E. coli
CC118λpir	Δ(ara-leu) araD ΔlacX74 galE galK phoA20 thi-1 rpsE rpoB argE(Am) recA1 λpir	42
S17-1λpir	Tpr Smr recA thi pro rK− mK+ RP4::2-Tc::MuKm Tn7 λpir	43
SM10λpir	thi thr leu tonA lacY supE recA (RP4-2-Tc::Mu) λpirR6K Kmr π+	44
TOP10	F− mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG	Invitrogen
BL21(DE3)	F− ompT hsdSB(rB− mB−) gal dcm (DE3)	Invitrogen
V. cholerae
FY_VC_1	Vibrio cholerae O1 El Tor A1552, wild type, Rifr	45
FY_VC_3	ΔlacZ Rifr	26
FY_VC_3282	ΔcarR Rifr	18
FY_VC_5668	ΔalmE Rifr	This study
FY_VC_4097	ΔalmF Rifr	This study
FY_VC_4094	ΔalmG Rifr	This study
FY_VC_5680	ΔalmEFG Rifr	This study
FY_VC_5486	ΔcarR ΔalmEFG, Rifr	This study
FY_VC_237	Wild-type mTn7-gfp Rifr Gmr	46
FY_VC_3283	ΔcarR mTn7-gfp Rifr Gmr	18
FY_VC_5563	ΔalmE mTn7-gfp Rifr Gmr	This study
FY_VC_5762	ΔalmF mTn7-gfp Rifr Gmr	This study
FY_VC_5758	ΔalmG mTn7-gfp Rifr Gmr	This study
FY_VC_5687	ΔalmEFG mTn7-gfp Rifr Gmr	This study
C6706	Vibrio cholerae O1 El Tor C6706, Strr	47
FY_VC_3756	C6706 ΔlacZ Strr	30
FY_VC_9419	C6706 ΔcarR Strr	This study
FY_VC_9744	C6706 ΔalmEFG Strr	This study
FY_VC_8466	C6706 mTn7-gfp Strr Gmr	This study
FY_VC_9750	C6706 ΔalmE mTn7-gfp Strr Gmr	This study
FY_VC_9754	C6706 ΔalmEFG mTn7-gfp Strr Gmr	This study
Plasmids
pGP704sacB28	pGP704 derivative, mob/oriT sacB Apr	G. Schoolnik
pFY-119	pGP704-sac28::ΔcarR Apr	18
pFY-985	pGP704-sac28::ΔalmE Apr	This study
pFY-983	pGP704-sac28::ΔalmF Apr	This study
pFY-981	pGP704-sac28::ΔalmG Apr	This study
pFY-977	pGP704-sac28::ΔalmEFG Apr	This study
pBAD/Myc-His B-C	Arabinose-inducible expression vector with C-terminal Myc epitope and six-His tags	Invitrogen
pFY-3601	pcarR pBAD-Myc/His C::carR Apr	This study
pFY-705	palmE pBAD-Myc/His C::almE Apr	This study
pFY-703	palmF pBAD-Myc/His C::almF Apr	This study
pFY-701	palmG pBAD-Myc/His C::almG Apr	This study
pFY-1533	palmEFG pBAD-Myc/His B::almEFG Apr	This study
pBBRlux	luxCDAB-based promoter fusion vector, Cmr	48
pFY-3448	pBBR-almEFGp-lux-1	This study
pFY-3449	pBBR-almEFGp-lux-2	This study
pFY-3450	pBBR-almEFGp-lux-3	This study
pFY-3451	pBBR-almEFGp-lux-4	This study
pUX-BF13	oriR6K helper plasmid, mob/oriT, provides the Tn7 transposition function in trans, Apr	49
pMCM11	pGP704::mTn7-gfp Gmr Apr	M. Miller and G. Schoolnik

Recombinant DNA techniques.

DNA manipulations were carried out by standard molecular techniques according to the manufacturer's instructions. Restriction and DNA modification enzymes were purchased from New England BioLabs (NEB, Ipswich, MA). PCRs were carried out using primers purchased from Bioneer Corporation (Alameda, CA) and the Phusion high-fidelity PCR kit (NEB, Ipswich, MA), unless otherwise noted. Sequences of the primers used in the present study are available upon request. Sequences of constructs were verified by DNA sequencing (UC Berkeley DNA Sequencing Facility, Berkeley, CA).

RNA isolation.

Total RNA was isolated from V. cholerae cells according to a previously published protocol (24). Briefly, overnight-grown cultures of V. cholerae in LB medium supplemented with ampicillin at 30°C were diluted 1:200 in LB medium supplemented with ampicillin and 0.2% arabinose and incubated at 30°C with shaking at 200 rpm until they reached an optical density at 600 nm (OD₆₀₀) of 0.3 to 0.4. To ensure homogeneity, these cultures were diluted again 1:200 in LB medium supplemented with ampicillin and 0.2% arabinose and grown to an OD₆₀₀ of 0.3 to 0.4. Aliquots (1.8 ml) were collected by centrifugation, immediately resuspended in 1 ml of TRIzol reagent (Life Technologies, Carlsbad, CA), and stored at −80°C. These samples were incubated for 5 min at room temperature, and 0.2 ml of chloroform was added into each tube. Tubes were shaken, incubated at room temperature for 5 min, and then centrifuged for 20 min at 12,000 × g and 4°C. The aqueous layer was removed into a new tube. Isopropanol (250 μl) and 250 μl high-salt solution (0.8 M sodium citrate, 1.2 M NaCl) were added, and the suspension was incubated for 10 min at room temperature to precipitate the RNA. Isopropanol was removed after centrifugation for 30 min at 12,000 × g and 4°C. Pellets were washed with 1 ml of 75% ethanol, and ethanol was removed after centrifugation for 5 min at 7,500 × g and 4°C. Pellets were dried at room temperature for 10 min. Dried pellets were then resuspended in RNase-free water. To remove contaminating DNA, total RNA was incubated with Turbo DNase (Life Technologies, Carlsbad, CA), and the RNeasy minikit (Qiagen, Valencia, CA) was used to clean up the RNA after DNase digestion.

Quantitative reverse transcription real-time PCR (qRT-PCR).

The SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA) was used to synthesize cDNA from 1 μg of isolated total RNA. Real-time PCR was performed using a Bio-Rad CFX1000 thermal cycler and Bio-Rad CFX96 real-time imager with specific primer pairs (designed within the coding region of the target genes) and SsoAdvanced SYBR green supermix (Bio-Rad, Hercules, CA). Results are from two independent experiments performed in triplicate. All samples were normalized to the expression of the housekeeping gene recA via the Pfaffl method (31). Statistical analysis was performed using a one-way analysis of variance (ANOVA) with Bonferroni's multiple-comparison test.

Protein production and purification.

The coding region of carR, excluding the stop codon, was amplified by PCR and cloned into the pBAD/Myc-His C bacterial expression vector (Life Technologies, Carlsbad, CA), resulting in an overexpression plasmid encoding a recombinant CarR protein with a C-terminal Myc and 6×His tags (CarR-mycHis). The carR overexpression plasmid (pcarR) was transformed into E. coli strains TOP10 and BL21(DE3) for maintenance and protein production, respectively. CarR-mycHis was purified by metal affinity purification using a Talon resin (Clontech Laboratories, Mountain View, CA) according to the manufacturer's instructions. Briefly, cultures of BL21(DE3) harboring pcarR were grown to mid-exponential phase in LB medium supplemented with ampicillin at 37°C, and expression of the recombinant protein was induced for 3 h at 30°C with the addition of 0.2% arabinose. Cells were harvested and then lysed with xTractor buffer (20 ml/g) (Clontech Laboratories, Mountain View, CA) for 10 min with orbital agitation at 4°C. The crude extract was centrifuged at 4°C to obtain the clarified sample (soluble fraction). The protein was purified with a batch/gravity flow protocol at 4°C using preequilibrated Talon resin (equilibration buffer: 50 mM sodium phosphate, 300 mM NaCl; pH 7.4). Elution of the protein was achieved by adding 250 mM imidazole to the equilibration buffer. To remove imidazole, the purification buffer was exchanged for a storage buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄, pH 7.0, 20% glycerol) using an Amicon Ultra-0.5-ml 10K centrifugal filter (Millipore, Billerica, MA). Protein concentration was determined using the Coomassie Plus (Bradford) protein assay (Thermo Scientific, Rockford, IL) and bovine serum albumin (BSA) as standards.

Electrophoretic mobility shift assays (EMSAs).

A DNA fragment encompassing the regulatory region (−250 to +160 bp with respect to the translational start site) of the almEFG operon was amplified using a forward oligonucleotide (GTTGCGTCTATTGGCGCG) labeled at the 5′ end with the fluorescent dye VIC, which has an absorbance maximum of 538 nm and an emission maximum of 554 nm (Life Technologies Corporation, Grand Island, NY), and a reverse oligonucleotide (TCTGTTTAACCCATAATGCAGGG) labeled at the 5′ end with the fluorescent dye 6-carboxyfluorescein (FAM), which has an absorbance maximum of 492 nm and an emission maximum of 517 nm (Life Technologies Corporation, Grand Island, NY). The amplified product was purified using the Wizard SV gel and PCR cleanup system (Promega, Madison, WI), and the concentration was determined using a NanoDrop spectrophotometer (Thermo Scientific, Rockford, IL). Prior to binding, the recombinant CarR protein (2 μM) was incubated in a buffer containing 100 mM Tris-Cl (pH 7.0), 10 mM MgCl₂, 125 mM KCl, and 50 mM disodium carbamoyl phosphate (Sigma, St. Louis, MO) for 1 h at 30°C. For the binding reactions, the fluorescently labeled probe (0.005 μM) and CarR (from 0.2 to 1 μM) were combined in a binding buffer [100 mM Tris-Cl (pH 7.4), 100 mM KCl, 10 mM MgCl₂, 10% glycerol, 2 mM dithiothreitol, 20 ng/μl poly(dI-dC), and 50 ng/μl of bovine serum albumin [BSA]) and incubated for 30 min at room temperature. The binding reaction mixtures were immediately loaded into a 5% acrylamide gel (37:5:1) and run at 4°C in 0.5× Tris-borate-EDTA buffer (Bio-Rad, Hercules, CA) for 30 min at 150 V. The competition assays were performed by incubating CarR (0.8 μM) and the labeled probe (0.005 μM) in the presence of unlabeled specific probe (0.28 μM) or a Cy3-labeled cyaA (−253 to −43 bp) nonspecific probe (0.28 μM). DNA migration was visualized using a ChemiDoc MP imaging system (Bio-Rad, Hercules, CA) with a 530/28 filter with Blue Epi illumination to limit detection of the Cy3 fluorophore (filter 605/50 Green Epi illumination).

Confocal laser scanning microscopy (CLSM) and flow cell biofilm studies.

Inoculation of flow cells was done by normalizing overnight-grown cultures to an OD₆₀₀ of 0.02 and injecting cells into an Ibidi m-Slide VI0.4 (Ibidi 80601; Ibidi LLC, Verona, WI). To seed the flow cell surface, bacteria were allowed to adhere at room temperature for 1 h. Flow of 2% (vol/vol) LB (0.2 g/liter tryptone, 0.1 g/liter yeast extract, 1% NaCl) was initiated at a rate of 7.5 ml/h and continued for up to 48 h. Ampicillin (100 μg/ml) and arabinose (0.2%, wt/vol) were used when needed. It should be noted that when biofilms are grown using a flow cell system with 2% LB supplemented with antibiotics, growth rate and biofilm formation are reduced relative to those of the biofilms formed in the absence of antibiotics. Following the biofilm growth period, the biofilms were either imaged directly or stained with Syto-9 (3.34 μM in phosphate-buffered saline [PBS]) prior to imaging (Life Technologies, Carlsbad, CA). Confocal images were obtained on a Zeiss LSM 5 Pascal laser scanning confocal microscope (Zeiss, Dublin, CA). Images were obtained with a 40× dry objective and were processed using Imaris software (Biplane, South Windsor, CT). Quantitative analyses were performed using the COMSTAT software package (32). Total biomass, average and maximum biofilm thicknesses, substrate coverage, and roughness coefficient were determined from z-stack images with the threshold set to 25. Five biofilm images were analyzed. Statistical significance was determined using Student's t test or one-way ANOVA with Dunnett's multiple-comparison test, when appropriate. Experiments with two biological replicates were carried out. Data presented are from one representative experiment.

Polymyxin B MIC assay.

V. cholerae deletion and complemented strains were grown overnight aerobically at 30°C in LB medium with or without ampicillin (100 μg/ml), respectively. Cultures were diluted 1:200 in fresh LB medium (deletion strains) or LB medium supplemented with ampicillin (100 μg/ml) and arabinose (0.2%) (complementation strains), incubated aerobically at 30°C, and harvested when OD₆₀₀ reached 0.5. To achieve confluent growth, the cultures were diluted 1:100 (deletion strains) or 1:10 (complementation strains) and 100 μl was plated onto appropriate agar medium. Etest gradient polymyxin B strips (bioMérieux, Durham, NC) were used to determine the polymyxin MIC of the strains after 24 h of incubation at 30°C. The polymyxin B killing assay was carried out according to a published protocol (2). Briefly, exponentially grown cells in LB or LB supplemented with 10 mM CaCl₂, pH 7.0 (18), were harvested, treated with 40 μg/ml polymyxin B for 1 h at 30°C, and plated. CFU were determined, and the percent survival was calculated as follow: % survival = (CFU_{PMB treatment}/CFU_{no treatment}) × 100.

Infant mouse colonization assays.

An in vivo competition assay for intestinal colonization was performed as described previously (33, 34). Each V. cholerae mutant strain (lacZ⁺) and wild-type strain (lacZ minus) were grown to stationary phase at 30°C with aeration in LB broth. Individual mutant and wild-type strains were mixed at 1:1 ratios in 1× PBS. The inocula were plated on LB agar plates containing 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) to differentiate wild-type and mutant colonies and to determine the input ratios. Approximately 10⁶ to 10⁷ CFU was intragastrically administered to groups of 5 to 7 anesthetized 5-day-old CD-1 mice (Charles River Laboratories, Hollister, CA). After 20 h of inoculation, the mice were sacrificed and the small intestine was removed, weighed, homogenized, and plated on appropriate selective and differential media to enumerate mutant and wild-type cells recovered, to determine the output ratios. In vivo competitive indices were calculated by dividing the small intestine output ratio by the inoculum input ratio of mutant to wild-type strains. Statistical analysis was performed using Student's t test. All animal procedures used were in strict accordance with the NIH Guide for the Care and Use of Laboratory Animals (35) and were approved by the UC Santa Cruz Institutional Animal Care and Use Committee (Yildf1206).

Luminescence assays.

V. cholerae strains harboring the indicated plasmid were grown overnight in LB medium supplemented with 5 μg/ml chloramphenicol. Cells were then diluted 1:500 in fresh LB medium supplemented with 5 μg/ml chloramphenicol and harvested at exponential phase at an OD₆₀₀ of 0.3 to 0.4. Luminescence was measured using a Victor3 multilabel counter (PerkinElmer, Waltham, MA), and lux expression is reported as counts min⁻¹ ml⁻¹/OD₆₀₀. Assays were repeated with at least two biological replicates and four technical replicates.

RESULTS

CarR directly regulates the almEFG operon.

Transcriptional profiling of V. cholerae carR and carS mutants revealed that the CarRS two-component system positively regulates expression of the almEFG genes (18). To confirm this finding, we quantified almEFG message levels by qRT-PCR. Expression of all three genes in the almEFG operon was significantly reduced (approximately 50-fold, P ≤ 0.01) in the ΔcarR strain compared to the wild-type strain (Fig. 1A). Complementation of the carR mutant with a wild-type copy of carR, provided on a pBAD plasmid, restored the expression of the almEFG operon to levels similar to those of the wild type. These findings support the hypothesis that CarR is an activator of the almEFG operon.

FIG 1.

Regulation of almEFG expression. (A) Relative expression of almE, almF, and almG mRNA levels measured via qRT-PCR in A1552 wild type and the ΔcarR strain harboring vector only (pBAD/Myc-His C) or the complementation plasmid pcarR. Data are normalized to the recA expression via the Pfaffl method, with the expression of the wild type set to 1.0. The graph represents the mean expression of two independent experiments performed in triplicate. Statistical significance was determined with Student's t test; asterisks indicate P values of <0.01. Error bars represent standard deviations. (B) CarR binds to the almEFG promoter region. Mobility shift assays performed with the almEFG promoter region and _VICalm_FAM, with different concentrations (0, 0.2, 0.4, 0.6, 0.8, and 1 μM) of the response regulator CarR. (C) DNA binding by CarR is specific to the almEFG regulatory region. Lane 1, free fluorescent probe _VICalm_FAM (0.005 μM); lane 2, fluorescent probe _VICalm_FAM (0.005 μM) plus 0.8 μM CarR; lane 3, fluorescent probe _VICalm_FAM (0.005 μM) plus 0.8 μM CarR and 56× unlabeled probe alm; lane 4, fluorescent probe _VICalm_FAM (0.005 μM) plus 0.8 μM CarR and 56× cyaA_Cy3 unspecific probe. (D) Schematic representation of the reporter fragments (F1 to F4) used to analyze the expression of the almEFG operon. The coordinates correspond to the position with respect to the annotated start codon. Rectangles and arrows represent the structural genes. (E) Expression of various almEFGp-lux reporter fragments (F1 to F4) in A1552 wild-type and ΔcarR strains shown in relative luminescence units (RLU; counts min⁻¹ ml⁻¹/OD₆₀₀). The graph represents the mean expression of two independent experiments performed with four replicates. Statistical significance was determined using a one-way ANOVA and Dunnett's multiple-comparison test; asterisks indicate P values of <0.01. Error bars represent standard deviations.

In order to determine if CarR directly regulates the expression of the almEFG operon, we analyzed the ability of a purified CarR to bind to the predicted regulatory region of the almEFG operon (Fig. 1B). We determined that CarR causes mobility shift of the predicted regulatory region of the almEFG operon (−250 to +160 bp with respect to the translational start site of almE), indicating that CarR binds to this region. We also observed direct binding of CarR to the almEFG promoter region spanning −100 to +54 bp with respect to the translational start site of almE (data not shown). Furthermore, we determined that CarR binding to the regulatory region of the almEFG operon was specific. An excess (56×) of unlabeled specific probe was able to outcompete the formation of the CarR-_VICalm_FAM complex. In contrast, formation of the CarR-_VICalm_FAM complex was not affected by an excess (56×) probe consisting of the upstream region (−253 to −43 bp) of the cyaA gene, which is not regulated by the CarR response regulator (Fig. 1C). Taken together, these results show that CarR likely binds to the promoter region of the almEFG operon and regulates transcription of the almEFG operon directly.

The annotated intergenic region between the almEFG operon and VC1580 is 63 nucleotides long. To determine the minimal region required to promote expression of the almEFG operon, we generated transcriptional fusions to the promoterless luxCDABE operon carried in the pBBRlux plasmid. Transcriptional fusions starting at −250 (F1), −76 (F2), and −38 (F3) nucleotides upstream of the annotated almE translational start site were able to activate lux expression in wild-type V. cholerae (Fig. 1D and E). The highest level of expression is observed in strains harboring F1. The strains with the fusions F2 and F3 had a small but reproducible decrease in expression compared to the strains harboring F1. However, a fusion that begins at +1 (F4) lost the ability to promote expression of the lux reporter. Expression of F1 is abolished in a ΔcarR strain. These results suggest that 38 nucleotides upstream of the annotated translational start site (F3) are sufficient to promote expression of the almEFG operon and that CarR is required for transcriptional activation. However, the promoter architecture of the almEFG operon has yet to be characterized in detail, and additional regulatory elements may be required for transcriptional activation.

CarR confers polymyxin B resistance through AlmEFG.

It has been shown previously that alm mutants exhibit polymyxin B sensitivity compared to wild type (5). To investigate if a carR mutant also exhibits a similar polymyxin B sensitivity, the MIC of polymyxin B was determined in a carR mutant and the alm mutants (Fig. 2A) using Etest gradient polymyxin B strips. The carR mutant exhibited polymyxin B sensitivity, with a MIC of 1 μg/ml compared to the wild-type A1552, which exhibits a MIC of 48 μg/ml. The individual alm mutants, the triple almEFG mutant, and the quadruple carR almEFG mutants exhibited similar decreases in MIC (0.5 to 1 μg/ml). We also determined that a carR deletion in the V. cholerae C6706 genetic background resulted in a decrease in the MIC compared to that of its parental C6706 strain (Fig. 2A).

FIG 2.

Polymyxin B sensitivity of wild-type, carR, and almEFG strains. (A) Polymyxin B MIC assays of wild-type and mutant (ΔcarR, ΔalmE, ΔalmF, ΔalmG, ΔalmEFG, and ΔcarR ΔalmEFG) strains in A1552 and C6706 genetic backgrounds. (B) Polymyxin B MIC assay of A1552 wild-type and mutant strains harboring vector only or complementation plasmids. (C) Polymyxin B killing assays of A1552 wild-type and ΔcarR and ΔalmEFG strains grown in the presence or absence of Ca²⁺. % survival = (CFU_{PMB treatment}/CFU_{no treatment}) × 100. Statistical significance was determined with Student's t test; asterisks indicate P values of <0.05. Error bars represent standard deviations. (D) Polymyxin B MIC assays of A1552 wild-type, ΔcarR, and ΔalmEFG strains grown in the presence or absence of Ca²⁺. Arrows indicate the MIC (μg/ml) on Etest gradient polymyxin B strips; MIC values are shown below the images. Assays were carried out with at least 2 biological replicates and 2 technical replicates.

To further investigate if CarR-dependent polymyxin B resistance is mediated by AlmEFG, the polymyxin B MIC was determined in a carR mutant harboring an almEFG complementation plasmid (Fig. 2B). Expression of almEFG from the complementation plasmid rescued the polymyxin B sensitivity phenotype of the carR deletion mutant, indicating that CarR confers polymyxin B resistance via positive regulation of almEFG. As expected, the carR complementation plasmid was able to rescue the polymyxin B sensitivity of the carR mutant (0.75 μg/ml) to the wild-type level (96 μg/ml). Similarly, the polymyxin B-sensitive phenotype of the individual alm and triple almEFG deletion strains could be rescued to the wild-type level when the alm genes were expressed in trans from the complementation plasmids (Fig. 2B).

Calcium affects the susceptibility of V. cholerae to polymyxin B.

Whole-genome expression profiling of V. cholerae cells grown in LB with Ca²⁺ (LBCa²⁺) revealed that Ca²⁺ leads to a 2- to 3-fold decrease in transcription of carR and alm genes (18). Thus, we also compared the sensitivity of V. cholerae cells grown in LB supplemented with 10 mM Ca²⁺ to that of cells grown in LB, using polymyxin B killing assays (2) and Etest gradient polymyxin B strips. No significant difference in survival was observed when the wild-type A1552 strain grown in the presence and that grown in the absence of Ca²⁺ were exposed to polymyxin B (Fig. 2C). This finding suggests that the decreased carR and alm message abundance observed in wild-type bacteria grown in LBCa²⁺ does not lead to a reduction in polymyxin B resistance. In contrast, we observed an increase in polymyxin B MIC when wild-type A1552 cells were grown on LBCa²⁺ agar plates (Fig. 2D). Similarly, when ΔcarR and ΔalmEFG strains were treated with polymyxin B, both percent survival (Fig. 2C) and polymyxin B MIC (Fig. 2D) were significantly higher in the cells grown in the presence of Ca²⁺ than in cells grown in the absence of Ca²⁺. These findings suggest that calcium modulates polymyxin B sensitivity via yet another unknown pathway that is independent of carR and alm operon products.

CarR impacts colonization in a strain-specific manner.

Since CarR and AlmEFG confer resistance to polymyxin B, we wondered if they could also contribute to intestinal colonization. Therefore, we measured the ability of ΔcarR, ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG mutants to colonize the infant mouse small intestine using a competition assay (Fig. 3). All the mutants generated in the V. cholerae A1552 genetic background colonized the infant mouse small intestine similarly to the wild-type strain. In contrast, the carR mutant in the C6706 genetic background showed a small but statistically significant difference in the levels of colonization from that of the wild-type strain. However, the ΔalmEFG mutant in the C6706 genetic background did not exhibit defects in colonization. These results suggest that the contribution of CarR to colonization differs between the V. cholerae strains and that the ΔcarR colonization defect in the C6706 genetic background is not due to decreased expression of almEFG operon genes.

FIG 3.

Intestinal colonization of wild-type, carR, and almEFG strains. Wild type (A1552 or C6706) was coinoculated with ΔcarR, ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG mutants at a ratio of ∼1:1 into infant mice. The number of bacteria per intestine was determined 20 to 22 h postinoculation. The competitive index (CI) was determined as the output ratio of mutant to wild type divided by the input ratio of mutant to wild type. Each dot represents data from an individual mouse. Statistical analysis was performed using Student's two-tailed t test; the asterisk indicates a P value of <0.05.

AlmE impacts biofilm formation.

Previous research in our laboratory has demonstrated that CarRS inhibits biofilm formation through repression of the vps operons and therefore VPS production (18). As discussed above, we demonstrated that CarR positively regulates expression of the almEFG operon. Thus, we wanted to test if alm genes impact biofilm formation. To this end, we analyzed biofilm-forming capabilities of the ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG strains. Biofilms were grown using a flow cell system, imaged using CLSM, and analyzed using COMSTAT to evaluate biofilm structural properties. Quantitative analysis of biofilms revealed that 48 h postinoculation, biofilms formed by ΔcarR, ΔalmE, ΔalmF, and ΔalmEFG strains had significantly more biomass and greater average thickness than the wild-type biofilms (Fig. 4A; Table 2). The ΔalmG mutant formed biofilms that were not significantly different from those of the wild type. Biofilms formed by a ΔalmEFG mutant are similar to the biofilms formed by the ΔalmE mutant, without an additive effect.

FIG 4.

Biofilm formation of alm mutants and complemented strains. (A) Three-dimensional view of biofilms formed by A1552 wild type and ΔcarR, ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG mutants after 24 h and 48 h. (B) Biofilms formed by A1552 wild type harboring the empty vector and alm deletion strains harboring empty vector or respective complementation plasmids. Biofilms were grown in flow cells for 30 h and stained with Syto-9 prior to confocal imaging. (C) Biofilms formed by wild-type C6706 and ΔalmE and ΔalmEFG strains in the C6706 genetic background after 24 h. Bars, 40 μm.

TABLE 2.

COMSTAT quantitative analysis of biofilms formed after 24 h and 48 h by wild-type A1552 and almEFG mutants

Strain	Mean (SD) and significance ata:
	24 h										48 h
	Biomass	Significance	Avg thickness (μm)	Significance	Maximum thickness (μm)	Significance	Substrate coverageb	Significance	Roughness	Significance	Biomass (μm3/μm2)	Significance	Avg thickness (μm)	Significance	Maximum thickness (μm)	Significance	Substrate coverage	Significance	Roughness	Significance
Wild type	9.75 (0.98)		9.01 (0.90)		15.11 (2.85)		1.00 (1.0 × 10−3)		0.14 (0.02)		20.51 (1.29)		20.39 (1.55)		29.70 (5.00)		1.00 (0.00)		0.09 (0.02)
ΔcarR mutant	13.19 (1.34)	***	12.56 (1.25)	***	20.46 (6.05)	**	1.00 (2.00 × 10−6)	NS	0.11 (0.02)	NS	30.23 (3.14)	***	30.82 (3.76)	***	42.13 (5.16)	***	1.00 (0.00)	NS	0.08 (0.02)	NS
ΔalmE mutant	10.89 (1.68)	NS	10.21 (1.57)	NS	16.50 (2.60)	NS	1.00 (5.20 × 10−6)	NS	0.14 (0.04)	NS	26.92 (2.82)	***	27.27 (2.53)	***	38.94 (5.36)	**	1.00 (0.00)	NS	0.09 (0.01)	NS
ΔalmF mutant	10.31 (1.31)	NS	9.60 (1.17)	NS	15.18 (3.03)	NS	1.00 (5.63 × 10−6)	NS	0.13 (0.03)	NS	24.40 (1.37)	**	24.62 (1.70)	**	33.99 (3.08)	NS	1.00 (0.00)	NS	0.09 (0.01)	NS
ΔalmG mutant	9.50 (0.75)	NS	8.78 (0.72)	NS	14.30 (1.64)	NS	1.00 (6.93 × 10−5)	NS	0.14 (0.03)	NS	20.55 (2.11)	NS	20.50 (1.74)	NS	30.47 (6.29)	NS	1.00 (0.00)	NS	0.10 (0.01)	NS
ΔalmEFG mutant	12.61 (2.04)	***	11.97 (1.94)	***	18.85 (4.08)	NS	1.00 (6.14 × 10−6)	NS	0.11 (0.02)	NS	30.07 (1.82)	***	30.56 (2.05)	***	40.37 (2.68)	***	1.00 (0.00)	NS	0.08 (0.01)	NS

^aTotal biomass, average and maximum thicknesses, substrate coverage, and roughness coefficient were calculated using COMSTAT. Values presented are means of data from at least eight z-series image stacks. Significance was determined by an ANOVA (P values for 24 and 48 h are 0.0001 and 0.0002, respectively). Dunnett's multiple-comparison test identified samples that differ significantly from biofilms formed by the wild-type strain. NS, not significant; **, P ≤ 0.01; ***, P ≤ 0.001.

^bA value of 0 indicates no coverage (equivalent to 0%), while a value of 1 indicates full coverage (equivalent to 100%).

To further investigate the role of the almEFG operon in biofilm formation, we introduced a wild-type copy of the alm genes on the pBAD plasmid into their respective mutants and analyzed biofilm formation using a flow cell system (Fig. 4B). We observed that 30 h postinoculation, expression of almE from the pBAD promoter significantly reduced the biofilm biomass and average thickness compared to the almE mutant harboring an empty vector (Fig. 4B; Table 3). We also overexpressed individual alm genes from the pBAD promoter in wild-type A1552 and observed that overexpressing almE resulted in the most dramatic decreases in biofilm formation (data not shown). Collectively, these findings support the conclusion that AlmE is the primary regulator of biofilm formation in the almEFG operon.

TABLE 3.

COMSTAT quantitative analysis of biofilms formed after 30 h by wild-type A1552 harboring the empty vector and deletion strains harboring empty vector or complementation plasmids

Strain	Mean (SD) and significancea
	Biomass (μm3/μm2)	Significance	Avg thickness (μm)	Significance	Maximum thickness (μm)	Significance	Substrate coverage	Significance	Roughness	Significance
Wild type with empty vector	9.56 (0.37)		8.83 (0.36)		23.32 (3.04)		0.995 (2.26 × 10−3)		0.375 (1.50 × 10−2)
ΔalmE mutant harboring
Empty vector	7.80 (0.99)		7.27 (1.07)		19.71 (1.18)		0.879 (2.99 × 10−2)		0.435 (5.31 × 10−2)
palmE	4.28 (1.21)	***	3.47 (1.22)	***	17.95 (6.24)	NS	0.943 (1.37 × 10−2)	**	0.589 (5.02 × 10−2)	**
ΔalmF mutant harboring
Empty vector	8.44 (0.66)		7.68 (0.64)		23.41 (0.79)		0.956 (2.23 × 10−2)		0.517 (5.41 × 10−2)
palmF	6.83 (0.89)	NS	6.02 (0.91)	NS	24.20 (4.22)	NS	0.969 (8.39 × 10−3)	NS	0.551 (5.41 × 10−2)	NS
ΔalmG mutant harboring
Empty vector	8.37 (0.53)		7.57 (0.52)		22.88 (1.65)		0.978 (2.03 × 10−2)		0.494 (4.46 × 10−2)
palmG	7.68 (0.43)	NS	6.90 (0.40)	NS	21.12 (3.11)	NS	0.953 (3.61 × 10−2)	NS	0.594 (8.86 × 10−2)	NS

^aTotal biomass, average and maximum thicknesses, substrate coverage, and roughness coefficient were calculated using COMSTAT. Values presented are means of data from at least five z-series image stacks. Significance was determined by Student's t test, comparing the mutant with the empty vector to the complemented strain. NS, not significant; **, P ≤ 0.01; ***, P ≤ 0.001.

To further test the effect of the alm genes in biofilm formation, we analyzed biofilm formation abilities of C6706 wild type and ΔalmE and ΔalmEFG mutants generated in the C6706 genetic background (Fig. 2C). COMSTAT analysis (Table 4) revealed that ΔalmE and ΔalmEFG mutants formed biofilms with increased biomass and thickness compared to biofilms formed by the C6706 wild-type strain. This finding shows that the effect of AlmE on biofilm formation is not strain specific.

TABLE 4.

COMSTAT quantitative analysis of biofilms formed after 24 h by deletion strains in C6706 genetic background

Strain	Mean (SD) and significancea
	Biomass (μm3/μm2)	Significance	Avg thickness (μm)	Significance	Maximum thickness (μm)	Significance	Substrate coverage	Significance	Roughness	Significance
C6706	16.27 (1.52)		16.68 (1.62)		35.75 (4.02)		1.00 (2.38 × 10−4)		0.36 (0.03)
ΔalmE mutant	20.85 (1.25)	***	22.97 (1.69)	***	40.26 (3.73)	*	1.00 (4.05 × 10−4)	NS	0.34 (0.02)	*
ΔalmEFG mutant	20.13 (0.86)	***	21.77 (1.03)	***	38.50 (2.57)	NS	1.00 (1.70 × 10−4)	NS	0.34 (0.04)	*

^aTotal biomass, average and maximum thicknesses, substrate coverage, and roughness coefficient were calculated using COMSTAT. Values presented are means of data from at least eight z-series image stacks. Significance was determined by one-way ANOVA followed by Dunnett's multiple-comparison test, comparing the deletion mutants to the C6706 wild-type strain. NS, not significant; *, P ≤ 0.05; ***, P ≤ 0.001.

AlmE negatively regulates vps gene expression.

We previously reported that expression of vpsL is upregulated in the absence of carR. To evaluate if the observed biofilm phenotypes correlate with changes in expression of vps genes, we analyzed the expression of a vpsLp-lux transcriptional fusion in wild-type, ΔcarR, ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG strains (Fig. 5). As previously reported, expression of vpsL was upregulated in a ΔcarR strain compared to wild type. Moreover, expression of vpsL is significantly upregulated in the ΔalmE strain to levels higher than those in the ΔcarR strain. However, the expression of vpsL did not change in the ΔalmF and ΔalmG strains. The levels of expression of vpsL in the ΔalmEFG strain are similar to the levels observed in the ΔalmE strain. Upregulation of vpsL in the ΔcarR, ΔalmE, and ΔalmEFG strains correlates with an increased ability to form biofilms.

FIG 5.

Analysis of vpsL expression in alm mutants. The expression of a vpsLp-lux transcriptional fusion was determined in wild-type, ΔcarR, ΔalmE, ΔalmF, ΔalmG, and ΔalmEFG strains. The data represent the mean expression (relative luminescence units [RLU]) of four replicates from two independent experiments. The negative control, A1552 wild type harboring vector only, reflects the background luminescence obtained from the promoterless pBBRlux plasmid. Statistical significance was determined using a one-way ANOVA and Dunnett's multiple-comparison test. Asterisks indicate P values of <0.01. Error bars represent standard deviations.

DISCUSSION

V. cholerae is exposed to many environmental stresses in the human intestine, including changes in nutrient quality and quantity, oxygen levels, pH, temperature, bile, osmolarity, and host antimicrobial peptides. We report that CarR, the response regulator of the CarRS TCS, regulates resistance to the antimicrobial peptide polymyxin B in V. cholerae. Thus, V. cholerae, similarly to S. enterica serovar Typhimurium and P. aeruginosa, uses TCSs to regulate expression of genes involved in lipid A modification, and these pathways contribute to antimicrobial peptide resistance.

Our previous work showed that the expression of carRS and almEFG genes is downregulated in cells grown in LB medium supplemented with Ca²⁺. Thus, we analyzed the effect of Ca²⁺ on polymyxin B resistance using polymyxin B killing assays and Etest gradient polymyxin B strips. We observed no significant difference in survival after exposure to polymyxin B when the wild-type A1552 strain was grown to exponential phase in LB alone or LBCa²⁺. However, when we determined the MIC after 24 h of growth on LB and LBCa²⁺ agar plates, MIC was increased in strains grown in the presence of Ca²⁺. The observed differences in polymyxin B sensitivity in the two assays are likely due to the different growth states of the cells at the time of exposure to polymyxin B. It is important to note that a significant increase in MIC was also observed when the ΔcarR and ΔalmEFG strains were tested, indicating that Ca²⁺ levels modulate polymyxin B resistance independently of CarR and AlmEFG. At present, it is not known how divalent cations are sensed by V. cholerae. Activity of the histidine kinase PhoQ in S. enterica serovar Typhimurium is modulated by low extracellular concentrations of divalent cations Mg²⁺ and Ca²⁺. Furthermore, it was shown that the extracellular DNA component of S. enterica serovar Typhimurium biofilm matrix activates PhoPQ/PmrAB systems and antimicrobial resistance by chelation of Mg²⁺ (36). Similarly, in P. aeruginosa, Mg²⁺ limitation promotes biofilm formation in a PhoPQ-dependent manner through modulation of the levels of small regulatory RNAs controlling biofilm formation (37). Two predicted V. cholerae PhoPQ homologs (VCA1104-05 and VC1638-39) might be involved in sensing divalent cations and associated antimicrobial resistance phenotypes.

We found that CarR contributes to intestinal colonization in a strain-specific manner. While the absence of CarR resulted in a small colonization defect in the V. cholerae O1 El Tor C6706 strain, it did not alter colonization in the V. cholerae O1 El Tor A1552 strain. At present, the genomic variation(s) responsible for differences in colonization is not known. Genome-wide transcriptional analyses of V. cholerae grown in an infant mouse model of infection have shown that expression of carS (VC1319) is induced during infection (38). It is possible that CarRS, as an infection-induced TCS, affects adaptation to the host environment and to host antimicrobial peptides. Neonatal mice could produce the cathelin-related antimicrobial peptide (CRAMP) (39), and CarR could be involved in resistance to CRAMP. We determined that AlmEFG did not contribute to intestinal colonization. However, contribution of CarR or AlmEFG to the general response to antimicrobial peptides has yet to be evaluated. Alternatively, another gene(s) whose expression is controlled by CarR could contribute to intestinal colonization.

Modifications to LPS, the major component of the outer membrane of Gram-negative bacteria, have been shown to affect biofilm formation in P. aeruginosa and E. coli (40, 41). The impact of modifications to LPS on V. cholerae biofilm formation and biofilm physiology has not been previously studied. We found that mainly AlmE and, to a smaller extent, AlmF could downregulate biofilm formation. This would suggest that the absence of almE, but not necessarily the absence of glycine modification at lipid A, promotes an increase in biofilm formation and an upregulation of vpsL. It was proposed that AlmE functions as an amino acid ligase and AlmF functions as a glycine carrier protein. AlmE catalyzes glycine ligation as a thioester to the cognate carrier protein AlmF. AlmG then catalyzes the transfer of glycine to the unmodified hexa-acylated V. cholerae lipid A (5). AlmE was initially annotated as an enterobactin synthetase component F-related protein and harbors an amino acid adenylation domain found in nonribosomal peptide synthetases (NRPS) involved in the biosynthesis of siderophores. AlmF shows structural similarity to acyl-acyl carrier protein (ACP) (5). NRPS act in conjunction with peptidyl carrier proteins (PCPs) or aryl carrier proteins (ArCPs). It is possible that in addition to their role in the synthesis of glycine-modified lipid A species, AlmE and AlmF could participate in the biosynthesis of a novel compound that affects biofilm formation. The biochemical characterization of AlmEFG and the substrate specificity for these proteins have to be assessed to gain a complete understanding of the role of AlmEFG proteins in V. cholerae biofilm formation. Further work is also needed to understand which environmental signals are sensed by the CarRS TCS to control almEFG expression and in turn antimicrobial resistance and biofilm formation.