Skip to main content
PMC home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2015 Mar 11;59(4):2421–2425. doi: 10.1128/AAC.03926-14

Dissemination of High-Risk Clones of Extensively Drug-Resistant Pseudomonas aeruginosa in Colombia

Adriana Correa a,✉, Rosa del Campo b, Marcela Perenguez a, Victor M Blanco a, Mercedes Rodríguez-Baños b, Federico Perez c,d, Juan J Maya a, Laura Rojas a, Rafael Cantón b, Cesar A Arias e,f, Maria V Villegas a
PMCID: PMC4356786  PMID: 25605362

Abstract

The ability of Pseudomonas aeruginosa to develop resistance to most antimicrobials represents an important clinical threat worldwide. We report the dissemination in several Colombian hospitals of two predominant lineages of extensively drug-resistant (XDR) carbapenemase-producing P. aeruginosa strains. These lineages belong to the high-risk clones sequence type 111 (ST111) and ST235 and harbor blaVIM-2 on a class 1 integron and blaKPC-2 on a Tn4401 transposon, respectively. Additionally, P. aeruginosa ST1492, a novel single-locus variant of ST111, was identified. Clonal dissemination and the presence of mobile genetic elements likely explain the successful spread of XDR P. aeruginosa strains in Colombia.

TEXT

Pseudomonas aeruginosa is an opportunistic pathogen associated with a variety of hospital-associated infections, often in critically ill patients. The treatment of infections caused by P. aeruginosa is challenging due to the expression of metallo-β-lactamases (e.g., VIM and IMP) and serine enzymes (e.g., Klebsiella pneumoniae carbapenemase [KPC]) that confer resistance to most commercially available β-lactams. The acquisition of carbapenemase-encoding genes, combined with the presence of mechanisms of resistance to multiple other antimicrobials, has led to the emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) P. aeruginosa (1). Clinicians are often left with very limited options to treat infections caused by MDR and XDR P. aeruginosa strains, which are associated with increased morbidity, mortality, and health care costs (2, 3).

Studies on the molecular epidemiology and population structure of Gram-negative bacteria have identified MDR strains that successfully disseminate across diverse geographic locations and patient populations and are therefore known as high-risk clones. Genetic fingerprinting with multilocus sequence typing (MLST) has identified sequence type 111 (ST111), ST175, and ST235 as high-risk clones that are prevalent among carbapenemase-producing P. aeruginosa strains from Europe and Asia (4–7). Carbapenem-resistant P. aeruginosa, mainly mediated by KPC- and VIM-type enzymes, is endemic in Colombia (8, 9). Although initial reports suggested that high-risk clones circulate in Colombia (10, 11), data on the molecular epidemiology of carbapenemase-producing P. aeruginosa isolates are limited. In this study, we characterize XDR P. aeruginosa isolates from seven cities in Colombia, focusing on the identification of high-risk clones and of genetic elements associated with the dissemination of carbapenemase genes.

Single-patient isolates of XDR P. aeruginosa (defined as resistant to antipseudomonal carbapenems, cephalosporins, penicillins, fluoroquinolones, and aminoglycosides [1]) were selected from the Colombian Bacterial Resistance Surveillance Network strain collection (2008 and 2010) at the Centro Internacional de Entrenamiento e Investigaciones Médicas (CIDEIM). A total of 161 isolates were recovered from 16 tertiary care hospitals in seven Colombian cities. The majority of the isolates (77%) were from intensive care units, and the most frequent sample sources were urine (n = 40), blood (n = 36), respiratory secretions (n = 34), and skin or soft tissue (n = 17). The study was approved by the ethics committee of CIDEIM.

An in-house multiplex quantitative PCR (qPCR) designed to detect blaKPC, blaVIM, blaIMP, blaNDM, blaTEM, blaSHV, and blaCTX-M was performed using a CFX96 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA). The probes (dual-labeled black hole quencher [BHQ] probes) and primers (Table 1) were designed using Beacon Designer 8.0 (Premier Biosoft International). Total DNA (100 ng) was used as the template for the reaction. The thermal cycling conditions for the multiplex qPCR were 50°C for 2 min, 95°C for 2 min, followed by 40 cycles at 95°C (15 s) and 60°C (1 min). The samples with a threshold cycle (CT) value of <35 were considered positive. Additionally, conventional PCR was used to screen for the presence of blaPER and blaGES (12). We performed phenotypic tests for carbapenemase production using the Carba NP test and a combined-disk method (CDM) using imipenem and cloxacillin in isolates that tested negative for the presence of carbapenemase genes (13, 14). The sequencing of PCR products was performed in order to confirm the identities of the detected genes. Pulsed-field gel electrophoresis (PFGE) using XbaI was performed in the 161 isolates to assess their genetic relatedness, as previously described by Gautom (15). Two or more strains were considered genetically related if the Dice coefficient was >75%. MLST was performed in at least one isolate from each PFGE type, as described previously (15). STs were assigned using the available Web-based scheme (Pseudomonas aeruginosa MLST database [http://pubmlst.org/paeruginosa]). The location of carbapenemase genes within the bacterial chromosome was investigated with S1 nuclease/I-CeuI probe hybridization using previously described protocols (16, 17), and the genetic environment surrounding blaVIM or blaKPC was further analyzed by PCR and sequencing (11, 18).

TABLE 1.

Primers and probes designed for the detection of bla genes among XDR P. aeruginosa from Colombia

Target gene 5′–3′ sequence fora:
Forward primer Reverse primer Probe
blaKPC GGACACACCCATCCGTTA GCGGGCGTTATCACTGTATTG FAM-TCCGCCACCGTCATGCCTGTTG-BHQ1b
blaVIM GCTTCGGTCCAGTAGAACTC AGACGTGCGTGACAACTC CR610-AATCGCACAACCACCATAGAGCACACT-BHQ2
blaIMP GCGGCTATAAAATAAAAGGCAGTA GATGCATACGTGGGGATAGA CY5.5-CACATTTCCATAGCGACAGCACGGGC-3BHQ3
blaNDM CAACGGTTTGGCGATCTG DGCCATCCCTGACGATCAA GOLD540-CGCACCGAATGTCTGGCAGCACA-BHQ1
blaCTX-M ATGTGCAGYACCAGTAARGTKATGGC ATCACKCGGRTCGCCXGGRAT CR610-CCCGACAGCTGGGAGACGAAACGT-BHQ2
blaTEM TGGCATGACAGTAAGAGAATTATG CAAGGCGAGTTACATGATCC CG540-AAGCGGTTAGCTCCTTCGGTCCTCC-BHQ1
blaSHV CAGGATCTGGTGGACTACTC CGCTGTTATCGCTCATGG Q670-CGCAGAGTTCGCCGACCGTCA-BHQ2
Open in a new tab
a

The final primer and probe concentrations in the multiplex reaction were 0.2 μM each. Additional volumes of magnesium and deoxynucleoside triphosphates (dNTPs) were used in the multiplex reaction.

b

FAM, 6-carboxyfluorescein.

PCR amplification and sequencing confirmed the presence of blaVIM-2 and blaKPC-2 in 128 out of 161 isolates that fit the definition of XDR P. aeruginosa (1). Of note, isolate 3386 was found to harbor both blaVIM-2 and blaKPC-2, as previously described in detail (10). All isolates that tested negative for the presence of carbapenemase genes by PCR were also negative for carbapenemase production, according to phenotypic tests (Carba NP and CDM). We did not characterize these isolates further, but we suspect that their phenotype can be explained by the hyperexpression of the MexAB-OprM efflux pump, modification of the OprD2 porin, and cephalosporinase hyperproduction, as described elsewhere (14, 19).

PFGE revealed 18 different types, seven of which were represented by single isolates. Seven PFGE types contained isolates with blaVIM-2, and six contained isolates with blaKPC-2. As mentioned above, one isolate harbored both blaVIM-2 and blaKPC-2, but other isolates from the same PFGE type (PTG2) harbored blaVIM-2 only. Among 12 isolates in PFGE type PTG1, only one contained blaVIM-2, whereas carbapenemase-encoding genes were not found in the remaining isolates. We were not able to detect carbapenemase genes in the isolates belonging to four PFGE types (Table 2).

TABLE 2.

Characterization of representative pulsed-field gel electrophoresis types of XDR P. aeruginosa from Colombia

IDa PFGE typeb MLSTc Carbapenemase gene MIC (μg/ml) for antibioticd:
 Carba NP result CDM resulte Genetic environment of blaVIM-2 and blaKPC-2
IPM MEM AMK ATM FEP CAZ CIP TZP PMB
90 PTG1 ST481 NEGf 64 8 64 64 32 128 >8 256/4 2 NEG NEG Negative for carbapenemases
127 PTG1 ST481 NEG 32 16 <8 32 32 64 >8 256/4 2 NEG NEG Negative for carbapenemases
93 PTG1 ST481 blaVIM-2 >128 64 64 <8 16 32 >8 32/4 1 NDg ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
142 PTG2 ST111 blaVIM-2 >128 128 64 32 16 32 >8 32/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
2146 PTG2 ST111 blaVIM-2 128 128 128 32 16 32 >8 32/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
2369 PTG2 ST111 blaVIM-2 128 128 64 32 16 16 >8 32/4 1 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
3386 PTG2 ST111 blaVIM-2 and blaKPC-2 128 128 128 64 128 64 >8 >128/4 64 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1 tnpR-tnpB-istB-blaKPC-2-tnpA
120 PTG3 ST111 blaVIM-2 128 128 128 32 32 64 >8 >256/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
2826 PTG3 ST111 blaVIM-2 128 128 128 16 32 64 >8 64/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
2961 PTG3 ST111 blaVIM-2 128 128 64 32 128 64 >8 64/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
712 PTG9 ST111 blaVIM-2 >128 64 32 16 16 16 >8 32/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
1275 PTG9 ST111 blaVIM-2 64 16 32 16 16 32 >8 64/4 1 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
275 PTG10 ST1492 blaVIM-2 32 16 128 <8 32 64 <1 64/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b
192 PTG4 ST235 blaKPC-2 128 >128 64 32 128 256 >8 128/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
1332 PTG4 ST235 blaKPC-2 128 >128 32 64 128 128 >8 128/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
343 PTG4 ST235 NEG 32 32 <8 64 16 64 >8 256/4 2 NEG NEG Negative for carbapenemases
3144 PTG5 ST235 blaKPC-2 128 128 128 64 128 64 >8 >128/4 2 ND ND blaKPC-2
2651 PTG5 ST235 blaKPC-2 32 32 64 64 128 64 >8 >128/4 1 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
1986 PTG5 ST235 blaKPC-2 128 128 64 >16 128 64 >8 >128/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
1602 PTG5 ST235 blaKPC-2 >128 >128 32 64 128 128 >8 128/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
542 PTG6 ST235 blaKPC-2 >128 >128 64 64 128 128 >8 256/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
1669 PTG7 ST235 blaKPC-2 16 64 64 64 128 32 >8 >256/4 1 ND ND blaKPC-2
2537 PTG7 ST235 NEG 16 32 <8 32 16 8 >8 32/4 1 NEG NEG Negative for carbapenemases
2902 PTG8 ST235 blaKPC-2 32 64 64 64 128 64 >8 >128/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
1516 PTG11 ST235 blaKPC-2 >128 >128 32 64 32 256 >8 256/4 2 ND ND tnpR-tnpB-istB-blaKPC-2-tnpA
2697 POLI1 ST298 blaVIM-2 32 16 32 <8 64 64 4 128/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b
185 POLI2 ST111 blaVIM-2 >128 128 64 32 32 32 >8 32/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
209 POLI3 ST111 blaVIM-2 >128 >128 64 32 32 32 >8 32/4 2 ND ND intl1-aac(6′)29a- blaVIM-2-aac(6′)29b-qacEΔ1sul-1
154 POLI4 ST111 NEG >128 128 64 32 32 16 >8 32/4 2 NEG NEG Negative for carbapenemases
1499 POLI5 ST235 NEG 4 16 64 64 32 >256 >8 128/4 2 NEG NEG Negative for carbapenemases
406 POLI6 ST481 NEG 16 4 32 64 32 64 >8 >256/4 2 NEG NEG Negative for carbapenemases
646 POLI7 227 NEG 16 16 <8 64 8 128 >8 >256/4 4 NEG NEG Negative for carbapenemases
Open in a new tab
a

ID, identification.

b

PFGE, pulsed-field gel electrophoresis; PTG, PFGE type with >1 isolate; POLI, PFGE type with a single isolate.

c

MLST, multilocus sequence typing; ST, sequence type.

d

IPM, imipenem; MEM, meropenem; AMK; amikacin; ATM, aztreonam; FEP, cefepime; CIP, ciprofloxacin; TZP, piperacillin-tazobactam; PMB, polymyxin B.

e

CDM, combined disk method.

f

NEG, negative.

g

ND, not determined.

We selected 32 isolates (at least one from each PFGE type) for further typing with MLST; 13 of these isolates harbored blaVIM-2 only, 10 isolates harbored blaKPC-2 only, and one isolate harbored both blaVIM-2 and blaKPC-2. Eight isolates were negative for all the carbapenemases tested. MLST indicated that 86% of the P. aeruginosa strains harboring blaVIM-2 belonged to ST111 (n = 11), while all P. aeruginosa strains carrying blaKPC-2 belonged to ST235. Interestingly, a novel single-locus variant of ST111 (designated ST1492) was identified in one isolate. Carbapenem-resistant P. aeruginosa isolates that did not carry any of the target genes belonged to ST111, ST235, ST481, and ST227 (Table 2). All these sequence types have >3 allele differences and are considered unrelated.

Using an S1/I-CeuI hybridization protocol, we were able to determine that blaVIM-2 and blaKPC-2 were located in the chromosome in the majority of the isolates (70%). In the remaining isolates, these genes were located in plasmids of variable length (80 to 190 kb). In the 12 isolates belonging to P. aeruginosa ST111, blaVIM-2 was found in a class 1 integron with aacA29a in the upstream region and aacA29b and qacEΔ1sul-1 in the downstream region; this genetic structure was previously designated In59 (10, 20). The transposon Tn4401 was found in 8 isolates carrying blaKPC-2; in the two remaining isolates, blaKPC-2 did not appear to be associated with this genetic structure (Table 2).

The emergence of MDR and XDR bacteria causes alarm and is deemed a global public health crisis. Colombia is a particular hot-spot for antibiotic resistance, where the acquisition of genes coding for KPC and VIM enzymes among Enterobacteriaceae and P. aeruginosa is of great concern (8–11, 18, 21–23). Previous reports (24, 25) described the predominance of certain genetic lineages of P. aeruginosa in various clinical settings and geographic locations; P. aeruginosa ST111 and ST235, mostly harboring blaVIM and other metallo-β-lactamases, have been identified as being among these high-risk clones (4, 26–30). Similar to findings elsewhere, our survey of P. aeruginosa from Colombian hospitals found that ST111 is a common host of blaVIM-2. In contrast, we found that P. aeruginosa ST235 is most commonly associated with the dissemination of blaKPC-2 and is present in hospitals from 6 out of the 7 cities included in our study (see Fig. S1 in the supplemental material). Although we had previously identified other P. aeruginosa STs (ST308, ST1006, and ST1060) associated with the dissemination of blaKPC-2, this more comprehensive survey revealed that ST235 is the predominant carbapenemase-producing P. aeruginosa strain type in Colombia. P. aeruginosa ST235 harboring other carbapenemase-encoding genes, such as blaVIM, blaIMP, and blaGES, has been reported in other countries (8, 30). Of note, the set of XDR P. aeruginosa strains analyzed in this survey displayed consistent susceptibility to polymyxin B (except for isolate 3386 that harbors both blaVIM-2 and blaKPC-2), indicating that polymyxins remain one of the few options for the treatment of infections caused by XDR P. aeruginosa strains in Colombia.

In summary, VIM-2 and KPC-2 carbapenemases are the main contributors to β-lactam resistance among XDR P. aeruginosa strains found in Colombian hospitals. Almost all P. aeruginosa strains harboring blaVIM-2 belong to ST111, while a single sequence type, ST235, is associated with P. aeruginosa strains harboring blaKPC-2. These XDR high-risk clones mainly rely on class 1 integrons and the well-known transposable element Tn4401 as the principal structures for gene mobilization. The coexistence of these lineages of XDR P. aeruginosa in this South American country suggests complex transmission dynamics that need to be explored further. Our findings indicate that the spread of XDR P. aeruginosa high-risk clones is a real threat in Colombian hospitals; this knowledge should serve as the basis for nationwide strategies to improve infection prevention and control efforts.

Supplementary Material

Supplemental material
supp_59_4_2421__index.html (1,018B, html)

ACKNOWLEDGMENTS

We thank the institutions that form the Colombian Nosocomial Resistance Study Group (CNRSG): Clinica de las Américas, Clinica General del Norte, Hospital Central de la Policía, Hospital Federico Lleras Acosta, Hospital General de Medellín, Hospital Pablo Tobón Uribe, Hospital Universitario San Jorge, Hospital Militar Central, Clinica Fundación Valle del Lilí, Hospital Universitario de Santander, and the bacterial resistance group at CIDEIM.

This work was supported by Merck Sharp & Dohme, Janssen-Cilag SA, Pfizer SA, AstraZeneca Colombia SA, Merck Colombia, Novartis, Amarey Novamedical, Merck S.A, and bioMérieux Colombia, which help fund the Colombian Nosocomial Resistance Study Group (CNRSG). The research of Rafael Cantón at the Microbiology Department of Ramón y Cajal University Hospital is funded by the European Commission (grants R-GNOSIS-FP7-HEALTH-F3-2011-282512 and FP7-HEALTH-F3-2013-MON4STRAT-602906-2) and the Instituto de Salud Carlos III of Spain, cofinanced by the European Development Regional Fund (A Way to Achieve Europe program; Spanish Network for Research in Infectious Diseases grant REIPI RD12/0015).

Maria V. Villegas has received consulting fees and research grants from Merck Sharp & Dohme, Pfizer SA, Janssen-Cilag SA, Novartis, Merck SA, and AstraZeneca Colombia SA. Cesar A. Arias has received grant support form Pfizer, Forest Pharmaceuticals, and Theravance, Inc., has served on the speaker bureaus of Cubist, Forest Pharmaceuticals, Pfizer, Novartis, and AstraZeneca, and has performed consulting activities for Cubist, Bayer, and AstraZeneca. Adriana Correa has received speaker honoraria from Merck Sharp & Dohme and bioMérieux Colombia. The other authors declare no competing interests.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AAC.03926-14.

REFERENCES

  • 1.Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  • 2.Tacconelli E, Cataldo MA, Dancer SJ, De Angelis G, Falcone M, Frank U, Kahlmeter G, Pan A, Petrosillo N, Rodríguez-Baño J, Singh N, Venditti M, Yokoe DS, Cookson B. 2014. ESCMID guidelines for the management of the infection control measures to reduce transmission of multidrug-resistant Gram-negative bacteria in hospitalized patients. Clin Microbiol Infect 20:1–55. doi: 10.1111/1469-0691.12427. [DOI] [PubMed] [Google Scholar]
  • 3.Dantas RC, Ferreira ML, Gontijo-Filho PP, Ribas RM. 2014. Pseudomonas aeruginosa bacteraemia: independent risk factors for mortality and impact of resistance on outcome. J Med Microbiol 63(Pt 12):1679–1687. doi: 10.1099/jmm.0.073262-0. [DOI] [PubMed] [Google Scholar]
  • 4.García-Castillo M, del Campo R, Morosini MI, Riera E, Cabot G, Willems R, van Mansfeld R, Oliver A, Cantón R. 2011. Wide dispersion of ST175 clone despite high genetic diversity of carbapenem-nonsusceptible Pseudomonas aeruginosa clinical strains in 16 Spanish hospitals. J Clin Microbiol 49:2905–2910. doi: 10.1128/JCM.00753-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wright LL, Turton JF, Livermore DM, Hopkins KL, Woodford N. 2014. Dominance of international “high-risk clones” among metallo-β-lactamase-producing Pseudomonas aeruginosa in the UK. J Antimicrob Chemother 70:103–110. doi: 10.1093/jac/dku339. [DOI] [PubMed] [Google Scholar]
  • 6.Castanheira M, Deshpande LM, Costello A, Davies TA, Jones RN. 2014. Epidemiology and carbapenem resistance mechanisms of carbapenem-non-susceptible Pseudomonas aeruginosa collected during 2009–11 in 14 European and Mediterranean countries. J Antimicrob Chemother 69:1804–1814. doi: 10.1093/jac/dku048. [DOI] [PubMed] [Google Scholar]
  • 7.Libisch B, Poirel L, Lepsanovic Z, Mirovic V, Balogh B, Pászti J, Hunyadi Z, Dobák A, Füzi M, Nordmann P. 2008. Identification of PER-1 extended-spectrum β-lactamase producing Pseudomonas aeruginosa clinical isolates of the international clonal complex CC11 from Hungary and Serbia. FEMS Immunol Med Microbiol 54:330–338. doi: 10.1111/j.1574-695X.2008.00483.x. [DOI] [PubMed] [Google Scholar]
  • 8.Villegas MV, Lolans K, Correa A, Kattan JN, Lopez JA, Quinn JP, Colombian Nosocomial Resistance Study Group . 2007. First identification of Pseudomonas aeruginosa isolates producing a KPC-type carbapenem-hydrolyzing β-lactamase. Antimicrob Agents Chemother 51:1553–1555. doi: 10.1128/AAC.01405-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Villegas MV, Lolans K, del Rosario Olivera M, Suarez CJ, Correa A, Queenan AM, Quinn JP, Colombian Nosocomial Resistance Study Group . 2006. First detection of metallo-β-lactamase VIM-2 in Pseudomonas aeruginosa isolates from Colombia. Antimicrob Agents Chemother 50:226–229. doi: 10.1128/AAC.50.1.226-229.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Correa A, Montealegre MC, Mojica MF, Maya JJ, Rojas LJ, De La Cadena EP, Ruiz SJ, Recalde M, Rosso F, Quinn JP, Villegas MV. 2012. First report of a Pseudomonas aeruginosa isolate coharboring KPC and VIM carbapenemases. Antimicrob Agents Chemother 56:5422–5423. doi: 10.1128/AAC.00695-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cuzon G, Naas T, Villegas M-V, Correa A, Quinn JP, Nordmann P. 2011. Wide dissemination of Pseudomonas aeruginosa producing β-lactamase blaKPC-2 gene in Colombia. Antimicrob Agents Chemother 55:5350–5353. doi: 10.1128/AAC.00297-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Poirel L, Le Thomas I, Naas T, Karim A, Nordmann P. 2000. Biochemical sequence analyses of GES-1, a novel class A extended-spectrum β-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob Agents Chemother 44:622–632. doi: 10.1128/AAC.44.3.622-632.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dortet L, Poirel L, Nordmann P. 2014. Rapid detection of extended-spectrum-β-lactamase-producing Enterobacteriaceae from urine samples by use of the ESBL NDP test. J Clin Microbiol 52:3701–3706. doi: 10.1128/JCM.01578-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fournier D, Garnier P, Jeannot K, Mille A, Gomez A-S, Plésiat P. 2013. A convenient method to screen for carbapenemase-producing Pseudomonas aeruginosa. J Clin Microbiol 51:3846–3848. doi: 10.1128/JCM.01299-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gautom RK. 1997. Rapid pulsed-field gel electrophoresis protocol for typing of Escherichia coli O157:H7 and other Gram-negative organisms in 1 day. J Clin Microbiol 35:2977–2980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Barton BM, Harding GP, Zuccarelli AJ. 1995. A general method for detecting and sizing large plasmids. Anal Biochem 226:235–240. doi: 10.1006/abio.1995.1220. [DOI] [PubMed] [Google Scholar]
  • 17.Liu SL, Hessel A, Sanderson KE. 1993. Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc Natl Acad Sci U S A 90:6874–6878. doi: 10.1073/pnas.90.14.6874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Naas T, Cuzon G, Villegas M-V, Lartigue M-F, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the β-lactamase bla KPC gene. Antimicrob Agents Chemother 52:1257–1263. doi: 10.1128/AAC.01451-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rawat V, Singhai M, Verma PK. 2013. Detection of different β-lactamases and their co-existence by using various discs combination methods in clinical isolates of Enterobacteriaceae and Pseudomonas spp. J Lab Physicians 5:21–25. doi: 10.4103/0974-2727.115918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Poirel L, Lambert T, Türkoglü S, Ronco E, Gaillard J, Nordmann P. 2001. Characterization of class 1 integrons from Pseudomonas aeruginosa that contain the bla(VIM-2) carbapenem-hydrolyzing β-lactamase gene and of two novel aminoglycoside resistance gene cassettes. Antimicrob Agents Chemother 45:546–552. doi: 10.1128/AAC.45.2.546-552.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cuzon G, Naas T, Truong H, Villegas MV, Wisell KT, Carmeli Y, Gales AC, Venezia SN, Quinn JP, Nordmann P. 2010. Worldwide diversity of Klebsiella pneumoniae that produce β-lactamase blaKPC-2 gene. Emerg Infect Dis 16:1349–1356. doi: 10.3201/eid1609.091389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lopez JA, Correa A, Navon-Venezia S, Correa AL, Torres JA, Briceño DF, Montealegre MC, Quinn JP, Carmeli Y, Villegas MV. 2011. Intercontinental spread from Israel to Colombia of a KPC-3-producing Klebsiella pneumoniae strain. Clin Microbiol Infect 17:52–56. doi: 10.1111/j.1469-0691.2010.03209.x. [DOI] [PubMed] [Google Scholar]
  • 23.Villegas MV, Lolans K, Correa A, Suarez CJ, Lopez JA, Vallejo M, Quinn JP, Colombian Nosocomial Resistance Study Group . 2006. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrob Agents Chemother 50:2880–2882. doi: 10.1128/AAC.00186-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Larché J, Pouillot F, Essoh C, Libisch B, Straut M, Lee JC, Soler C, Lamarca R, Gleize E, Gabard J, Vergnaud G, Pourcel C. 2012. Rapid identification of international multidrug-resistant Pseudomonas aeruginosa clones by multiple-locus variable number of tandem repeats analysis and investigation of their susceptibility to lytic bacteriophages. Antimicrob Agents Chemother 56:6175–6180. doi: 10.1128/AAC.01233-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Woodford N, Turton JF, Livermore DM. 2011. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev 35:736–755. doi: 10.1111/j.1574-6976.2011.00268.x. [DOI] [PubMed] [Google Scholar]
  • 26.Elias J, Schoen C, Heinze G, Valenza G, Gerharz E, Gerharz H, Vogel U. 2010. Nosocomial outbreak of VIM-2 metallo-β-lactamase-producing Pseudomonas aeruginosa associated with retrograde urography. Clin Microbiol Infect 16:1494–1500. doi: 10.1111/j.1469-0691.2009.03146.x. [DOI] [PubMed] [Google Scholar]
  • 27.Lee J-Y, Peck KR, Ko KS. 2013. Selective advantages of two major clones of carbapenem-resistant Pseudomonas aeruginosa isolates (CC235 and CC641) from Korea: antimicrobial resistance, virulence and biofilm-forming activity. J Med Microbiol 62:1015–1024. doi: 10.1099/jmm.0.055426-0. [DOI] [PubMed] [Google Scholar]
  • 28.Maatallah M, Cheriaa J, Backhrouf A, Iversen A, Grundmann H, Do T, Lanotte P, Mastouri M, Elghmati MS, Rojo F, Mejdi S, Giske CG. 2011. Population structure of Pseudomonas aeruginosa from five Mediterranean countries: evidence for frequent recombination and epidemic occurrence of CC235. PLoS One 6:e25617. doi: 10.1371/journal.pone.0025617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Samuelsen O, Toleman MA, Sundsfjord A, Rydberg J, Leegaard TM, Walder M, Lia A, Ranheim TE, Rajendra Y, Hermansen NO, Walsh TR, Giske CG. 2010. Molecular epidemiology of metallo-β-lactamase-producing Pseudomonas aeruginosa isolates from Norway and Sweden shows import of international clones and local clonal expansion. Antimicrob Agents Chemother 54:346–352. doi: 10.1128/AAC.00824-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Viedma E, Juan C, Acosta J, Zamorano L, Otero JR, Sanz F, Chaves F, Oliver A. 2009. Nosocomial spread of colistin-only-sensitive sequence type 235 Pseudomonas aeruginosa isolates producing the extended-spectrum β-lactamases GES-1 and GES-5 in Spain. Antimicrob Agents Chemother 53:4930–4933. doi: 10.1128/AAC.00900-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_59_4_2421__index.html (1,018B, html)
AAC.03926-14_zac004153830so1.pdf (321.7KB, pdf)

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES