MOUSE MODEL FOR PRE-CLINICAL STUDY OF HUMAN CANCER IMMUNOTHERAPY

Abstract

This unit describes protocols for developing tumors in mice including subcutaneous growth, pulmonary metastases of B16 melanoma, and spontaneous melanoma in B-Raf V600E/PTEN deletion transgenic mouse models. Two immunization methods to prevent B16 tumor growth are described using B16.GM-CSF and recombinant vaccinia virus. A therapeutic approach is also included that uses adoptive transfer of tumor antigen-specific T cells. Methods including CTL induction, isolation, testing, and genetic modification of mouse T cells for adoptive transfer by using retrovirus expressing genes of interest are provided. Additional sections, including growing B16 melanoma, enumerating pulmonary metastases, tumor imaging technique and use of recombinant viruses for vaccination, are discussed together with safety concerns.

INTRODUCTION

In the past two decades, cancer immunotherapies have been beneficial in a subset of patients with metastatic melanoma or renal cell carcinoma, successfully treated by the administration of recombinant interleukin-2 (rIL-2), sometimes given together with autologous melanoma-reactive lymphocytes that have been expanded ex vivo (Rosenberg, 1999; Rosenberg, 2008; Dudley, 2003). Recently, a number of different laboratories have used immune-modulating antibodies (gene engineered autologous T cells expressing tumor-antigen specific T cell receptor (TCR) or chimeric antigen receptor (CAR)) to treat a variety of human cancers other than melanoma and renal cell carcinoma. The list of cancer immunotherapies are now expanding to non-small-cell lung carcinoma (Brahmer, 2012; Topalian, 2012), metastatic hormone-refractory prostate cancer (Small, 2007), synovial sarcoma (Robbins, 2011), lymphoma, leukemia, breast cancer, colorectal cancer, ovarian cancer and glioblastoma.

Animal models play important roles in translational cancer immunotherapy. They not only provide scientific principles for clinical trials, but also can be used to develop immune reagents such as humanized monoclonal antibody and HLA restricted antigen-specific TCRs that are directly applicable to cancer treatment. In addition, animal models allow pre-clinical studies on potential toxicity of therapeutic reagent in patients. Table 20.1.1 summarizes the pre-clinical studies in mouse models that have been translated into clinical trials in Surgery Branch, NCI from 1986–2013.

Table 20.1.1.

Summary of pre-clinical mouse models that were translated into clinical trials of cancer immunotherapy in Surgery Branch, National Cancer Institute from 1986–2013.

Cancer immunotherapy		mouse model	Clinical trial
Tumor specific-vaccines
Peptide anchor-modification		(Irvine, 1999); (Yu, 2004)	(Rosenberg, 1998); (Schwartzentruber, 2011)
Recombinant poxvirus		(Irvine, 1997); (Overwijk, 1999b)	(Lindsey, 2006); (Rosenberg, 2003)
Antibody immunotherapy
CTLA-4		(van Elsas, 2001)	(Phan, 2003)
T cell immunotherapy
TIL		(Rosenberg, 1986)	(Dudley, 2002)
Gp100209–217 - specific T cells		(Yu, 2004)	(Morgan, 2006)
Gp100154–162-specific T cells		(Johnson, 2009)	(Johnson, 2009)
CEA691–699-specific T cells		(Parkhurst, 2009)	(Parkhurst, 2011)
MAGE A3112–120-specific T cells		(Chinnasamy, 2011)	(Morgan, 2013)
Less differentiated T cells		(Hinrichs, 2009)	(Dudley, 2010)
CAR immunotherapy
Anti-VEGFR-2 CAR		(Chinnasamy, 2010)	(Phan, 2013)
Anti-CD19 CAR		(Kochenderfer, 2010)	(Kochenderfer, 2013)
Immune-modulation
Total body irradiation		(Wrzesinski, 2010)	(Dudley, 2008)
IL-12		(Kerkar, 2010)	Manuscript in preparation
IL-15		(Klebanoff, 2004)	In progress

This unit will detail protocols for developing tumors in mice including subcutaneous growth (Basic Protocol 1), pulmonary metastases of B16 melanoma (Basic Protocol 2), and spontaneous melanoma in B-Raf V600E/PTEN deletion transgenic mouse models (Basic Protocol 3). Two immunization methods to prevent B16 tumor growth are introduced in Basic Protocol 4 (using B16.GM-CSF) and 5 (using recombinant vaccinia virus). Therapeutic approach is focused on adoptive transfer of tumor antigen-specific T cells (Basic Protocol 6). Identifying human HLA restricted- T cell receptors are illustrated in Basic Protocol 7. In supporting protocols, methods including CTL induction, isolation, testing, and genetic modification of mouse T cells for adoptive transfer by using retrovirus expressing genes of interest are provided. Additional sections, including growing B16 melanoma, enumerating pulmonary metastases, tumor imaging technique and use of recombinant viruses for vaccination, are discussed together with safety concerns (Table 20.1.2).

Table 20.1.2.

Protocol summery in this unit

Basic protocols	Supporting protocols
Tumor models: 1Subcutaneous B16 2Pulmonary metastatic B16 3Spontaneous melanoma in transgenic mice	1Growing B16 tumor cells 2Enumerating pulmonary metastases 3Luciferase imaging
Tumor protection: 4B16.GM-CSF vaccine 5rVV TRP-1 immunization	4Immuniation with recombinant rVV, rFPV or rAd 5Detection of antibodies against MDA by ELISA
Therapeutic approach: 6Adoptive transfer of T cells 7Development of HLA restricted antigen-specific T cells for Clinical use	6CTL induction 7CTL isolation and testing 8CTL maintenance 9Culture Pmel-1 T cells 10Retroviral transduction of mouse T cells

Basic Protocol 1

MOUSE MODEL OF SUBCUTANEOUS TUMOR

The subcutaneous model is widely used for the evaluation of therapy in many tumor models, including B16 melanoma. Upon subcutaneous injection into syngeneic C57BL/6 mice, B16 will form a palpable tumor in 5 to 10 days and grow to a 1cm × 1cm tumor in 14 to 21 days. When allowed to grow larger, the tumors often become necrotic in the center and begin to ulcerate or bleed; it is advisable to sacrifice the mice before this point. The typical dose used is 1–5 × 10⁵ cells/mouse. For any new tumor type, test its growth with 1×10⁴ to 5 × 10⁶ cells/mouse to establish a suitable model. It is important to note that, for subcutaneous tumor growth experiments, a consistent injection technique is extremely important. Each mouse should show a clearly visible, defined “bleb” upon injection; if not, a new mouse should be used. Mice without a clear “bleb” will show delayed tumor growth or no growth at all

Materials

B16 culture, 50–80% confluent (see Support Protocol 1)

TrypLE™ Express (Life Technologies)

DMEM medium (see recipe)

Phosphate buffered saline (PBS, Life Technologies) or Hanks’ balanced salt solution (HBSS, Life Technolgies)

6- to 12-week-old female C57BL/6 mice

70% isopropyl alcohol Prep (WEBCOL™, Kendall)

50-ml conical centrifuge tubes

Refrigerated centrifuge such as Sorvall RC4

100 µm cell strainer (Falcon)

1-ml disposable syringes and 27G × ½ inch needles

Hair clipper (WAHL, Model 8761)

Calipers

Additional reagents and equipment for trypsinizing cells, counting cells in a hemocytometer, and determining viability by trypan blue exclusion (APPENDIX 3B), restraint of mice (UNIT 1.3), ear tagging (UNIT 1.5), and subcutaneous injection of mice (UNIT 1.6)

Prepare B16 cells

• 1
  Ensure that B16 cells are in the logarithmic growth phase when harvesting for injection about 50–80% confluent.

  • Nondividing tumor cells from confluent flasks may not take as well.
• 2
  Aspirate medium, rinse flask briefly with 3 ml TrypLE™ Express, and aspirate again.

  • Rinsing helps remove fetal bovine serum (FBS), which otherwise dilutes the trypsin and inhibits proteolysis. APPENDIX 3B provides additional detail on trypsinization of cells.
• 3
  Add 5 ml TrypLE™ Express and tilt flask to ensure that all cells are covered. Periodically and firmly tap side of flask until cells detach and slide down the culturing surface.

  • Do not leave cells in trypsin any longer than necessary to ensure high viability.
• 4Add 5 ml cold DMEM medium and pipette vigorously to obtain single-cell suspension.
• 5Transfer to 50-ml conical centrifuge tube and add 40 ml cold DMEM medium to neutralize trypsin.
• 6Centrifuge the cells for 5 min at 663× g (1500 rpm in Sorvall RC4 centrifuge), 4°C.
• 7Decant supernatant and resuspend cells in ice-cold PBS or HBSS, aiming for 1–5×10⁶ cells/ml.
• 8
  Pass suspension through disposable cell strainer to remove any clumps. Count live cells using trypan blue (APPENDIX 3B).

  • Viability should be >90%.
• 9Adjust cell concentration to 1–5 ×10⁶ cells/ml in ice-cold PBS or HBSS.

Inoculate mice

• 10
  Relocate work area to facility where 6 to 12 week old female C57BL/6 mice are kept, keep cells on ice.

  • Inject cells as quickly as possible after preparation; viability slowly decreases over time, even on ice.
• 11
  Hold mouse with one hand and shave abdominal hair with hair clipper and sanitize the skin with 70% ethanol prep.

  • Mice can also be shaved in advance especially when more than 50 mice are required in an experiment. This can help prevent tumor cells sitting on ice for a long period of time. Sanitizing the skin needs to be performed immediately prior to injection.
• 12Resuspend cells by inverting tube several times. Fill 1-ml syringe with attached 27G × ½ in needle.
• 13
  Hold a mouse with one hand, use the other hand to slide needle 5 to 10 mm subcutaneously and inject 100 µl cell suspension; watch for appearance of a “bleb”.

  • Holding a mouse with single hand requires some practice: use thumb and index finger to hold the neck, ring and little finger to press down the hind legs. This will result in a much tightened abdominal skin which is critical for successful subcutaneous injection.
  • Failure to insert needle far enough will result in leakage of tumor suspension when mice massage the area after injection. If no clear “bleb” results, sacrifice mouse and use a new one.
• 14
  Gently withdraw needle and place mouse back in cage.

  • Do not let the syringe with cell suspension sit undisturbed on bench for more than 5 minutes because the cells can settle quickly.

Randomize mice and follow up

• 15Ear tag mice (UNIT 1.5) to blind the experiment and randomize among cages.
• 16
  Observe mice for tumor growth. Use calipers to measure perpendicular tumor diameters.

  • Tumors should become palpable in 5 to 10 days.

Basic Protocol 2

MOUSE MODEL OF MULTIPLE PULMONARY TUMOR METASTASES

The pulmonary metastasis model is the other widely used method for evaluating therapy in many tumor models, including B16 melanoma. Since essentially all tumor cells that “take” upon intravenous tumor injection are found in the lungs, the term pulmonary metastasis is widely used even though every resulting pulmonary nodule is technically an independent “primary” tumor rather than a true metastasis. The typical dose used is 2 × 10⁵ cells/mouse, which will yield between 50 and 250 pulmonary nodules visible on the lung surface. Since the melanin in B16 does not bleach like the rest of the pulmonary tissues, the tumor nodules can be easily visualized after bleaching of the extracted lungs in Fekete’s solution (see Reagents and Solutions). There is always a fraction of nodules that is amelanotic (“white”); this requires careful counting in order not to underestimate tumor burden. For non-pigmented tumor, India ink is injected into the lungs to create a color-contrast.

Intravenous injections (tail vain) are difficult and require extensive practice. It is recommended that no “real” experiments be performed until investigators are comfortable with the technique, since the inexperienced injector is likely to introduce inconsistent tumor take among mice.

Materials

B16 culture, 50–80% confluent (see Support Protocol 1)

TrypLE™ Express (Life Technologies)

DMEM medium (see recipe)

PBS or HBSS (Life Technologies)

6- to 12-week old female C57BL/6 mice

70% isopropyl alcohol Prep (WEBCOL™, Kendall)

50-ml conical centrifuge tubes

Refrigerated centrifuge, such as Sorvall RC4

100 µm cell strainer (Falcon)

1-ml disposable syringes and 27G × ½ inch needles

Heat lamp

Additional reagent s and equipment for counting cells in a hemocytometer (APPENDIX 3B), restrain of mice (UNIT 1.3), ear tagging (UNIT 1.5), and intravenous injections (UNIT 1.6).

Prepare B16 cells

• 1
  Perform steps 1 to 8 of Basic Protocol 1 to prepare cell suspension.

  • Take special care to remove clumps by straining the trypsinized cells just before injection. Clumps can kill mice upon intravenous injection by causing embolisms.
• 2Adjust cell concentration to 4 × 10⁵ cells/ml in ice-cold PBS or HBSS.

Inoculate mice

• 3
  Relocate work area to the facility where 6 to 12-week old female C57BL/6 mice are kept; keep cells on ice.

  • Inject cells as quickly as possible after preparation; viability slowly decreases over time, even on ice.
• 4Warm mice by placing open cage under heat lamp for 2 to 3 minutes, until tail veins are dilated.
• 5
  Thoroughly resuspend cells by inverting tube several times. Quickly fill 1-ml syringe with B16 cells and attach a 27G × ½ in needle.

  • Failure to resuspend will result in steadily decreasing numbers of tumor cells injected. Avoid air-bubbles in the syringe.
• 6
  Immobilize mouse in a restraint that allows the tail to protrude and inject 0.5 ml cell suspension intravenously into dilated tail vein (also see UNIT 1.6).

  • The tail veins run laterally from the clearly visible central tail artery, into which injection is difficult. Start towards the tip of tail; if the injection fails to enter easily, the needle is not inside the vein; don’t try to force it in but try again by moving closer to the base of tail.
• 7Resuspend cells before each syringe refill.

Randomize mice and follow-up

• 8If mice have not been pretreated, ear tag mice and randomize mice to blind the experiment.
• 9
  Euthanize mice by CO₂ asphyxiation on day 16 to 18 after tumor inoculation and enumerate lung metastases (see Support Protocol 2).

  • Alternatively, follow mice for survival.
  • Untreated mice will begin to die of pulmonary congestion caused by tumor, starting around day 21.

Basic Protocol 3

INDUCTION OF SPONTANEOUS TUMOR IN TRANSGENIC MICE

In recent years, genetic modifications in mice have provided new opportunities for investigators to study spontaneous tumors that can better mimic human cancers. Some of the early versions of mouse models overexpress oncogenes under the control of tissue-specific promoters (Greenberg, 1995; Hanahan, 1985; Stewart, 1984). The more advanced models combine the interruption of tumor suppressers genes (Donehower, 1992; Hingorani, 2005; Aguirre, 2003) and inducible tissue-specific “knock-in/out” technology to develop tumors in a controlled manner. The latter models are more suitable for therapeutic studies. One important note for immunological studies is that mouse strains are critical for any MHC restricted intervention. In order to avoid the complications caused by any differences in minor histocompatability during adoptive cell transfer, complete backcross (N>10) to the designated strain is preferred. In this unit the authors demonstrate the induction of spontaneous cutaneous tumor in Tyr:CreERT2/BRAFhV600E CA/CA/PTEN flox/flox transgenic mice.

Materials

4-hydroxytamoxifen (4-HT, > 70% z-isomer, Sigma),

Dimethylsulphoxide (DMSO, Sigma)

Nair hair remover

4–5 weeks old Tyr:CreERT2/BRAFhV600E CA/CA/PTEN flox/flox transgenic mice.

Brown colored non-transparent microcentrifuge tube

Sterile swabs

Paper towel, wet with warm water

10 µl pipette and tips

Fine tip paint brush

Hair clipper (WAHL, Model 8761)

Caliper

Prepare 4-HTsolution

• 1Dissolve 1.9 mg/ml of 4-HT in DMSO to make a 5 mM solution. Make 50–100 µl aliquots in dark microcentrifuge tubes to avoid light degradation and store in −20° freezer.

Induction of tumor

• 2Relocate work are to facility where transgenic mice are housed.
• 3
  Shave the lower back of mice and apply a thin layer of Nair on the shaved skin with sterile swab.

  • Because spontaneous tumor can occasionally occur without 4-HT treatment after 12 weeks of age in this strain of transgenic mice (Tyr:CreERT2/BRAFhV600E CA/CA/PTEN flox/flox), 4–5 week old mice are optimal for tumor induction by 4-HT.
• 4After 5 minutes of Nair application, wet paper towel with warm water and wipe off Nair. Repeat until the lotion is completely cleared from the skin.
• 5Drop 2 µl of 4-HT solution onto the clean skin with a 10-ul pipette and use a fine tip paint brush to evenly spread the 4-HT in a 5 mm × 5 mm area.

Monitor tumor growth

• 6After tumor development (1–2 months), monitor the growth by measuring perpendicular tumor diameters with a caliper.

Basic Protocol 4

TUMOR PROTECTION USING GM-CSF-TRANSDUCED WHOLE-CELL VACCINE (B16.GM-CSF)

It is difficult to induce reliable protection against aggressively growing tumors, such as mouse B16 melanoma challenge by vaccination with irradiated tumor, even when admixed with Corynebacterium parvum. However, robust protection can be obtained by vaccinating with tumor that is retrovirally transduced to secrete high levels of GM-CSF (Dranoff, 1993). Although B16.GM-CSF will still grow upon injection, vaccination with irradiated cells will induce a T cell-dependent protection against wild-type B16. It is unknown what antigens are targets of the immune protection, and the involvement of eosinophils and macrophages has been implicated (Hung, 1998). The following protocol describes the use of B16.GM-CSF for protection against B16 challenge in the authors’ laboratory. Additional results suggest it may also be possible to impact the growth of established tumors by vaccinations with irradiated B16.GM-CSF, especially in conjunction with anti-CTLA-4 antibody (van Elsas, 1999b). The addition of this antibody, which presumably abrogates T cell-inhibitory signaling through the CTLA-4 receptor, enhances protection and also allows for the induction of vitiligo, which does not routinely result when vaccinating with B16.GM-CSF alone.

When using a whole-cell vaccine, it becomes of greatest importance to ensure that tumor cells are free of mycoplasma, since vaccination with mycoplasma contaminated cells and subsequent challenge with mycoplasma contaminated cells could result in impressive mycoplasm-specific tumor rejection.

Materials

B16.GM-CSF culture, 50–80% confluent

B16 culture, 50–80% confluent

Trypsin/EDTA (Life Technologies)

TrypLE™ Express (Life Technologies)

DMEM medium (see recipe)

PBS or HBSS (Life Technologies), ice cold

6- to 12-week old female C57BL/6 mice

50-ml conical centrifuge tubes

Refrigerated centrifuge (such as Sorvall RC4)

100 µm cell strainer (Falcon)

1-ml disposable syringes and 27G×½ inch needles

γ-irradiator

Hair clipper (WAHL, Model 8761)

Calipers

Additional reagents and equipment for trypsinizing cells, counting cells in a hemocytometer, and determining viability by trypan blue exclusion (APPENDIX 3B), restraint of mice (UNIT 1.3), ear tagging (UNIT 1.5), and subcutaneous injection of mice (UNIT 1.6)

Prepare B16.GM-CSF vaccine

• 1Perform steps 1 to 8 of Basic Protocol 1 to prepare cell suspension.
• 2Adjust cell concentration to 1×10⁷/ml in ice-cold PBS or HBSS.
• 3Irradiate cells in a γ-irradiator with a dose of 50 Gy.

Vaccinate mice

• 4Relocate work area to the facility where 6- to12-week old female mice are housed; keep cells on ice.
• 5Inject 100 µl (1×10⁶ cells) of the irradiated B16.GM-CSF subcutaneously as described in Basic Protocol 1, steps 10 to 14.

Challenge mice

• 6Two to 3 weeks after vaccination, challenge mice with 1 × 10⁵ wild-type B16 as described in Basic Protocol 1.

Randomize mice and follow-up

• 7Ear tag mice (UNIT 1.5) to blind the experiment and randomize over cages.
• 8Observe mice for tumor growth. Use calipers to measure perpendicular tumor diameters.

Basic Protocol 5

INDUCTION OF B16 MELANOMA PROTECTION BY RECOMBINANT VACCINIA VIRUS (rVV) VACCINE

Currently, the two tumor vaccines that induced the most reliable protection of mice from lethal B16 challenge are rVV encoding the melanoma differentiation antigen (MDA), mTRP-1, and irradiated B16 expressing GM-CSF (Hung, 1998; Overwijk, 1999a). Although immunization with rVVhgp100 induces high levels of gp100-specific cytotoxic T lymphocytes (CTL), this regimen is completely ineffective in preventing B16 growth upon intravenous or subcutaneous challenge. However, adoptive transfer of in vitro cultured, gp100-reactive CTL can greatly reduce the number of lung metastases upon subsequent intravenous B16 challenge (Overwijk, 1998).

The following protocol describes the induction of tumor protection by vaccination with rVVmTRP-1. All viruses mentioned in this unit can be obtained through Dr. Nicholas Restifo at the Surgery Branch, NCI, NIH. Using this approach, vitiligo is also induced in essentially every vaccinated mouse, and can initiate anywhere on the body, with some apparent preference for the abdomen. Depigmentation should be scored blindly and compared with control mice receiving two injections of a control rVV encoding an irrelevant antigen. A slightly lighter shade of black or brown is not vitiligo, as this can occur at random even in untreated mice. Vitiligo manifests itself as clear, usually sharply demarcated white spots or bands, often bilaterally distributed over the body. Mice typically do not turn completely white, though an additional booster injection of rVVmTRP-1 may enhance the degree of depigmentation. Mice receiving only one vaccination of rVVmTRP-1 never develop vitiligo and are not protected from tumor challenge.

Safety Concerns Regarding the Use of Recombinant vaccinia viruses

Vaccinia virus (VV) and adenovirus have a very broad host range, infecting virtually all mammalian cells, including human. Everyone born before the early to mid-1970s has been vaccinated with the smallpox vaccine, which provides a long-lasting protection against systemic viremia upon VV infection. Most people are continually exposed to adenovirus, which is present in the upper respiratory tract of a large portion of healthy individuals where it ordinarily does not cause pathology. However, it is important to realize that, even in individuals who have been repeatedly boosted, a limited infection does occur upon dermal scarification with VV, as evidenced by a localized pustule and tender draining lymph nodes. Evidence is accumulating that mucosal immunity to vaccinia may be weak, so protection from infection through nose, mouth, and eyes may be particularly poor. In addition, wild-type adenovirus causes significant numbers of respiratory tract infections and even deaths, especially in infants and the elderly. Although rVV, rFPV and rAd used in vaccine approaches are all selected and/or modified low-virulence viral strains that have been administrated safely to humans in multiple clinical trials, the growing list of modifications artificially introduced in viral genomes makes them unpredictable agents. This becomes especially important when using viruses encoding human genes or their closely related mammalian counterparts. The effects of viruses encoding MDA on healthy individuals are largely unknown, but the real possibility exists that accidental exposure induces immunity to MDA, with vitiligo as a potential outcome. This is more than a theoretical risk, especially with the use of rVVmTRP-1, which induces irreversible vitiligo in mice. The greatest care should be taken when using recombinant viruses, especially those encoding mammalian “self” antigens. Wear gloves, protective eye wear, and use utmost precautions when injecting animals. Do not recap needles, and instantly discard used syringes and needles in designated biohazard sharp boxes. VV and FPV, especially, are quite stable viruses that retain infectiousness after lyophilization or prolonged exposure to room temperature. Do not leave virally contaminated tubes, pipettes, or pipette tips in the laminar flow cabinet or exposed in the biohazard waste box; use bleach to destroy the viruses. Do not flush leftover viral preparations down the drain before bleach treatment. As an additional precaution, those who intend to work with rVV should request a vaccination with smallpox vaccine regardless of whether they were ever vaccinated before. Virtually every animal facility has rules and regulations regarding the use of recombinant organisms in animals: be sure to contact your animal facility safety personnel. Handle recombinant viruses with respect.

Materials

6- to 12-week old female C57BL/6 mice

Additional reagents and equipment for immunization of mice with recombinant viral vectors (see Support Protocol 4)

Immunize mice

• 1
  Inject 6- to 12-week old female C57BL/6 mice intravenously with 1 × 10⁷ pfu rVVmTRP-1 as described in Support Protocol 6. Also immunize mice with a control rVV encoding an irrelevant antigen.

  • Prepare rVV for intravenous injection according to instructions in Support Protocol 4
• 2Two to 3 weeks later, boost mice intravenously with 1 × 10⁷ pfu rVVmTRP-1 or control rVV.

Monitor for vitiligo

• 3Between 2 and 3 weeks after the second immunization with rVVmTRP-1, look for clearly developed apparent depigmentation.

Challenge with B16 tumor

• 4As soon as depigmentation is apparent in all mice (i.e., typically 2 to 4 weeks after the booster injection), challenge mice subcutaneously with B16 melanoma and follow tumor growth (see Basic Protocol 1).

Monitor serological response

• 5Collect serum from immunized mice at any time for testing by ELISA (see Support Protocol 5).

Basic Protocol 6

ADOPTIVE TRANSFER OF TUMOR ANTIGEN-SPECIFIC T CELLS TO TREAT ESTABLISHED TUMOR

Adoptive transfer of tumor antigen-specific T cells to treat established tumor in mice have been demonstrated by the authors’ research team and others in the field of cancer immunotherapy (Overwijk, 2003; Chinnasamy, 2010; Kochenderfer, 2010; Kerkar, 2010). This experimental model has been directly translated into several clinical trials (Dudley, 2002; Kochenderfer, 2013; Phan, 2013) as well as adapted to study the mechanisms of adoptive immunotherapy and provide insights to improvement of therapeutic efficacy.

To be considered as an established tumor, vascularization is one of the criteria. In subcutaneous models, vascularization occurs after tumor size reaches 5 mm to 10 mm in diameter. In pulmonary metastases models, a 7-day tumor growth period prior to treatment is much preferred over a 3-day tumor growth period. In recent years, a bioluminescence imaging system using a cooled CCD camera is utilized to monitor systemically growing tumors expressing luciferase (see Support Protocol 3). The treatment schedule can therefore be determined based on the imaging results.

T cells used for adoptive transfer can be from various sources: freshly isolated lymphocytes either from spleens or lymph nodes; FACS sorted or antibody-column enriched lymphocyte subsets; ex vivo cultured T cells with antigen stimulation or retrovirual transduction. To ensure the quality of these T cells, it is recommended to test their functions in vitro prior to adoptive transfer. The viability of cells should be greater than 50% since the clumps of dead cells can cause acute pulmonary embolisms in mice. In 6- to 8-week old female C57BL/6 mice, a single dose of intravenously administered cells should not exceed 1×10⁸ cells. A typical dose is 1×10⁶ cells/mouse, and when titrating the cell numbers, a log increment is recommended to allow measurable differences in tumor treatment results.

The current standard protocol for adoptive immunotherapy in B16 melanoma model also requires sublethal total body irradiation and cytokine administration prior and post adoptive cell transfer, respectively (Gattinoni, 2005), as well as vaccination to activate antigen specific T cells (with the exception of using CAR transduced T cells) (van Elsas, 2001). Although alternatives have been identified to replace these requirements (Muranski, 2008; Wrzesinski, 2007; Dudda, 2013), the authors suggest to use the standard protocol as a control.

Materials

T cells (see Support Protocol 5–9)

Recombinant viral vaccines (optional)

Recombinant human IL-2 (optional)

HBSS (Life Technologies), ice cold

6- to 12-week old female mice

1000 µl Multi-channel pipette and tips

100-ml reagent basins, sterile

50-ml conical centrifuge tubes

Refrigerated centrifuge (such as Sorvall RC4)

γ-irradiator for small animals (optional)

Heat lamp

3 ml and 1 ml disposable syringes with 27G × ½ inch needles

Additional reagents and equipment for counting cells in a hemocytometer and determining viability by trypan blue exclusion (APPENDIX 3B), restraint of mice (UNIT 1.3), ear tagging (UNIT 1.5) and euthanasia by CO₂ asphyxiation (UNIT 1.8)

Prepare T cells

• 1
  Harvest T cells in culture media from 24-well plates (see Support Protocol 5–9) using multi-channel pipette and collect the cell suspension in a reagent basin. Transfer the cells into 50-ml conical centrifuge tubes.

  • One confluent well of a 24-well plate typically yields 5×10⁵ to 2×10⁶ cells
• 2
  Centrifuge the cell suspension for 10 minutes at 663 × g (1500 rpm using Sorvall RC4) at 4°C. Discard the supernatant and resuspend T cells in ice-cold HBSS or PBS, aiming for a final concentration of twice the designated cell numbers per mouse per ml.

  • If a large amount of debris is present in culture, purify T cells on a Ficoll gradient according to manufacturer’s protocol.
• 3Count cells using trypan blue to exclude dead cells (APPENDIX 3B).
• 4Dilute cells to desired concentration and keep on ice.

Transfer T cells

• 5Relocate work area to the facility where 6- to 12-week old female mice are housed.
• 6Randomize tumor bearing mice (5–10 mm in diameter for subcutaneous tumor, day 7, or desired imaging size for systemic tumor) by pooling in a large cage.
• 7
  Irradiate mice using γ-irradiator with a sublethal dose to deplete endogenous lymphocytes. (Optional)

  • In C57BL/6 mice, 5Gy is the standard dose. Irradiation of mice can be done one day before cell transfer.
• 8Warm mice by placing under heat lamp for 2 to 3 minutes until tail veins are dilated.
• 9
  Resuspend T cells before injection by repeatedly inverting tube. Fill 1 ml syringe with 27G½ inch needle with cell suspension.

  • When vaccinations are required, mix less than 10 µl/mouse (i.e.1–2 × 10⁷ pfu of rVV virus/mouse, see Basic Protocol 5) into the cells suspension immediately prior to intravenously injection. (optional)
• 10
  Immobilize mice using a restraint that allows tail to protrude and inject 0.5 ml of T cell suspension intravenously into tail vein.

  • When injecting large number of cells (i.e. > 5 × 10⁶), inject slowly to prevent embolisms.
• 11
  Inject 60, 000 to 600, 000 IU rhIL-2 in 0.5 ml of PBS intraperitoneally using 1 ml or 3 ml syringe and 27G ½ inch needles 1 to 2 times a day for three days. (Optional)

  • Mice should be closely monitored during the first week after cell transfer. If mice show any signs of distress or weight loss, adding soft food and hydrating gel in the cage can help their recovery.

Evaluate tumor burden

• 12Measure perpendicular tumor diameters of subcutaneous tumors 3 times per week using calipers. For systemic growing tumors, use bioimaging weekly (see Support Protocol 3). For pulmonary metastases, euthanize mice by CO₂ asphyxiation 16 to 18 days after tumor inoculation and enumerate the tumor nodules (see Support Protocol 2). Alternatively, follow mice for survival.

Basic Protocol 7

CLONING HLA-RESTRICTED ANTIGEN-SPECIFIC T CELL RECEPTORS FOR CLINICAL USE

HLA-transgenic mice are useful tools to generate T cells against antigens that are “self” in human, but “none-self” in mice. Because these T cells are not eliminated during the thymic negative selection, the affinity of their TCRs can be higher than those on human T cells. During the past decade, the authors have successfully identified several T cell receptors with high affinity to human tumor antigen in the context of HLA-A*0201 (Johnson, 2009; Parkhurst, 2009; Chinnasamy, 2011) and translated directly into clinical trials.

Target antigens and their HLA restricted epitopes need to be carefully selected prior to using this protocol. An ideal target antigen should be abundantly expressed in tumor cells and can be presented by HLA molecules on cell surface. Although MHC binding algorithm is commonly used to predict binding affinity of peptides derived from an antigen, the most reliable method is the direct detection of peptide/MHC complex on tumor cells by mass spectrometry. Tumor specificity is also a very important concern for target selection. Two categories of proteins are currently on the list: 1. Proteins that are only expressed in non-life-threatening tissues, such as melanocytes differentiation antigens and tumor-testis antigens. 2. Proteins that are mutated only in tumors and mutated peptide/MHC complexes are presented on tumors.

Specificity of the cloned TCR needs to be thoroughly tested before any consideration of clinical use. The panel of target cells should include not only tumors expressing the antigen and correspondent MHC, but also tumors expressing the antigen without correspondent MHC as well as tumors expressing neither the antigen nor the MHC.

Materials

Peptide of interests or recombinant viral vaccines

HBV-core peptide 128–140: TPPAYRPPNAPIL (a PAN MCH class II helper peptide)

Sterile HBSS or PBS (Life Technologies)

DSMO (Sigma)

Incomplete Freund’s adjuvant (Sigma)

Complete medium (CM; see recipe)

Ultrapure lipopolysaccharide (LPS) from E. coli 0111:B4 strain (InVivogen), prepared at 5 mg/ml in sterile water according to manufacturer’s manual.

Recombinant human IL-2

FACS buffer (see recipe)

RNA Later solution (Life Technologies)

RNeasy Mini Kit (Qiagen)

SMART cDNA synthesis kit (Clontech)

Zymoclean™ Gel DNA recovery kit (Zymo Research)

1.2% agarose gel with ethidium bromide

TA cloning kit (Life Technologies)

Plasmid DNA Miniprep kit (Qiagen)

6- to 8-week old HLA transgenic mice

Dremel MultiPro 3955 variable speed kit with a 1/8 inch drill

Pipette and tips

1 ml syringes

50 ml conical tubes

19G and 27G×½ inch needles

Sterile dissecting tools

70% isopropyl alcohol prep (Webcol^tm, Kendall)

70% isopropyl alcohol in a spray bottle

1.5 ml Eppendorf tubes

162 cm² tissue culture coated flasks

48 well plates

24 well plates

96 well round-bottom plates

FACS tubes

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer and determining viability by trypan blue exclusion (APPENDIX 3B).

Prepare peptide-adjuvant emulsion

• 1
  Dissolve immunization peptide in DMSO at 20 mg/ml and dissolve HBV-core helper peptide in DMSO at 24 mg/ml.

  • This solution can be stored at 4°C for several months. If the peptides do not completely dissolve in DMSO, use as a suspension instead of a solution, ensuring that it is mixed well immediately before step 2.
• 2
  Mix 50 µl of immunization peptide solution, 50 µl of HBV-core helper peptide/DMSO solution and 400 µl of PBS in an Eppendorf tube.

  • It is not recommended to use less than 1 ml of the final volume (0.5 ml of peptide and 0.5 ml of IFA) to prepare peptide/IFA using the drill-mix method. The advantage of using a drill instead of syringes to prepare the emulsion is saving time; however, it could lose up to 20–30% of the emulsion during transfer of emulsion to syringe. In general, one preparation should be enough to immunize 5 mice.
• 3Place a 48-well plate on ice, add 500 µl of IFA in one well. Install a clean 1/8 inch-drill into the head of the Dremel. Hold the Dremel with one hand, insert the drill tip in the well and start the speed at 1–2. Meanwhile, pipette 0.5 ml of the peptide solution into the well, then slowly drip in IFA in about 10–20 seconds. After all the peptides are added into the well, increase the speed to 4–5 and carefully stir the mixture for 30 seconds. Test the formation of emulsion by dropping 20 µl of the mixture onto water in a separate beaker. If the mixture does not spread out and forms an immiscible drop on the water surface, the emulsion is ready for use. Otherwise, repeat mixing at high speed for another 30 seconds. 2 to 3 repeats should be sufficient.
• 4Slowly fill the emulsion into a 1 ml syringe using a19G-needle and try to avoid any air bubbles. Change the needle to 27G × ½ inch and place the syringe on ice.

Immunize mice

• 5Relocate work area to the facility where 6- to 12-week old female mice are housed.
• 6
  The immunization procedure requires two people. One holds the mice and one injects. Wipe foodpads and tail with 70% isopropanol prep prior to injection. Inject 25 µl of emulsion into each foodpad and 50 µl into the base of tail (see basic protocol 1 for subcutaneous injection).

  • Inflammation of footpads is minimal using IFA, however, mild swelling may occur in some cases 5–7 days post injection. Be sure to monitor the mice and provide soft food and hydrating gel in the cage. The booster immunization may be only given at the base of the tail if the swelling persists.
• 7
  Repeat the same immunization procedure 2 weeks later.

  • If using recombinant virus, see Support Protocol 4.

Prepare antigen presenting cells

• 8
  Five days after the second immunization, harvest one spleen from a non-immunized HLA transgenic mouse and make a single cell suspension (see Support Protocol 6). Resuspend the splenocytes in 30 ml of CM containing 1 ug/ml of LPS and plate the cells in a 162-cm² tissue culture flask and incubate for 2 days.

  • These LPS stimulated lymphoblasts are used as antigen presenting cells (APCs) in stimulating T cells. Extra cells can be frozen in liquid nitrogen for future use.
• 9Seven days after the second immunization, collect LPS activated lymphoblasts into a 50-ml conical tube. Wash once with CM and re-suspend in CM at 3 × 10⁶ cells/ml.
• 10
  Add immunization peptide to the activated lymphoblasts at concentration of 1 µg/ml or less and put the cells in a 37°C/ 5% CO2 incubator for 2–4 hours with occasional mixing.

  • If the HLA transgenic mice have unstable MHC on the surface due to the lack of binding site of β2-microglobulin, 10 µg/ml of human β2-microglobulin can be added to the culture during peptide pulse. Peptide concentration can be as low as 0.01 µg/ml depending on its binding affinity to HLA molecules. If the affinity is unknown, start at 1 µg/ml.

Stimulate bulk T cells

• 11
  During peptide pulsing, euthanize the immunized mice by cervical dislocation and immediately harvest spleens, popliteal and inguinal lymph nodes into 50-ml conical tubes containing 10 ml of sterile PBS. Properly discard of animal carcasses.

  • Spray the mouse carcass with 70% isopropyl alcohol and use sterilized instruments for tissue harvesting. If multiple mice are used for one peptide immunization, tissues from individual mouse should be collected separately. Spleens and lymph nodes should also be collected in separate tubes. However, once the single cell suspensions are prepared, splenocytes and lymph node cells from a same mouse can be combined for stimulation.
• 12Make single cell suspension following Support Protocol 6. In a 50 ml conical tube, adjust cell concentration to 3×10⁶ cells/ml in CM and place it on ice.
• 13Irradiate peptide pulsed APCs with 30Gy of γ-radiation. Wash the cells with CM three times and resuspend the cells in the same volume of CM as used in peptide pulsing.
• 14In a 24 well plate, add 1 ml of peptide pulsed APCs (3×10⁶ cells) and 1 ml of immunized splenocytes or lymph node cells (3×10⁶ cells) in each well. Incubate in 37°C, 5% CO₂ incubator for 7–10 days.
• 15Every 7–10 days the cells can be restimulated in the same conditions except 60 IU/ml of IL-2 is added in the culture medium.

Test for antigen specificity

Test can be done 7 days after each round of ex vivo stimulation.

• 16
  During the ex vivo peptide stimulation, culture various target cells.

  • The target cells may include: LPS activated transgenic splenocytes, HEK 293 cells expressing HLA restriction elements and antigen, tumor cells. In the case of HLA-A*0201, T2 cells can be used as target cells.
• 17
  After 7 days of ex vivo peptide stimulation, either tetramer binding assay or antigen-specific IFN-γ production assay is performed. If peptide/HLA tetramers are available, move 100 µl of cell suspension from each well into individual FACS tubes and add 2 µl (or manufacturer’s recommended amount) of target peptide/HLA tetramer or control tetramer. Incubate on ice for 20 minutes. Wash the cells once with FACS buffer. Re-suspend the cells in 200 µl of FACS buffer and proceed to FACS. If tetramers are not available, T cell functions are tested by antigen-specific IFN-γ production assay using Support Protocol 7. Each well in the 24 well plate is tested separately. When settin up the co-culture, duplicated wells are preferred.

  • Due to a limited number of effector cells, T cells are not counted during the co-culture. By adding 100 µl of cell suspension into each well of the 24 well plate, 10×10⁴ cells can be placed in one well of a 96 well round bottom plate. Save tetramer positive and co-culture cell pellets by adding 200ul of RNA later solution to each well and storing at −20°C.

Clone antigen-specific T cells

• 18Harvest T cells that test positive for antigen reactivity from bulk stimulations and make a single cell suspension at 10, 3, 1 and 0.3 cells/ 100 µl of CM/IL-2 medium.
• 19Prepare LPS activated lymphoblasts and pulse with peptide (irradiated) as described in steps 8 to 10. Adjust the cell concentration to 5×10⁵ cells/ml in CM/IL-2.
• 20Add 100 µl of T cells (10, 3, 1 and 0.3 cells/well) to each well of a 96 well round bottom plate and 100 µl of peptide pulsed irradiated APCs (4 × 10⁴ cells/well) to the same well. Incubate in 37°C, 5%CO2 for 12–14 days.
• 21
  Monitor the growth of T cell clones by observing the cells under a microscope. Transfer any proliferating T cells first into a 96 well plate and then a 48 well plate.

  • T cell proliferations usually occur 5–7 days after antigen stimulation.
• 22
  Proliferating clones are tested following steps 16 to 17 before molecular cloning.

  • Save tetramer positive and co-culture cell pellets by adding 200ul of RNA Later solution to each well and storing at −20°C. These materials can be used for molecular cloning.

Clone antigen-specific T cell receptor

• 23
  Total RNA from T cell clone is isolated using Qiagen RNeasy Mini Kit following manufacturer’s manual.

  • The total T cell numbers required for molecular cloning can be as low as a few thousand. If positive cells are not found during the limiting dilution cloning, the cell pellets saved after each positive testing can be used for RNA isolation.
• 24Prepare 5’ RACE ready cDNA from total RNA using Clontech SMART (Switching Mechanism at 5’ End of RNA Template) cDNA synthesis kit following manufacturer’s instruction.
• 25Perform 5’ RACE (Rapid Amplification of cDNA Ends) using Clontech SMARTer RACE kit following manufacturer’s instruction. Gene specific primers for mouse T cell receptor: α-chain ggctactttcagcaggagga, β-chain aggcctctgcactgatgttc.
• 26Run the RACE PCR products on 1.2% agarose gel electrophoresis and purify any distinctive bands appearing at 800 to 900 base pairs using Zymoclean™ Gel DNA recovery kit (Zymo Research) following manufacturer’s instruction.
• 27Ligate freshly isolated 5’ RACE PCR products into TA cloning vector and transform into TOP 10 E. coli (Invitrogen) following manufacturer’s instruction.
• 28Grow bacteria culture from plated colonies in 1.2 ml of selection LB media for plasmid DNA isolation using Qiagen Plasmid DNA Miniprep kit.
• 29Sequence RACE product in plasmid DNA using the sequencing primers provided by TA cloning vector to determine TCR 5’ sequences.
• 30Use the 5’ sequencing information to design 5’ gene specific primers and 3’ gene specific primers for TCR α-chain (tcaactggaccacagcctcagc) and β-chain (tcatgaattctttcttttgaccatagcc) to PCR full length TCR using 5’RACE ready cDNAs and Clontech Advantage 2 HF Taq polymerase (following the manufacturer’s recommendation). PCR conditions are as following: 95°C for 1 minute, 35 cycles of 95°C for 30 seconds followed by 68°C for 3 minutes, 68°C for 3 minutes and 4°C to end.
• 31Repeat step 26 to 29 and note the full length TCR PCR products are 1500–1600 bp in length.
• 32Compare the full length TCR sequences to the database published at http://imgt.cines.fr/textes/vquest/ and determine the TCR nomenclatures. Exclude any sequences containing premature stop codons.
• 33
  Synthesize codon optimized TCR sequences using GeneArt Gene synthesis service and clone the α-chain and β-chain genes into a MSGV1 retroviral vector with a linker sequence encoding the foot and mouth disease picornavirus 2A “self-cleaving” site separating the two.

  • This viral vector can be obtained from Dr. Nicholas Restifo at Surgery Branch, NCI. Retrovirus encoding the TCR can be made by transfecting Plat-E cells (see Support Protocol 10). Retrovirally transduced human T cells (see Support Protocol 10) are tested again for tumor recognition before applying for clinical trials.

Support Protocol 1

GROWING B16 MELANOMA

Many laboratories carry B16 lines; however it is important to note that B16 tends to be an unstable cell line that has many variants among laboratories. Even within one laboratory, B16 can change quickly over time. Changes that have been observed include dramatic differences in the degree of pigmentation, minimum tumorigenic dose, metastatic potential, antigen expression, and recognition by CTL. Pigmentation, which may change from week to week, does not appear to clearly correlate with MDA expression or recognition by CTL; however, it is still important to freeze a large number of vials of the B16 line that “works,” and regularly thaw a new vial. B16 freezes and thaws well; trypsinized B16 cells can be washed in complete medium and frozen in 90% FBS/10% DMSO. Regardless of the source, every new tumor cell line that enters the laboratory should be tested for mycoplasma; these microorganisms are prevalent and may significantly influence in vitro and in vivo results, particularly tumor “take” upon injection. In addition, any murine tumor lines to be used in mice are subject to murine pathogen test such as molecular testing of biological material (MTBM) or murine antibody production (MAP) test. B16.F10 and other sublines can be obtained from American Type Culture Collection (ATCC; see SUPPLIERS APPENDIX) or the DCTDC Tumor Repository at the Frederick Cancer Research and Development Center of the National Cancer Institute (Frederick, Maryland). The DCTDC catalog contains additional information on B16.F10 melanoma and other sublines.

Materials

Cryopreserved vial of B16.F10

DMEM medium (see recipe), ice cold

15 ml centrifuge tubes

Refrigerated centrifuge (such as Sorvall RC4)

162 cm² tissue culture coated flasks

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer (APPENDIX 3B)

Thaw and plate B16 cells

• 1
  Rapidly thaw a vial of cryopreserved B16 cells in a 37°C water bath until a small ice crystal is left in the vial.

  • Prevent “heat shock” to tumor cells.
• 2Transfer contents into a 15 ml tube containing 10 ml ice cold DMEM medium.
• 3
  Centrifuge the cells for 10 minutes at 663 × g (1500 rpm, Sorvall RC4) at 4°C

  • Cell pellet should appear light brown to black.
• 4Decant supernatant and resuspend cells in 20 ml of ice-cold DMEM medium.
• 5Plate in 162 cm² tissue culture coated flask and grow in 37°C, 5% CO₂ incubator.

Maintain culture

• 6Split 1:5 to 1:10 into a 162 cm² tissue culture flask when cells are 80–90% confluent (typically twice a week).
• 7Use cells when in logarithmic growth phase (50–80%); this will yield 1–5×10⁷ cells per 162 cm² flask.

Support Protocol 2

ENUMERATING PULMONARY METASTASES IN MICE WITH B16 MELANOMA

Counting pulmonary nodules is facilitated by using a magnifying glass and lamp. Lungs with >250 pulmonary nodules are often scored as too numerous to count (TNTC) and assigned an arbitrary value of 250, since tumor nodules tend to fuse into continuous tumor sheets. Inclusion of such a nonlinear value necessitates a specific statistical test to determine significant differences between groups, i.e., the Kruskal-Wallis test, which can be found in every statistics textbook. Code the vials to enable subsequent counting in a blinded fashion.

Materials

B16-injected mice (see Basic Protocol 2)

Fekete’s solution (see recipe)

Hardboard plate and pins

Sterile dissecting tools

Scintillation vials (PGC Scientifics)

Additional reagents and equipment for ear tagging (UNIT 1.5) and euthanasia by CO₂ asphyxiation (UNIT 1.8)

Isolate lungs

• 1Ear tag mice (UNIT 1.5), if necessary.
• 2
  Euthanize mice by CO₂ asphyxiation.

  • Cervical dislocation tends to rupture cervical blood vessels, causing the chest cavity to fill with blood clots that complicate lung extraction and enumeration of tumor nodules. Euthanized mice may be stored for up to several days at 4°C without compromising tumor counts.
• 3
  Pin mice face up to hardboard plate.

  • Use push pins through hands and tail to stretch the body.
• 4
  Open chest cavity with scissors, clipping a “V” from apex of sternum through ribs to upper left and right shoulder.

  • Use small sharp scissors, taking care not to cut into lungs.
• 5Use forceps to pull sternal plate towards and over head, exposing lungs and heart.
• 6
  Using forceps, firmly grasp lung hilus directly above the heart and pull out lungs and heart as one unit.

  • Ensure that no pulmonary lobes remain in chest cavity.
• 7Rinse lungs in clean water to remove excess blood.
• 8
  Place lungs in a labeled glass scintillation vial containing 5 ml Fekete’s solution.

  • Lungs should fix instantly and bleach to dull pink/white. B16 nodules will appear black, with occasional amelanotic, gray/white nodules.
• 9After harvesting entirety of lungs, properly discard animal carcasses.

Enumerate nodules

• 10Enumerate pulmonary nodules by a blinded investigator.
• 11
  Using forceps, pry fixed lungs apart into individual lobes and enumerate tumor nodules on each lung. Also note total for all lobes.

  • A lamp and magnifying glass are helpful.
• 12
  Place lobes back in scintillation vial and store for future reference.

  • The lobes may be store indefinitely at room temperature in a tightly sealed vial.
• 13Determine the average number of nodules for all mice within treatment groups.

Support Protocol 3

BIOIMAGING OF LUCIFERASE-EXPRESSING TUMOR IN VIVO

This protocol requires the use of luciferase-expressing tumor and mice with light hair coat. Luciferase expressing tumor can be generated by stable transfection of tumor cells with plasmid DNA encoding luciferase under the control of mammalian constitutive promoter such as CMV promoter or by transduction of tumor cells with retrovirus encoding luciferase gene. Albino mice in various MHC backgrounds can be used if the hair coat color of original strain is dark or black. For example, in B16 tumor model, albino C57BL/6 mice are recommended.

Bioimaging can also be used to trace adoptively transferred T cells in vivo (Rabinovich, 2008). T cells are transduced with retrovirus expressing luciferase prior to adoptive transfer (see Support Protocol 10). Follow the same imaging procedures as described in this unit to trace the cells.

Materials

D-luciferin substrate (Caliper Life Sciences)

Dulbecco's PBS, without Ca⁺⁺ and Mg⁺⁺ (DPBS, Life Technologies)

Isoflurane

Luciferase-expressing tumor bearing mice

27G × ½ inch needle

1 ml syringes

70% isopropyl alcohol prep (Webcol^tm, Kendall)

IVIS 200 Pre-clinical In Vivo Imaging System (Caliper Life Sciences)

Living Image^® software (Caliper Life Sciences)

XGI-8 Gas Anesthesia System (Caliper Life Sciences)

Inject luciferase substrate

• 1Prepare D-luciferin substrate in DPBS at 15 mg/ml and fill in a 1 ml syringe.
• 2Restrain the mouse abdominal side up with one hand and use the other hand to wipe the lower left abdominal quadrant of mouse with alcohol prep.
• 3
  Keep mouse restrained and use the other hand to hold the syringe with needle’s bevel-side facing up, slightly angled, and penetrate 4–5 mm into abdominal wall to inject 100 µl substrate solution per 10g of mouse body weight.

  • A Luciferin kinetic study should be performed for each animal model to determine peak signal time after Luciferin administration. In general mice should be imaged 5–15 minutes after the substrate injection.

Bioimage tumor

• 4
  Place mice into a clear anesthesia box with 1–3% of isoflurane.

  • Because the peak of luciferin signal is time-sensitive, no more than 5 mice should be imaged together.
• 5
  After mice are fully anesthetized, transfer the mice to the nose cones attached to the manifold in the imaging chamber.

  • Practice the procedures to ensure that everything goes smoothly to achieve the best image in an optimized time frame, especially when handle multiple mice at a time.
• 6Close the door of imaging chamber and acquire images according to manufacturer’s instruction. Image both ventral and dorsal side of the mice. After images are acquired, return the mice to their cage.
• 7Designate regions of interest from displayed images and quantify as total photon counts or photon/second using Living Image^® software.

Support Protocol 4

IMMUNIZATION WITH rVV, rFPV, OR rAd

The construction, amplification, and purification of recombinant vaccinia virus are described in detail in Earl et al. (Earl, 1998). All viruses mentioned in this unit can be obtained through Dr. Nicholas Restifo (restifonih.gov) at the Surgery Branch, NCI, NIH. This protocol describes the use of recombinant vaccinia virus (rVV), recombinant fowlpox virus (rFPV), and recombinant adenovirus (rAd) in vivo. Make sure to contact the animal facility safety personnel to discuss safety and regulations for the use of viruses in a particular facility. Since rVV and rFPV are used identically, procedures are described for rVV only. The use of rVV and rFPV at a concentration ≥ 1 × 10⁹ pfu/ml is recommended since use of crude, unpurified, or low-titered preparations can result in the injection of relatively large and potentially lethal quantities of cellular debris and contaminants originating from the amplification cell line.

Typical doses that induce reliable immunization upon intravenous injection are 1×10⁷ plaque forming units (pfu) of rVV or rFPV, and 1×10⁹ pfu of rAd. These immunizations have induced CTL and antibody responses to foreign antigens such as β-galactosidase, chicken ovalbumin, and influenza nuclear protein, as well a the “self” proteins gp100, tyrosinase, and TRP-2 (Overwijk, 1997; Overwijk, 1998; Colella, 2000; Bronte, 2000). Two immunizations with 1×10⁷ pfu rVVmTRP-1 will induce mTRP-1 specific antibodies, vitiligo and tumor protection in essentially 100% of mice (Overwijk, 1999a).

If necessary, mice can be boosted with virus or another immunogen, such as plasmid DNA, to enhance the immune response. Vaccine vectors used for boosting should preferably be different from those used for primary immunization to prevent rapid clearance of the vector by the vector-specific immune response induced during primary immunization. Therefore, using rVV followed by rFPV or rAd is more effective than rVV followed by rVV (Irvine, 1997).

CTL responses peak around 6 days after primary immunization or 4 days after booster immunization (Irvine, 1997). Spleens or serum can be harvested 2 to 3 weeks after last immunization. This is also the optimum time to challenge mice with B16; CTL and antibody levels tend to gradually decrease with time.

Materials

rVV or rFPV stock at a titer > 1×10⁹ pfu/ml, or rAD at a titer > 1×10¹⁰ pfu/ml

PBS (Life Technologies), ice cold

6- to 12-week old female C57BL/6 mice

Cup sonicator filled with ice water

Heat lamp

1 ml disposable syringes and 27G×½ inch needles

Additional reagents and equipment for mouse restraint (UNIT 1.3), ear tagging (UNIT 1.5), and intravenous injection of mice (UNIT 1.6)

Prepare virus

• 1
  Thaw rVV, rFPV or rAd viral stock in 37°C water bath.

  • From this point on, all procedures are performed on ice.
• 2
  Optional: Sonicate virus stock (in case of rVV or rFPV) using an ice-water-filled cup sonicator at full power for 30 seconds.

  • This breaks up clumps formed during freezing. Wear ear protection.
• 3
  Dilute virus in ice-cold PBS to desired concentration.

  • Typically 2×10⁷ pfu/ml for rVV or 2×10⁹ pfu/ml for rAd.
  • Viral stocks can be refrozen. rVV and rFPV are quite stable and can be freeze-thawed several times without major reduction in titers. rAd is less stable depending on its diluents and should preferably be aliquoted after purification so that no refreezing is necessary.

Immunize mice

• 4Relocate work area to the facility where the 6- to 12-week old female C57BL/6 mice are kept, while keeping virus on ice.
• 5Warm mice by placing under heat lamp for 2 to 3 minutes, until tail veins are dilated.
• 6Immobilize mice using a restraint that allows tail to protrude. Inject 0.5 ml virus intravenously in tail vein (UNIT 1.6) using a 1 ml syringe and 27G×½ inch needle.

Randomize mice

• 7If mice have not been pretreated, randomize mice after they have been injected. Ear tag mice to blind the experiment.

Support Protocol 5

DETECTING ANTIBODIES AGAINST MDA BY ELISA

It is recommended making a large bath of B16 lysate and freezing it in 5 ml aliquots since there can be considerable variation between batches. B16 lysate loses reactivity with increasing freeze-thaw cycles; for this reason, use a fresh aliquot for each experiment.

It is of critical importance to include a lysate made from cells that do not contain the antigen(s) of interest as a negative control, along with the B16 lysate to control for nonspecific reactions.

Instead of B16 melanoma, non-melanoma cells transfected with plasmid DNA or infected with viral vectors encoding MDA can be used. However, if antibody responses were induced using recombinant viruses, the resulting high titers of antiviral antibodies will typically obscure most specific antibody responses to the transgene if virus-infected cells are used as the source of antigen for ELISA. This protocol is less sensitive for detecting antibodies than protocols that use immunoprecipitated MDA from lysates of metabolically labeled (³⁵S-methionine) B16 cells (Naftzger, 1996). However, it is faster and does not require the use of radioactivity.

Typical dilutions of sera are 1:10, 1:50, 1:250, 1: 1, 250, 1:6, 250, and 1:31, 250. Dilutions are made in PBS with 1% BSA.

Materials

B16 culture

PBS (Life Technologies), ice cold

1% and 5% (w/v) BSA in PBS (Life Technologies)

Sera from immunized mice

HRP-conjugated anti-mouse Ig (Amersham Pharmacia Biotech)

TMB substrate (Life Technologies)

4M H₂SO₄

Disposable cell scraper

Refrigerated centrifuge

PVC microtiter plates (Dynex Technologies)

ELISA reader

Prepare B16 cell lysate

• 1Ensure that B16 cells are 50–80% confluent.
• 2
  Decant medium. With a cell scraper, scrape B16 cells from culture flask and re-suspend in 10 ml ice-cold PBS. Pipette vigorously to obtain a single-cell suspension.

  • If necessary, pass through a cell strainer.
    Do not use trypsin since it may cause proteolysis of the MDA of interest.
• 3Count cells (APPENDIX 3B). Centrifuge the cells for 5 minutes at 663 × g, 4°C.
• 4
  Carefully remove all supernatant using vacuum aspiration. Resuspend cells at 2×10⁵ cells/ml in PBS, transfer to freeze-resistant tube, and lyse using 3 freeze/thaw-cycles.

  • Use freeze-resistant tubes; alternate between liquid nitrogen and 37°C water bath.

Coat and block plates

• 5Plate 50 µl/well of lysate (equivalent to 1×10⁴ cells) into PVC microtiter plates. Dry overnight at 37°C.
• 6
  Block with 100 µl 5% BSA in PBS per well for 1 hour at 37°C. After 1 hr, discard blocking buffer from ELISA plates.

  • Remove remaining buffer by clapping inverted plate on a hard surface.

Probe wells with serum samples

• 7
  Add 50 µl mouse sera diluted in PBS with 1% BSA per well and incubate for 2 hr at 37°C.

  • Typical dilutions of sera are 1:10, 1:50, 1:250, 1: 1, 250, 1:6, 250, and 1:31, 250.
• 8Wash wells three times with 1% BSA in PBS, room temperature.
• 9Incubate with HRP-conjugated anti-mouse Ig at 1:4000 dilutions in 1%BSA in PBS for 1 hr at 4°C.
• 10Wash three times with 1% BSA in PBS, room temperature.

Develop Enzymatic reactions

• 11Add 50 µl of TMB substrate per well and incubate for 10 minutes at room temperature.
• 12Stop reaction by adding 50 µl 4M H₂SO₄ per well.
• 13Read plate at 492 nm in an ELISA reader.

Support Protocol 6

GENERATING B16 MELANOMA-SPECIFIC T CELL CULTURES

This protocol can be used to test the degree of immunization against specific antigens upon vaccination. It assumes that an MHC Class I restricted peptide epitope has been identified for in vitro restimulation and testing. Alternatively, irradiated B16 tumor cells can be used as stimulators; however, in the authors’ experience this often results in outgrowth of TRP-2 reactive CTL, even when stimulating splenocytes from naive mice (Bloom, 1997; Zeh, III, 1999). This protocol has been used to determine efficacy of immunization with recombinant viruses (i.e., rVV, rFPV, rAd; see Support Protocol 4), whole tumor cells (see Basic Protocol 4), recombinant DNA, whole protein and synthetic peptides. T cell cultures are initiated 2 to 3 weeks after vaccination.

Materials

Immunized mice, at least 2 mice per group (see Basic Protocols 3 and 4)

HBSS (Life Technologies), ice cold

ACK Lysing buffer (Life Technologies)

CM (see recipe), ice cold

Peptide stocks: 10 mg/ml in DMSO

Sterile dissecting instruments

70% isopropyl alcohol in spray bottle

100 µm sterile disposable cell strainers (BD biosciences)

3 ml syringe

50 ml conical tubes

Refrigerated centrifuge (such as Sorvall RC4)

25 cm² flasks

Prepare single cell suspension from spleen

• 1Euthanize immunized mice using cervical dislocation.
• 2
  In a biosafety cabinet, using sterile instruments, remove spleens and place into 50-ml conical tube with 5 ml ice-cold HBSS and place on ice.

  • Spleens are obtained through incision in the left flank after wetting of fur with 70% isopropyl alcohol.
• 3Insert a 100 µm disposable cell strainer into a 50-ml conical tube. Transfer spleens to the strainer and mash spleens thoroughly with the sterile end of a plunger from 3 ml syringe.
• 4Rinse the strainer with 10 ml of cold HBSS and discard the cell strainer.
• 5Close the cap and centrifuge the cell suspension for 5 minutes at 779 × g (1800 rpm, Sorvall RC4) at 4°C.
• 6Discard the supernatant and resuspend the cell pellet with 5 ml of ACK lysis buffer. Incubate at room temperature for 5 minutes.
• 7Add 45 ml of cold HBSS to the tube and centrifuge the cell suspension for 5 minutes at 600 × g at 4°C
• 8
  Add 10 ml of CM to the cell pellet and pipette vigorously to obtain single-cell suspension.

  • UNIT 3.1 contains additional details on preparation of spleen cell suspensions.
• 9Count cells.
• 10
  Divide cells into groups- e.g., specific peptide(s), control peptide(s) – and culture 2×10⁶ cells/ml CM in a 25-cm² tissue culture flasks.

  • Typically 10 to 30 ml CM/flask. Alternatively, cells can be cultured at 3–5×10⁶ cells/well in a 2 ml CM/well in 24 well plates. No rIL-2 is added.

Stimulate cultures

• 11
  Add 1 to 10 µM final concentration of the appropriate stimulator peptide.

  • This roughly equals 1 to 10 µg/ml for 9-mer peptides.
• 12
  Incubate flasks horizontally. Culture for 7–10 days at 37°C before testing or restimulation.

  • Slightly unscrew caps or use vented caps to allow gas exchange.

Support Protocol 7

FUNCTIONAL TESTING OF B16 MELANOMA-SPECIFIC T CELLS

When testing CTL lines, especially new secondary cultures, it is critical to include two types of negative controls. First, a CTL culture or line that is not antigen-specific must be included. Some CTL lines, and in particular secondary cultures, often display non-specific recognition of tumor cells, especially B16, which can be a good stimulator of some T cell lines with unrelated specificity. The best control for this is CTL generated from the same splenocytes (i.e., same mice) as the CTL cultures of interest, except using a 7-day culture of the splenocytes with either a different peptide or no peptide. The recognition of B16 by this nonspecific CTL culture should be carefully compared to the recognition of B16 by the CTL culture of interest. This controls for the ability of B16 to nonspecifically stimulate cytokine secretion by any CTL culture it is incubated with; this nonspecific secretion can be quite pronounced.

The second control that should be included is one or more nonspecific target cells, i.e., any tumor cell line that is antigen negative and is H-2^b. Examples are sarcomas from the MCA series, EL-4 thymoma, or MC 38 colon carcinoma. This controls for the nonspecific reactivity of the CTL cultures of interest; some CTL cultures can “recognize” essentially any tumor with which they are incubated.

It is important to keep vials of peptide stock solution physically separated. These peptides are highly stable and, due to their high concentrations, the smallest peptide cross-contamination can result in erratic “recognition” upon use in CTL assays. Ethanol does not destroy peptides, and any peptide clinging to the outside of the vial, gloves, etc., can easily cross-contaminate another vial.

Materials

B16-specific CTL bulk culture (see Support Protocol 6)

CM (see recipe)

Target cells, including B16 and control tumor cell lines

10 mg/ml peptide stock in DMSO

IFN-γ ELISA kit

Sterile reagent basins

50-ml conical tubes

Refrigerated centrifuge (such as Sorvall RC4)

96 well round-bottom plates

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer and determining viability by trypan blue exclusion (APPENDIX 3B)

Harvest CTL cultures

• 1Suspend B16-specific CTL from wells or flasks by vigorously pipetting medium up and down. Collect all cells into a reagent basin and transfer the cell suspension to 50-ml conical tubes.
• 2Centrifuge cell suspension for 5 minutes at 779 × g (1800 rpm, Sorvall RC4) at room temperature.
• 3Decant supernatant and resuspend cell pellet in CM at a final concentration of 1–5×10⁶ cells/ml.
• 4
  Count cells using trypan blue to exclude dead cells. Dilute cells to 5×10⁵ cells/ml in CM.

  • There will be quite a few dead cells.
• 5
  Plate 100 µl cells/well (5×10⁴ cells) in round-bottom 96 well plate.

  • If signal is expected to be weak, use 1×10⁵ cells/well.

Prepare targets

• 6Prepare target cells at 5×10⁵ cells/ml.
• 7
  For peptide-pulsed targets, incubate target cells with 1 to 10 µM peptide in CM at 37°C for 2 hrs. Wash in CM, then centrifuge for 5 minutes at 779 × g (1800 rpm, Sorvall RC4) at 4° C to remove free peptide. Repeat 2 times, for a total of 3 washes.

  • Alternatively add 100 µl peptide (2 to 20 µM in CM) directly to CTL. The CTL will present peptide to each other on MHC Class I and subsequently kill each other, but not before secreting high quantities of IFN-γ. Adding peptide directly tends to yield a more sensitive reading than using peptide-pulsed tumor targets; it also eliminates possible background recognition of the tumor target itself.

Co-culture CTL and targets

• 8Add 100 µl of target cells (5×10⁴ cells) to each well containing T cells.
• 9
  Incubate co-culture plates overnight at 37°C.

  • In cases of established CTL lines, lysis of targets can sometimes be scored visually, which can be useful when screening large numbers of cultures; however IFN–γ ELISA is a more sensitive assay.

Test supernatant

• 10
  Harvest supernatants from wells.

  • Most ELISA kits use 50 µl supernatant per sample, freeze remainder as backup. If necessary, supernatants can be stored up to several months at −20° C for later use.
• 11Perform IFN-γ ELISA on supernatants according to instructions provided with the kit.

Analyze results

• 12
  Compare cytokine production by CTL cultures of interest when co-cultured with B16 to that of control tumors; also compare specific peptide to nonspecific peptide.

  • Values for nonspecific peptide should be similar to values for CTL in CM alone; if not, use a different control peptide, since cross-reactivity can occur reproducibly between non-sequence-related peptides. Also, ensure that nonspecific CTL lines are not stimulated by B16 to produce cytokines.
  • To establish CTL lines from any short-term cultures, purify cells by Ficoll gradient and restimulate CTL on day 7 to 10 after start of secondary culture, as described in Support Protocol 6.

Support Protocol 8

MAINTAINING B16-SPECIFIC CTL CULTURES

Growing CTL takes practice, and may be somewhat more difficult for “self” antigens like gp100 than for “non-self” antigens such as β-galactosidase or ovalbumin. The following protocol is one of many variants; each laboratory tends to use a different modified protocol. Experimenting is key, as is daily observation of cultures. Murine CTL are very unforgiving; neglect-- sometimes just for one day-- can result in rapid death or irreversible conversion from spindle-shaped, specific CTL into large, round, granular cells that grow faster but display high background reactivity and ultimately lose all specificity. Keeping cultures “clean,” i.e., free of too much cell debris, tends to suppress this phenomenon, as does maintaining the CTL in relatively low IL-2 concentrations (e.g., between 30 and 60 IU/ml rhIL-2). As an alternative strategy, some investigators prefer not to add IL-2 for the first 1 or 2 days after restimulation.

Despite the establishment of international units (IU) for biological response modifiers like IL-2, IU values differ among manufacturers. The guidelines mentioned here are for human recombinant IL-2 (Proleukin or Aldesleukin); some experimenting with concentrations may be required when using a different source. RBC lysis of feeder splenocytes is not required for restimulation but does result in less debris in CTL cultures.

Restimulate CTL lines every 7 to 14 days. Cultures will need the most attention during the first 5 days after restimulation; restimulating on Mondays may help accommodate this requirement. Observe cultures daily; initially (i.e., day 1 to 3 after restimulation) it may appear as if no CTL remain, however they will suddenly reemerge as feeder splenocytes disappear. At this point (i.e., day 3 to 7), CTL numbers can double every 12 to 24 hr, requiring close observation to prevent overcrowding of the wells. As soon as CTL begin to reach confluency, split 1:2 to 1:4 into new wells and fill wells to 2 ml with CM/IL-2. Regardless of growth, replace 1 ml of medium with CM/IL-2 every other day to ensure continuous presence of IL-2. Proliferation will typically slow down after day 5 to 10. CTL will then “calm down”; they appear less bloated, more spindle-shaped, and somewhat smaller. This is the best time for use in CTL recognition assays, i.e., between day 0 and 3 CTL tend to display high background reactivity. CTL can remain for up to 2 weeks at stable or slowly decreasing numbers in CM/IL-2 without restimulation as long as IL-2 is regularly provided. The cells remain highly specific throughout this time, making this a useful strategy to always have CTL available for CTL assays.

B16 itself can be used to restimulate B16-specific CTL cultures. It is important to heavily irradiate B16 since it is very radiation resistant and will overgrow CTL cultures if given less than 40, 000 rad. Even after this large dose, B16 can persist for weeks and continue to rapidly acidify culture medium (overnight) if not killed by CTL. It is therefore important not to exceed 1×10⁵ irradiated B16 cells/well (with 3×10⁶ cells/well unpulsed feeder splenocytes in 24-well plate), especially when restimulating poorly lytic CTL cultures. Peptide-pulsed, lightly irradiated splenocytes tend to give greater stimulation and expansion and disappear within days.

Materials

B16-specfic CTL (see Support Protocol 6)

CM/IL-2 (see recipe for CM)

6- to 12-week old female C57BL/6 mice

HBSS (Life Technologies)

CM (see recipe), ice cold

10 mg/ml peptide in DMSO

100 µm disposable sterile cell strainer (Falcon)

Sterile dissecting instrument

70% isopropyl alcohol

3 ml syringes

50 ml conical tubes

γ-irradiators for cells

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer (APPENDIX 3B) and CO2 euthanasia (UNIT 1.8)

Harvest CTL

• 1
  Suspend CTL from wells or flasks by vigorously pipetting medium up and down.

  • If cultures contain a large amount of debris, purify by Ficoll gradient. To do this, centrifuge cells for 5 minutes at 600 × g, room temperature. Count cells and resuspend to roughly 1×10⁷/ml in CM. It is important to keep the cells at room temperature. Carefully underlay 5 ml of Lympholyte-M (Cedarlane, room temperature) and centrifuge according to manufacturer’s recommendations.
• 2Resuspend CTL at 1×10⁶ cells/ml in CM/IL-2
• 3Plate 1 ml CTL per well in 24 well plate

Prepare stimulator cells

• 4Isolate splenocytes following steps 1–8 of Support Protocol 6. Adjust the cell concentration to 1×10⁷ cells/ml.
• 5
  Incubate splenoctyes with 1 to 10 µM peptide for 2 hours at 37°C.

  • For peptides with 9 amino acids, 1 µM is equivalent to 1 µg/ml.
• 6Irradiate splenocytes at 30 Gy.
• 7Wash the irradiated splenoctyes three times in 50 ml of CM by centrifugation for 5 minutes at 779 × g (1800 rpm Sorvall RC4) at 4°C.
• 8Decant supernatant and resuspend cell pellet in CM/IL-2 to a final concentration of 3×10⁶ cells/ml.

Add stimulators to CTL

• 9
  Add 1 ml peptide-pulsed irradiated stimulator splenoctyes to plated CTL (from step 3)

  • Alternatively, use 3×10⁶ unpulsed splenocytes and add 1×10⁵ B16 (400 Gy irradiated)
• 10Culture cells at 37°C, overnight.

Observe daily and split when necessary

• 11
  The following day, replace 1 ml of the medium with 1 ml of fresh CM/IL-2.

  • Observe daily under microscope; replace 1 ml medium every other day with CM/IL-2. When CTL become confluent, split 1:2 to 1:5.

Support Protocol 9

CULTURING PMEL-1 TRANSGENIC T CELLS

Pmel-1 transgenic T cells recognize mouse MDA gp100_25–33 epitope in the context of H-2K^b. Pmel-1 transgenic mice were developed in the authors’ laboratory more than a decade ago and have become useful tools to study the biology of adoptive transfer in tumor treatment model (Overwijk, 2003). Although naïve lymphocytes from Pmel-1 transgenic mice can be used in adoptive transfer, it is more common to use ex vivo expanded Pmel-1 cells. Between 20 and 30% of freshly isolated lymphocytes from Pmel-1 transgenic mice are CD8+ T cells, and more than 90% of those CD8+ T cells express TCR Vβ13. After 7 days of ex vivo culture with gp100_25–33 peptide and rhIL-2, more than 90% of cells in the culture are CD8⁺ Vβ13⁺ T cells. In general, a 100–500 fold increase in number of pmel-1 cells can be achieved using the culture method described in this unit. Although the most common source of lymphocytes is spleen, lymph nodes and peripheral blood can also be used to culture Pmel-1 T cells.

Materials

CM/IL-2 (see recipe)

gp100_25–33 peptide stock 10 mg/ml in DMSO

HBSS (Life Technologies)

ACK Lysing buffer (Life Technoligies)

6- to 8-week old Pmel-1 transgenic mice (Jackson Laboratory)

100 µm disposable sterile cell strainer (Falcon)

Sterile dissecting instrument

70% isopropyl alcohol

3 ml syringes

50 ml conical tubes

Refrigerated centrifuge (such as Sorvall RC4)

24 well plates

1200 µl Multi-channel pipette

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer (APPENDIX 3B)

Isolate splenocytes

• 1
  Isolate splenocytes following steps 1–8 of Support Protocol 6. Adjust the cell concentration to 1.5 to 2 × 10⁶ cells/ml in CM/IL-2

  • A normal size spleen usually generates 50 ml of cell suspension at the required concentration. Although freshly isolated splenocytes can be cyropreserved for future use, ex vivo expansion of Pmel-1 cells requires additional irradiated feeder cells if frozen splenocytes are used.

Culture Pmel-1 cells

• 2Add peptide stock to the cell suspension at the final concentration of 1 µg/ml. Mix well by inverting the tube repeatedly.
• 3
  Add 2 ml of the cell suspension into a well of 24 well plate and incubate for 2 days, 37°C, 5% CO2.

  • In general, these cells do not need to be split during the first 48 hours of peptide stimulation. Close contact of cells during this period facilitates cell proliferation. After 24 hours in culture, look for signs of activated T cells, i.e. cell colony formation and elongated or “tennis racket” shaped cells, especially around the edge of the well.
• 4
  Spit cells every day after 2 days of culture using a 1200 µl multi-channel pipette. Fresh CM/IL-2 media is added to the wells--no additional peptide is needed.

  • Cells need to be monitored daily. During rapid proliferation phase of Pmel-1 T cells, a high density of cells is detrimental to the growth. Maintain 50–80% confluence for optimal cell growth.
• 5
  On day 7, harvest Pmel-1 cells from 24 well plate using 1200 µl multi-channel pipette. Cells can be frozen or used immediately in adoptive transfer experiment as described in Basic Protocol 6.

  • A typical 7 day-culture of one Pmel-1 spleen can yield 16 to 32 24 well plates with 2–5 ×10⁷ cells/plate. Frozen Pmel-1 cells at day-7 of culture can be recovered in CM/IL-2 overnight at 37°C, 5% CO₂ and are ready to use for adoptive transfer. Some investigators use as early as day-4 culture for adoptive transfer.

Support Protocol 10

GENE MODIFICATION OF MOUSE T CELLS BY γ-RETROVIRAL TRANSDUCTION

In the past, mouse T cells were hard to transduce with retrovirus as compared to human T cells. With the improvement of viral constructs and optimization of transduction conditions, gene expression is greatly enhanced upon retroviral transduction. In many cases, the efficiency can reach as high as 90%. Therefore, it has become a very useful tool to modify T cells for adoptive transfer.

The viral construct is critical to the success of gene engineering in mouse T cells. In the authors’ laboratory, one of the optimized vectors is MSGV1 (MSCV-based splice-gag vector). MSGV1 is derived from murine stem cell virus (MSCV) long term repeat (LTR) and contains an extended gag region and env splice site (Hughes, 2005). When more than one gene product needs to be co-expressed in a same cell, such as α and β chain of T cell receptors, the two cDNA sequences are linked by either a sequence encoding the foot and mouth disease picornavirus 2A ribosomal skip peptide or an internal ribosomal entry site, IRES.

Freshly prepared ecotropic γ–retrovirus is a more efficient transducer of mouse T cells as compared to frozen viral supernatant. Making a γ-retroviral producing line for mouse T cell transduction can be time intensive. For most explorative experiments, it is not worth the effort. Therefore, many investigators use transiently produced retroviral supernatant for mouse experiments. However, to ensure reproducible results, it is very important to keep the reagents (such as plasmid DNA, Lipofectamine, and RetroNectin) and experimental procedures consistent.

Many investigators have found using RetroNectin during transduction an irreplaceable element, others have successfully used protamine sulfate, a cost-cutting and time-saving substitute. In this unit, both methods are described.

Materials

Platinum-E retroviral packaging cell line ecotropic, (Plat-E, Cell Biolabs Inc.) or other 293 based retroviral packaging cell line such as 293-GP

Lipofectamine 2000 (Life Technologies)

Retroviral vector

Envelope vector such as pCL-eco for ecotropic retroviral production

Opti-MEM media (Life Technologies)

DMEM medium, with and without antibiotics (see recipe)

CM/IL-2 (see recipe)

Concanavalin A (ConA, Sigma)

Recombinant murine IL-7

RetroNectin (Clontech), prepared as 1 mg/ml in sterile water following manufacturer’s instruction

Protamine sulfate (as an alternative)

Sterile PBS

2% Bovine serum albumin in PBS, sterile filtered

Polypropylene tubes

Pipettes and tips

100 mm poly-D-lysine coated tissue culture dish (BD-Biocoat)

24 well non-tissue culture plates

24 well tissue culture plates

0.45 µm filters and 20-ml syringes

Refrigerated centrifuge with biohazard protection covered rotor buckets adapted for tissue culture plates.

4°C refrigerator

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO₂ incubator.

Additional reagents and equipment for counting cells in a hemocytometer (APPENDIX 3B)

Transfect γ-retroviral packing cells

All cell culture procedures should be performed in a biological safety cabinet and follow proper sterile and Biosafety level 2/3 techniques.

• 1
  Day 0: plate Plat-E or 293 GP cells at 6.0×10⁶ in 10 ml of DMEM medium in 100 mm poly-lysine D coated dishes

  • Cell density should reach around 80% confluence on the day of transfection.
• 2
  Day 2: change media with 10 ml of DMEM without antibiotics. Place the cells back in the incubator and proceed to preparation of transfection reagents.

  • Transfection is usually done in the morning because the medium need to be changed in 6–8 hours.
• 3In a sterile 3 ml polypropylene tube, label “A”. Add 1.5 ml of Opti-MEM, 9.0 µg of retroviral vector and 6 µg of Envelope vector, mix well by pipetting up and down. In another sterile 3 ml polypropylene tube, label “B”. Add 1.5 ml of Opti-MEM and 60 µl of Lipofectamine 2000 and gently mix well.
• 4Using a pipette, gently mix solution from tube B into tube A. Do not vortex. Incubate the DNA/lipid complex mixture at room temperature for 20 minutes.
• 5Add 3 ml DNA/lipid complex mix drop-wise to the packing cells in 100 mm dish (total 13 ml media). Incubate the cells for 6–8 hours at 37°C.
• 6Replace the media with 10 ml DMEM with antibiotics and incubator at 37°C for 36 to 48 hours.

Activate T cells

• 7Day 2: harvest splenocytes from mice and prepare single cell suspension following steps 1–8 of Support Protocol 4. Adjust cell concentration to 2×10⁶ cells/ml in CM/IL-2.
• 8Add 2.5 µg/ml ConA and 1 ng/ml IL7 into the cell suspension and mix well by pipetting up and down.
• 9Add 2 ml of cell suspension per well of a 24-well plate. Incubate at 37°C for 48 hours.

Coat plates with RetroNectin (Skip if use protamine sulfate)

• 10Day 3: prepare 50 µg/ml RetroNectin in sterile PBS and add 0.5 ml per well of 24 well non-tissue culture plates. Incubate the coated plates overnight at 4°C.
• 11Day 4: wash the coated plates with 2 ml of sterile PBS twice and block the plates with 1 ml/well of sterile PBS with 2% BSA at room temperature for 30 minutes followed by washing twice with sterile PBS. Place the plates in the biosafety hood and proceed to the next step.

Harvest retroviral supernatant

• 12
  Day 4: collect supernatant from transfected Plat-E cells using 20 ml syringe and push through a 0.45 µM filter attached to syringe into sterile 15 ml tube.

  • There is about 13 ml of supernatant from each 100 mm dish, which is enough for one 24 well plate.

Transduce activated T cells

The following steps are to be performed on day 4.

• 13
  Dilute retroviral supernatant with equal volume of CM and add 1 ml /well to RetroNectin coated plates (at room temperature). Place the plate in a covered plate rotor and centrifuge for 2 hours at 2000 × g, room temperature.

  • If biohazard covered rotor is not available, the plates can be wrapped with parafilm and place in a plastic bag during the centrifugation to prevent contamination. This step is not necessary if using protamine sulfate.
• 14
  During centrifugation, harvest activated T cells and re-suspend T cells at 1×10⁶ cells/ml in CM/IL-2.

  • If use RetroNectin, go to Step 16.
• 15
  Add 1.5 µg/ml of protamine sulfate to activated T cells and plate 1 ml/well (1 × 10⁶ cells/well) of cell suspension into a 24 well tissue culture plate. To each well add 0.5 ml of retroviral supernatant and centrifuge the plate in biohazard covered rotor for 1.5 hours at 1000 × g, room temperature, followed by incubation at 37°C, 5% CO₂.

  • Go to step 18.
• 16
  After centrifugation of retroviral supernatant onto the RetroNectin coated plates, remove the supernatant. Do not discard the supernatant. Add 1 ml/well (1 × 10⁶ cells/well) of activated T cell suspension into each well and centrifuge the plate in a covered plate rotor for 10 minutes at 1000× g at room temperate. Incubate the plates at 37°C, 5%CO₂.

  • Transduction efficiency can be enhanced by second round of transduction on the following day. After being removed from the RetroNectin coated plates, the retroviral supernatant can be added to a new RetroNectin coated plate and repeat the centrifugation in step 13. The plate can then be stored in 4°C and used the next day, following step 16.
• 17If using RetroNectin, 24 hours after the last transduction, transfer T cells into 24 well tissue culture plate and continue incubation at 37°C.
• 18
  Split cells in CM/IL-2 daily 48 hours after transduction. Gene expression can be assessed 72 hours after last transduction. T cells can be used for adoptive cell transfer 5–7 days post transduction.

  • Cell viability is generally 80–90% within 7 days after transduction and is reduced after 7 days. In some cases, when the transduction efficiency is very high (>90%), the cell viability can decline within 7 days after transduction. Washing the cells with CM/IL-2 during the split may help the cell viability.

REAGENTS AND SOLUTIONS

Use deionized, distilled water in all recipes and protocol steps, see APPENDIX 2A; for suppliers, see APPENDIX 5.

Complete medium (CM)

10% (v/v) fetal bovine serum (FBS; APPENDIX 2A)

1 mM sodium pyruvate

2 mM L-glutamine or glutamax

100 µM nonessential amino acids

100 U/ml penicillin

100 ug/ml streptomycin

50 ug/ml gentamicin

0.05 mM 2-mercaptoethanol

Bring up to 500 ml with RPMI 1640 (Life Technologies)

For CM/IL-2: add 30 to 60 IU/m recombinant human IL-2, store up to 2 weeks in the dark at 4°C.

Il-2 is quite stable in CM (weeks).

DMEM medium

10% (v/v) fetal bovine serum (FBS; APPENDIX 2A)

1 mM sodium pyruvate

2 mM L-glutamine or glutamax

100 µM nonessential amino acids

100 U/ml penicillin

100 µg/ml streptomycin

50 µg/ml gentamicin

Bring up to 500 ml with DMEM (Life Technologies)

For DMEM without antibiotics:

10% (v/v) fetal bovine serum (FBS; APPENDIX 2A)

1 mM sodium pyruvate

2 mM L-glutamine or glutamax

100 µM nonessential amino acids

Bring up to 500 ml with DMEM (Life Technologies)

FACS buffer

2.5 g bovine serum albumin (BSA)

0.02 g sodium azide

Dissolved in 500 ml of PBS

Fekete’s solution

For 1 liter:

580 ml 95% ethanol

200 ml H₂O

80 ml 37% formaldehyde solution

40 ml glacial acetic acid

Stable at room temperature indefinitely

CAUTION: Potential irritant.

COMMENTARY

Background Information

B16 melanoma, a spontaneous melanoma derived from a C57BL/6 mouse, has been used in many pre-clinical studies to model human cancer immunotherapy, including the authors’ own research. There are many characteristics of this tumor line that have made it an attractive model.

As a model for human tumors, it is important to note similarities and differences between B16 and human melanomas (see Table 20.1.3). Several variants were isolated by Dr. Isaiah J. Fidler in the mid-1970s, the main differences between sub- lines being their metastatic potential and susceptibility to immune destruction (Fidler, 1976; Fidler, 1977). The most commonly used variant is B16.F10, which is highly aggressive and will metastasize from a primary subcutaneous site to the lungs, as well as colonize lungs upon intravenous (i.v.) injection. The parental line is named B16.F1; other variants are B16.F0, a poorly metastatic variant, and B16.BL6, which has a high degree of metastasis and intermediate colonization of lungs (Hart, 1979). Most laboratories use B16.F10 for in vivo experiments.

Table 20.1.3.

B16 as a Model for Human Melanoma: Similarities and Differences

Similarities	Differences
Human melanomas express at least 5 different MDA: gp100/pmel 17, MART-1/Melan-A, tyrosinase, TRP-1/gp75, and TRP-2. All of these can be recognized by CTL from human melanoma patients: the mouse homologs of these genes are all expressed in B16 melanoma.	Human melanomas express variable levels of MHC class I; B16 murine melanoma normally expresses low levels of MHC Class I.
MDA, mgp100, mTyr, mTRP-1, and mTRP-2 have been reported to be recognized by mouse CTL (Bloom, 1997; Dyall, 1998; Overwijk, 1998; Colella, 2000)	Growing human melanoma biopsies fragment in IL-2 will yield melanoma-specific CTL in ~50% of cases; B16 biopsies fragment grown in IL-2 rarely yield B16-specific CTL.
Adoptive transfer of MDA-specific CTL can cause autoimmunity both in mice and human (Overwijk, 2003; Johnson, 2009)	Human melanomas have express ongogene mutations such as BRAF V600E which can be targeted by inhibitors. B16 tumor lacks many of the mutations found in human melanomas.
Both human melanomas and B16 can often be induced to express MHC Class II by IFN-γ treatment. (Bohm, 1998; Surman, 2000)	Humans can survive for months or years despite melanoma growth; a minimal tumorigenic dose of B16 melanoma (intravenous or subcutaneous) will kill an untreated mouse within weeks.

B16 melanoma is one of the very few pigmented melanoma lines available for use in mice, although recently transgenic models have been developed in which the reliable incidence of melanoma allows the establishment of new lines (Chin, 1997; Otsuka, 1998; Zhu, 1998). In addition, a recent report described a retrovirus derived from B16 itself that can transform normal, cultured mouse melanocytes to establish melanoma tumor lines that grow in normal, immunocompetent mice (Li, 1998). Interestingly, these tumor cell lines, like B16, express low levels of MHC Class I compared to other C57BL/6 derived tumors such as the methylcholanthrene-induced sarcomas (MCA series) and other commonly used cells such as EL-4 thymoma or normal splenocytes. This low expression of MHC Class I appears to be a feature of normal C57BL/6 mouse melanocytes that is retained after transformation to melanoma (Li, 1998; Xu, 1998).

B16 melanoma has classically been described as a non- or low-immunogenic tumor. One reason for this designation is the difficulty in inducing protection against B16 challenge by injection of irradiated B16, regardless of the addition of Bacillus Calmette Guérin (BCG) or Corynebacterium parvum (C. parvum), a strategy that can induce reliable protection in many other tumor models. B16 is also relatively resistant to treatment with high-dose Il-2, a therapy that can essentially cure mice bearing MCA sarcomas, Renca, and other more immunogenic tumors. In addition, strategies that can render “non-immunogenic” mouse tumors more susceptible to immune destruction, such as transfection with the costimulatory molecule B7-1, tend to work much less well, if at all, in B16 (Chen, 1994; Wu, 1995). The reason for this low immunogenicity is still unknown, although the low expression of MHC Class I is one obvious candidate. Although it is possible to induce therapeutic immune responses to B16, it is useful to keep in mind that a strategy that is effective in another tumor model may not necessarily work for B16 melanoma. It tends to be one of the tougher tests for any form of immunotherapy.

How to induce immune response: Effective vaccinations

There are several incidental reports in the literature of regimens that can prevent growth of melanoma in normal C57BL/6 mice; however in the authors’ experiences many of these are poorly reproducible. For example, vaccination using irradiated B16, with or without admixture of BCG or C. parvum, typically does not confer protection to subsequent challenge with even a minimum tumorigenic dose (i.e., 1×10⁵ cells) of B16. The transfected line, B16.B7-1, expressing the costimulatory molecule B7-1, tends to display reduced tumorigenicity but still fails to immunize to wild- type B16, probably since most of the killing of B16.B7-1 seems to be mediated through direct recognition by NK cells (Chen, 1994; Wu, 1995). However some recent approaches based on the specific targeting of the MDA, TRP-1, appear to give consistent protection and/or treatment of B16, i.e., repeated injections of monoclonal antibodies against TRP-1 (Hara, 1995), vaccination with baculovirus encoding mTRP-1 (Naftzger, 1996), or plasmid DNA encoding human TRP-1 (Weber, 1998), or a modified TRP-1 peptide in adjuvant (Dyall, 1998).

In the authors’ laboratory, the following three treatment protocols reliably and reproducibly impact significantly on B16 growth.

1. Treatment of established pulmonary metastases by adoptive transfer of CTL specific for the MDA gp100 or TRP-2, or the retroviral antigen p15E (Bloom, 1997; Overwijk, 1998; Zeh, III, 1999).

2. Protection against subcutaneous B16 challenge of mice with autoimmune depigmentation (i.e., vitiligo) after two vaccinations with recombinant vaccinia virus (rVV) encoding mouse TRP-1 (rVVmTRP-1; (Overwijk, 1999a)).

3. Protection against and partial treatment of subcutaneous B16 in mice vaccinated with irradiated B16 expressing GM-CSF (B16.GM- CSF), particularly when administered together with anti-CTLA-4 antibody (Hung, 1998; van Elsas, 1999a).

How to define the type of response induced

There are several approaches to identify the immune compartments responsible for an immune response to B16. First, purified freshly isolated or cultured lymphocyte subsets can be adoptively transferred into naive or tumor-bearing animals; examples are the transfer of purified CD4⁺ or CD8⁺ fresh splenocytes, or the adoptive transfer of cultured, B16-specific CTL. Second, lymphocyte subpopulations can be isolated and studied for specificity towards target antigens, for example, by culturing CD4⁺ and CD8⁺ T lymphocytes with specific antigen and subsequent testing for antigen recognition (see Support Protocols 3 and 4). Likewise, serum from treated mice can be tested for the presence of antigen-specific antibodies (see Support Protocol 10). Third, mice can be depleted from T cell subsets using in vivo administration of antibodies specific for CD4⁺ or CD8⁺. Fourth, mice can be used that are deficient in certain lymphocyte subsets or immune-modulating molecules due to genetic mutations, either spontaneous, such as nude (T cells) or beige (NK cells) mice, or induced through knockout technology (such as CD4, MHC Class II, β₂m, TAP-1, RAG-1, or IgM KO mice) available from commercial sources or research laboratories. Fifth, using gene engineering to over-express or delete genes of interest in T cells is a quick and feasible way to access their functions both in vitro and in vivo (see Basic Protocol 6 and Support Protocol 8).

Critical Parameters

One of the most important aspects of in vivo mouse experiments is ensuring that tumor take among mice is highly consistent. Inconsistent injection techniques make it very difficult to distinguish therapeutic effects over random fluctuations in tumor take. Practicing in the injection of tumor, virus, and CTL is critical, not only to ensure reproducible inoculations but also to allow quick completion of the injection procedure, thus reducing the time reagents remain on ice. Presence of mycoplasma in B16 cultures can also result in inconsistent tumor take. B16 is known as a relatively “unstable” tumor. B16 cultures from different laboratories can differ significantly in minimal tumorigenic dose, degree of pigmentation, expression of antigens, and growth rate in mice. Some optimization may be required; the numbers in this unit are merely guidelines. B16 is also known as a difficult tumor to treat; therefore failure of an immunotherapeutic regimen to impact on B16 growth does not necessarily imply it is immunologically ineffective. In vivo experiments should always be accompanied by some in vitro assays to evaluate the immunological effects of the experimental strategy. Further optimization may then result in therapeutic efficacy.

The counting of lung metastases, measurement of subcutaneous tumors, and scoring of vitiligo are all highly susceptible to observer bias and must be performed in a blinded fashion.

Troubleshooting

For detailed instruction on how to troubleshoot, please look to Table 20.1.4 for guidelines.

Table 20.1.4.

Troubleshooting Guide for Use of Mouse Model for Human Melanoma

Problem	Possible cause	Solution
Poor tumor take	Mycoplasma infection of tumor cultures	Eliminate mycoplasma with ciprofloxacin or thaw vial with fresh tumor sample
	Over-trypsinization of tumor cells	Dilute out trypsin with large volume of HBSS as soon as tumor cells dislodge; pellet and discard supernatant
	Tumor cells not kept on ice or on ice for a long time	Keep tumor on ice at all time and plan the experiment to minimize cell standing-by time
	Injected too few tumor cells	Increase inoculums of tumor cells
Poor treatment up adoptive transfer of CTL	Low potency or specificity of CTL	Test CTL in vitro directly prior to transfer to ensure specificity
	Low viability or too few CTL transferred	Transfer more CTL, Ficoll enrich live cells, minimize cell standing-by time
Poor CTL growth	Missing, incorrect does or poor quality components in CM. For examples: 2-Mercaptoethanol, IL-2 and FBS	Make fresh CM/IL-2; choose a FBS lot with optimal for growing mouse T cells
	Poor quality of peptide stock	Make fresh peptide in DMSO
	Over- or understimulation	Restimulate every 7–10 days
	Overcrowding of culture wells	Split once T cells exceed 50% confluency
Poor CTL specificity/high background (often irreversible)	Too much IL-2 in cultures “dirty culture”	Keep IL-2 concentration between 30–60 IU/ml Ficoll to eliminate debris
	Progressive deterioration of specificity, large, granular, fast-growing cells	Discard culture and thaw new vial or establish new culture from immunized mice Retiter viral stock
No induction of vitiligo and/or antibodies upon two immunizations with rVVmTRP-1	Poor viral titer Mixup of rVV stocks	Check expression by immunostaining of infected cells.
Large variables in tumor treatment within a group	Variable tumor size prior to treatment	Inject extra mice and select mice with similar size of tumor for the experiment
	Poorly mixed cells	Make sure the cells are mixed well before injection and do not leave cells in the syringe for a long time.
Difficult to clone full length TCR α and β chain	PCR conditions hard to optimize	Synthesize full length cDNA using V region and constant region (one α, two βs)
Low transduction efficiency	Sub-optimized retroviral vector construct	Codon optimization of cDNAs, switch α and β chain positions.
	Poorly activated T cells	Check culture conditions and media
	Low viral titers	Perform second transduction 24 hours after the 1st one.
Poor T cell viability after retroviral transduction	High viral titers	Wash T cells with CM and split cells

Time Considerations

In vivo experiments require careful planning since they may take several hours of uninterrupted work in order to minimize the time tumor cells or CTL remain on ice. A typical tumor treatment experiment lasts a couple of weeks from the day of tumor inoculation. Sufficient amount of tumor cells and CTL should be ready for use on the appropriate days, especially when using cultured T cells or retroviral transduced T cells. Many mice with complete tumor regression can be tumor-free for more than a year and have normal lifespan. However, some tumor can grow back from the original site after temporal regression. Effective treatments usually lasts a couple of months to a year. To induce vitiligo, two injections of rVVmTRP-1 are spaced at least 2 weeks apart, upon which it takes another 2 to 3 weeks until mice develop detectable vitiligo and are protected from B16 tumor take. Waiting longer after onset of vitiligo before challenging causes the immune response to wane, and protection against B16 growth will be less complete.