Abstract
Ethambutol (EMB) plays a pivotal role in the chemotherapy of drug-resistant tuberculosis (TB), including multidrug-resistant tuberculosis (MDR-TB). Resistance to EMB is considered to be caused by mutations in the embCAB operon (embC, embA, and embB). In this study, we analyzed the embCAB mutations among 139 MDR-TB isolates from China and found a possible association between embCAB operon mutation and EMB resistance. Our data indicate that 56.8% of MDR-TB isolates are resistant to EMB, and 82.2% of EMB-resistant isolates belong to the Beijing family. Overall, 110 (79.1%) MDR-TB isolates had at least one mutation in the embCAB operon. The majority of mutations were present in the embB gene and the embA upstream region, which also displayed significant correlations with EMB resistance. The most common mutations occurred at codon 306 in embB (embB306), followed by embB406, embA(−16), and embB497. Mutations at embB306 were associated with EMB resistance. DNA sequencing of embB306–497 was the best strategy for detecting EMB resistance, with 89.9% sensitivity, 58.3% specificity, and 76.3% accuracy. Additionally, embB306 had limited value as a candidate predictor for EMB resistance among MDR-TB infections in China.
INTRODUCTION
Multidrug-resistant tuberculosis (MDR-TB) is attributed to an estimated 3.7% new cases and 20.2% previously treated cases of TB annually worldwide and is becoming a major threat to global public health (1). In China, the significantly high prevalence (5.7% new cases and 25.6% previously treated cases) of MDR-TB makes TB control especially challenging (2). Ethambutol (EMB) is an important first-line anti-TB drug routinely recommended for therapy of drug-resistant TB, including MDR-TB. Disturbingly, in some regions of China, substantial proportions (51.3% to 66.7%) of MDR-TB isolates demonstrated EMB resistance (3–5). Development of new rapid and reliable molecular methods for detecting drug resistance is essential to optimize treatment regimens, prevent treatment failure, and thus reduce the further spread of drug-resistant isolates. However, these molecular assays require precise knowledge of the genetic mutations associated with drug resistance. Prior studies indicated that the characteristics of resistance-associated mutations vary in different regions (6, 7).
EMB acts against TB by inhibiting membrane-associated arabinosyl transferases encoded by the embCAB operon (including embC, embA, and embB), which are involved in the synthesis of cell wall arabinogalactan (8, 9). Approximately 50% to 70% of EMB-resistant TB isolates harbor mutations in a relatively short fragment (codons 306–497) in embB genes, with mutations occurring most frequently at codon 306 in embB (embB306), embB406, and embB497 (5, 8, 10–13). Sequence analysis of this fragment has been a tool for the rapid detection of EMB resistance. However, approximately one third of EMB-resistant isolates do not carry changes in this region and therefore are not detectable by using DNA sequencing (12, 14). Although other mutations in the embCAB operon were suggested to confer resistance (14–16), only limited data have been available until now in China, with most studies analyzing only a short fragment of the embB gene encompassing codons 306, 406, and 497 (3, 4, 17). In addition, some studies showed a widespread presence of mutations at these three codons among EMB-susceptible isolates (13, 18–20). The roles of mutations within embB306, embB406, and embB497 were uncertain. Thus, the aim of this study was to explore the mutations within the entire embCAB operon (nucleotide positions in H37Rv [GenBank accession number NC_000962]: 4239863–4249810) among 139 MDR-TB clinical isolates from 8 provinces in China and to find a possible association between embCAB operon mutation and EMB resistance.
MATERIALS AND METHODS
Ethical approval.
The study obtained approval from the ethics committee of the National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention. The patients with TB included in the present research were given a subject information sheet, and they all gave written informed consent to participate in the study.
Mycobacterium tuberculosis isolates.
A total of 139 epidemiologically unrelated MDR-TB strains, isolated from 139 patients (98 male; age range, 16 to 83 years; median age, 43.1 years) with pulmonary tuberculosis from 2008 to 2010 were collected. These MDR-TB isolates were obtained from eight provincial tuberculosis hospitals, including Fujian (19 isolates), Guangzhou (12 isolates), Guizhou (17 isolates), Liaoning (15 isolates), Beijing (14 isolates), Shaanxi (18 isolates), Shanghai (21 isolates), and Xizang (23 isolates). H37Rv (ATCC 27294) was used as a reference.
Drug susceptibility testing.
The Lowenstein-Jensen (L-J) proportion method (PM), recommended by the World Health Organization (21), was used to perform drug susceptibility testing (DST) with the following critical drug concentrations: 0.2 μg/ml isoniazid (INH), 40 μg/ml rifampin (RIF), and 2.0 μg/ml EMB. The results were read 28 days after inoculation of the media. H37Rv was used as a control with each batch of drug susceptibility testing.
DNA extraction and spoligotyping.
Genomic DNA was extracted from M. tuberculosis isolates according to the conventional cetyltrimethylammonium bromide (CTAB) method (22). Additionally, all isolates were analyzed by the spoligotyping method as previously described by Kamerbeek et al. (23). The results in binary format were entered in an Excel spreadsheet and compared with the spoligotyping database SpolDB4 (http://www.pasteur-guadeloupe.fr:8081/SITVITDemo/index.jsp).
PCR amplification and sequencing.
Expected fragments were amplified using the primers and conditions shown in Table 1. PCR products were sent for sequencing. All sequence data were aligned with the corresponding sequences of published H37Rv data (GenBank accession number NC_000962) using BioEdit software version 7.05.3. All the mutations found were compared with those contained in the TB Drug Resistance Mutation Database (www.tbdreamdb.com) (24) and previous publications (3, 5, 15, 25, 26). Novel mutations were defined as mutations not included in the database and publications. These mutations were verified by retesting PCR and sequencing.
TABLE 1.
PCR primers and conditions used for amplification and sequencing
| Primers | Sequence (5′ to 3′) | Nucleotide position | PCR conditionsa |
||
|---|---|---|---|---|---|
| D (s) | A (°C, s) | E (s) | |||
| EmbC1F | CGTCGTCGAGGACATTGGC | 4239803–4241169 | 30 | 61, 40 | 60 |
| EmbC1R | AGGGTCAAGGCACCGATGATG | ||||
| EmbC2F | CGGGCATGTTTCTGGCTGTCTG | 4241007–4242233 | 30 | 61, 40 | 60 |
| EmbC2R | GAATGCCGTTGGGTGTGAAGG | ||||
| EmbC3F | CCGGTCTAACCTACAGGCTTTGG | 4242073–4243240 | 30 | 61, 40 | 60 |
| EmbC3R | TGGGGCACGAGGCTCGATGGTA | ||||
| EmbA1F | AACCTAGGAACGGTGACT | 4243105–4243726 | 30 | 58, 40 | 40 |
| EmbA1R | CAACCTGTGGCTTCTTCT | ||||
| EmbA2F | CAACCAGGACACGGTCGTCG | 4243559–4245121 | 40 | 62, 40 | 90 |
| EmbA2R | TAGTTGCCGACGTAGAACCACC | ||||
| EmbA3F | CTTTGCCCGCATCGGTCTACAT | 4245005–4246534 | 40 | 62, 40 | 90 |
| EmbA3R | TCTGCTCGCGCACTGTGTCAT | ||||
| EmbB1F | ATCAGGGCGCTGCCATGACA | 4246500–4247838 | 30 | 62, 40 | 60 |
| EmbB1R | AGTGTGAATGCGGCGGTAACGA | ||||
| EmbB2F | CTCGCTGGTCACCTATGTGCTG | 4247746–4248939 | 30 | 62, 40 | 60 |
| EmbB2R | GGCTGGTTGGGTTTCATCACG | ||||
| EmbB3F | TGGACGGCGATTCGGGTTCT | 4248813–4249826 | 30 | 62, 40 | 60 |
| EmbB3R | ACTGCGGAGCCTGACGCTATG | ||||
D, length of denaturation at 94°C; A, primer annealing conditions; E, length of extension at 72°C. All PCRs were 32 cycles, were preceded by a denaturation step at 94°C for 5 min, and included a final extension step at 72°C for 7 min.
Resolution of discrepant results.
Discrepancies between phenotypic susceptibility results and genotypic data were handled with retesting the DST and DNA sequencing. If the retesting results were different from the original data, a third round of testing was completed, with the final result representing two of the three cycles of testing.
Statistical analysis.
The chi-square test was used to analyze data with SPSS 16.0 software (SPSS, Inc.). Differences were considered statistically significant at a P value of <0.05.
Nucleotide sequence accession numbers.
The sequences containing novel mutations obtained in the present study were deposited in the GenBank database under the following accession numbers: KP337627, KP337626, KP337625, KP337628, and KP337629 for embC Val42Ala, Pro150Ser, Val417Met, Gln725Arg, and Val885Met mutants, respectively; KP337631 and KP337639, KP337633, KP337630, KP337636, KP337637, KP337638, KP337635, KP337632, KP337640, and KP337634 for G(−43)C, Gly154Ser, Thr270Pro, Ala291Thr, Ala331Thr, Gly554Asp, Thr652Lys, Pro763Ser, Pro769Thr, and Glu951Asp mutants, respectively; KP337624 and KP337617, KP337621, KP337623, KP337618, KP337619, KP337620, and KP337622 for embB Val50Ala, Ser412Pro, Gly603Arg, Thr642Ala, Thr643Ile, Ala679Thr, and Pro907Ser mutants, respectively.
RESULTS
EMB-resistant phenotype and spoligotype.
Among 139 MDR-TB isolates, 79 isolates (56.8%) displayed EMB resistance, and the remaining 60 isolates (43.2%) were EMB susceptible. The Beijing family (114 isolates, 82.0%) was the most prevalent among all MDR-TB isolates. Isolates from the T family (11 isolates; 7.9%), H family (4 isolates; 2.9%), MANU2 family (1 isolate; 0.7%), CAS family (1 isolate; 0.7%), and orphans (8 isolates; 5.8%) were also identified in this study. Most of the EMB-resistant isolates (65/79 isolates; 82.2%) also belonged to the Beijing family. There was no association between EMB resistance and the Beijing family (P = 0.93).
Overall polymorphisms in embCAB.
The entire embCAB operon (including the embC to embA intergenic region and entire open reading frame of embC, embA, and embB) of 139 MDR-TB isolates was screened. Overall, 18 sites with polymorphic synonymous substitutions presented in all isolates. Since these changes could not contribute to amino acid replacements, they are unlikely to participate in drug resistance. Thus, they were not considered further when describing the sequencing results of the embCAB region. (A list of 18 synonymous nucleotide changes is available by request from K. Wan)
Also, 35 codons in embCAB carrying nonsynonymous substitutions and 5 polymorphic nucleotide sites in the embA upstream region (UR) were identified (Table 2). Out of these, 19 variant codons and 4 mutated sites in the embA UR were uniquely present in the EMB-resistant isolates (Table 2). Overall, 110 MDR-TB isolates (79.1%) had at least one mutation in the embCAB operon, of which 76 (96.2%; 76/79 EMB-resistant isolates) were EMB-resistant isolates and 34 (56.7%; 34/60 EMB-susceptible isolates) were EMB-susceptible isolates. Only 3 EMB-resistant isolates did not show any mutations across the entire operon. In the following sections, the mutations observed in EMB-resistant isolates exclusively and the mutations detected in both EMB-resistant and -susceptible isolates are presented in detail (Table 2).
TABLE 2.
Mutations in embCAB among 139 MDR-TB isolates
| Mutations in: |
No. of isolates |
|||
|---|---|---|---|---|
| embC | embA | embB | EMB resistant (n = 79) | EMB susceptible (n = 60) |
| Arg738Gln | 0 | 1 | ||
| C(−16)A | 0 | 1 | ||
| G(−43)Ca | 1 | 0 | ||
| Gly154Sera | 0 | 1 | ||
| Thr270Proa | 0 | 1 | ||
| Ala291Thra | 0 | 1 | ||
| Gly554Aspa | 1 | 0 | ||
| Val417Meta | Thr652Lysa | 0 | 1 | |
| Pro763Sera | 0 | 1 | ||
| C(−16)A | Val50Alaa/Gln497Pro | 1 | 0 | |
| C(−16)G | Val50Alaa/Gln497Lys | 1 | 0 | |
| C(−16)G | Met306Ile | 1 | 0 | |
| C(−16)T | Met306Ile | 1 | 0 | |
| Met306Ile/Asp354Ala | 1 | 0 | ||
| Met306Ile/Gly406Ser | 1 | 0 | ||
| Met306Ile/Thr643Ilea | 1 | 0 | ||
| Met306Ile | 14 | 5 | ||
| C(−16)T | Met306Leu | 1 | 0 | |
| Met306Leu | 2 | 2 | ||
| Met306Val/Ile563Leu | 0 | 1 | ||
| Met306Val/Pro907Sera | 0 | 1 | ||
| Met306Val/Asp1024Asn | 1 | 0 | ||
| C(−12)T | Met306Val | 1 | 0 | |
| Pro150Sera | C(−12)T/Ala331Thra | Met306Val | 1 | 0 |
| C(−16)T | Met306Val | 1 | 0 | |
| Asp4Asn | Met306Val | 1 | 0 | |
| Pro769Thra | Met306Val | 1 | 0 | |
| Gln725Arga | Met306Val | 1 | 0 | |
| Val885Meta | Met306Val | 0 | 1 | |
| Met306Val | 21 | 5 | ||
| Tyr319Asp | 1 | 0 | ||
| C(−11)A | Tyr319Cys | 1 | 0 | |
| Tyr319Cys | 1 | 0 | ||
| Asp328Tyr | 1 | 0 | ||
| C(−8)T/Gly200Ser | Asp354Asn/Ala679Thra | 1 | 0 | |
| C(−12)T | Asp354Ala | 1 | 0 | |
| Asp354Ala | 0 | 1 | ||
| Asp354Asn | 0 | 1 | ||
| G(−43)Ca | Asn399Thr | 1 | 0 | |
| Gly406Ala | 4 | 2 | ||
| Glu951Aspa | Gly406Asp | 0 | 1 | |
| Gly406Asp | 2 | 2 | ||
| C(−16)A | Gly406Ser | 1 | 0 | |
| Gly406Ser | 2 | 0 | ||
| Ser412Proa | 1 | 0 | ||
| Val42Alaa | Gln497Arg | 0 | 1 | |
| Gln497Arg | 1 | 1 | ||
| Gln497Lys | 1 | 1 | ||
| Ile563Leu | 0 | 1 | ||
| C(−16)G | Gly603Arga | 0 | 1 | |
| Thr642Alaa/His1002Arg | 1 | 0 | ||
| His1002Arg | 1 | 0 | ||
| Asp1024Asn | 1 | 0 | ||
Mutation not previously reported.
Mutations in embC.
Six MDR-TB isolates had variable mutations within the embC gene (Table 2), including Val42Ala, Pro150Ser, Val417Met, Gln725Arg, Arg738Gln, and Val885Met. A single Arg738Gln replacement was detected in 1 EMB-susceptible isolate. The other five mutations were combined with additional mutations within embA and/or embB, of which Pro150Ser and Gln725Arg occurred in EMB-resistant isolates. Mutations within embC revealed no statistical correlation with EMB resistance (P = 0.44).
Mutations in embA.
For embA, both the UR (i.e., the embC to embA intergenic region) and the entire open reading frame (ORF) were analyzed. Fourteen EMB-resistant isolates displayed nucleotide substitutions in the embA UR (Table 2). The most common nucleotide changes were located at position −16 bp, which was detected in 7 EMB-resistant isolates. However, this mutation was also present in 2 EMB-susceptible isolates. The other nucleotide changes found in EMB-resistant isolates occurred at positions −8, −11, −12, and −43 bp. Notably, in one EMB-resistant isolate harboring a nucleotide change at −43 bp, no other mutation in embCAB was detected.
Mutations within the ORF of embA were observed in 5 EMB-resistant isolates and 6 EMB-susceptible isolates (Table 2). Among 5 EMB-resistant isolates, only 1 isolate had a single Gly554Asp mutation in embA. The remaining 4 isolates carried other mutations in embC and/or embB, of which 2 also harbored mutations in the UR of embA. Furthermore, mutations in the embA UR were found to be associated with EMB resistance (P = 0.01), whereas mutations in the embA ORF demonstrated no association with EMB resistance (P = 0.63).
Mutations in embB.
A total of 29 embB mutated types were detected in 18 distinct codons among 101 (72.7%) isolates tested, including 74 (93.7%) EMB-resistant isolates and 27 (45.0%) EMB-susceptible isolates (Table 2). The majority of embB mutations were observed in the region between codons 306 and 497. Mutations in this region showed strong correlations with EMB resistance (P = 0.00).
An amino acid replacement at codon 306 was the most prevalent and occurred in 74 MDR-TB isolates (53.2%). The proportion of embB306 mutants in EMB-resistant isolates (50/79 isolates; 63.3%) was >2 times that in EMB-susceptible isolates (15/60 isolates; 25.0%). Statistical analysis indicated that there was a significant difference in the mutation frequency of embB306 between EMB-resistant and EMB-susceptible isolates (P = 0.00). The next most predominant mutated codons were embB406 and embB497. Mutations in embB406 were found in 10 of 79 EMB-resistant isolates (12.7%) and 5 of 60 EMB-susceptible isolates (8.3%). Four of 79 EMB-resistant isolates (5.1%) and 3 of 60 EMB-susceptible isolates (5.0%) harbored embB497 mutations. There was no statistical difference in the mutation rate of these two codons between EMB-resistant and EMB-susceptible isolates (P406 = 0.42 and P497 = 1.00).
Other mutations were also detected in codons 50, 319, 328, 354, 399, 412, 534, 563, 603, 642, 643, 679, 907, 1002, and 1024 (for a detailed summary of mutations, see Table 2). Among them, a single mutation at codon 319, 328, 412, 1002, or 1024 was found exclusively in EMB-resistant isolates. To our knowledge, codon 412 has not been described previously.
Predicting EMB resistance based on embCAB.
With reference to the phenotypic data, the sensitivities, specificities, and accuracies for detecting EMB resistance using DNA sequencing based on analysis of different codons, regions, and genes within embCAB are summarized in Table 3. In our study, screens of embB and embB306–497 achieved the best prediction accuracy. Inclusion of the embA UR did not increase the prediction accuracy (Table 3). Sequence analysis of embB306 predicted for EMB resistance with 63.3% sensitivity, 75.0% specificity, and 68.3% accuracy.
TABLE 3.
Summary of sequence analysis of embCAB and phenotypic drug susceptibility testing
| Locus or codona | No. of MDR-TB isolates |
P value | Sensitivityb (%) | Specificityc (%) | Accuracyd (%) | |||
|---|---|---|---|---|---|---|---|---|
| Resistant |
Susceptible |
|||||||
| With mutation | Without mutation | With mutation | Without mutation | |||||
| embC | 2 | 77 | 4 | 56 | 0.44 | 2.5 | 93.3 | 41.7 |
| embA UR | 14 | 65 | 2 | 58 | 0.01e | 17.7 | 96.7 | 51.8 |
| embA(−16) | 7 | 72 | 2 | 58 | 0.34 | 8.9 | 96.7 | 46.8 |
| embA ORF | 5 | 74 | 6 | 54 | 0.63 | 6.3 | 90.0 | 42.4 |
| embB | 74 | 5 | 27 | 33 | 0.00f | 93.7 | 55.0 | 77.0 |
| embB306–497 | 71 | 8 | 25 | 35 | 0.00f | 89.9 | 58.3 | 76.3 |
| embB306 | 50 | 29 | 15 | 45 | 0.00f | 63.3 | 75.0 | 68.3 |
| embB406 | 10 | 69 | 5 | 55 | 0.42 | 12.7 | 91.7 | 46.8 |
| embB497 | 4 | 75 | 3 | 57 | 1.00 | 5.1 | 95.0 | 43.9 |
| embB and/or embA UR | 75 | 4 | 28 | 32 | 0.00f | 94.9 | 53.3 | 77.0 |
| embB306–497 and/or embA UR | 72 | 7 | 26 | 34 | 0.00f | 91.1 | 56.7 | 76.3 |
UR, upstream region; ORF, open reading frame.
Sensitivity = no. of resistant isolates with mutation/total no. of resistant isolates.
Specificity = no. of susceptible isolates without mutation/total no. of susceptible isolates.
Accuracy = (no. of resistant isolates with mutation + no. of susceptible isolates without mutation)/(total no. of resistant isolates + total no. of susceptible isolates).
P < 0.05.
P < 0.01.
DISCUSSION
In our study, 56.8% of MDR-TB isolates were resistant to EMB, and 82.2% of EMB-resistant isolates belonged to the Beijing family, consistent with data from Henan, China (5). No correlation between EMB resistance and the Beijing family was observed (P = 0.93). A total of 110 (79.1%) MDR-TB isolates were found to harbor mutation(s) in the embCAB operon.
It was reported that the EMB resistance phenotype correlated with the mutations in the embCAB operon, most prevalently in the embB gene (15, 27). We identified 76 EMB-resistant isolates (96.2%) with mutations in embCAB, of which 74 isolates (93.7%) had mutations in embB. We also found that the overall mutated rate in the embB gene among all MDR-TB isolates was 72.7% (101/139 isolates), supporting the idea that embB mutation was associated with multidrug resistance (5, 19).
It was notable that among 74 EMB-resistant isolates with mutations in embB, 21 isolates harbored at least one additional mutation in embCBA. Some reports suggested that the isolates with mutation combinations presented higher-level EMB resistance (14, 25, 26). Nevertheless, the relevance of these mutations in EMB resistance was unclear and deserved further investigation.
The majority of embB mutations were concentrated in a small fragment (codons 306 to 497). Of them, embB306 was the most frequent mutation, with a mutated rate of 47% to 70.6% (4, 5, 12, 13, 17, 18, 28). Mutations in embB306 were also detected in EMB-susceptible isolates. In some studies, the frequencies of those mutations among EMB-susceptible isolates even approached those of EMB-resistant isolates (19, 29). Accordingly, our findings revealed that embB306 mutations were predominant (46.8% of all MDR-TB isolates) and occurred at a higher frequency in EMB-resistant than in EMB-susceptible isolates (63.3% versus 25.0%). The correlation between embB306 mutations and EMB resistance was statistically significant, suggesting that embB306 was associated with EMB resistance (5, 28).
Other major embB mutations were in embB406 and embB497. Despite some reports revealing that among EMB-resistant isolates, the percentage of embB406 mutants is significantly lower than that of embB497 (3, 5, 10, 15, 27, 30), other studies and our results were in contrast to this view (13, 26, 31). This difference is probably due to regional variations in the mutated frequencies at these two codons in the EMB-resistant isolates. Interestingly, mutations in embB406 and embB497 were also detected in EMB-susceptible isolates, which was similar to the prior investigations (3, 5, 10, 13, 20, 26). There was no association between mutations at codons 406 and 497 and EMB resistance.
Despite the fact that 19 EMB-resistant isolates (24.1%) carried mutations in embC and/or embA, 17 isolates had additional mutations in embB, implying that mutations in the first two genes are not necessary for EMB resistance. Among these 19 isolates, the majority of mutations were in the embA upstream region, including −43 (2 isolates), −16 (7 isolates), −12 (3 isolates), −11 (1 isolate), and −8 (1 isolate) bp. Statistical analysis indicated that embA UR mutations were associated with EMB resistance, consistent with the data from east China (26). Nevertheless, we observed that the proportion of isolates with a single embA UR mutation to isolates with all embA UR mutations was 7.1% (1/14 isolates), significantly lower than the earlier findings (55.6% to 71.0%) (15, 26). Considering that mutations in both the embA UR and embB were related to high-level EMB resistance (26), we determined that the number of EMB-resistant isolates with high-level resistance used in our study was relatively large.
Many novel mutations were detected among EMB-resistant isolates in this study. Since most cases were accompanied by other mutations known to confer drug resistance, it was uncertain whether these mutations were involved in EMB resistance. Interestingly, the novel mutations embAG(−43)C, Gly554Asp, and embB Ser412Pro led to EMB resistance with no additional mutations. Their actual roles in the development of EMB resistance require further exploration. There were still 3 EMB-resistant isolates with wild-type embCAB sequences, implying that resistance in these isolates may be attributed to mutations in other genes, such as embR, iniA, iniB, and rmlD (14).
Although 94.9% of EMB-resistant isolates among MDR-TB isolates were detected with DNA sequencing of embB and embA UR, the addition of the embA UR in the molecular diagnosis decreased the testing specificity from 55.0% to 53.3%. Furthermore, the embB gene was long and not very convenient for amplification and sequencing. Thus, the best strategy at present for molecular diagnostics was selective targeting of embB306–497, with 89.9% sensitivity, 58.3% specificity, and 76.3% accuracy. Mutations at embB306 could detect EMB resistance with 63.3% sensitivity, 75.0% specificity, and 68.3% accuracy. As the sensitivity and specificity of embB306 were not particularly high, its effects on identifying EMB resistance were limited.
Our research had several limitations. (i) The MIC values of all MDR-TB isolates in this study were not determined. (ii) Although a large number of MDR-TB isolates (n = 139) was investigated, the number of EMB-resistant isolates was relatively limited (n = 79). (iii) Only MDR-TB isolates were referred in our study, and other types of resistant and pan-susceptible isolates were not included. (iv) Several EMB-resistant isolates could not be explained by the mutations within embCAB.
To summarize, our results indicate that >50% of MDR-TB isolates in China demonstrate EMB resistance, and most EMB-resistant isolates belong to the Beijing family. Mutations in the embB gene and embA upstream region, other than in embA and embC, revealed significant correlations with EMB resistance. Compared with phenotypic data, sequence analysis of embB306–497 showed a satisfactory sensitivity for the detection of EMB resistance in China. The most common mutations occurred at embB306, embB406, embA(−16), and embB497. However, the embB306 mutation had limited value as a reliable marker for prediction of EMB resistance in China. Three novel mutations conferring EMB resistance [embAG(−43)C, Gly554Asp, and embB Ser412Pro] were identified. These findings will expand current knowledge of EMB resistance and further promote the establishment of rapid diagnostic methods to be implemented in China.
ACKNOWLEDGMENTS
We thank the staff of Fujian, Guangzhou, Guizhou, Liaoning, Beijing, Shaanxi, Shanghai, and Xizang for supplying strains.
This study was supported by the projects of the National Natural Science Foundation of China (grant no. 81201348) and the National Key Program of Mega Infectious Diseases (grant no. 2013ZX10003002-001).
The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
We have no conflicts of interest to report.
REFERENCES
- 1.World Health Organization (WHO). 2012. Global tuberculosis report 2012. WHO/HTM/TB/2012.6 World Health Organization, Geneva, Switzerland. [Google Scholar]
- 2.Zhao Y, Xu S, Wang L, Chin DP, Wang S, Jiang G, Xia H, Zhou Y, Li Q, Ou X, Pang Y, Song Y, Zhao B, Zhang H, He G, Guo J, Wang Y. 2012. National survey of drug-resistant tuberculosis in China. N Engl J Med 366:2161–2170. doi: 10.1056/NEJMoa1108789. [DOI] [PubMed] [Google Scholar]
- 3.Zhang Z, Wang Y, Pang Y, Kam KM. 2014. Ethambutol resistance as determined by broth dilution method correlates better than sequencing results with embB mutations in multidrug-resistant Mycobacterium tuberculosis isolates. J Clin Microbiol 52:638–641. doi: 10.1128/JCM.02713-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chen Q, Pang Y, Liang Q, Lin S, Wang Y, Lin J, Zhao Y, Wei S, Zheng J, Zheng S. 2014. Molecular characteristics of MDR Mycobacterium tuberculosis strains isolated in Fujian, China. Tuberculosis (Edinb) 94:159–161. doi: 10.1016/j.tube.2013.03.004. [DOI] [PubMed] [Google Scholar]
- 5.Shi D, Li L, Zhao Y, Jia Q, Li H, Coulter C, Jin Q, Zhu G. 2011. Characteristics of embB mutations in multidrug-resistant Mycobacterium tuberculosis isolates in Henan, China. J Antimicrob Chemother 66:2240–2247. doi: 10.1093/jac/dkr284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Afanas'ev MV, Ikryannikova LN, Il'ina EN, Sidorenko SV, Kuz'min AV, Larionova EE, Smirnova TG, Chernousova LN, Kamaev EY, Skorniakov SN, Kinsht VN, Cherednichenko AG, Govorun VM. 2007. Molecular characteristics of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis isolates from the Russian Federation. J Antimicrob Chemother 59:1057–1064. doi: 10.1093/jac/dkm086. [DOI] [PubMed] [Google Scholar]
- 7.Sekiguchi J, Miyoshi-Akiyama T, Augustynowicz-Kopec E, Zwolska Z, Kirikae F, Toyota E, Kobayashi I, Morita K, Kudo K, Kato S, Kuratsuji T, Mori T, Kirikae T. 2007. Detection of multidrug resistance in Mycobacterium tuberculosis. J Clin Microbiol 45:179–192. doi: 10.1128/JCM.00750-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Telenti A, Philipp WJ, Sreevatsan S, Bernasconi C, Stockbauer KE, Wieles B, Musser JM, Jacobs WR Jr. 1997. The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nat Med 3:567–570. doi: 10.1038/nm0597-567. [DOI] [PubMed] [Google Scholar]
- 9.Mikusova K, Slayden RA, Besra GS, Brennan PJ. 1995. Biogenesis of the mycobacterial cell wall and the site of action of ethambutol. Antimicrob Agents Chemother 39:2484–2489. doi: 10.1128/AAC.39.11.2484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lee AS, Othman SN, Ho YM, Wong SY. 2004. Novel mutations within the embB gene in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 48:4447–4449. doi: 10.1128/AAC.48.11.4447-4449.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Parsons LM, Salfinger M, Clobridge A, Dormandy J, Mirabello L, Polletta VL, Sanic A, Sinyavskiy O, Larsen SC, Driscoll J, Zickas G, Taber HW. 2005. Phenotypic and molecular characterization of Mycobacterium tuberculosis isolates resistant to both isoniazid and ethambutol. Antimicrob Agents Chemother 49:2218–2225. doi: 10.1128/AAC.49.6.2218-2225.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Starks AM, Gumusboga A, Plikaytis BB, Shinnick TM, Posey JE. 2009. Mutations at embB codon 306 are an important molecular indicator of ethambutol resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 53:1061–1066. doi: 10.1128/AAC.01357-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Campbell PJ, Morlock GP, Sikes RD, Dalton TL, Metchock B, Starks AM, Hooks DP, Cowan LS, Plikaytis BB, Posey JE. 2011. Molecular detection of mutations associated with first- and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob Agents Chemother 55:2032–2041. doi: 10.1128/AAC.01550-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ramaswamy SV, Amin AG, Goksel S, Stager CE, Dou SJ, El Sahly H, Moghazeh SL, Kreiswirth BN, Musser JM. 2000. Molecular genetic analysis of nucleotide polymorphisms associated with ethambutol resistance in human isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 44:326–336. doi: 10.1128/AAC.44.2.326-336.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Plinke C, Cox HS, Zarkua N, Karimovich HA, Braker K, Diel R, Rusch-Gerdes S, Feuerriegel S, Niemann S. 2010. embCAB sequence variation among ethambutol-resistant Mycobacterium tuberculosis isolates without embB306 mutation. J Antimicrob Chemother 65:1359–1367. doi: 10.1093/jac/dkq120. [DOI] [PubMed] [Google Scholar]
- 16.Zhang H, Li D, Zhao L, Fleming J, Lin N, Wang T, Liu Z, Li C, Galwey N, Deng J, Zhou Y, Zhu Y, Gao Y, Wang S, Huang Y, Wang M, Zhong Q, Zhou L, Chen T, Zhou J, Yang R, Zhu G, Hang H, Zhang J, Li F, Wan K, Wang J, Zhang XE, Bi L. 2013. Genome sequencing of 161 Mycobacterium tuberculosis isolates from China identifies genes and intergenic regions associated with drug resistance. Nat Genet 45:1255–1260. doi: 10.1038/ng.2735. [DOI] [PubMed] [Google Scholar]
- 17.Zhao LL, Chen Y, Chen ZN, Liu HC, Hu PL, Sun Q, Zhao XQ, Jiang Y, Li GL, Tan YH, Wan KL. 2014. Prevalence and molecular characteristics of drug-resistant Mycobacterium tuberculosis in Hunan, China. Antimicrob Agents Chemother 58:3475–3480. doi: 10.1128/AAC.02426-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Mokrousov I, Otten T, Vyshnevskiy B, Narvskaya O. 2002. Detection of embB306 mutations in ethambutol-susceptible clinical isolates of Mycobacterium tuberculosis from Northwestern Russia: implications for genotypic resistance testing. J Clin Microbiol 40:3810–3813. doi: 10.1128/JCM.40.10.3810-3813.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Shi R, Zhang J, Otomo K, Zhang G, Sugawara I. 2007. Lack of correlation between embB mutation and ethambutol MIC in Mycobacterium tuberculosis clinical isolates from China. Antimicrob Agents Chemother 51:4515–4517. doi: 10.1128/AAC.00416-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Brossier F, Veziris N, Aubry A, Jarlier V, Sougakoff W. 2010. Detection by GenoType MTBDRsl test of complex mechanisms of resistance to second-line drugs and ethambutol in multidrug-resistant Mycobacterium tuberculosis complex isolates. J Clin Microbiol 48:1683–1689. doi: 10.1128/JCM.01947-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.World Health Organization. 2008. Policy guidance on TB drug susceptibility testing (DST) of second-line drugs. WHO/HTM/TB/2008392 World Health Organization, Geneva, Switzerland. [PubMed] [Google Scholar]
- 22.Somerville W, Thibert L, Schwartzman K, Behr MA. 2005. Extraction of Mycobacterium tuberculosis DNA: a question of containment. J Clin Microbiol 43:2996–2997. doi: 10.1128/JCM.43.6.2996-2997.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, Bunschoten A, Molhuizen H, Shaw R, Goyal M, van Embden J. 1997. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 35:907–914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sandgren A, Strong M, Muthukrishnan P, Weiner BK, Church GM, Murray MB. 2009. Tuberculosis drug resistance mutation database. PLoS Med 6:e2. doi: 10.1371/journal.pmed.1000002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Jadaun GP, Das R, Upadhyay P, Chauhan DS, Sharma VD, Katoch VM. 2009. Role of embCAB gene mutations in ethambutol resistance in Mycobacterium tuberculosis isolates from India. Int J Antimicrob Agents 33:483–486. doi: 10.1016/j.ijantimicag.2008.10.017. [DOI] [PubMed] [Google Scholar]
- 26.Cui Z, Li Y, Cheng S, Yang H, Lu J, Hu Z, Ge B. 2014. Mutations in the embC-embA intergenic region contribute to Mycobacterium tuberculosis resistance to ethambutol. Antimicrob Agents Chemother 58:6837–6843. doi: 10.1128/AAC.03285-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Safi H, Fleischmann RD, Peterson SN, Jones MB, Jarrahi B, Alland D. 2010. Allelic exchange and mutant selection demonstrate that common clinical embCAB gene mutations only modestly increase resistance to ethambutol in Mycobacterium tuberculosis. Antimicrob Agents Chemother 54:103–108. doi: 10.1128/AAC.01288-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Plinke C, Rusch-Gerdes S, Niemann S. 2006. Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother 50:1900–1902. doi: 10.1128/AAC.50.5.1900-1902.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Hu Y, Hoffner S, Jiang W, Wang W, Xu B. 2010. Genetic characterisation of drug-resistant Mycobacterium tuberculosis in rural China: a population-based study. Int J Tuberc Lung Dis 14:210–216. [PubMed] [Google Scholar]
- 30.Huang WL, Chi TL, Wu MH, Jou R. 2011. Performance assessment of the GenoType MTBDRsl test and DNA sequencing for detection of second-line and ethambutol drug resistance among patients infected with multidrug-resistant Mycobacterium tuberculosis. J Clin Microbiol 49:2502–2508. doi: 10.1128/JCM.00197-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Bakula Z, Napiorkowska A, Bielecki J, Augustynowicz-Kopec E, Zwolska Z, Jagielski T. 2013. Mutations in the embB gene and their association with ethambutol resistance in multidrug-resistant Mycobacterium tuberculosis clinical isolates from Poland. Biomed Res Int 2013:167954. doi: 10.1155/2013/167954. [DOI] [PMC free article] [PubMed] [Google Scholar]