Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Mar 6.
Published in final edited form as: Int J Artif Organs. 2009 Sep;32(9):611–620. doi: 10.1177/039139880903200910

Surface protein EF3314 contributes to virulence properties of Enterococcus faecalis

ROBERTA CRETI 1,*, FRANCESCA FABRETTI 1,#, STEFANIE KOCH 3,§, JOHANNES HUEBNER 2,3, DANIELLE A GARSIN 4, LUCILLA BALDASSARRI 1, LUCIO MONTANARO 5,6, CARLA RENATA ARCIOLA 5,6
PMCID: PMC4351668  NIHMSID: NIHMS667939  PMID: 19856273

Abstract

Purpose

Identification of putative new virulence factors as additional targets for therapeutic approaches alternative to antibiotic treatment of multi-resistant enterococcal infections.

Methods

The EF3314 gene, coding for a putative surface-exposed antigen, was identified by the analysis of the Enterococcus faecalis V583 genome for LPXTG-motif cell wall anchor surface protein genes. A non-polar EF3314 gene deletion mutant in the E. faecalis 12030 human clinical isolate was obtained. The wild type and the isogenic mutant strain were investigated for biofilm formation, adherence to Hela cells, survival in human macrophages and a Caenorhabditis elegans infection model. The aminoterminal portion of the EF3314 protein was overexpressed in E. coli to obtain mouse polyclonal antibodies for use in Western blotting and immunolocalization experiments.

Results

The EF3314 gene has an unusually high GC content (46.88% vs. an average of 37.5% in the E. faecalis chromosome) and encodes a protein of 1744 amino acids that presents a series of 14 imperfect repeats of 90 amino acids covering almost the entire length of the protein. Its global organization is similar to the alpha-like protein family of group B streptococci, enterococcal surface protein Esp and biofilm associated protein Bap from S. aureus. The EF3314 gene was always present and specific for E. faecalis strains of human, food and animal origin. Differences in size depended on variable numbers of repeats in the repetitive region.

Conclusions

EF3314 is a newly described, surface exposed protein that contributes to the virulence properties of E. faecalis.

Keywords: E. faecalis, Surface protein, Adhesion, Biofilm, C. elegans infection model

INTRODUCTION

Enterococci are commensals of the human and animal intestinal microflora that have emerged as an important cause of nosocomial infections; the most frequently isolated species is Enterococcus faecalis, often in association with implanted medical devices (1–4). The increasing occurrence of enterococci resistant to antibiotics of the last resort against gram-positive infections has fueled research on the molecular mechanism underlying the innate and acquired resistance of enterococci toward antimicrobials agents (5–7). As an opportunistic pathogen, E. faecalis does not possess unequivocal virulence factors like toxins and hydrolytic enzymes; some proteins/enzymes are commonly recognized as virulence factors and the knowledge of their specific role in the pathogenesis and contribution to the establishment of infection is increasing (8–11). Rather than the presence of a specific virulence factor, it is the total number of virulence factors possessed by an E. faecalis strain that appears to be correlated to its source of isolation (12). This can be partially explained by the concentration of virulence factors in a pathogenicity island identified in E. faecalis strains mainly present in nosocomial settings (13, 14). This enterococcal subpopulation appear to colonize new niches of the gastro-intestinal tract of patients within few days of admission to a hospital following antibiotic treatment (15). Much attention has been recently given to the possible involvement of biofilm production by E. faecalis in the infectious process (16–22).

The possibility to explore available sequenced genomes looking for potential new virulence determinants is a very important chance to speed up the research on novel therapeutic strategies. We previously identified a new cell wall surface anchor protein gene, EF3314, that was always present among E. faecalis clinical strains (12). In the present study, we confirmed that the EF3314 gene is species-specific and present in E. faecalis isolates of human, food and animal origin, with differences in size depending on the repetitive region. Additionally, we showed that EF3314 is a surface protein and affects virulence in both human cell and C. elegans infection models.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media

E. faecalis cells were grown without agitation in Todd-Hewitt broth (THB; Becton Dickinson, Franklin Lakes, NJ, USA) or tryptic soy broth (TSB; Becton Dickinson, Franklin Lakes, NJ, USA). For specific purposes they were grown in Biofilm Medium (BFM; 17 g of pancreatic digest of casein, 5 g of NaCl, 3 g of yeast extract, and 2.5 g of dipotassium phosphate per liter) with the addition of 1% glucose when indicated (BFM-G). Escherichia coli strains were cultured aerobically in Luria-Bertani (LB) broth or LB agar at 37°C.

Kanamycin at 50 μg/mL and ampicillin at 100 μg/mL (Sigma Chemicals, Milan, Italy) were used where appropriate for E. coli; kanamycin 2000 μg/mL was used for E. faecalis.

DNA manipulations

Genomic DNA preparations from enterococci were prepared by using the Qiagen DNeasy Tissue Kit (Milan, Italy), according to the manufacturer’s instructions. Plasmid DNA was prepared from E. coli by the use of QIAprep Spin miniprep (Qiagen). DNA was purified from agarose gels and from polymerase chain reactions (PCRs) by the use of the QIAquick Gel Extraction Kit or the PCR Purification Kit (Qiagen), according to the manufacturer’s instructions. Restriction enzymes and modifying enzymes were obtained from Invitrogen (Carlsbad, CA, USA)) or New England Bio-labs (Ipswich, MA, USA). Custom primers were ordered from Invitrogen. Electrocompetent enterococci preparation and electroporation (Bio-Rad Gene Pulser II; Bio-Rad, Hercules, CA, USA) were performed according to established protocols (23).

All other methods (DNA ligations, electrophoresis, and transformation of competent E. coli) were performed by use of standard techniques (24). For amplification of large DNA fragments (>5 kb) or high fidelity amplification for expression vector cloning, the Elongase mix from Invitrogen was used according to the manufacturer’s instructions.

Construction of a nonpolar deletion mutant

A non-polar deletion of the N-terminal portion of the EF3314 gene was created by use of a established methodology (25). Primers 7 and 8 were used to amplify the region from − 690 to + 54 of the EF3314 gene and primers 9 and 10 to amplify the region from pos. + 480 to + 1071 (Tab. II). Primers 8 and 9 contained a 21-bp complementary sequence (underlined in Tab. II). Overlap-extension PCR was used to create a PCR product from pos. − 690 to pos. + 1071 lacking a portion of the N-terminal region of the EF3314 gene (from pos. + 54 to + 480). This fragment was cloned into pCRII vector (Invitrogen) and cut with the restriction enzymes SpeI and XhoI. The construct was inserted into the mutagenesis vector pTEX4577 (23). The resulting plasmid was transformed into E. faecalis 12030 strain (18) by electroporation, and integrants were selected on TSB plates with kanamycin. A single colony was picked, and the insertion of plasmid into the chromosome was confirmed by PCR using the high-fidelity Elongase mix. The integrant was passaged 10 times in liquid culture without antibiotics at the permissive temperature, and colonies were replica-plated to screen for loss of kanamycin resistance. The excision of the plasmid created either a reconstituted wild-type strain or led to an allelic replacement with the interrupted sequence in the chromosome. The deletion mutant created was designated E. faecalis 12030ΔEF3314 and was confirmed by PCR by use of primers 3 and 4 (Tab. II) and by automated sequencing of the PCR product.

Production of the N-terminal portion EF3314 recombinant protein

The N-terminal portion of the EF3314 gene was amplified by PCR from primers 5 and 6 (Tab.II) with high-fidelity Elongase mix and inserted into BamHI – SalI linearized pQE30 vector (Qiagen) to place the 6X histidine (His)-affinity tag at the amino-terminal of the fusion protein. The recombinant plasmid was sequenced to verify that the correct open reading frame had been maintained and used to transform E. coli M15 (pREP4) competent cells for the isopropyl-beta-D-thiogalactoside (IPTG) inducible expression of the His-tagged N-terminal portion of the EF3314 protein. When the culture reached an OD600 of 0.7, IPTG was added to a final concentration of 1.5 mM to induce expression. E. coli M15 cells transformed with the recombinant pQE16 plasmid encoding the mouse (His)-tagged 16 kDa dihydrofolate reductase protein were used as the positive control. To follow the time course of the protein production, 1 mL samples of E. coli M15 cultures were collected at times 0, 2, and 4 hours by centrifugation and boiled for 3 minutes in loading buffer. A 20 μL volume of each sample was subjected to 12% SDS-PAGE and proteins were visualized by staining with Coomassie Blue.

For protein purification, E. coli M15 cells expressing the recombinant EF3314 protein portion were collected after incubation for 5 hours with IPTG. The bacteria were disrupted according to the manufacture’s instructions. To remove cell debris, the samples were centrifuged and the supernatants were applied to a nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography column (Qiagen). All purification steps were performed in denaturing conditions according to the manufacturer’s instructions.

Peptide sequencing and preparation of the anti-EF3314 polyclonal serum

The identity of the recombinant protein was confirmed by Edman degradation of the first 17 amino acids corresponding to the pEQ30 tag (MRGHHHHHHGS) plus the first six amino acids (SVTSGT) of the purified EF3314 protein portion. BALB/c mice were immunized with the recombinant EF3314 protein for the production of polyclonal antisera by Primm.

SDS-PAGE and immunoblotting

E. faecalis cells were disrupted by sonication at 4°C for 6 minutes (1 min cycles with 1 min cooling intervals). Recombinant EF3314 and E. faecalis crude extracts were subjected to SDS-PAGE in separating acrylamide gels (Bio-Rad) 10% W/v and the proteins were visualized by staining with Coomassie Blue as described previously (24). Separated proteins were transferred on to nitrocellulose membrane in a Trans-Blot SD module (Bio-Rad). Nitrocellulose sheets were blocked for 1 hour at 37°C in PBS containing Non-Fat Dry Milk (Bio-Rad) 5% w/v and incubated for 2 hours at room temperature with the mouse anti-EF3314 serum diluted 1:50 in PBS. After washing in TTBS (Tween 20 0.05% v/v in TBS), the sheets were incubated for 1 hour at room temperature with goat anti-mouse IgG alkaline-phosphatase conjugate diluted 1:1000 with PBS and then washed again in TTBS. Binding of the enzyme-conjugated antibodies was detected with the AP color development reagent and fast red (Bio-Rad).

Biofilm plate assay

Overnight cultures grown either in BFM alone or BFM-G were diluted 1:10 and inoculated into polystyrene microtiter plates (Costar, Milan, Italy) in BFM-G (−/+ G, +/+ G conditions) at 37°C for 18 hours. Enterococci were tested for production of biofilm according to the protocol previously described by the authors (26, 27). Biofilm formation was normalized to growth with the biofilm index, calculated as ODbiofilm x 0.5/ODgrowth (28).

Immunoelectron microscopy

Immune mouse serum raised against purified recombinant 3314 protein was used as primary antibody for protein localization. Bacterial pellets from overnight cultures were washed three times with PBS. Drops of bacterial suspensions were placed on carbon-coated grids and air dried. Primary antibody was applied diluted 1:100 in PBS supplemented with 1% BSA and 0.05% Tween 20 for 30 minutes at 37°C. Preimmune mouse serum was used as control. After washing with PBS/BSA, 10 nm-gold-conjugated protein G was used at a dilution of 1:500 and incubated for 30 minutes at room temperature. After washing, samples were examined without further staining, by a Philips 208 electron microscope.

Adherence to HeLa cell monolayer and THP-1 survival test

A standard adhesion assay was performed as previously described (9). Briefly, HeLa cells were seeded at 5×104 per well, on sterile glass coverslips placed into 24-well plates, 24 hours before infection. Semiconfluent monolayers (2×105 cells/well) were inoculated with stationary phase bacterial suspensions normalized at different bacteria-to-cell ratios. After incubation for 1 or 2 hours at 37°C and/or 4°C in a modified atmosphere of 5% CO2, monolayers were washed five times with PBS and lysed for 5 minutes with 1% Triton X-100. Viable bacteria were quantified by plating aliquots of serial dilutions on trypticase soy agar (TSA).

THP-1, a myelomonocytic human cell line expressing Fc and C3b receptors, was maintained in RPMI 1640 medium supplemented with 10% FCS and 2 mM glutamine in an atmosphere of 95% air and 5% CO2. Cells were differentiated by incubation with phorbol miristate acetate (0.16 μM; Sigma) for 24 hours at 37°C in 24- or 96-well plates, as described by Scorneaux et al (29). Macrophages were infected for 1 hour at 37°C, thoroughly washed with PBS, and further incubated for 3 and 24 hours in medium supplemented with 10% FCS and gentamycin 250 μg/mL. At the different time points, duplicate wells were washed and lysed with 0.1% Triton X-100 in PBS for 5 minutes. Lysates were diluted in PBS and plated on TSB agar plates to quantify viable bacteria. Throughout the experiment, viability of cells was confirmed by trypan blue dye exclusion and counting with an hemocytometer.

Results are reported as the percentage of the inoculum recovered after infection. All assays were conducted in duplicate and repeated independently at least three times.

Assay of C. elegans killing

Assay conditions as well as statistical evaluation were performed as already described (30, 31). In brief, a synchronized population of N2 wildtype worms were grown on NG plates containing a lawn of OP50 (standard conditions for laboratory growth of C. elegans). At the L4 stage the worms were moved onto BHI (Brain Heart Infusion) plates containing a lawn of either E. faecalis 12030 or its isogenic mutant strain. Nalidixic acid (10 μg/mL) was added to the medium to selectively prevent growth of E. coli. The number of dead and alive worms was counted once a day, and the dead ones were removed. Sixty to ninety worms were used in each replicate of the experiment. The data was analyzed using GraphPadPrism 3.0 (GraphPad Software, San Diego, CA, USA). Survival was plotted by the Kaplan-Meier method and the curves compared using the log-rank test, which generates a p-value testing the null hypothesis that the survival curves are identical. P-values less than 0.05 were considered statistically significant.

RESULTS

Structural features of the deduced EF3314 protein

The E. faecalis V583 EF3314 gene consists of 5495 base pairs and possesses an unusually high GC content (46.88% vs. an average of 37.5% in the E. faecalis chromosome). The deduced protein sequence is 1744 amino acids long and presents features characteristic of gram-positive surface adhesins: a signal sequence directing export of the mature protein outside the cytoplasm corresponding to the first 60 amino acids; an N-terminal region of 300 amino acids; a series of 14 imperfect repeats of 90 amino acids covering almost the entire length of the protein; and a LPX-TG-motif cell wall anchor domain at the C-terminal portion (Fig. 1A). The first three repeats are identical while the others present some variations in the amino acid composition (Fig. 1B). The global organization of the EF3314 protein is similar to other gram-positive repeat-containing proteins like the alpha-like protein family of group B streptococci (32), the enterococcal surface protein Esp and the biofilm associated protein Bap from S. aureus (33).

Fig. 1.

Fig. 1

Open in a new tab

Structure of the EF3314 deduced protein (A). Alignment of the 90 amino acid repeat units present in the V583 EF3314 protein. Identical or similar amino acids between the units are highlighted in dark and light grey, respectively (B).

The search for similar protein sequences in the data bank using either FASTA3 and Blastp programs retrieved as first hits a putative surface protein of Lactococcus lactis subsp. cremoris (38.9% identity, 73% similarity) and the Staphylococcus aureus biofilm associated protein Bap (31.8% identity, 66.7% similarity) restricted, in this case, to the repeat and carboxy-terminal region of the proteins, while the N-terminal portion was distinctive.

Distribution and expression of EF3314 protein among E. faecalis isolates

The N-terminal portion of the protein EF3314 corresponding to the amino acid positions 61–357 was over-expressed in E. coli. The signal sequence was avoided as well as the repeat region for maximizing the expression of the heterologous protein. The recombinant protein was successfully expressed by introducing the His-tag at the N-terminal portion while poor levels were obtained when the His-tag was placed at the C-terminus (data not shown).

Mouse polyclonal anti-EF3314 serum raised against the purified N-terminal portion of the EF3314 protein specifically reacted with the recombinant portion of the EF3314 protein (Fig. 2A). We previously reported that the EF3314 gene is E. faecalis-specific and present in all isolates tested so far (12). To verify whether this gene was expressed, total protein extracts from twenty randomly chosen strains were examined by Western blot with the mouse polyclonal anti-EF3314 serum. All strains examined showed the appropriate band (Fig. 2B). Mouse serum was also used to verify the presence of the protein on the bacterial surface by immunoelectron microscopy (Fig. 3).

Fig. 2.

Fig. 2

Open in a new tab

Western immunoblotting of recombinant EF3314 protein (A) and of selected E. faecalis sonicates (B), after separation by SDS-PAGE, using hyperimmune mouse polyclonal EF3314 serum. In column 1 of panel A pre-immune serum was used. Columns M indicate the molecular markers in kDa: Precision Plus Protein Standards (Bio-Rad, panel A) and SeeBlue Plus2 pre-stained standard (Invitrogen, panel B).

Fig. 3.

Fig. 3

Open in a new tab

Immunolocalization of the EF3314 protein. Polyclonal mouse antiserum raised against the recombinant EF3314 protein recognized a specific target on the bacterial surface of E. faecalis 12030 strain, evidentiated by arrows (B) but not on its isogenic deletion mutant (A).

Biofilm assay of parental and mutant strain

No differences in biofilm formation were observed between E. faecalis 12030 and its isogenic mutant when grown in conditions that were not favorable to biofilm formation, i.e. when 1% glucose was present since the first overnight growth (+/+G) (34). When the additional carbon source was added only in the second overnight subculture growth (−/+ G), significantly less biofilm was formed by the 12030Δ3314 compared to the wild type (Fig. 4A).

Fig. 4.

Fig. 4

Open in a new tab

Comparison between E. faecalis 12030 strain and its isogenic deletion mutant in biofilm formation (A), adherence on HeLa epithelial cells (B), and survival in human THP-1 macrophages (C). Conditions −/+ G and +/+ G are described in the text.

Adherence to HeLa cells and survival in macrophages of parental and mutant strain

The ability of E. faecalis 12030 strain and its isogenic deletion mutant to adhere to HeLa cells was tested by allowing the bacteria to adhere for either one or two hours. While no significant differences were observed at 1 hour post-infection, after two hours the rate of attachment of the deletion mutant strain was significantly lower than the 12030 strain (Fig. 4B). To evaluate whether the differential attachment to epithelial cells would translate into a differential survival ability of the 12030Δ3314 mutant strain compared to the wild type, the interaction of both strains was tested with professional phagocytes, i.e. THP-1 cells. As predicted, significantly higher adherence and survival rates of 12030 were observed compared to the EF3314 deletion mutant derivative (Fig. 4C).

C. elegans infection model

To see if the 12030:3314 significantly affected pathogenesis in an animal model we infected C. elegans with strain 12030 as well as the isogenic mutant 12030ΔEF3314. It has previously been shown that a number of E. faecalis virulence determinants that affect pathogenesis in mammalian models also affect pathogenesis in the worm model by causing death to occur significantly more slowly than a wildtype isogenic strain (30, 31, 35). A synchronized population of wildtype C. elegans was grown to the L4 stage and then placed on lawns of 12030ΔEF3314 and 12030 where they become infected by consuming the pathogens. Survival over time was followed by counting the number of worms alive and dead at approximately 24-hour intervals. C. elegans feeding on strain 12030ΔEF3314 died significantly more slowly compared to those infected with the wild type 12030 strain (Fig. 5) with a p-value of 0.0010. These data suggest that EF3314 contributes positively to the pathogenic process in C. elegans.

Fig. 5.

Fig. 5

Open in a new tab

C. elegans killing by E. faecalis 12030 and 12030ΔEF3314 strains. A significant attenuation in the killing was observed when nematodes were fed on lawns of E. faecalis 12030 (solid line) compared to the isogenic deletion mutant strain (dotted line). Survival was plotted by the Kaplan-Meier method and the curves compared using the log-rank test, generating a p-value equal to 0.0010. This experiment was repeated three times with similar results.

DISCUSSION

The ability of E. faecalis to cause infection in humans has become of particular relevance primarily in the hospital environment, where enterococci resistant to multiple antibiotics are leading nosocomial pathogens of urinary tract, bloodstream and surgical-wound infections (16).

Enterococcal genomic studies are unraveling the factors involved in transforming a commensal into a pathogen. The analysis of the genome sequence of E. faecalis V583 strain, the first vancomycin-resistant clinical isolate reported in the United States, demonstrated that, in addition to antibiotic resistance, the strain had also acquired a number of genes conferring infectivity and virulence encoded within a pathogenicity island (13–15, 36). A recent comparative genomics study revealed that there is variation in the penetration of antibiotic resistance determinants and virulence traits within the major E. faecalis lineages (37).

By the analysis of the V583 genome sequence for the identification of new surface-associated proteins as potentially exposed antigens and/or as factors that may influence the ability of enterococci to colonize host tissues or implanted medical devices, we have focused our studies on a chromosomal gene, EF3314 encoding a LPTXG motif anchor membrane protein.

The EF3314 gene possesses an unusually high GC content (46.88% vs. 37.5% average). Generally a higher GC content in genomic regions is due to constraints on nucleotide bias at replication origins or at the ribosomal RNAs operons (38), but, when present in protein-coding genes, is often a sign of a lateral gene transfer event.

On the other hand, the higher GC content of the EF3314 gene compared to the E. faecalis genome could be attributed to intrinsic characteristics of the EF3314 gene. In fact, while the GC content of the first and third codon positions of the EF3314 gene (53.7% and 31.2%) is not different from the GC content of the first and third codon positions of all the E. faecalis coding regions (48.7% and 30.4%), there is a significant difference between the EF3314 second codon positions (55.7 %GC content) and second codon positions of the rest of the genome coding regions (34.7 % GC content). The second codon position is distinctive for each amino acid (39) and indeed the EF3314 protein is rich in amino acids (Ser, Ala, Thr, Gly) whose second codon position is G or C, constituting up to 49.4% of the amino acid content.

The highest homology of the deduced EF3314 protein was with a hypothetical surface protein gene identified both in Lactobacillus lactis subsp. cremoris MG1363 and SK11 genomes (40). Annotation describes the deduced protein (1349 amino acids) as a subtilisin-like serine protease, yet no experimental evidence of its function has been reported. The EF3314 protein also presents a lower but significant sequence homology with the S. aureus biofilm-associated protein (Bap) as well as gram-negative surface proteins: a 6310 aa hypothetical surface adhesion protein of Pseudomonas putida (60.3% GC genomic content, 30.2% amino acid identity) and 1578 aa putative outer membrane ligand of Bordetella bronchiseptica (63.0 %GC content, 28.9 % identity). The gene organization of the chromosomal region comprising the E. faecalis EF3314 gene and Lactococcus, Bordetella and Pseudomonas genomes are not comparable and, for this reason, the hypothesis of a lateral gene transfer between high %GC gram-negative and low %GC gram-positive bacteria cannot be demonstrated.

As pointed out above, the structural organization of the EF3314 protein is similar to other well characterized gram-positive cell surface proteins (S. aureus Bap protein, E. faecalis surface protein Esp), whose involvement in biofilm formation and adhesion has been hypothesized (33, 41, 42). Additionally, there is similarity to the alpha-like proteins of group B streptococci that promote S. agalactiae invasion of epithelial cells by interaction with host cell glycosaminoglycans and are involved in the first step of infection (43, 44). These proteins exhibit size variability, also within the same strain, probably as a means to evade the human immune system (32, 33, 45). We have previously demonstrated that the EF3314 gene is always present in all the E. faecalis isolates tested and is E. faecalis-specific (12). Analysis of different E. faecalis strains demonstrated that the EF3314 gene exhibits size variability depending on a variable number of the internal repeat units (data not shown).

Furthermore, the nucleotide portion of the 12030 EF3314 gene, utilized for the expression experiments, was sequenced and compared to the corresponding region of the V583 EF3314 gene (pos. 183 – 1071). Fifteen nucleotide differences, of which three leading to nonsynonymous amino acid substitutions were observed, demonstrating a polymorphism of the EF3314 protein among E. faecalis strains. It will be useful to investigate whether these amino acid differences may contribute to a difference in the properties of EF3314 proteins.

Based on the immunolocalization results and the functional properties of the homologous proteins, we investigated the role of the EF3314 protein as a possible surface-exposed virulence factor. E. faecalis is often isolated from biofilms on the surfaces of indwelling medical devices (4). The development of biofilm is a multi-step and multi-factorial process; the dissection and elucidation of the factors involved in each stage are difficult and sometimes controversial (46). The identification of a molecular mechanism contributing to E. faecalis biofilm production have been recently reported (22, 27). According to our experimental results, EF3314 may be reasonably considered a new E. faecalis cell-anchor surface protein implicated in biofilm formation. The specific step in which the EF3314 protein enters the biofilm formation process is still unknown; however, because the lack of the EF3314 protein renders the isogenic deletion mutant strain significantly less capable of forming biofilm in favorable growth conditions, it is possible that the EF3314 protein plays a role in the biofilm tridimensional architecture.

The EF3314 protein may also be involved in the early interaction steps with epithelia. Within the first hour of contact between human epithelial cells and the 12030 strain or its isogenic deletion mutant, there are no significant differences in the number of bacteria attached to the cell surface but when, after two hours, specialized structures are presumably expressed and exposed on the bacterial surfaces (47, 48), the 12030ΔEF3314 strain is less effective in the attachment than the wild type strain. These data led to the hypothesis that the EF3314 protein actively contributes to the specific recognition of, and adherence to, the human host epithelium. The possible role of the EF3314 surface protein as a new E. faecalis adhesin is also suggested by the lower adherence rate and survival in macrophages by the isogenic deletion mutant compared to the wild type 12030 strain.

The infection animal model supported the hypothesis of a contribution of the EF3314 protein to the E. faecalis virulence. An attenuated killing of C. elegans was observed when fed with the E. faecalis deletion mutant, indicating the EF3314 protein is a potential virulence determinant affecting pathogenesis in the worm.

In conclusion, this study investigated the characteristics and function of a new large repetitive surface protein of E. faecalis, EF3314, and presented evidence that this protein may contribute to the virulence properties of E. faecalis by influencing the interaction between the bacterium and its host.

TABLE I.

PRIMER SEQUENCES USED IN THIS STUDY

Primer Name Sequence (5′ → 3′) a Position with respect to the first nucleotide of V583 EF3314 gene
1 EF3314-F AGAGGGACGATCAGATGAAAAA + 36
2 EF3314-R ATTCCAATTGACGATTCACTTC + 602
3 EF3314 Ro2 left CTTCCTCATTTTCCTCTCATTGG − 206
4 EF3314 Ro5 right GCACTTTCACTGCTTGTTCCTTCG + 58 after the stop codon
5 EF3314-BAMHI GGGAAAGGATCCGTTACCTCTGGCACAATCAGT + 184
6 EF3314-SALI GGGAAAGTCGACGGATACACCGTCTGCTGTTGC + 1072
7 EF3314-1 GCCTATGGAAAGGTCTCAAGAG − 690
8 EF3314-2 ACTAGCGCGGCCGCTTGCTCCTTTCATCTGATCGTCCCTCTTT + 54
9 EF3314-3 GGAGCAAGCGGCCGCGCTAGTACTGCCGTTTTGAATGCAGCC + 480
10 EF3314-4 GGATACACCGTCTGCTGTTGC + 1071
Open in a new tab
a

Nucleotides in bold represent the restriction cloning sites; the underlined nucleotides represent the 21-bp overlap used in the overlap-extension PCR.

Acknowledgments

This work was partially supported by the National Health Ministry 1% project Q1I to LB.

Footnotes

Conflict of interest statement

None of the authors have a financial interest in any of the products or devices described in this article.

References

  • 1.Murray BE, Weinstock GM. Enterococci: new aspects of an old organism. Proc Assoc Am Physicians. 1999;111:328–34. doi: 10.1046/j.1525-1381.1999.99241.x. [DOI] [PubMed] [Google Scholar]
  • 2.Koch S, Hufnagel M, Huebner J. Treatment and prevention of enterococcal infections - alternative and experimental approaches. Expert Opin Biol Ther. 2004;7:439–44. doi: 10.1517/14712598.4.9.1519. [DOI] [PubMed] [Google Scholar]
  • 3.Ruiz-Garbajosa P, del Campo R, Coque TM, Asensio A, Bonten M, Willems R, Baquero F, Cantón R. Longer intestinal persistence of Enterococcus faecalis compared to Enterococcus faecium clones in intensive-care-unit patients. J Clin Microbiol. 2009;47:345–51. doi: 10.1128/JCM.01597-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Baldassarri L, Creti R, Montanaro L, Orefici G, Arciola R. Pathogenesis of implant infections by enterococci. Int J Artif Organs. 2005;28:1101–9. doi: 10.1177/039139880502801107. [DOI] [PubMed] [Google Scholar]
  • 5.Shepard BD, Gilmore MS. Antibiotic-resistant enterococci: the mechanisms and dynamics of drug introduction and resistance. Microbes Infect. 2002;4:215–24. doi: 10.1016/s1286-4579(01)01530-1. [DOI] [PubMed] [Google Scholar]
  • 6.Werner G, Coque TM, Hammerum AM, et al. Emergence and spread of vancomycin resistance among enterococci in Europe. Euro Surveill. 2008;13:19046. [PubMed] [Google Scholar]
  • 7.Arias CA, Murray BE. Emergence and management of drug-resistant enterococcal infections. Expert Rev Anti Infect Ther. 2008;6:637–55. doi: 10.1586/14787210.6.5.637. [DOI] [PubMed] [Google Scholar]
  • 8.Baldassarri L, Creti R, Recchia S, et al. Virulence factors in enterococcal infections. Int J Artif Organs. 2006;29:402–6. doi: 10.1177/039139880602900410. [DOI] [PubMed] [Google Scholar]
  • 9.Baldassarri L, Bertuccini L, Creti R, et al. Glycosaminoglycans mediate invasion and survival of Enterococcus faecalis into macrophages. J Infect Dis. 2005;191:1253–62. doi: 10.1086/428778. [DOI] [PubMed] [Google Scholar]
  • 10.Park SY, Shin YP, Kim CH, et al. Immune evasion of Enterococcus faecalis by an extracellular gelatinase that cleaves C3 and iC3b. J Immunol. 2008;181:6328–36. doi: 10.4049/jimmunol.181.9.6328. [DOI] [PubMed] [Google Scholar]
  • 11.Cox CR, Coburn PS, Gilmore MS. Enterococcal cytolysin: a novel two component peptide system that serves as a bacterial defense against eukaryotic and prokaryotic cells. Curr Protein Pept Sci. 2005;6:77–84. doi: 10.2174/1389203053027557. [DOI] [PubMed] [Google Scholar]
  • 12.Creti R, Imperi M, Bertuccini L, et al. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J Med Microbiol. 2004;53:13–20. doi: 10.1099/jmm.0.05353-0. [DOI] [PubMed] [Google Scholar]
  • 13.Shankar N, Baghdayan AS, Gilmore MS. Modulation of virulence within pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature. 2002;417:746–50. doi: 10.1038/nature00802. [DOI] [PubMed] [Google Scholar]
  • 14.McBride SM, Coburn PS, Baghdayan AS, et al. Genetic variation and evolution of the pathogenicity island of Enterococcus faecalis. J Bacteriol. 2009;191:3392–402. doi: 10.1128/JB.00031-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gilmore MS, Ferretti JJ. The thin line between gut commensal and pathogen. Science. 2003;299:1999–2002. doi: 10.1126/science.1083534. [DOI] [PubMed] [Google Scholar]
  • 16.Creti R, Koch S, Fabretti F, Baldassarri L, Huebner J. Enterococcal colonization of the gastro-intestinal tract: role of biofilm and environmental oligosaccharides. BMC Microbiol. 2006;6:60–8. doi: 10.1186/1471-2180-6-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fabretti F, Huebner J. Implant infections due to enterococci: role of capsular polysaccharides and biofilm. Int J Artif Organs. 2005;28:1079–90. doi: 10.1177/039139880502801105. [DOI] [PubMed] [Google Scholar]
  • 18.Theilacker C, Sanchez-Carballo P, Toma I, et al. Glycolipids are involved in biofilm accumulation and prolonged bacteraemia in Enterococcus faecalis. Mol Microbiol. 2009;71:1055–69. doi: 10.1111/j.1365-2958.2008.06587.x. [DOI] [PubMed] [Google Scholar]
  • 19.Tendolkar PM, Baghdayan AS, Shankar N. Putative surface proteins encoded within a novel transferable locus confer a high-biofilm phenotype to Enterococcus faecalis. J Bacteriol. 2006;188:2063–72. doi: 10.1128/JB.188.6.2063-2072.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Di Rosa R, Creti R, Venditti M, et al. Relationship between biofilm formation the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol Lett. 2006;256:145–50. doi: 10.1111/j.1574-6968.2006.00112.x. [DOI] [PubMed] [Google Scholar]
  • 21.Arciola CR, Baldassarri L, Campoccia D, et al. Strong biofilm production, antibiotic multi-resistance and high gelE expression in epidemic clones of Enterococcus faecalis from orthopaedic implant infections. Biomaterials. 2008;29:580–6. doi: 10.1016/j.biomaterials.2007.10.008. [DOI] [PubMed] [Google Scholar]
  • 22.Ballering KS, Kristich CJ, Grindle SM, Oromendia A, Beattie DT, Dunny GM. Functional genomics of Enterococcus faecalis: multiple novel genetic determinants for biofilm formation in the core genome. J Bacteriol. 2009;191:2806–14. doi: 10.1128/JB.01688-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fiedler S, Wirth R. Transformation of Enterococcus faecalis and Enterococcus faecium by electroporation. In: Dunny GM, Cleary PP, McKay LL, editors. Genetics and molecular biology of streptococci lactococci and enterococci. Washington DC: American Society for Microbiology; 1991. p. 301. [Google Scholar]
  • 24.Ausubel FM, Brent R, Kingstone RE, et al., editors. Current protocols in Molecular Biology. New York, NY: John Wiley & Sons, Inc; 1998. [Google Scholar]
  • 25.Qin X, Teng F, Xu Y, Singh KV, Weinstock GM, Murray BE. Targeted mutagenesis of enterococcal genes. Methods Cell Sci. 1998;20:21–33. [Google Scholar]
  • 26.Baldassarri L, Cecchini R, Bertuccini L, et al. Enterococcus spp produces slime and survives in rat peritoneal macrophages. Med Microbiol Immunol (Berl) 2001;190:113–20. doi: 10.1007/s00430-001-0096-8. [DOI] [PubMed] [Google Scholar]
  • 27.Hufnagel M, Koch S, Creti R, Baldassarri L, Huebner H. A putative sugar-binding transcriptional regulator in a novel gene locus in Enterococcus faecalis contributes to production of biofilm and prolonged bacteremia in mice. J Infect Dis. 2004;189:420–30. doi: 10.1086/381150. [DOI] [PubMed] [Google Scholar]
  • 28.Deighton M, Borland R. Regulation of slime production in Staphylococcus epidermidis by iron limitation. Infect Immun. 1993;61:4473–9. doi: 10.1128/iai.61.10.4473-4479.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Scorneaux B, Ouadrhiri Y, Anzalone G, Tulkens PM. Effect of recombinant human gamma interferon on intracellular activities of antibiotics against Listeria monocytogenes in the human macrophage cell line THP-1. Antimicrob Agents Chemother. 1996;40:1225–30. doi: 10.1128/aac.40.5.1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Garsin DA, Sifri CD, Mylonakis E, et al. A simple model host for identifying Gram-positive virulence factors. Proc Natl Acad Sci USA. 2001;98:10892–7. doi: 10.1073/pnas.191378698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Maadani A, Fox KA, Mylonakis E, Garsin DA. Enterococcus faecalis mutations affecting virulence in the Caenorhabtidis elegans model host. Infect Immun. 2007;75:2634–7. doi: 10.1128/IAI.01372-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lachenauer CS, Creti R, Michel JL, Madoff LC. Mosaicism in the alpha-like protein genes of group B streptococci. Proc Natl Acad Sci USA. 2000;97:9630–5. doi: 10.1073/pnas.97.17.9630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Creti R, Baldassarri L, Montanaro L, Arciola CR. The Alpha-like surface proteins: an example of an expanding family of adhesins. Int J Artif Organs. 2008;31:834–40. doi: 10.1177/039139880803100912. [DOI] [PubMed] [Google Scholar]
  • 34.Jackson DW, Simecka JW, Romeo T. Catabolite repression of Escherichia coli biofilm formation. J Bacteriol. 2002;184:3406–10. doi: 10.1128/JB.184.12.3406-3410.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sifri CD, Mylonakis E, Singh KV, et al. Virulence effect of Enterococcus faecalis protease genes and the quorum-sensing locus fsr in Caenorhabditis elegans and mice. Infect Immun. 2002;70:5647–50. doi: 10.1128/IAI.70.10.5647-5650.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Paulsen IT, Banerjei L, Myers GS, et al. Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science. 2003;299:2071–4. doi: 10.1126/science.1080613. [DOI] [PubMed] [Google Scholar]
  • 37.McBride SM, Fischetti VA, LeBlanc DJ, Moellering RC, Jr, Gilmore MS. Genetic diversity among Enterococcus faecalis. Plos One. 2007;2:e582. doi: 10.1371/journal.pone.0000582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Faguy DM. The controlled chaos of shifty pathogens. Curr Biol. 2000;10:R498–501. doi: 10.1016/s0960-9822(00)00558-3. [DOI] [PubMed] [Google Scholar]
  • 39.Creti R, Ceccarelli E, Bocchetta M, et al. Evolution of translational elongation factor (EF) sequences: reliability of global phylogenies inferred from EF-1 alpha(Tu) and EF-2(G) proteins. Proc Natl Acad Sci U S A. 1994;91:3255–9. doi: 10.1073/pnas.91.8.3255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wegmann U, O’Connell-Motherway M, Zomer A, et al. Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol. 2007;189:3256–70. doi: 10.1128/JB.01768-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Toledo-Arana A, Valle J, Solano C, et al. The enterococcal surface protein Esp is involved in Enterococcus faecalis bio-film formation. Appl Environ Microb. 2001;67:4538–45. doi: 10.1128/AEM.67.10.4538-4545.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cucarella C, Solano C, Valle J, Amorena B, Lasa I, Penades JR. Bap a Staphylococcus aureus surface protein involved in biofilm formation. J Bacteriol. 2001;183:2888–96. doi: 10.1128/JB.183.9.2888-2896.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Li J, Kasper DL, Ausubel FM, Rosner B, Michel JL. Inactivation of the alpha C protein antigen gene bca by a novel shuttle/suicide vector results in attenuation of virulence and immunity in group B Streptococcus. Proc Natl Acad Sci USA. 1997;94:13251–6. doi: 10.1073/pnas.94.24.13251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Baron MJ, Filman DJ, Prophete GA, Hogle JM, Madoff LC. Identification of a glycosaminoglycan binding region of the alpha C protein that mediates entry of group B Streptococci into host cells. J Biol Chem. 2007;282:10526–36. doi: 10.1074/jbc.M608279200. [DOI] [PubMed] [Google Scholar]
  • 45.Madoff LC, Michel JL, Gong EW, Kling DE, Kasper DL. Group B streptococci escape host immunity by deletion of tandem repeat elements of the alpha C protein. Proc Natl Acad Sci USA. 1996;93:4131–6. doi: 10.1073/pnas.93.9.4131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Mohamed JA, Huang DB. Biofilm formation by enterococci. J Med Microbiol. 2007;56:1581–8. doi: 10.1099/jmm.0.47331-0. [DOI] [PubMed] [Google Scholar]
  • 47.Deighton M, Borland R. Regulation of slime production in Staphylococcus epidermidis by iron limitation. Infect Immun. 1993;61:4473–9. doi: 10.1128/iai.61.10.4473-4479.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Anderson JM, Marchant RE. Biomaterials: factors favoring colonization and infection. In: Waldvogel FA, Bisno AL, editors. Infections associated with indwelling medical devices. 3. Washington, DC: American Society for Microbiology; 2000. pp. 89–109. [Google Scholar]

RESOURCES