Skip to main content
PLOS One logoLink to PLOS One
. 2015 Jun 1;10(6):e0128250. doi: 10.1371/journal.pone.0128250

Epigenetic Regulation of Bovine Spermatogenic Cell-Specific Gene Boule

Wang Yao 1,#, Yinxia Li 2,#, Bojiang Li 1,#, Hua Luo 1, Hongtao Xu 1, Zengxiang Pan 1, Zhuang Xie 1, Qifa Li 1,*
Editor: Stefan Schlatt3
PMCID: PMC4451259  PMID: 26030766

Abstract

Non-primate mammals have two deleted azoospermia (DAZ) family genes, DAZL and Boule; genes in this family encode RNA-binding proteins essential for male fertility in diverse animals. Testicular DAZL transcription is regulated by epigenetic factors such as DNA methylation. However, nothing is known about the epigenetic regulation of Boule. Here, we explored the role of DNA methylation in the regulation of the bovine Boule (bBoule) gene. We found that a long CpG island (CGI) in the bBoule promoter was hypermethylated in the testes of cattle-yak hybrids with low bBoule expression, whereas cattle had relatively low methylation levels (P < 0.01), and there was no difference in the methylation level in the short CGI of the gene body between cattle and cattle-yak hybrids (P > 0.05). We identified a 107 bp proximal core promoter region of bBoule. Intriguingly, the differences in the methylation level between cattle and cattle-yak hybrids were larger in the core promoter than outside the core promoter. An in vitro methylation assay showed that the core promoter activity of bBoule decreased significantly after M.SssI methylase treatment (P < 0.01). We also observed dramatically increased bBoule transcription in bovine mammary epithelial cells (BMECs) after treatment with the methyltransferase inhibitor 5-Aza-dC. Taken together, our results establish that methylation status of the core promoter might be involved in testicular bBoule transcription, and may provide new insight into the epigenetic regulation of DAZ family genes and clinical insights regarding male infertility.

Introduction

Spermatogenesis is an extremely complex process of cell differentiation, and includes three specific functional phases: spermatogonia proliferation, spermatocyte meiosis, and spermatid differentiation. Spermatocyte meiosis is a key step in spermatogenesis, and defects in genes controlling spermatocyte meiosis, such as microdeletions, mutations, and decreased expression, lead to meiotic arrest, impaired spermatogenesis, and male infertility [1–4]. The deleted in azoospermia (DAZ) gene family is distinctly involved in meiosis during spermatogenesis, and consists of three members, DAZ, DAZL (DAZ-Like), and Boule [5–7]. Boule is the recently identified ancestral “grandfather” gene in the DAZ family; it is expressed in prophase and metaphase spermatocyte meiosis in the testis, and highly expressed in meiotic pachytene spermatocytes [5]. Boule is found in vertebrates and invertebrates [5, 8–10]. DAZL is regarded as the “father” gene in the DAZ family and evolved from ancestral Boule [5]. It is expressed in spermatogonia and spermatocytes of the testis and ovary [11]. DAZL is only detected in vertebrates [7, 10–12]. DAZ maps to the Y chromosome, is obtained by gene transposition, duplication, and exon splicing from autosomal DAZL, and is highly expressed in meiotic prophase germ cells in the testis. DAZ is only found in Old World monkeys and humans [13–15]. The proteins encoded by DAZ family genes are all RNA-binding proteins with typical RNA-recognition motifs (RRM) and DAZ repeats; they play an important role in spermatocyte meiosis and are associated with male infertility [5–8, 16–17].

Boule, a recently identified member of the DAZ family, was first detected in Drosophila and human testes [5, 18]. In Drosophila, the testes of boule mutants produce no sperm and have germ cells that are arrested before meiosis, resulting in azoospermia and male infertility [19]. A fly boule transgene or a human BOULE transgene can rescue the reproductive defects of boule mutant flies [18, 19]. Testicular BOULE expression is decreased in some patients with abnormal spermatogenesis, and spermatogenesis is arrested before the primary spermatocyte stage; no BOULE expression is detected in testes of patients with complete meiotic arrest [20]. Lin et al. [21] also found that BOULE mRNA levels are significantly decreased in azoospermic male testes, and are progressively decreased with increasing severity of testicular failure; patients with successful sperm retrieval have significantly higher BOULE levels than patients with failed sperm retrieval. Boule −/− mice are male sterile and azoospermic [22], similar to boule mutant flies and some men with DAZ deletions [13, 18]. Li et al. [23] demonstrated that over-expression of Boule promotes the expression of meiosis-related genes such as Stra8 in goat male germline stem cells. Thus, these results suggest that the expression of Boule is associated with mammalian spermatocyte meiosis and male infertility, and that it may be the key regulatory factor of spermatocyte meiosis.

The transcriptional regulation of DAZ family genes has been extensively studied [24–31]. However, little is known about the regulation of Boule [3, 23, 32], and particularly its epigenetic regulation. Our previous study suggested that bovine Boule (bBoule) may function in bovine spermatogenesis, and that low bBoule expression might lead to male sterility in cattle-yak hybrids [8, 33]. In the present study, we examined the epigenetic mechanisms of low bBoule expression in testes of cattle-yak hybrids.

Materials and Methods

Bioinformatic analysis

The genomic DNA sequence of the bBoule gene was obtained by a BLAST search of the genome database of cattle (Bos taurus) (http://www.ncbi.nlm.nih.gov/genome/82) based on the cDNA sequence of bBoule (GenBank ID: EU050657) that was previously cloned by our group [8]. The putative promoter region of bBoule was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/proscan/). CpG islands (CGI) were searched by the online CpG Island Searcher program (http://ccnt.hsc.usc.edu/cpgislands2/cpg.aspx). We searched the transcription factor binding sites (TFBS) of the bBoule core promoter using the web tool TFSEARCH v1.3 (http://www.cbrc.jp/research/db/TFSEARCH.html) using a threshold score of 85.0.

PCR and sequencing

Genomic DNA was isolated from testes using the phenol-chloroform method. Three primers for the amplification of the bBoule promoter region were designed by Primer Premier 5.0 software based on the genomic DNA sequence of bBoule (Table 1). The reaction mixture and PCR program were described in Luo et al. [34]. PCR products were separated using 1.2% agarose gel electrophoresis, purified using a DNA Purification Kit (Axygen, Union City, CA, USA), and sequenced by Invitrogen (Shanghai, China).

Table 1. The primers used in this study.

Gene GenBank ID Primer sequence (5'-3') Size/bp Tm/°C Usage
P1 bBoule NW_001494657 F: TTTAGATCTCTCGATCCGCTCACCTCA R: GGGAATCTTCACCCAGGAAGCAACACC 297 60.5 vector construction
P2 bBoule NW_001494657 F: TTTAGATCTACGGGCCACGACCGAAACCT R: GGGAATCTTCACCCAGGAAGCAACACC 224 59.8 vector construction
P3 bBoule NW_001494657 F: TTTAGATCTAGGTTCAGGCCCTGGGTT R: GGGAATCTTCACCCAGGAAGCAACACC 107 56.7 vector construction
P4 bBoule NW_001494657 F: GAGAGTGGTTTGAGAATAGAGTATT R: TTCACACCCAAAAAACAACA 324 50.6 BSP for long CGI
P5 bBoule NW_001494657 F: GAGGGAGGGATGTTGTAAATAA R: TAATTTTAAAAAAATATTATTT 444 56.0 BSP for short CGI
P6 bBoule NM_001102115 F:CAAGTGCCATTGCTATGCCTGC R: GGTTCATTGAAGCTGGATCTCGG 157 60.0 qRT-PCR
P7 β-actin NM_173979 F:TCCAGCCTTCCTTCCTGGGCAT R: GGACAGCACCGTGTTGGCGTAGA 116 56.0 qRT-PCR

BSP, bisulfite sequencing PCR. CGI, CpG island.

BSP methylation analysis

The testes were collected from healthy adult cattle (male, n = 8) and cattle-yak hybrids (male, n = 8) provided by the Songpan Bovine Breeding Farm (Sichuan, China), and frozen in liquid nitrogen immediately. All animal work was approved by the Animal Ethics Committee at Nanjing Agricultural University. Extraction and bisulfite conversion of genomic DNA and bisulfite sequencing PCR (BSP) were performed according to the methods described by Luo et al. [34]. Primers for BSP were designed by Methyl Primer Express v1.0 software, and are shown in Table 1.

Deletion construction

To create the deletion constructs, we designed three pairs of primers (P1–P3, Table 1) for the amplification of three successively shorter PCR products, which were 107 bp (-172/-66), 224 bp (-289/-66), and 297 bp (-362/-66) in length. All primers used had the HindIII endonuclease site incorporated at the 5′ end and the BglII site at the 3′ end, and the downstream primers were all the same. PCR products were subcloned into the pGL3 luciferase reporter vector (Promega, Madison, WI, USA) with HindIII/BglII sites, and transformed into Escherichia coli to generate the luciferase reporter plasmid. Recombinant plasmids were verified by sequencing and named pbBoule-107, pbBoule-224, and pbBoule-297.

Cell lines and cell culture

Mouse spermatogonia cell line GC-1 (ATCC CRL-2053) and African Green Monkey SV40-transformed kidney fibroblast cell line COS-7 (ATCC CRL-1651) were cultured in Dulbecco's modified Eagle's medium (DMEM) with high glucose, supplemented with 10% (v/v) fetal bovine serum (FBS), 100 U/mL penicillin G, and 100 μg/mL of streptomycin sulfate in a 5% CO2 incubator at 37°C.

Transfection and luciferase assay

The cells were seeded in 48-well culture plates, and transfected with 1 μg/well of promoter-reporter plasmids or empty vector along with 10 ng/well of Renilla luciferase expression vector pRT-TK as an internal control using Lipofectamine 2000 reagent (Invitrogen). After 24 h, luciferase activity was measured using the Dual-Luciferase Reporter Assay Kit (Promega) with a Modulus Single Tube Multimode Reader (Turner Biosystems, Sunnyvale, CA, USA) according to the manufacturer's protocol. Results are expressed as Renilla/firefly luciferase activities.

M.SssI treatments

The core promoter fragment of bBoule was methylated with 2 μL of M.SssI methylase (NEB, Ipswich, MA, USA) at 37°C for 16 h. The completion of the methylation reaction was confirmed by digestion of the fragment with methylation-sensitive HpaII restriction endonucleases (NEB), which cannot cleave DNA if their cognate restriction sites are methylated. The methylated core promoter fragment was then ligated to the same sites of the pGL3 vector (Promega), and transfected into GC-1 and COS-7 cells. Luciferase assays were performed 36 h after transfection.

5-Aza-dC treatments

Bovine mammary epithelial cells (BMECs) that do not express bBoule were isolated from the mammary tissues of Holstein cows collected during lactation. Cells were seeded in 96-well plates and grown to 80% confluence, then treated with various concentrations (0, 0.05, and 0.5 μmol/L) of fresh 5-aza-2′-deoxycytidine (5-Aza-dC) (Sigma, St. Louis, MO, USA) for 48 h. After 48 h with or without 5-Aza-dC, cells were washed twice with phosphate-buffered saline and harvested. Total RNA was isolated, and the mRNA levels of bBoule were measured by qRT-PCR with P6 primers (Table 1) according to the ΔΔCT method; β-actin was used as the internal control for normalization.

Statistical analysis

All data are expressed as means ± SEM. The statistical analysis was performed using SPSS v11.0 software (SPSS Inc., Chicago, IL, USA). A two-tailed Student’s t-test and ANOVA were used to evaluate the statistical significance of the differences in our experiment data, and Duncan's multiple comparisons test was used for ANOVA. A value of P < 0.05 was considered statistically significant.

Results

Differential methylation of testicular bBoule promoter CGI between cattle and cattle-yak

We detected two CGIs within the 70 kb genome sequence of bBoule consists of a 3 kb of the 5' proximal flanking region and a 2 kb of the 3' proximal flanking region. The long CGI was located between nt -2,074 and nt +225 (2229 bp), and included the 5' proximal flanking region, exon 1, and intron 1, with an observed/expected ratio of 0.807 and C+G content of 60.6%. The short CGI was located from nt +20,565 to nt +21,348 (784 bp) in intron 5, with an observed/expected ratio of 0.719 and C+G content of 60.2%.

At present, studies of the regulation of gene expression by methylation mainly focus on promoter CGI regions [34–36]. Our previous study demonstrated that bBoule is expressed at low levels in testes of cattle-yak hybrids with male sterility [8]. To examine whether low bBoule expression was associated with methylation in promoter CGIs, we first determined the methylation status of the promoter CGIs (Fig 1A and 1B) by BSP using genomic DNA isolated from cattle-yak testes (the males have meiotic arrest and are sterile) and their male parent cattle (with normal meiosis and spermatogenesis). An analysis of the long CGI within the promoter region revealed differences in the methylation profile of the CpG sites between testicular tissue samples of the two bovine populations (Fig 1C). The methylation level of the long CGI in cattle-yak testes with male sterility (17.78%, 64/360) was significantly higher than in cattle (6.94%, 25/360) (P < 0.01). These data indicate that hypomethylation of promoter CGIs may be associated with low bBoule expression in cattle-yak testes.

Fig 1. The methylation profile of the long CpG island in the bBoule 5' flanking region.

Fig 1

(A) Schematic diagram of the long CGI within the bBoule promoter. (B) Schematic depiction of the CpG sites for methylation analysis. Nucleotide numbering is relative to +1 at the initiating ATG codon. The short vertical bars represent the CpG dinucleotides. (C) Methylation status of the bBoule promoter in the testes of cattle and cattle-yak hybrids. Each line represents an individual bacterial clone that was sequenced. Open circles indicate unmethylated CpG sites. Black circles indicate methylated CpG sites.

Similar methylation profiles for cattle and cattle-yak testicular bBoule intragenic CGIs

Recent studies demonstrated that intragenic CGIs play an important role in regulating gene expression [37–39]. To assess the methylation status of short intragenic CGIs in cattle and cattle-yak testes, a 444 bp DNA fragment was amplified from the +20580/+21023 region of bBoule intron 5 with the P5 primers (Fig 2A). The amplified fragment contained 25 CpG sites (Fig 2B). Unlike the methylation of promoter CGIs, the bBoule short intragenic CGI methylation pattern was similar in cattle and cattle-yak testes (Fig 2C), and the difference between the methylation level of short intragenic CGI in cattle (52.0%, 130/250) and cattle-yak (51.6%, 129/250) was not significant (P > 0.05). These data indicate that methylation of short intragenic CGI is likely not associated with low bBoule expression in cattle-yak testes.

Fig 2. The methylation profile of the short CpG island in the bBoule gene body.

Fig 2

(A) Schematic diagram of the short CGI within the bBoule gene body. (B) Schematic depiction of the CpG sites for methylation analysis. Nucleotide numbering is relative to +1 at the initiating ATG codon. The short vertical bars represent the CpG dinucleotides. (C) Methylation statuses of bBoule in testes of cattle and cattle-yak hybrids. Each line represents an individual bacterial clone that was sequenced. Open circles indicate unmethylated CpG sites. Black circles indicate methylated CpG sites.

Core promoter methylation level differed more in cattle and cattle-yak testes

To explore whether DNA methylation of the long CGI within the 5' flanking region contributes to the regulation of bBoule, we identified the core promoter region of bBoule by dual-luciferase reporter experiments. First, we predicted the 5' proximal flanking sequence from nt -408 to nt -158 as a potential core promoter region of bBoule. A series of deletion constructs (pbBoule-107, pbBoule-224, and pbBoule-297) were generated in the predicted promoter region (Fig 3), and GC-1 and COS-7 cells were transiently transfected. A luciferase activity analysis revealed that the pbBoule-107 construct is important for bBoule transcriptional activity, indicating that the basal promoter was located in the region from nt -172 to nt -66 (Fig 3). Further analysis showed that the core promoter of bBoule was located in the long CGI, and overlapped with the region examined in our methylation analysis. The core promoter included nine CpG sites, and the methylation level (45.56%, 41/90) of the core promoter region in the testes of cattle-yak was significantly higher than that of cattle (16.67%, 15/90) (P < 0.00001). However, among the 27 CpG sites outside the core promoter, the difference in methylation level between the testes of cattle-yak (8.52%, 23/270) and cattle (3.70%, 10/270) was small (P < 0.05). These data indicated that there was a greater difference in the methylation level between cattle and cattle-yak for the core promoter CGI than for the CGI outside the core promoter, and hypomethylation of core promoter CGI may be involved in low bBoule expression in cattle-yak testes.

Fig 3. Identification of the core promoter in the bBoule gene.

Fig 3

Left panel, functional deletion constructs of the bBoule 5' flanking region. Right panel, the luciferase activity of each deletion construct of the bBoule 5' flanking region. The deletion constructs were transiently transfected into GC-1 and COS-7 cell lines. Normalized luciferase activities are expressed as mean ± SEM of duplicates for a minimum of three experiments. All data were compared with the control group (pGL3-basic). ** indicates a significant difference (P < 0.01).

In vitro methylation represses bBoule promoter activity

To further determine where bBoule promoter activity was regulated by methylation of the core promoter, we performed an in vitro DNA methylation assay using the DNA methylase M.SssI. The core promoter pbBoule-107 construct was treated with M.SssI methylase, then the methylated (mpbBoule-107) or unmethylated plasmids (pbBoule-107) were transfected into GC-1 and COS-7 cell lines. Luciferase assays showed that the activity of the bBoule core promoter in both GC-1 and COS-7 cells decreased significantly after DNA methylase M.SssI treatment (all P < 0.01) (Fig 4), suggesting that promoter methylation is important in repressing bBoule transcriptional activity.

Fig 4. In vitro methylation assay of the bBoule promoter.

Fig 4

The bBoule core promoter construct pbBoule-107 was treated with M.SssI methylase, and then methylated (mpbBoule-107) or unmethylated (pbBoule-107) plasmids were transiently transfected into GC-1 and COS-7 cell lines. Normalized luciferase activities are expressed as mean ± SEM of at least three independent experiments. The bar above the histogram indicates the SEM. ** indicate a significant difference (P < 0.01).

Demethylation increases bBoule expression

To verify the association between promoter methylation and bBoule transcriptional activity, we treated BMECs that do not express bBoule with 5-Aza-dC, an inhibitor of DNA methyltransferase. bBoule mRNA expression was significantly higher in the 5-Aza-dC-treated group than the control group (Fig 5) (P < 0.01). Furthermore, the increased expression was dose-dependent (P < 0.05). These results further indicated that the transcription of bBoule was regulated by DNA methylation.

Fig 5. mRNA expression of bBoule in BMECs treated with 5-Aza-dC.

Fig 5

mRNA expression was detected in treated cells but not in untreated cells by qRT-PCR. All experiments were performed three times. The bar above the histogram indicates the SEM. Different uppercase letters denote significant differences between different groups with a significance level of P < 0.01. Different lowercase letters denote significant differences between different groups with a significance level of P < 0.05.

Discussion

Boule is one of only two genes (Boule and Nanos3) that was directly shown to function in germ-cell development across diverse species including flies, worms, frogs, mice, and humans [5, 40]. Nanos3 belongs to the Nanos gene family, and is expressed in the primordial germ cells of mammals; Nanos3 knockout mice have smaller gonads and infertility in both male and female mice [40, 41]. Boule is a member of the DAZ family and is expressed in germ cells during the first meiotic division of mammalian spermatogenesis, and loss of function of mammalian Boule results in male-specific infertility [5, 42]. Our previous study found that bBoule is expressed at low levels in the testes of cattle-yak, a hybrid offspring of cattle and yaks, with male cattle-yak infertility caused by meiotic arrest [8, 33]. However, the epigenetic regulation mechanism of low bBoule expression is not known. DNA methylation is one of the most common epigenetic modifications in vertebrates; it regulates gene expression and thus affects gene function by influencing chromatin structure, DNA conformation, chromosome stability, and the interaction between DNA and proteins [37, 43–44]. In this study, we demonstrated a higher methylation level of the bBoule 5' region in cattle-yak testes with low bBoule expression and male infertility than in cattle with normal spermatogenesis (P < 0.01). Thus, methylation of the long CGI in the promoter may contribute to testicular bBoule transcription and male infertility. In fact, methylation in the promoter regions of many spermatogenic cell-specific genes is associated with male sterility, such as PIWIL1 [35, 45–46], PIWIL2 [46–47], DAZL [26, 28, 48], SNRPN [6, 49], MEST [6, 50], VASA [34, 51], and MTHFR [51–52]. Therefore, in the DAZ family, the methylation of two members, which exist in all mammals, DAZL and Boule, is associated with male sterility [28, 48], while the methylation of DAZ, another DAZ family member only found in primates, is not associated with male sterility [53].

In vertebrates, cytosine methylation is predominantly restricted to CpG dinucleotides and stably distributed across the genome, and regions with a high frequency of CpG sites are considered CGIs. CGIs are distributed throughout the genome, including in 5' promoter regions, gene bodies (coding regions and introns), 3' regions, and intergenic regions. In the past two decades, many experiments showed that CGI hypermethylation in 5' promoter regions represses gene transcription [34, 38, 54]. However, it was only recently discovered that CGI methylation in gene bodies is also distinctly involved in gene expression [37, 55–56]. Maunakea et al. [37] demonstrated a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies, and methylation of CGIs is more common in intragenic regions than in 5′ promoter regions in the human brain. A recent study showed that DNA methylation is not the key determinant in the regulation of most promoters in human HCT116 cells, but demethylation has a major effect on promoter-distal regulatory regions, uncovering intragenic enhancers within genes whose expression increases in the absence of DNA methylation [56]. This indicates that DNA methylation plays a distinct role in the silencing of regulatory elements within gene bodies. However, the methylation status of the short intragenic CGI in intron 5 of bBoule in the testis did not differ between cattle and cattle-yak. Similarly, methylation of a CGI in intron 1 of GNA11 does not show a clear correlation with its decreased expression in human breast cancers [57]. Zhu et al. [58] reported that the methylation status of intragenic CpG islands-1 in SHANK3 is not changed in brain tissues of patients with autism spectrum disorders. These observations suggested that the methylation level of intragenic CGI was not associated with low bBoule expression in the testes of cattle-yak hybrids or with male infertility.

In mammals, CGIs were found in or near approximately 40% of gene promoters [59]. Currently, studies of DNA methylation regulation of the expression of single genes mostly focus on methylation of CGIs in promoter regions, and hypermethylation generally inhibits promoter activity, whereas hypomethylation activates gene transcription [35, 52, 56, 60]. Here, we found that the difference in methylation level between the testicular tissue of cattle and cattle-yak hybrids was bigger for the core promoter CGIs than for those outside of the core promoter, indicating that high methylation of CpG sites in the core promoter was strongly associated with low bBoule expression in cattle-yak testes. The treatments with DNA methyltransferase (M.SssI) and the inhibitor of DNA methyltransferase (5-aza-dC) are the main direct in vitro methods to confirm that promoter DNA methylation regulates gene expression [61–65]. We further found that the activity of the bBoule core promoter decreased significantly after DNA methylase M.SssI treatment in GC-1 and COS-7 cells, while inhibition of DNA methylation with 5-aza-dC resulted in an approximately 2.5-fold induction of bBoule mRNA expression in BMECs. Our study provides strong support that DNA methylation inactivates the endogenous bBoule promoter, and exerts a negative effect on mRNA expression of bBoule in cattle-yak testes.

DNA promoter methylation could inhibit gene expression through direct interference with transcription factor binding to promoters, direct binding of specific transcriptional repressors, or alterations of the chromatin structure [35, 66–67]. To explore the molecular mechanism of DNA methylation inhibiting bBoule expression, we analyzed the methylation level of all CpG sites in the core promoter and found three differentially methylated CpG sites (-117CpG, -97CpG, and -94CpG). We next identified putative TFBS associated with the differentially methylated CpG sites using TFSEARCH v1.3 software (http://www.cbrc.jp/research/db/TFSEARCH.html), and found that -117CpG and -97CpG are located in the binding site for the transcription factors activator protein (AP)-2 and alcohol dehydrogenase gene regulator 1 (ADR1), respectively, while no known TFBS was predicted for the -94CpG region (Fig 6). AP-2 is a sequence-specific DNA-binding protein family including AP-2α, AP-2β, AP-2γ, AP-2δ, and AP-2ε, each of which binds to a GC-rich recognition sequence present in promoter and enhancer sequences, forming a vital link between cis-regulatory DNA elements and the general transcription machinery [68–70]. Bennett et al. [71] found that AP-2α expression is associated with target gene methylation and decreased expression in HNSCC cell lines, and demonstrated that AP-2α acts as a suppressor for certain “tumor suppressive” genes by targeting promoter methylation and/or deacetylation via HDAC recruitment. Adr1 is a transcription factor from Saccharomyces cerevisiae that belongs to the family of Cys2His2-type zinc finger proteins and regulates ADH2 expression through a 22 bp palindromic sequence [72–74]. However, there are no reports about the relationship between Adr1 and methylation of target genes in mammals. Therefore, hypermethylation of the AP-2 binding site (-117CpG site) in the bBoule promoter in cattle-yak testes probably causes reduced bBoule expression. Taken together, we speculate that methylation of the -117CpG site likely prevents AP-2 binding via disruption of its target sequence, which in turn hinders the recruitment of epigenetic factors, such as HDACs to the bBoule promoter, and results in bBoule repression; however, further experimental verification is needed.

Fig 6. The predicated TFBS of differentially methylated CpG sites within the bBoule promoter.

Fig 6

Arrows indicate differentially methylated CpG sites. The TFBS is underlined.

Data Availability

All relevant data are within the paper.

Funding Statement

The work was supported by the National Natural Science Foundation of China (Grant No. 30500360), http://www.nsfc.gov.cn/.

References

  • 1. Handel MA, Schimenti JC (2010) Genetics of mammalian meiosis: regulation, dynamics and impact on fertility. Nat Rev Genet 11: 124–136. 10.1038/nrg2723 [DOI] [PubMed] [Google Scholar]
  • 2. Comazzetto S, Di Giacomo M, Rasmussen KD, Much C, Azzi C, Perlas E, et al. (2014) Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 loci. PLoS Genet 10: e1004597 10.1371/journal.pgen.1004597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Lu C, Kim J, Fuller MT (2013) The polyubiquitin gene Ubi-p63E is essential for male meiotic cell cycle progression and germ cell differentiation in Drosophila. Development 140: 3522–3531 10.1242/dev.098947 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Berkowitz KM, Sowash AR, Koenig LR, Urcuyo D, Khan F, Yang F, et al. (2012) Disruption of CHTF18 causes defective meiotic recombination in male mice. PLoS Genet 8: e1002996 10.1371/journal.pgen.1002996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Xu EY, Moore FL, Pera RA (2001) A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc Natl Acad Sci USA 98: 7414–7419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kee K, Angeles VT, Flores M, Nguyen HN, Reijo Pera RA (2009) Human DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete formation. Nature 462: 222–225. 10.1038/nature08562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Zhang S, Tang Q, Wu W, Yuan B, Lu C, Xia Y, et al. (2014) Association between DAZL polymorphisms and susceptibility to male infertility: systematic review with meta-analysis and trial sequential analysis. Sci Rep 4: 4642 10.1038/srep04642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Zhang Q, Li J, Li Q, Li X, Liu Z, Song D, et al. (2009) Cloning and characterization of the gene encoding the bovine BOULE protein. Mol Genet Genomics 281 67–75 10.1007/s00438-008-0394-6 [DOI] [PubMed] [Google Scholar]
  • 9. Bhat N, Hong Y (2014) Cloning and expression of boule and dazl in the Nile tilapia (Oreochromis niloticus). Gene 540: 140–5. 10.1016/j.gene.2014.02.057 [DOI] [PubMed] [Google Scholar]
  • 10. Li M, Shen Q, Xu H, Wong FM, Cui J, Li Z, et al. (2011) Differential conservation and divergence of fertility genes boule and dazl in the rainbow trout. PLoS One 6: e15910 10.1371/journal.pone.0015910 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Yen PH, Chai NN, Salido EC (1996) The human autosomal gene DAZLA: testis specificity and a candidate for male infertility. Hum Mol Genet 5: 2013–2017. [DOI] [PubMed] [Google Scholar]
  • 12. He J, Stewart K, Kinnell HL, Anderson RA, Childs AJ (2013) A developmental stage-specific switch from DAZL to BOLL occurs during fetal oogenesis in humans, but not mice. PLoS One 8: e73996 10.1371/journal.pone.0073996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Reijo R, Lee T Y, Salo P, Alagappan R, Brown L G, Rosenberg M, et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 10: 383–393. [DOI] [PubMed] [Google Scholar]
  • 14. Hughes JF, Skaletsky H, Page DC (2012) Sequencing of rhesus macaque Y chromosome clarifies origins and evolution of the DAZ (Deleted in AZoospermia) genes. Bioessays 34: 1035–1044. 10.1002/bies.201200066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Kim B, Lee W, Rhee K, Kim SW, Paick JS (2014) Analysis of DAZ gene expression in a partial AZFc deletion of the human Y chromosome. Reprod Fertil Dev 26: 307–315. 10.1071/RD12290 [DOI] [PubMed] [Google Scholar]
  • 16. Yen PH (2004) Putative biological functions of the DAZ family. Int J Androl 27: 125–129. [DOI] [PubMed] [Google Scholar]
  • 17. Teng YN, Chang YP, Tseng JT, Kuo PH, Lee IW, Lee MS, et al. (2012) A single-nucleotide polymorphism of the DAZL gene promoter confers susceptibility to spermatogenic failure in the Taiwanese Han. Hum Reprod, 27: 2857–2865. 10.1093/humrep/des227 [DOI] [PubMed] [Google Scholar]
  • 18. Eberhart CG, Maines JZ, Wasserman SA (1996) Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 381: 783–785. [DOI] [PubMed] [Google Scholar]
  • 19. Xu EY, Lee DF, Klebes A, Turek PJ, Kornberg TB, Reijo RA (2003) Human BOULE gene rescues meiotic defects in infertile flies. Hum Mol Genet 12: 169–175 [DOI] [PubMed] [Google Scholar]
  • 20. Luetjens CM, Xu EY, Rejo RA, Kamischke A, Nieschlag E, Gromoll J (2004) Association of meiotic arrest with lack of BOULE protein expression in infertile men. J Clin Endocrinol Metab 89: 1926–1933. [DOI] [PubMed] [Google Scholar]
  • 21. Lin YM, Kuo PL, Lin YH, Teng YN, Lin JS (2005) Messenger RNA transcripts of the meiotic regulator BOULE in the testis of azoospermic men and their application in predicting the success of sperm retrieval. Hum Reprod 20: 782–788. [DOI] [PubMed] [Google Scholar]
  • 22. Vangompel MJ, Xu EY (2010) A novel requirement in mammalian spermatid differentiation for the DAZ-family protein Boule. Hum Mol Genet 19: 2360–2369. 10.1093/hmg/ddq109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Li M, Liu C, Zhu H, Sun J, Yu M, Niu Z, et al. (2013) Expression pattern of Boule in dairy goat testis and its function in promoting the meiosis in male germline stem cells (mGSCs). J Cell Biochem 114: 294–302. 10.1002/jcb.24368 [DOI] [PubMed] [Google Scholar]
  • 24. Linher K, Cheung Q, Baker P, Bedecarrats G, Shiota K, Li J (2009) An epigenetic mechanism regulates germ cell-specific expression of the porcine Deleted in Azoospermia-Like (DAZL) gene. Differentiation 77: 335–349. 10.1016/j.diff.2008.08.001 [DOI] [PubMed] [Google Scholar]
  • 25. Popp C, Dean W, Feng S, Cokus SJ, Andrews S, Pellegrini M, et al. (2010) Genome-wide erasure of DNA methylation in mouse primordial germ cells is affected by AID deficiency. Nature 463: 1101–1105. 10.1038/nature08829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Navarro-Costa P, Nogueira P, Carvalho M, Leal F, Cordeiro I, Calhaz-Jorge C, et al. (2010) Incorrect DNA methylation of the DAZL promoter CpG island associates with defective human sperm. Hum Reprod 25: 2647–2654. 10.1093/humrep/deq200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Jenkins HT, Malkova B, Edwards TA (2011) Kinked β-strands mediate high-affinity recognition of mRNA targets by the germ-cell regulator DAZL. Proc Natl Acad Sci USA, 108: 18266–18271. 10.1073/pnas.1105211108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Liu Z, Li Q, Pan Z, Qu X, Zhang C, Xie Z (2011) Comparative analysis on mRNA expression level and methylation status of DAZL gene between cattle-yaks and their parents. Anim Reprod Sci 126: 258–264. 10.1016/j.anireprosci.2011.05.013 [DOI] [PubMed] [Google Scholar]
  • 29. Hackett JA, Sengupta R, Zylicz JJ, Murakami K, Lee C, Down TA, et al. (2013) Germline DNA demethylation dynamics and imprint erasure through 5-hydroxymethylcytosine. Science 339: 448–452. 10.1126/science.1229277 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Shen W, Park BW, Toms D, Li J (2012) Midkine promotes proliferation of primordial germ cells by inhibiting the expression of the deleted in azoospermia-like gene. Endocrinology 153: 3482–3492. 10.1210/en.2011-1456 [DOI] [PubMed] [Google Scholar]
  • 31. Kasimanickam V, Kasimanickam R (2014) Exogenous retinoic acid and cytochrome P450 26B1 inhibitor modulate meiosis-associated genes expression in canine testis, an in vitro model. Reprod Domest Anim 49: 315–323. 10.1111/rda.12276 [DOI] [PubMed] [Google Scholar]
  • 32. Li M, Yu M, Zhu H, Song W, Hua J (2013) The effects of Nanos2 on Boule and Stra8 in male germline stem cells (mGSCs). Mol Biol Rep 40: 4383–4389. 10.1007/s11033-013-2527-1 [DOI] [PubMed] [Google Scholar]
  • 33. Li B, Ngo S, Wu W, Xu H, Xie Z, Li Q, et al. (2014) Identification and characterization of yak (Bos grunniens) b-Boule gene and its alternative splice variants. Gene 550: 193–199. 10.1016/j.gene.2014.08.028 [DOI] [PubMed] [Google Scholar]
  • 34. Luo H, Zhou Y, Li Y, Li Q (2013) Splice variants and promoter methylation status of the Bovine Vasa Homology (Bvh) gene may be involved in bull spermatogenesis. BMC Genet 14: 58 10.1186/1471-2156-14-58 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Hou Y, Yuan J, Zhou X, Fu X, Cheng H, Zhou R (2012) DNA demethylation and USF regulate the meiosis-specific expression of the mouse Miwi. PLoS Genet 8: e1002716 10.1371/journal.pgen.1002716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Peng P, Wang L, Yang X, Huang X, Ba Y, Chen X, et al. (2014) A Preliminary Study of the Relationship between Promoter Methylation of the ABCG1, GALNT2 and HMGCR Genes and Coronary Heart Disease. PLoS One 9: e102265 10.1371/journal.pone.0102265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Maunakea AK, Nagarajan RP, Bilenky M, Ballinger TJ, D'Souza C, Fouse SD, et al. (2010) Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466: 253–257. 10.1038/nature09165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Deaton AM, Webb S, Kerr AR, Illingworth RS, Guy J, Andrews R, Bird A (2011) Cell type-specific DNA methylation at intragenic CpG islands in the immune system. Genome Res 21: 1074–1086. 10.1101/gr.118703.110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Lou S, Lee HM, Qin H, Li JW, Gao Z, Liu X, et al. (2014) Whole-genome bisulfite sequencing of multiple individuals reveals complementary roles of promoter and gene body methylation in transcriptional regulation. Genome Biol 15: 408 10.1186/s13059-014-0408-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Julaton VT, Reijo Pera RA (2011) NANOS3 function in human germ cell development. Hum Mol Genet 20: 2238–2250. 10.1093/hmg/ddr114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Tsuda M, Sasaoka Y, Kiso M, Abe K, Haraguchi S, Kobayashi S, et al. (2003) Conserved role of nanos proteins in germ cell development. Science 301: 1239–1241. [DOI] [PubMed] [Google Scholar]
  • 42. Shah C, Vangompel MJ, Naeem V, Chen Y, Lee T, Angeloni N, et al. (2010) Widespread presence of human BOULE homologs among animals and conservation of their ancient reproductive function. PLoS Genet 6: e1001022 10.1371/journal.pgen.1001022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Guo H, Zhu P, Yan L, Li R, Hu B, Lian Y, et al. (2014) The DNA methylation landscape of human early embryos. Nature 511: 606–610. 10.1038/nature13544 [DOI] [PubMed] [Google Scholar]
  • 44. Jones B (2014) DNA methylation: switching phenotypes with epialleles. Nat Rev Genet 15: 572 10.1038/nrg3799 [DOI] [PubMed] [Google Scholar]
  • 45. Gu Y, Li Q, Pan Z, Li M, Luo H, Xie Z (2013) Molecular cloning, gene expression and methylation status analysis of PIWIL1 in cattle-yaks and the parental generation. Anim Reprod Sci 140: 131–137. 10.1016/j.anireprosci.2013.05.010 [DOI] [PubMed] [Google Scholar]
  • 46. Friemel C, Ammerpohl O, Gutwein J, Schmutzler AG, Caliebe A, Kautza M, et al. (2014) Array-based DNA methylation profiling in male infertility reveals allele-specific DNA methylation in PIWIL1 and PIWIL2. Fertil Steril 101: 1097–1103. 10.1016/j.fertnstert.2013.12.054 [DOI] [PubMed] [Google Scholar]
  • 47. Heyn H, Ferreira HJ, Bassas L, Bonache S, Sayols S, Sandoval J, et al. (2012) Epigenetic disruption of the PIWI pathway in human spermatogenic disorders. PLoS One 7: e47892 10.1371/journal.pone.0047892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Li B, Li JB, Xiao XF, Ma YF, Wang J, Liang XX, et al. (2013) Altered DNA methylation patterns of the H19 differentially methylated region and the DAZL gene promoter are associated with defective human sperm. PLoS One 8: e71215 10.1371/journal.pone.0071215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Camprubí C, Pladevall M, Grossmann M, Garrido N, Pons MC, Blanco J (2012) Semen samples showing an increased rate of spermatozoa with imprinting errors have a negligible effect in the outcome of assisted reproduction techniques. Epigenetics 7: 1115–1124. 10.4161/epi.21743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Hammoud SS, Purwar J, Pflueger C, Cairns BR, Carrell DT (2010) Alterations in sperm DNA methylation patterns at imprinted loci in two classes of infertility. Fertil Steril 94: 1728–1733. 10.1016/j.fertnstert.2009.09.010 [DOI] [PubMed] [Google Scholar]
  • 51. Kläver R, Bleiziffer A, Redmann K, Mallidis C, Kliesch S, Gromoll J (2012) Routine cryopreservation of spermatozoa is safe—evidence from the DNA methylation pattern of nine spermatozoa genes. J Assist Reprod Genet 29: 943–950. 10.1007/s10815-012-9813-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Rotondo JC, Selvatici R, Di Domenico M, Marci R, Vesce F, Tognon M, et al. (2013) Methylation loss at H19 imprinted gene correlates with methylenetetrahydrofolate reductase gene promoter hypermethylation in semen samples from infertile males. Epigenetics 8: 990–997 10.4161/epi.25798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Wu W, Lu C, Xia Y, Shen O, Ji G, Gu A, et al. (2010) Lack of association between DAZ gene methylation patterns and spermatogenic failure. Clin Chem Lab Med 48: 355–360. 10.1515/CCLM.2010.007 [DOI] [PubMed] [Google Scholar]
  • 54. Smith ZD, Chan MM, Humm KC, Karnik R, Mekhoubad S, Regev A, et al. (2014) DNA methylation dynamics of the human preimplantation embryo. Nature 511: 611–615. 10.1038/nature13581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Pinheiro A, Nunes MJ, Milagre I, Rodrigues E, Silva MJ, de Almeida IT, et al. (2012). Demethylation of the coding region triggers the activation of the human testis-specific PDHA2 gene in somatic tissues. PLoS One 7: e38076 10.1371/journal.pone.0038076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Blattler A, Yao L, Witt H, Guo Y, Nicolet CM, Berman BP, et al. (2014) Global loss of DNA methylation uncovers intronic enhancers in genes showing expression changes. Genome Biol 15: 469 10.1186/s13059-014-0469-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Asada K, Miyamoto K, Fukutomi T, Tsuda H, Yagi Y, Wakazono K, et al. (2003) Reduced expression of GNA11 and silencing of MCT1 in human breast cancers. Oncology. 64: 380–388. [DOI] [PubMed] [Google Scholar]
  • 58. Zhu L, Wang X, Li XL, Towers A, Cao X, Wang P, et al. (2014) Epigenetic dysregulation of SHANK3 in brain tissues from individuals with autism spectrum disorders. Hum Mol Genet. 23: 1563–1578. 10.1093/hmg/ddt547 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Fatemi M, Pao MM, Jeong S, Gal-Yam EN, Egger G, Weisenberger DJ, et al. (2005) Footprinting of mammalian promoters: use of a CpG DNA methyltransferase revealing nucleosome positions at a single molecule level. Nucleic Acids Res 33: e176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Miyata K, Miyata T, Nakabayashi K, Okamura K, Naito M, Kawai T, et al. (2014) DNA methylation analysis of human myoblasts during in vitro myogenic differentiation: de novo methylation of promoters of muscle-related genes and its involvement in transcriptional down-regulation. Hum Mol Genet 10.1093/hmg/ddu457 [DOI] [PMC free article] [PubMed]
  • 61. Xie W, Han S, Khan M, DeJong J (2002) Regulation of ALF gene expression in somatic and male germ line tissues involves partial and site-specific patterns of methylation. J Biol Chem 277: 17765–17774. [DOI] [PubMed] [Google Scholar]
  • 62. Christman JK (2002) 5-Azacytidine and 5-aza-2'-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene 21: 5483–5495. [DOI] [PubMed] [Google Scholar]
  • 63. Knower KC, To SQ, Simpson ER, Clyne CD (2010) Epigenetic mechanisms regulating CYP19 transcription in human breast adipose fibroblasts. Mol Cell Endocrinol 321: 123–130. 10.1016/j.mce.2010.02.035 [DOI] [PubMed] [Google Scholar]
  • 64. Gutjahr A, Xu SY (2014) Engineering nicking enzymes that preferentially nick 5-methylcytosine-modified DNA. Nucleic Acids Res 42: e77 10.1093/nar/gku192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Lu Y, Wajapeyee N, Turker MS, Glazer PM (2014) Silencing of the DNA mismatch repair gene MLH1 induced by hypoxic stress in a pathway dependent on the histone demethylase LSD1. Cell Rep 8: 501–513. 10.1016/j.celrep.2014.06.035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Huang YZ, Zhang LZ, Lai XS, Li MX, Sun YJ, Li CJ, et al. (2014) Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts. Sci Rep 4: 4570 10.1038/srep04570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Corrêa S, Binato R, Du Rocher B, Ferreira G, Cappelletti P, Soares-Lima S, et al. (2014) ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter. Epigenetics 9: 1172–1183. 10.4161/epi.29675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Zhao F, Satoda M, Licht JD, Hayashizaki Y, Gelb BD (2001) Cloning and characterization of a novel mouse AP-2 transcription factor, AP-2delta, with unique DNA binding and transactivation properties. J Biol Chem 276: 40755–40760. [DOI] [PubMed] [Google Scholar]
  • 69. Eckert D, Buhl S, Weber S, Jäger R, Schorle H (2005) The AP-2 family of transcription factors. Genome Biol 6: 246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Sun L, Zhao Y, Gu S, Mao Y, Ji C, Xin X (2014) Regulation of the HMOX1 gene by the transcription factor AP-2δ with unique DNA binding site. Mol Med Rep 10: 423–428. 10.3892/mmr.2014.2196 [DOI] [PubMed] [Google Scholar]
  • 71. Bennett KL, Romigh T, Eng C (2009) AP-2alpha induces epigenetic silencing of tumor suppressive genes and microsatellite instability in head and neck squamous cell carcinoma. PLoS One 4: e6931 10.1371/journal.pone.0006931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Thukral SK, Eisen A, Young ET (1991) Two monomers of yeast transcription factor ADR1 bind a palindromic sequence symmetrically to activate ADH2 expression. Mol Cell Biol 11: 1566–1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Braun KA, Parua PK, Dombek KM, Miner GE, Young ET (2013) 14-3-3 (Bmh) proteins regulate combinatorial transcription following RNA polymerase II recruitment by binding at Adr1-dependent promoters in Saccharomyces cerevisiae. Mol Cell Biol 33: 712–724. 10.1128/MCB.01226-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Gasmi N, Jacques PE, Klimova N, Guo X, Ricciardi A, Robert F, et al. (2014) The switch from fermentation to respiration in Saccharomyces cerevisiae is regulated by the Ert1 transcriptional activator/repressor. Genetics 198: 547–560. 10.1534/genetics.114.168609 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES