Skip to main content
Meta Gene logoLink to Meta Gene
. 2015 Jun 14;5:68–83. doi: 10.1016/j.mgene.2015.05.002

The complete mitochondrial genome of Papilio glaucus and its phylogenetic implications

Jinhui Shen b, Qian Cong b, Nick V Grishin a,b,⁎
PMCID: PMC4475787  PMID: 26106582

Abstract

Due to the intriguing morphology, lifecycle, and diversity of butterflies and moths, Lepidoptera are emerging as model organisms for the study of genetics, evolution and speciation. The progress of these studies relies on decoding Lepidoptera genomes, both nuclear and mitochondrial. Here we describe a protocol to obtain mitogenomes from Next Generation Sequencing reads performed for whole-genome sequencing and report the complete mitogenome of Papilio (Pterourus) glaucus. The circular mitogenome is 15,306 bp in length and rich in A and T. It contains 13 protein-coding genes (PCGs), 22 transfer-RNA-coding genes (tRNA), and 2 ribosomal-RNA-coding genes (rRNA), with a gene order typical for mitogenomes of Lepidoptera. We performed phylogenetic analyses based on PCG and RNA-coding genes or protein sequences using Bayesian Inference and Maximum Likelihood methods. The phylogenetic trees consistently show that among species with available mitogenomes Papilio glaucus is the closest to Papilio (Agehana) maraho from Asia.

Keywords: Papilio glaucus, Mitochondrial genome, Illumina sequencing, Phylogeny

Introduction

The order Lepidoptera contains approximately 160,000 described and half a million estimated species (Kristensen et al., 2007), and it represents one of the most diverse and fascinating group of insects. Recent studies have revealed their potential as model organisms to study the genetics of interesting phenotypic traits in butterflies, such as the Batesian mimicry in swallowtails (Clarke and Sheppard, 1972, Nishikawa et al., 2013), migration in the monarch (Zhan et al., 2011, Zhan et al., 2014) and wing pattern development in longwings (Hines et al., 2012, Surridge et al., 2011). The profound diversity and the recent evolutionary radiation of Lepidoptera provide rich materials to study evolution, speciation and adaptation (Engsontia et al., 2014, Zhang et al., 2013a). These studies benefit significantly from decoding the genomes of various Lepidoptera species.

Recently, we published the draft genome of Eastern Tiger swallowtail Papilio (Pterourus) glaucus using next generation sequencing techniques (Cong et al., 2015). This nuclear whole genome was the first reported from the Papilionidae family. Traditional genome assemblers failed to automatically assemble the mitogenome, probably due to the difficulty in distinguishing NGS reads of the mitogenome from those of nuclear genome, the presence of nuclear copies of mitochondrial (NUMT) DNA (which can lead to conflicts in assembly), and the poor signal-to-noise ratio caused by the high coverage of mitochondrial DNA (Hahn et al., 2013). However, a dedicated effort should be able to assemble the mitogenome from whole-genome sequencing reads. The mitogenome sequences are expected to be useful for phylogenetic studies, and they have been obtained for many species. The Papilionidae family has over 570 species worldwide (C.A. Bridges, 1988), while only 17 species have complete mitogenomes currently available in GenBank (included in Table 1, accessed on: 11/28/2014).

Table 1.

List of taxa analyzed in present paper.

Family Species Length (bp) Accession number References
Papilionidae Papilio glaucus 15,306 KR822739 This study
Papilio bianor 15,357 NC_018040.1 Unpublished
Papilio dardanus 15,337 JX313686.2 Unpublished
Papilio maackii 15,357 KC433408.1 Dong et al. (2013)
Papilio machaon 15,185 HM243594.1 Unpublished
Papilio maraho 16,094 FJ810212.1 Unpublished
Papilio polytes 15,256 KM014701.1 Wang et al. (2014a)
Papilio syfanius 15,359 KJ396621.1 Dong et al. (2014)
Parnassius apollo 15,404 KF746065.1 Chen et al. (2014a)
Parnassius bremeri 15,389 NC_014053.1 Kim et al. (2009)
Parnassius imperator 15,424 KM507326.1 Wang et al. (2014b)
Sericinus montela 15,242 HQ259122.1 Ji et al. (2012)
Luehdorfia taibai 15,553 KC952673.1 Lian-Xi et al. (2014)
Teinopalpus aureus 15,242 HM563681.1 Qin et al. (2012a)
Lamproptera curius 15,277 KJ141168.1 Unpublished
Graphium timur 15,226 KJ472924.1 Chen et al. (2014b)
Atrophaneura alcinous 15,266 KJ540880.1 Chen et al. (2014c)
Troides aeacus 15,263 EU625344.1 Unpublished
Lycaenidae Coreana raphaelis 15,314 DQ102703.1 Kim et al. (2006)
Cupido argiades 15,330 KC310728.1 Zhang et al. (2013b)
Curetis bulis 15,162 JX262888.1 Zhang et al. (2013c)
Lycaena phlaeas 15,280 JX262887.1 Zhang et al. (2013c)
Protantigius superans 15,248 HQ184265.1 Kim et al. (2011a)
Spindasis takanonis 15,349 HQ184266.1 Kim et al. (2011a)
Riodinidae Abisara fylloides 15,301 HQ259069.1 Unpublished
Apodemia mormo 15,262 KJ647171.1 Kim and Kim (2014)
Pieridae Anthocharis bambusarum 15,180 KC465748.1 Unpublished
Aporia crataegi 15,140 JN796473.1 Park et al. (2012)
Aporia intercostata 15,144 KC461928.1 Unpublished
Catopsilia pomona 15,142 JX274649.1 Hao et al. (2014)
Delias hyparete 15,186 JX094279.1 Shi et al. (2012)
Eurema hecabe 15,160 KC257480.1 Sun et al. (2014)
Hebomoia glaucippe 15,701 KC489093.1 Hao et al. (2013a)
Leptidea morsei 15,122 JX274648.1 Hao et al. (2014)
Artogeia melete 15,140 EU597124.1 Hong et al. (2009)
Pieris rapae 15,157 NC_015895.1 Mao et al. (2010)
Hesperiidae Ampittia dioscorides 15,313 KM102732.1 Unpublished
Carterocephalus silvicola 15,765 KJ629163.1 Kim et al. (2014)
Celaenorrhinus maculosa 15,282 KF543077.1 Wang et al. (2013a)
Choaspes benjaminii 15,300 KJ629164.1 Kim et al. (2014)
Ctenoptilum vasava 15,468 JF713818.1 Hao et al. (2012)
Daimio tethys 15,350 KJ629165.1 Kim et al. (2014)
Erynnis montanus 15,530 KC659955.1 Wang et al. (2014c)
Lobocla bifasciatus 15,366 KJ629166.1 Kim et al. (2014)
Ochlodes venata 15,622 HM243593.1 Unpublished
Potanthus flavus 15,267 KJ629167.1 Kim et al. (2014)
Nymphalidae Abrota ganga 15,356 KF590536.1 Wu et al. (2014)
Acraea issoria 15,245 GQ376195.1 Hu et al. (2010)
Apatura ilia 15,242 JF437925.1 Chen et al. (2012)
Apatura metis 15,236 JF801742.1 Zhang et al. (2012)
Argynnis childreni 15,131 KF590547.1 Wu et al. (2014)
Argynnis hyperbius 15,156 JF439070.1 Wang et al. (2011)
Athyma asura 15,181 KF590542.1 Wu et al. (2014)
Athyma cama 15,269 KF590526.1 Wu et al. (2014)
Athyma kasa 15,230 KF590524.1 Wu et al. (2014)
Athyma opalina 15,240 KF590551.1 Wu et al. (2014)
Athyma perius 15,277 KF590528.1 Wu et al. (2014)
Athyma selenophora 15,208 KF590529.1 Wu et al. (2014)
Athyma sulpitia 15,268 JQ347260.1 Tian et al. (2012)
Bhagadatta austenia 15,615 KF590545.1 Wu et al. (2014)
Calinaga davidis 15,267 HQ658143.1 Xia et al. (2011)
Danaus chrysippus 15,236 KF690637.1 Gan et al. (2014a)
Danaus plexippus 15,314 KC836923.1 Servin-Garciduenas and Martinez-Romero (2014)
Dichorragia nesimachus 15,355 KF590541.1 Wu et al. (2014)
Dophla evelina 15,320 KF590532.1 Wu et al. (2014)
Euploea core 15,192 KF590546.1 Wu et al. (2014)
Euploea midamus 15,187 KJ866207.1 Unpublished
Euploea mulciber 15,166 HQ378507.1 Hao et al. (2013b)
Euthalia irrubescens 15,365 KF590527.1 Wu et al. (2014)
Fabriciana nerippe 15,140 JF504707.1 Kim et al. (2011b)
Hamadryas epinome 15,207 KM378244.1 Cally et al. (2014)
Heliconius cydno 15,367 KM208636.1 Qian (2014)
Heliconius hecale 15,338 KM068091.1 Shen and Wang (2014)
Heliconius melpomene 15,328 KP100653.1 (Heliconius Genome, 2012, Meng et al., 2014)
Heliconius pachinus 15,369 KM014809.1 Huang et al. (2014a)
Hipparchia autonoe 15,489 GQ868707.1 Kim et al. (2010)
Ideopsis similis 15,200 KJ476729.1 Gan et al. (2014b)
Issoria lathonia 15,172 HM243590.1 Unpublished
Junonia almana 15,256 KF590539.1 Wu et al. (2014)
Junonia orithya 15,214 KF199862.1 Shi et al. (2013a)
Kallima inachus 15,183 JN857943.1 Qin et al. (2012b)
Lexias dirtea 15,250 KF590531.1 Wu et al. (2014)
Libythea celtis 15,164 HQ378508.1 Unpublished
Melanargia asiatica 15,142 KF906486.1 Huang et al. (2014b)
Melanitis leda 15,122 JF905446.1 Shi et al. (2013b)
Melanitis phedima 15,142 KF590538.1 Wu et al. (2014)
Melitaea cinxia 15,162 HM243592.1 Unpublished
Neope pulaha 15,209 KF590543.1 Wu et al. (2014)
Neptis philyra 15,164 KF590552.1 Wu et al. (2014)
Neptis soma 15,130 KF590533.1 Wu et al. (2014)
Pandita sinope 15,257 KF590530.1 Wu et al. (2014)
Pantoporia hordonia 15,603 KF590534.1 Wu et al. (2014)
Parantica sita 15,211 KF590544.1 Wu et al. (2014)
Pararge aegeria 15,240 KJ547676.1 Teixeira da Costa (2014)
Parasarpa dudu 15,236 KF590537.1 Wu et al. (2014)
Parthenos sylvia 15,249 KF590550.1 Wu et al. (2014)
Polyura arja 15,363 KF590540.1 Wu et al. (2014)
Sasakia charonda 15,233 JX119051.1 Wang et al. (2012)
Sasakia funebris 15,233 JX131328.1 Wang et al. (2013b)
Tanaecia julii 15,316 KF590548.1 Wu et al. (2014)
Timelaea maculata 15,178 KC572131.1 Cao et al. (2013)
Tirumala limniace 15,285 KJ784473.1 Gan et al. (2014c)
Triphysa phryne 15,143 KF906487.1 Zhang et al. (2014a)
Yoma sabina 15,330 KF590535.1 Wu et al. (2014)
Ypthima akragas 15,227 KF590553.1 Wu et al. (2014)
Cossidae Eogystia hippophaecolus 15,431 KC831443.1 Gong et al. (2014)
Bombycidae Bombyx mori 15,643 KM279431.1 Zhang et al. (2014b)
Hepialidae Thitarodes renzhiensis 16,173 NC_018094.1 Cao et al. (2012)

The insect mitogenome is a circular DNA of 14–19 kilobases (kb), containing 13 protein-coding genes (PCGs), 2 ribosomal-RNA-coding genes (rRNAs), 22 transfer-RNA-coding genes (tRNAs), and an A + T rich displacement loop (D-loop) control region (Cameron, 2014). Because of their maternal inheritance, compact structure, lack of genetic recombination, and relatively fast evolutionary rate, mitogenomes have been used widely in molecular phylogenetics and evolution studies (Cameron, 2014, Moritz et al., 1987). Here, we reconstruct and annotate the complete mitogenome of Papilio glaucus from next generation sequencing reads, and perform phylogenetic analyses of P. glaucus mitogenome with available complete mitogenomes of butterflies.

Materials and methods

Library preparation and Illumina sequencing

A male P. glaucus was caught and freshly frozen from Lake Ray Roberts State Park, Greenbelt Corridor along the Elm Fork of the Trinity River, 33.2536, − 97.0434, Denton County, Texas, USA (date 4-VIII-2013). The specimen will be deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM). Detailed procedures and protocols for library preparation were described in Cong et al. (2015). Briefly, we extracted genomic DNA from a piece of muscle dissected from the butterfly thorax using the ChargeSwitch gDNA mini tissue kit (Life Technologies, Grand Island, NY, USA). 250 bp and 500 bp paired-end libraries were made following the Illumina TruSeq DNA sample preparation guide using enzymes from NEBNext Modules (New England Biolabs, Ipswich, MA, USA). These libraries were sequenced at the genomics core facility in UT Southwestern Medical Center for 150 bp from both ends with a rapid run on Illumina HiSeq1500.

Sequence assembly

Sequencing reads were processed sequentially by MIRABAIT (Chevreux et al., 1999) to remove contamination from sequence adapters, by Fastq_quality_trimmer (http://hannonlab.cshl.ed/fastx_toolkit/) to trim low-quality regions at both ends and by QUAKE to correct errors (Cong et al., 2015, Kelley et al., 2010). From either the 250 bp or 500 bp library, we used mitochondrial baiting and iterative mapping (MITObim) v1.6 (Hahn et al., 2013) to assemble the mitogenome using two approaches: (1) using mitogenomes of Papilio maackii (KC433408.1), Papilio polytes (KM014701.1) and Papilio maraho (FJ810212.1) as references to guide the assembly; (2) using a short COI barcode sequence (a segment of about 600 bp from the mitochondrial gene cytochrome oxidase I) of P. glaucus (GU090087.1) as the starting seed. We used the default parameters for MITObim except for setting the — kbait to be 35 instead of 31.

The genome assemblies directly produced by the reference-guided mode in MITObim did not directly consider that the mitogenome should be a circular DNA and that the reads mapped to the N-terminus of the reference sequence could overlap with reads mapped to the C-terminus of the reference mitogenome. Therefore, it produced sequences whose C-terminal segment (usually about several hundred base pairs) is a duplication of the N-terminal segment. We detected such duplicated regions by aligning the N-terminal half and C-terminal half with BLASTN and manually removed the redundant segments. We also adjusted the linear representation of the circular DNA by circular permutation so that the sequence starts with the coding gene for ND2, which is the convention for most Lepidoptera sequences deposited in the database.

We aligned the mitogenome sequences produced by different methods with MAFFT (Katoh and Standley, 2013) (Supplementary data). These assemblies mostly agree with each other, with most discrepancies located in the D-loop region. We derived our final mitogenome sequence from the alignment of these different assemblies by taking the dominant nucleotide or gap at each position.

Annotation and analysis of the mitochondrial genome

The mitogenome sequence was annotated using the MITOS web server (Bernt et al., 2013). We translated the sequences of PCGs to protein sequences using the genetic code for invertebrate mitogenomes. Secondary structures of tRNA genes were predicted using the same server.

Assembly quality assessment

We first checked if the assembly was well-supported by the sequencing reads by mapping the reads to the mitogenome using bowtie2 v2.2.3 (Langmead and Salzberg, 2012). The alignments were combined into one single SAM-format file, processed with SAMtools (Li et al., 2009) and visualized in Integrative Genomics Viewer (IGV) (Robinson et al., 2011). Number of mapped reads (coverage by reads) at each position was calculated using bedtools v2.20.1 (Quinlan and Hall, 2010) and the histogram of the coverage was prepared in IBM SPSS Statistics v21 and Microsoft Excel 2010.

Second, we assessed the quality of our assembly by its consistency with other published Papilio sequences in the protein-, rRNA- and tRNA-coding regions. We aligned the rRNA- and tRNA-coding sequences directly and aligned translated sequences for PCGs to the corresponding proteins of other published Papilio mitogenomes. Alignments confirmed that our sequences are consistent with the majority of these published mitogenomes, and gaps are only in regions that are poorly conserved among other Papilio species.

Finally, we confirmed the assembly by comparing with Sanger sequencing results. We compared the mitogenome sequence with a reported 2291 bp partial mitogenome sequence of P. glaucus (accession: AF044013) (Caterino and Sperling, 1999) using BLAST. In addition, we sequenced the D-loop region and one arbitrarily selected coding region that partly covers ND4 and ND5. We amplified the two fragments from genomic DNA using primers shown in Table 2 with AmpliTaq Gold® 360 Master Mix (Life Technologies, Grand Island, NY, USA), following the manufacturer's protocol. Amplified products were separated by 2% E-Gel® EX Agarose Gels (Life Technologies, Grand Island, NY, USA) and purified by Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA). The purified DNA fragments were sent for Sanger sequencing in the sequencing core facility at UT Southwestern Medical Center. Sequencing results were manually confirmed by visualizing the traces in FinchTV v1.4 and then compared with the assembled mitogenome.

Table 2.

Primers used for amplification of the fragments containing D-loop and ND4 end region.

Fragment location on genome Primer Primer sequence (5′ to 3′)
14,387–15,306, 1–104 D-loopF GCAACTGCTGGCACAAAAT
D-loopR CCAATTCAACATCCCAATCA
7428–8136 ND4F CTAATCCTAACCCATCCCAACC
ND4R TAGCTGCTCCTCCTTCTATGA

Phylogenetic analysis

104 complete, non-redundant butterfly mitogenomes that are currently available were downloaded from GenBank (Table 1). Moth mitogenomes from Thitarodes renzhiensis (NC_018094.1), Bombyx mori (KM279431.1), and Eogystia hippophaecolus (KC831443.1) were also downloaded and used as outgroups. DNA sequences of the 37 protein- and RNA-coding genes were aligned by MAFFT. We manually checked the alignments of each gene, corrected sequences from some species with annotation errors based on consensus, replaced mitogenomes of poor quality (for example, sequences with frame-shift mutation that causes premature ending of proteins) with alternative mitogenome from the same species, and removed positions with large gaps and their surrounding regions with uncertain alignment.

The processed alignments were analyzed for phylogeny with Bayesian Inference and Maximum likelihood methods using MrBayes v3.2 (Huelsenbeck and Ronquist, 2001) and RaxML v8.1 (Stamatakis, 2006). We built trees with a different partitioning of the data sets (unpartitioned; partitioned by genes, PCG codon positions, and the exclusion of 3rd codon positions of PCGs). In addition, the translated protein sequences were aligned with MAFFT and analyzed with MrBayes. For analyses based on DNA alignments, the most suitable nucleotide substitution model (GTR + I + G) selected by jModelTest v2.1.7 (Darriba et al., 2012) was used, and for the protein-based analyses, we used a mixed model (Poisson, Jones, Dayhoff, Mtrev, Mtmam, Wag, Rtrev, Cprev, Vt, and Blosum) provided by the MrBayes program. The resulting phylogenetic trees were visualized in FigTree v1.4.2.

Results

Coverage of the mitogenome assembly by the reads

The coverage of the assembled P. glaucus mitogenome was high by the sequencing reads, with about 6000 fold mean coverage at base pair level and 500 fold minimal coverage (Fig. 1A and B). As shown in Fig. 1A, the regions with the lowest coverage were the beginning, the end and the D-loop regions. The low coverage at the beginning and the end of the mitogenome was primarily an artifact from limiting each read to map to only one most likely position: the circular DNA was represented as a linear sequence, and reads that should map partly to the beginning and partly to the end were restricted to map to either the beginning or the end.

Fig. 1.

Fig. 1

Coverage of Papilio glaucus mitogenome by sequencing reads (250 bp and 500 bp) mapped to them by Bowtie2. (A). Coverage at each base position. (B). Histogram of coverage distribution. (C). Negative correlation between the coverage and A + T contents of 50 bp windows in the genome.

The lower coverage in the D-loop might indicate potential errors in that region. However, independent Sanger sequencing of both the D-loop region (from the end of rrnS to the beginning of ND2) and another arbitrarily selected region (from the end of ND4 to the beginning of ND5), completely matched our assembly, indicating its high quality. In addition, the mitogenome sequence also agreed with the partial mitogenome (2291 bp) sequence of P. glaucus (accession: AF044013) in the database. Our sequence showed 0.3% sequence divergence from the previous sequence (only 6 out of 2291 positions are different), which likely corresponded to sequence variations between different individuals of the same species.

Instead, the low coverage of the D-loop region is probably related to its AT-rich composition, which tends to break during library preparation and is thus underrepresented in the sequencing libraries (Benjamini and Speed, 2012). Indeed, we observed that the percentage of A and T in a 50 bp window from the mitogenome is negatively correlated with the coverage for that region by the reads (Fig. 1C).

Base composition and genome structure

The P. glaucus mitogenome is a closed circular DNA of 15,306 bp. The nucleotide composition of the majority strand is A = 6117 (39.96%), T = 6193 (40.46%), G = 1167 (7.62%), and C = 1829 (11.95%), which is highly biased towards A and T. The majority strand has a negative AT-skew (− 0.0062) and GC-skew (− 0.2210) (Table 3), indicating a higher occurrence of T over A, C over G nucleotides on this strand. The P. glaucus mitogenome retains the typical insect mitogenome gene set, including 13 PCGs (ND1-6, COX1-3, ND4L, ATP8, ATP6, and CYTB), 22 tRNA genes (two for serine and leucine and one for each of the remaining amino acids), 2 ribosomal RNAs (rrnL and rrnS), and an A + T rich D-loop control region (Fig. 2 and Table 4).

Table 3.

Composition and skewness of Papilio glaucus mitogenome regions.

Nucleotides Whole genome PCGs tRNAs rRNAs A + T rich region Intergenic spacer region
A% 39.96 39.52 40.06 40.76 47.13 39.36
T% 40.46 39.50 40.96 43.33 47.54 45.74
G% 7.62 8.33 8.32 4.90 1.84 4.26
C% 11.95 12.65 10.67 11.00 3.48 10.64
A + T% 80.43 79.02 81.01 84.10 94.67 85.11
G + C% 19.57 20.98 18.99 15.90 5.33 14.89
AT-skew⁎ − 0.0062 0.0003 − 0.0111 − 0.0306 − 0.0043 − 0.0750
GC-skew⁎⁎ − 0.2210 − 0.2061 − 0.1241 − 0.3832 − 0.3077 − 0.4286
⁎

AT-skew = [A − T] / [A + T].

⁎⁎

GC-skew = [G − C] / [G + C] (Perna and Kocher, 1995).

Fig. 2.

Fig. 2

Map of genes in the Papilio glaucus mitochondrial genome. PCGs are colored in yellow, tRNA-coding genes are in purple, rrnL and rrnS are in green. Each gene is shown as an arrow indicating the transcription direction. The black line in the middle shows the coordinate of each gene in the mitogenome. The arrows on top of the line correspond to genes coded on the majority strand, and those below show genes on the minority strand.

Table 4.

Summary of the Papilio glaucus mitogenome.

Gene Direction From To Size Intergenic nucleotides Anticodon Start codon Stop codon
ND2 F 1 1014 1014 − 2 – ATT TAA
trnW F 1013 1077 65 − 8 TCA – –
trnC R 1070 1131 62 3 GCA – –
trnY R 1135 1199 65 2 GTA – –
COX1 F 1202 2732 1531 0 – CGA T
trnL2 F 2733 2800 68 0 TAA – –
COX2 F 2801 3482 682 0 – ATG T
trnK F 3483 3552 70 0 CTT – –
trnD F 3553 3619 67 0 GTC – –
ATP8 F 3620 3787 168 − 7 – ATT TAA
ATP6 F 3781 4458 678 7 – ATG TAA
COX3 F 4466 5254 789 2 – ATG TAA
trnG F 5257 5322 66 − 3 TCC – –
ND3 F 5320 5676 357 − 2 – ATA TAG
trnA F 5675 5738 64 − 1 TGC – –
trnR F 5738 5801 64 − 1 TCG – –
trnN F 5801 5866 66 0 GTT – –
trnS1 F 5867 5927 61 1 ACT – –
trnE F 5929 5995 67 − 2 TTC – –
trnF R 5994 6060 67 0 GAA – –
ND5 R 6061 7794 1734 0 – ATA TAA
trnH R 7795 7860 66 0 GTG – –
ND4 R 7861 9202 1342 − 4 – ATA T
ND4L R 9199 9489 291 6 – ATG TAA
trnT F 9496 9559 64 0 TGT – –
trnP R 9560 9623 64 2 TGG – –
ND6 F 9626 10,159 534 4 – ATT TAA
CYTB F 10,164 11,318 1155 2 – ATA TAA
trnS2 F 11,321 11,385 65 16 TGA – –
ND1 R 11,402 12,340 939 1 – ATG TAG
trnL1 R 12,342 12,409 68 0 TAG – –
rrnL R 12,410 13,728 1319 0 – – –
trnV R 13,729 13,791 63 0 TAC – –
rrnS R 13,792 14,572 781 0 – – –
A + T rich region 14,573 15,060 488 0 – – –
trnM F 15,061 15,129 69 0 CAT – –
trnI F 15,130 15,193 64 − 3 GAT – –
trnQ R 15,191 15,258 68 48 TTG – –

Annotation of the mitogenome

The annotation of the mitogenome is illustrated in Fig. 2 and summarized in Table 4. Nine protein-coding genes (ND2, COX1, COX2, ATP8, ATP6, COX3, ND3, ND6, and CYTB) are coded on the majority strand. COX1 uses start codon CGA, which is consistent with many other insect mitogenomes (Kim et al., 2009). A recent study using an expressed sequence tag from a Lepidopteran species confirmed the presence of COXI transcripts starting from CGA (Margam et al., 2011). Each of the rest of the genes starts with the typical ATN. COX1, COX2 and ND4 use an incomplete stop codon T (Ojala et al., 1981), and a complete TAA codon will likely be formed during mRNA maturation (Boore, 1999, Ojala et al., 1981). The 13 PCGs have a total length of 11,214 bp (Table 4).

14 out of the 22 tRNA-coding genes are encoded on the majority strand. The tRNAs have a total length of 1443 bp, and their individual lengths range from 61 bp to 70 bp (Table 4). Secondary structures predicted by MITOS suggest that all tRNA genes adopt a typical cloverleaf structure except for trnS1 (Fig. 3). The dihydrouridine (DHU) arm of trnS1 does not form a stable stem-loop structure, which is very common in butterfly mitogenomes (Kim et al., 2014, Lu et al., 2013). The two rRNA genes, rrnL and rrnS, are located on the minority strand, and their lengths are 1319 bp and 781 bp, respectively (Table 4).

Fig. 3.

Fig. 3

Secondary structure of 22 tRNA-coding genes of Papilio glaucus mitogenome predicted by the MITOS web server. The tRNAs are labeled by their corresponding amino acids in abbreviations.

A 488 bp A + T rich region (A + T content: 94.7%) connects rrnS and trnM. This region contains an “ATAGA” motif located 19 bp downstream from rrnS and followed by 14 bp of poly-T stretch that is consistent with a gene regulation element commonly found in Lepidoptera (Lu et al., 2013, Salvato et al., 2008). In addition to this A + T rich region, there are 94 bp non-coding nucleotides that make up 12 intergenic spacer sequences, ranging from 1 bp to 48 bp in length. The longest 48 bp spacer is located between trnQ and ND2, and a 16 bp spacer is located between trnS2 and ND1 (Table 4). In addition, there are 33 bp of overlapping sequences at 10 locations. The longest 8 bp overlap is between trnW and trnC. There is a 7 bp “ATGATAA” overlap between ATP8 and ATP6 (Table 4), and this is a common feature for Lepidopteran mitogenomes (Lu et al., 2013).

Phylogenetic relationships

We phylogenetically analyzed 105 butterfly species from 6 families: Papilionidae, Hesperiidae, Pieridae, Lycaenidae, Riodinidae, and Nymphalidae, and used 3 species of moths as outgroups. Maximum Likelihood analysis of the DNA alignments (Fig. 4A) and Bayesian Inference of DNA (Fig. 4B and Supplemental S2) and protein sequences (Fig. 4C) correctly partitioned butterflies into 6 families and suggested the same tree topology at the family level: (Papilionidae + (Hesperiidae + (Pieridae + ((Riodinidae + Lycaenidae) + Nymphalidae)))). Tree topologies between different methods were very similar. The positions of several species vary between trees obtained with different methods, such as Carterocephalus silvicola, Hebomoia glaucippe, and Ypthima akragas. However, all the trees consistently place P. glaucus, the only available mitogenome from the subgenus Pterourus, as a sister of P. maraho, the only available mitogenome from the subgenus Agehana (Fig. 4 and Supplemental S2).

Fig. 4.

Fig. 4

Phylogeny of butterflies. (A). Phylogenetic tree obtained by RaxML with the data set of PCG and RNA genes, partitioned into 13 PCGs, 1 tRNA, and 2 rRNA groups. (B). Phylogenetic tree obtained by MrBayes based on PCG and RNA genes, partitioned into 13 PCGs, 1 tRNA, and 2 rRNA groups. (C). Phylogenetic tree obtained by MrBayes based on 13 protein sequences, unpartitioned. Number at each node shows confidence of that group by bootstrap in (A), or posterior probability in (B) and (C). Thitarodes renzhiensis (NC_018094.1), Bombyx mori (KM279431.1), and Eogystia hippophaecolus (KC831443.1) were used as outgroup.

Discussion

The traditional method to obtain the mitogenome is through Sanger sequencing of a couple of overlapping segments. Here, we describe our protocol of assembling mitogenomes from Next Generation Sequencing reads for whole genome sequencing, and report the mitogenome of Eastern tiger swallowtail, P. glaucus. We used MITObim, a published tool designed for this task. MITObim has a reference-guided mode: it finds the conserved regions of a mitogenome using related reference species and extends these regions by baiting reads that overlap with the assembled regions until no gaps are left in between. Another mode of MITObim works without a reference mitogenome: it starts with a short COI sequence and extends by baiting reads with overlaps, till the N- and C-termini of the sequence can be mapped to the same reads, indicating that a circular mitogenome has been assembled (Hahn et al., 2013). Compared with the traditional PCR method, this method of mitogenome assembly does not require multiple primer designing and optimization, especially for species with limited knowledge available for primers' design.

However, MITObim could make mistakes due to (1) ambiguity in mapping and aligning the reads, (2) presence of sequencing error, and (3) difficulty in distinguishing mitochondrial DNA reads from nuclear DNA reads, especially those from nuclear copies of mitochondrial DNA or low-complexity regions. Therefore, taking the consensus of different MITObim runs with different modes and references, and careful validation of the result are needed. We produced a highly accurate assembly by integrating assemblies made by different MITObim modes (using other mitogenomes as references or the COI barcode sequence as seed). Even for the D-loop region that contains multiple short repeats, sequences obtained from Sanger sequencing showed no differences from our assembly.

Our phylogenetic analysis yielded a detailed tree of butterflies with available complete mitogenomes. Traditionally, Hesperiidae were considered to be at the root of the phylogenetic tree for all butterflies due to their similarity in morphology to moths (Kristensen and Skalski, 1998). However, several recent studies with molecular evidence have suggested a different evolutionary history of butterflies: (Papilionidae + (Hesperiidae + (Pieridae + (Nymphalidae + (Lycaenidae + Riodinidae))))) (Heikkila et al., 2012, Kim et al., 2014, Regier et al., 2013). Our phylogenetic analysis contained many more taxa compared with previous analyses and supported the same result in placing Papilionidae at the base. The reason for this apparent contradiction between the traditional morphology and recent molecular-based phylogeny is still poorly understood and requires future analysis.

It is notable that P. glaucus, a swallowtail native of eastern North America, is found to be confidently grouped with P. maraho based on our phylogeny analysis. P. maraho is a threatened swallowtail endemic to Taiwan in Asia (Baillie and Groombridge, 1996). Morphology, behavior and phylogenetic studies based on COI barcode suggested that P. maraho is very close to Papilio elwesi (Igarashi, 1979, Lu et al., 2009). Both P. elwesi and P. maraho are frequently attributed to the subgenus Agehana, which in some studies is included in subgenus Chilasa (Hancock, 1983, Zakharov et al., 2004). Despite a wide geographic separation, Agehana and Chilasa native to Asia are likely to be the closest relatives of the subgenus Pterourus (Zakharov et al., 2004), which is native to America. We speculate that these butterflies might have migrated between Asia (Agehana) and North America (Pterourus). Swallowtail butterflies have dispersed between continents (Condamine et al., 2012, Condamine et al., 2013). A recent report had found that Polyommatus blue butterflies traveled from Asia to North America via the Bering Strait, ultimately migrating to South America (Vila et al., 2011). Several other reports found that other butterfly species, animals, and plants followed the same route to the New World (Donoghue and Smith, 2004, Enghoff, 1995, Mullen, 2006, Peña et al., 2010).

Although our phylogenetic analyses produced similar phylogenetic trees, despite being performed with different methods, on different subsets of data (without or without RNA-coding sequences, DNA and translated proteins), and with different partition schemes, minor variations in positions of some taxa were observed. These inconsistencies might be caused by the available mitogenomes not carrying sufficient information to deduce accurate phylogeny, available software not being fully adequate for the task, or our position selection strategy requiring improvement. The current sample of taxa did not provide a fully resolved, consistent and accurate phylogeny. Additional analyses, mitogenomes, and possibly information from nuclear genomes are needed to address the question of the applicability of mitogenomes to infer a more accurate phylogenetic tree of butterflies.

The following are the supplementary data related to this article.

Supplemental S1

Multiple alignment of MITObim results.

mmc1.zip (20.2KB, zip)
Supplemental S2

More phylogenetic trees.

mmc2.pdf (6.6MB, pdf)

Acknowledgment

This work was supported by the National Institutes of Health (GM094575 to NVG) and the Welch Foundation (I-1505 to NVG). Qian Cong is a Howard Hughes Medical Institute International Student Research fellow. We acknowledge Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind) for the permit #08-02Rev that makes our research in Texas State Parks possible. And we thank Lisa N. Kinch and Dustin Schaeffer for critical suggestions and corrections to the manuscript.

References

  1. Baillie J., Groombridge B. IUCN, Gland; Switzerland and Cambridge, UK: 1996. 1996 IUCN Red List of Threatened Animals. [Google Scholar]
  2. Benjamini Y., Speed T.P. Summarizing and correcting the GC content bias in high-throughput sequencing. Nucleic Acids Res. 2012;40:e72. doi: 10.1093/nar/gks001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bernt M., Donath A., Juhling F., Externbrink F., Florentz C., Fritzsch G., Putz J., Middendorf M., Stadler P.F. MITOS: improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013;69:313–319. doi: 10.1016/j.ympev.2012.08.023. [DOI] [PubMed] [Google Scholar]
  4. Boore J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27:1767–1780. doi: 10.1093/nar/27.8.1767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. C.A. Bridges . C.A. Bridges; Urbana, IL: 1988. Catalogue of Papilionidae & Pieridae (Lepidoptera: Rhopalocera) [Google Scholar]
  6. Cally S., Lhuillier E., Iribar A., Garzon-Orduna I., Coissac E., Murienne J. Shotgun assembly of the complete mitochondrial genome of the neotropical cracker butterfly Hamadryas epinome. Mitochondrial DNA. 2014:1–3. doi: 10.3109/19401736.2014.971262. [DOI] [PubMed] [Google Scholar]
  7. Cameron S.L. Insect mitochondrial genomics: implications for evolution and phylogeny. Annu. Rev. Entomol. 2014;59:95–117. doi: 10.1146/annurev-ento-011613-162007. [DOI] [PubMed] [Google Scholar]
  8. Cao Y.Q., Ma C., Chen J.Y., Yang D.R. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics. 2012;13:276. doi: 10.1186/1471-2164-13-276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cao T.-W., Wang J.-P., Xuan S.-B., Zhang M., Guo Y.-P., Ma E.-B. Analysis of complete mitochondrial genome of Timelaea maculata (Lepidoptera, Nymphalida) Zool. Syst. 2013;38:468–475. [Google Scholar]
  10. Caterino M.S., Sperling F.A. Papilio phylogeny based on mitochondrial cytochrome oxidase I and II genes. Mol. Phylogenet. Evol. 1999;11:122–137. doi: 10.1006/mpev.1998.0549. [DOI] [PubMed] [Google Scholar]
  11. Chen M., Tian L.L., Shi Q.H., Cao T.W., Hao J.S. Complete mitogenome of the Lesser Purple Emperor Apatura ilia (Lepidoptera: Nymphalidae: Apaturinae) and comparison with other nymphalid butterflies. Dongwuxue Yanjiu. 2012;33:191–201. doi: 10.3724/SP.J.1141.2012.02191. [DOI] [PubMed] [Google Scholar]
  12. Chen Y.-h., Huang D.-y., Wang Y.-l., Zhu C.-d., Hao J.-s. The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species. J. Asia Pac. Entomol. 2014;17:663–671. [Google Scholar]
  13. Chen Y., Gan S., Shao L., Cheng C., Hao J. The complete mitochondrial genome of the Pazala timur (Lepidoptera: Papilionidae: Papilioninae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2014.905843. [DOI] [PubMed] [Google Scholar]
  14. Chen Y., Gan S., Wang Y., Wang Y., Zuo N., Hao J. The complete mitochondrial genome of the Byasa alcinous (Lepidoptera: Papilionidae: Papilioninae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.919472. [DOI] [PubMed] [Google Scholar]
  15. Chevreux B., Wetter T., Suhai S. Computer Science and Biology: Proceedings of the German Conference on Bioinformatics (GCB) 1999. Genome sequence assembly using trace signals and additional sequence information. [Google Scholar]
  16. Clarke C.A., Sheppard P.M. The genetics of the mimetic butterfly Papilio polytes L. Philos. Trans. R. Soc. B. 1972;263:431–458. doi: 10.1098/rstb.1972.0006. [DOI] [PubMed] [Google Scholar]
  17. Condamine F.L., Sperling F.A.H., Wahlberg N., Rasplus J.-Y., Kergoat G.J. What causes latitudinal gradients in species diversity? Evolutionary processes and ecological constraints on swallowtail biodiversity. Ecol. Lett. 2012;15:267–277. doi: 10.1111/j.1461-0248.2011.01737.x. [DOI] [PubMed] [Google Scholar]
  18. Condamine F.L., Sperling F.A.H., Kergoat G.J. Global biogeographical pattern of swallowtail diversification demonstrates alternative colonization routes in the Northern and Southern hemispheres. J. Biogeogr. 2013;40:9–23. [Google Scholar]
  19. Cong Q., Borek D., Otwinowski Z., Grishin Nick V. Tiger swallowtail genome reveals mechanisms for speciation and caterpillar chemical defense. Cell Rep. 2015;10 doi: 10.1016/j.celrep.2015.01.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Darriba D., Taboada G.L., Doallo R., Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat. Methods. 2012;9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Dong Y., Zhu L.X., Wu Y.F., Wu X.B. The complete mitochondrial genome of the Alpine black swallowtail, Papilio maackii (Insecta: Lepidoptera: Papilionidae) Mitochondrial DNA. 2013;24:639–641. doi: 10.3109/19401736.2013.772162. [DOI] [PubMed] [Google Scholar]
  22. Dong Y., Zhu L.X., Ding M.J., Wang J.J., Luo L.G., Liu Y., Ou Y.Y. Complete mitochondrial genome of Papilio syfanius (Lepidoptera: Papilionidae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2014.898278. [DOI] [PubMed] [Google Scholar]
  23. Donoghue M.J., Smith S.A. Patterns in the assembly of temperate forests around the Northern Hemisphere. Philos. Trans. R. Soc. B. 2004;359:1633–1644. doi: 10.1098/rstb.2004.1538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Enghoff H. Historical biogeography of the holarctic: area relationships, ancestral areas, and dispersal of non-marine animals. Cladistics. 1995;11:223–263. [Google Scholar]
  25. Engsontia P., Sangket U., Chotigeat W., Satasook C. Molecular evolution of the odorant and gustatory receptor genes in lepidopteran insects: implications for their adaptation and speciation. J. Mol. Evol. 2014;79:21–39. doi: 10.1007/s00239-014-9633-0. [DOI] [PubMed] [Google Scholar]
  26. Gan, Sun X.Y., Gai Y.H., Hao J.S. The complete mitochondrial genome of Danaus chrysippus (Lepidoptera: Nymphalidae: Danainae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2013.855909. [DOI] [PubMed] [Google Scholar]
  27. Gan S., Chen Y., Zuo N., Zhang W., Hao J. The complete mitochondrial genome of Ideopsis similis (Lepidoptera: Nymphalidae: Danainae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2014.905842. [DOI] [PubMed] [Google Scholar]
  28. Gan S., Chen Y., Zuo N., Xia C., Hao J. The complete mitochondrial genome of Tirumala limniace (Lepidoptera: Nymphalidae: Danainae) Mitochondrial DNA. 2014:1–3. doi: 10.3109/19401736.2014.930839. [DOI] [PubMed] [Google Scholar]
  29. Gong Y.J., Wu Q.L., Wei S.J. The first complete mitogenome for the superfamily Cossoidea of Lepidoptera: the seabuckthorn carpenter moth Eogystia hippophaecolus. Mitochondrial DNA. 2014;25:288–289. doi: 10.3109/19401736.2013.792071. [DOI] [PubMed] [Google Scholar]
  30. Hahn C., Bachmann L., Chevreux B. Reconstructing mitochondrial genomes directly from genomic next-generation sequencing reads—a baiting and iterative mapping approach. Nucleic Acids Res. 2013;41:e129. doi: 10.1093/nar/gkt371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Hancock D.L. Classification of the Papilionidae (Lepidoptera): a phylogenetic approach. Smithersia. 1983;2:1–48. [Google Scholar]
  32. Hao J., Sun Q., Zhao H., Sun X., Gai Y., Yang Q. The complete mitochondrial genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and its phylogenetic implication. Comp. Funct. Genomics. 2012;2012:328049. doi: 10.1155/2012/328049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hao J.J., Wang Y.L., Sun X.Y., Zhang L.L., Hao J.S., Yang Q. The complete mitochondrial genome of Hebomoia glaucippe (Lepidoptera: Pieridae) Mitochondrial DNA. 2013;24:668–670. doi: 10.3109/19401736.2013.773983. [DOI] [PubMed] [Google Scholar]
  34. Hao J., Sun M., Shi Q., Sun X., Shao L., Yang Q. Complete mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and their phylogenetic implications. ISRN Genomics. 2013;2013:14. [Google Scholar]
  35. Hao J.J., Hao J.S., Sun X.Y., Zhang L.L., Yang Q. The complete mitochondrial genomes of the Fenton's wood white, Leptidea morsei, and the lemon emigrant, Catopsilia pomona. J. Insect Sci. 2014;14:130. doi: 10.1093/jis/14.1.130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Heikkila M., Kaila L., Mutanen M., Pena C., Wahlberg N. Cretaceous origin and repeated tertiary diversification of the redefined butterflies. Proc. Biol. Sci. R. Soc. 2012;279:1093–1099. doi: 10.1098/rspb.2011.1430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Heliconius Genome C. Butterfly genome reveals promiscuous exchange of mimicry adaptations among species. Nature. 2012;487:94–98. doi: 10.1038/nature11041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hines H.M., Papa R., Ruiz M., Papanicolaou A., Wang C., Nijhout H.F., McMillan W.O., Reed R.D. Transcriptome analysis reveals novel patterning and pigmentation genes underlying Heliconius butterfly wing pattern variation. BMC Genomics. 2012;13:288. doi: 10.1186/1471-2164-13-288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hong G., Jiang S., Yu M., Yang Y., Li F., Xue F., Wei Z. The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae) Acta Biochim. Biophys. Sin. 2009;41:446–455. doi: 10.1093/abbs/gmp030. [DOI] [PubMed] [Google Scholar]
  40. http://hannonlab.cshl.edu/fastx_toolkit/
  41. Hu J., Zhang D., Hao J., Huang D., Cameron S., Zhu C. The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event. Mol. Biol. Rep. 2010;37:3431–3438. doi: 10.1007/s11033-009-9934-3. [DOI] [PubMed] [Google Scholar]
  42. Huang Z.H., Dai P.F., Zhao G.F. The complete mitochondrial genome of Heliconius pachinus (Insecta: Lepidoptera: Nymphalidae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.945542. [DOI] [PubMed] [Google Scholar]
  43. Huang D., Hao J., Zhang W., Su T., Wang Y., Xu X. The complete mitochondrial genome of Melanargia asiatica (Lepidoptera: Nymphalidae: Satyrinae) Mitochondrial DNA. 2014:1–3. doi: 10.3109/19401736.2014.919452. [DOI] [PubMed] [Google Scholar]
  44. Huelsenbeck J.P., Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  45. Igarashi S. Kodansha; Tokyo: 1979. Papilionidae and Their Early Stages. [Google Scholar]
  46. Ji L.-W., Hao J.-S., Wang Y., Huang D.-Y., Zhao J.-L., Zhu C.-D. The complete mitochondrial genome of the dragon swallowtail, Sericinus montela Gray (Lepidoptera: Papilionidae) and its phylogenetic implication. Acta Entomol. Sin. 2012;55:91–100. [Google Scholar]
  47. Katoh K., Standley D.M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Kelley D.R., Schatz M.C., Salzberg S.L. Quake: quality-aware detection and correction of sequencing errors. Genome Biol. 2010;11:R116. doi: 10.1186/gb-2010-11-11-r116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Kim M.J., Kim I. Complete mitochondrial genome of the Mormon metalmark butterfly, Apodemia mormo (Lepidoptera: Riodinidae) Mitochondrial DNA. 2014:1–3. doi: 10.3109/19401736.2014.915539. [DOI] [PubMed] [Google Scholar]
  50. Kim I., Lee E.M., Seol K.Y., Yun E.Y., Lee Y.B., Hwang J.S., Jin B.R. The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae) Insect Mol. Biol. 2006;15:217–225. doi: 10.1111/j.1365-2583.2006.00630.x. [DOI] [PubMed] [Google Scholar]
  51. Kim M.I., Baek J.Y., Kim M.J., Jeong H.C., Kim K.G., Bae C.H., Han Y.S., Jin B.R., Kim I. Complete nucleotide sequence and organization of the mitogenome of the red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol. Cells. 2009;28:347–363. doi: 10.1007/s10059-009-0129-5. [DOI] [PubMed] [Google Scholar]
  52. Kim M.J., Kim M.J., Wan X.l., Kim K.-G., Hwang J.S., Kim I. Complete nucleotide sequence and organization of the mitogenome of endangered Eumenis autonoe (Lepidoptera: Nymphalidae) Afr. J. Biotechnol. 2010;9:735–754. [Google Scholar]
  53. Kim M.J., Kang A.R., Jeong H.C., Kim K.G., Kim I. Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae) Mol. Phylogenet. Evol. 2011;61:436–445. doi: 10.1016/j.ympev.2011.07.013. [DOI] [PubMed] [Google Scholar]
  54. Kim M.J., Jeong H.C., Kim S.R., Kim I. Complete mitochondrial genome of the nerippe fritillary butterfly, Argynnis nerippe (Lepidoptera: Nymphalidae) Mitochondrial DNA. 2011;22:86–88. doi: 10.3109/19401736.2011.624604. [DOI] [PubMed] [Google Scholar]
  55. Kim M.J., Wang A.R., Park J.S., Kim I. Complete mitochondrial genomes of five skippers (Lepidoptera: Hesperiidae) and phylogenetic reconstruction of Lepidoptera. Gene. 2014;549:97–112. doi: 10.1016/j.gene.2014.07.052. [DOI] [PubMed] [Google Scholar]
  56. Kristensen N.P., Skalski A.W. Handbuch der Zoologie/Handbook of Zoology. Walter de Gruyter GmbH & Co.; Berlin, Germany: 1998. Phylogeny and palaeontology; pp. 7–25. [Google Scholar]
  57. Kristensen N.P., Scoble M.J., Karsholt O. Lepidoptera phylogeny and systematics: the state of inventorying moth and butterfly diversity. Zootaxa. 2007;1668:699–747. [Google Scholar]
  58. Langmead B., Salzberg S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012;9:357–359. doi: 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R., Genome Project Data Processing S. The sequence alignment/map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Lian-Xi X., Peng-Fei L., Jia W., Kai W., Ping Y. The complete mitochondrial genome of the endangered butterfly Luehdorfia taibai Chou (Lepidoptera: Papilionidae) Mitochondrial DNA. 2014;25:122–123. doi: 10.3109/19401736.2013.800506. [DOI] [PubMed] [Google Scholar]
  61. Lu C.-C., Wu L.-W., Jiang G.-F., Deng H.-L., Wang L.-H., Yang P.-S., Hsu Y.-F. Systematic status of Agehana elwesi f. cavaleriei based on morphological and molecular evidence. Zool. Stud. 2009;48:270–279. [Google Scholar]
  62. Lu H.F., Su T.J., Luo A.R., Zhu C.D., Wu C.S. Characterization of the complete mitochondrion genome of diurnal moth Amata emma (Butler) (Lepidoptera: Erebidae) and its phylogenetic implications. PLoS One. 2013;8:e72410. doi: 10.1371/journal.pone.0072410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Mao Z.-H., Hao J.-S., Zhu G.-P., Hu J., Si M.-M., Zhu C.-D. Sequencing and analysis of the complete mitochondrial genome of Pieris rapae Linnaeus (Lepidoptera: Pieridae) Acta Entomol. Sin. 2010;53:1295–1304. [Google Scholar]
  64. Margam V.M., Coates B.S., Hellmich R.L., Agunbiade T., Seufferheld M.J., Sun W., Ba M.N., Sanon A., Binso-Dabire C.L., Baoua I., Ishiyaku M.F., Covas F.G., Srinivasan R., Armstrong J., Murdock L.L., Pittendrigh B.R. Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae) PLoS One. 2011;6:e16444. doi: 10.1371/journal.pone.0016444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Meng Z., Lei C., Chen X., Jiang S. Complete mitochondrial genome sequence of Heliconius melpomene rosina (Insecta: Lepidoptera: Nymphalidae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.987261. [DOI] [PubMed] [Google Scholar]
  66. Moritz C., Dowling T.E., Brown W.M. Evolution of animal mitochondrial-DNA — relevance for population biology and systematics. Annu. Rev. Ecol. Syst. 1987;18:269–292. [Google Scholar]
  67. Mullen S.P. Wing pattern evolution and the origins of mimicry among North American admiral butterflies (Nymphalidae: Limenitis) Mol. Phylogenet. Evol. 2006;39:747–758. doi: 10.1016/j.ympev.2006.01.021. [DOI] [PubMed] [Google Scholar]
  68. Nishikawa H., Iga M., Yamaguchi J., Saito K., Kataoka H., Suzuki Y., Sugano S., Fujiwara H. Molecular basis of wing coloration in a Batesian mimic butterfly, Papilio polytes. Sci. Rep. 2013;3 doi: 10.1038/srep03184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Ojala D., Montoya J., Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981;290:470–474. doi: 10.1038/290470a0. [DOI] [PubMed] [Google Scholar]
  70. Park J.S., Cho Y., Kim M.J., Nam S.-H., Kim I. Description of complete mitochondrial genome of the black-veined white, Aporia crataegi (Lepidoptera: Papilionoidea), and comparison to papilionoid species. J. Asia Pac. Entomol. 2012;15:331–341. [Google Scholar]
  71. Peña C., Nylin S., Freitas A.V.L., Wahlberg N. Biogeographic history of the butterfly subtribe Euptychiina (Lepidoptera, Nymphalidae, Satyrinae) Zool. Scr. 2010;39:243–258. [Google Scholar]
  72. Perna N.T., Kocher T.D. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995;41:353–358. doi: 10.1007/BF00186547. [DOI] [PubMed] [Google Scholar]
  73. Qian Z.Q. The complete mitogenome of the Cydno Longwing Heliconius cydno (Insecta: Lepidoptera: Nymphalidae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.953089. [DOI] [PubMed] [Google Scholar]
  74. Qin F., Jiang G.F., Zhou S.Y. Complete mitochondrial genome of the Teinopalpus aureus guangxiensis (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mitochondrial DNA. 2012;23:123–125. doi: 10.3109/19401736.2011.653805. [DOI] [PubMed] [Google Scholar]
  75. Qin X.M., Guan Q.X., Zeng D.L., Qin F., Li H.M. Complete mitochondrial genome of Kallima inachus (Lepidoptera: Nymphalidae: Nymphalinae): comparison of K. inachus and Argynnis hyperbius. Mitochondrial DNA. 2012;23:318–320. doi: 10.3109/19401736.2012.684093. [DOI] [PubMed] [Google Scholar]
  76. Quinlan A.R., Hall I.M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26:841–842. doi: 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Regier J.C., Mitter C., Zwick A., Bazinet A.L., Cummings M.P., Kawahara A.Y., Sohn J.C., Zwickl D.J., Cho S., Davis D.R., Baixeras J., Brown J., Parr C., Weller S., Lees D.C., Mitter K.T. A large-scale, higher-level, molecular phylogenetic study of the insect order Lepidoptera (moths and butterflies) PLoS One. 2013;8:e58568. doi: 10.1371/journal.pone.0058568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Robinson J.T., Thorvaldsdottir H., Winckler W., Guttman M., Lander E.S., Getz G., Mesirov J.P. Integrative genomics viewer. Nat. Biotechnol. 2011;29:24–26. doi: 10.1038/nbt.1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Salvato P., Simonato M., Battisti A., Negrisolo E. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae) BMC Genomics. 2008;9:331. doi: 10.1186/1471-2164-9-331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Servin-Garciduenas L.E., Martinez-Romero E. Complete mitochondrial genome recovered from the gut metagenome of overwintering monarch butterflies, Danaus plexippus (L.) (Lepidoptera: Nymphalidae, Danainae) Mitochondrial DNA. 2014;25:427–428. doi: 10.3109/19401736.2013.809441. [DOI] [PubMed] [Google Scholar]
  81. Shen Q.Q., Wang L. The complete mitochondrial genome sequence of Heliconius hecale (Insecta: Lepidoptera: Nymphalidae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.945561. [DOI] [PubMed] [Google Scholar]
  82. Shi Q.H., Xia J., Sun X.Y., Hao J.S., Yang Q. Complete mitogenome of the Painted Jezebel, Delias hyparete Linnaeus (Lepidoptera: Pieridae) and its comparison with other butterfly species. Dongwuxue Yanjiu. 2012;33:E111–E120. doi: 10.3724/SP.J.1141.2012.E05-06E111. [DOI] [PubMed] [Google Scholar]
  83. Shi Q., Huang D., Wang Y., Hao J. The complete mitochondrial genome of Blue Pansy, Junonia orithya (Lepidoptera: Nymphalidae: Nymphalinae) Mitochondrial DNA. 2013;26(2):245–246. doi: 10.3109/19401736.2013.823182. [DOI] [PubMed] [Google Scholar]
  84. Shi Q.H., Zhao F., Hao J.S., Yang Q. Complete mitochondrial genome of the common evening brown, Melanitis leda Linnaeus (Lepidoptera: Nymphalidae: Satyrinae) Mitochondrial DNA. 2013;24:492–494. doi: 10.3109/19401736.2013.770501. [DOI] [PubMed] [Google Scholar]
  85. Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006;22:2688–2690. doi: 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
  86. Sun X., Shao L., Peng C., Hao J., Yang Q. The complete mitochondrial genome of Eurema hecabe (Lepidoptera: Pieridae: Coliadinae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2013.855751. [DOI] [PubMed] [Google Scholar]
  87. Surridge A.K., Lopez-Gomollon S., Moxon S., Maroja L.S., Rathjen T., Nadeau N.J., Dalmay T., Jiggins C.D. Characterisation and expression of microRNAs in developing wings of the neotropical butterfly Heliconius melpomene. BMC Genomics. 2011;12:62. doi: 10.1186/1471-2164-12-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Teixeira da Costa L.F. The complete mitochondrial genome of Parage aegeria (Insecta: Lepidoptera: Papilionidae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2014.905853. [DOI] [PubMed] [Google Scholar]
  89. Tian L.L., Sun X.Y., Chen M., Gai Y.H., Hao J.S., Yang Q. Complete mitochondrial genome of the five-dot sergeant Parathyma sulpitia (Nymphalidae: Limenitidinae) and its phylogenetic implications. Dongwuxue Yanjiu. 2012;33:133–143. doi: 10.3724/SP.J.1141.2012.02133. [DOI] [PubMed] [Google Scholar]
  90. Vila R., Bell C.D., Macniven R., Goldman-Huertas B., Ree R.H., Marshall C.R., Bálint Z., Johnson K., Benyamini D., Pierce N.E. Phylogeny and palaeoecology of Polyommatus blue butterflies show Beringia was a climate-regulated gateway to the New World. Proc. R. Soc. Lond. B Biol. Sci. 2011;278(1719):2737–2744. doi: 10.1098/rspb.2010.2213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Wang X.C., Sun X.Y., Sun Q.Q., Zhang D.X., Hu J., Yang Q., Hao J.S. Complete mitochondrial genome of the laced fritillary Argyreus hyperbius (Lepidoptera: Nymphalidae) Dongwuxue Yanjiu. 2011;32:465–475. doi: 10.3724/SP.J.1141.2011.05465. [DOI] [PubMed] [Google Scholar]
  92. Wang J.-P., Nie X.-P., Cao T.-W., Zhang M., Guo Y.-P., Ma E.-B., Zhang X.-N. Analysis of complete mitochondrial genome of Sasakia charonda coreana (Lepidoptera, Nymphalida) Zool. Syst. 2012;37:1–9. [Google Scholar]
  93. Wang K., Hao J., Zhao H. Characterization of complete mitochondrial genome of the skipper butterfly, Celaenorrhinus maculosus (Lepidoptera: Hesperiidae) Mitochondrial DNA. 2013 doi: 10.3109/19401736.2013.840610. [DOI] [PubMed] [Google Scholar]
  94. Wang J.P., Cao T.W., Xuan S.B., Wang H., Zhang M., Ma E. The complete mitochondrial genome of Sasakia funebris (Leech) (Lepidoptera: Nymphalidae) and comparison with other Apaturinae insects. Gene. 2013;526:277–283. doi: 10.1016/j.gene.2013.05.036. [DOI] [PubMed] [Google Scholar]
  95. Wang L., Du X.J., Li X.F. The complete mitogenome of the common Mormon Papilio polytes (Insecta: Lepidoptera: Papilionoidea) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.945550. [DOI] [PubMed] [Google Scholar]
  96. Wang Y., Chen Y., Xia C., Xia X., Chen X., Hao J. The complete mitochondrial genome of Parnassius imperator (Lepidoptera: Papilionidae: Parnassiinae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.971277. [DOI] [PubMed] [Google Scholar]
  97. Wang A.R., Jeong H.C., Han Y.S., Kim I. The complete mitochondrial genome of the mountainous duskywing, Erynnis montanus (Lepidoptera: Hesperiidae): a new gene arrangement in Lepidoptera. Mitochondrial DNA. 2014;25:93–94. doi: 10.3109/19401736.2013.784752. [DOI] [PubMed] [Google Scholar]
  98. Wu L.W., Lin L.H., Lees D.C., Hsu Y.F. Mitogenomic sequences effectively recover relationships within brush-footed butterflies (Lepidoptera: Nymphalidae) BMC Genomics. 2014;15:468. doi: 10.1186/1471-2164-15-468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Xia J., Hu J., Zhu G.-P., Zhu C.-D., Hao J.-S. Sequencing and analysis of the complete mitochondrial genome of Calinaga davidis Oberthur (Lepidoptera: Nymphalidae) Acta Entomol. Sin. 2011;54:555–565. [Google Scholar]
  100. Zakharov E.V., Caterino M.S., Sperling F.A. Molecular phylogeny, historical biogeography, and divergence time estimates for swallowtail butterflies of the genus Papilio (Lepidoptera: Papilionidae) Syst. Biol. 2004;53:193–215. doi: 10.1080/10635150490423403. [DOI] [PubMed] [Google Scholar]
  101. Zhan S., Merlin C., Boore J.L., Reppert S.M. The monarch butterfly genome yields insights into long-distance migration. Cell. 2011;147:1171–1185. doi: 10.1016/j.cell.2011.09.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Zhan S., Zhang W., Niitepold K., Hsu J., Haeger J.F., Zalucki M.P., Altizer S., de Roode J.C., Reppert S.M., Kronforst M.R. The genetics of monarch butterfly migration and warning colouration. Nature. 2014;514:317–321. doi: 10.1038/nature13812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  103. Zhang M., Nie X., Cao T., Wang J., Li T., Zhang X., Guo Y., Ma E., Zhong Y. The complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae) Mol. Biol. Rep. 2012;39:6529–6536. doi: 10.1007/s11033-012-1481-7. [DOI] [PubMed] [Google Scholar]
  104. Zhang W., Kunte K., Kronforst M.R. Genome-wide characterization of adaptation and speciation in tiger swallowtail butterflies using de novo transcriptome assemblies. Genome Biol. Evol. 2013;5:1233–1245. doi: 10.1093/gbe/evt090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  105. Zhang L., Huang D., Sun X., Hao J., Hao J., Peng C., Yang Q. The complete mitochondrial genome of Cupido argiades (Lepidoptera: Lycaenidae) Mitochondrial DNA. 2013;24:475–477. doi: 10.3109/19401736.2013.770495. [DOI] [PubMed] [Google Scholar]
  106. Zhang L.L., Hao J.S., Huang D.Y., Sun X.Y., Hao J.J., Peng C.M., Yang Q. Complete mitochondrial genomes of the bright sunbeam Curetis bulis and the small copper Lycaena phlaeas (Lepidoptera: Lycaenidae) and their phylogenetic implications. Genet. Mol. Res. 2013;12:4434–4445. doi: 10.4238/2013.October.10.9. [DOI] [PubMed] [Google Scholar]
  107. Zhang W., Gan S., Zuo N., Chen C., Wang Y., Hao J. The complete mitochondrial genome of Triphysa phryne (Lepidoptera: Nymphalidae: Satyrinae) Mitochondrial DNA. 2014 doi: 10.3109/19401736.2014.900673. [DOI] [PubMed] [Google Scholar]
  108. Zhang H., Li F., Zhu X., Meng Z. The complete mitochondrial genome of Bombyx mori strain Baiyun (Lepidoptera: Bombycidae) Mitochondrial DNA. 2014:1–2. doi: 10.3109/19401736.2014.958713. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental S1

Multiple alignment of MITObim results.

mmc1.zip (20.2KB, zip)
Supplemental S2

More phylogenetic trees.

mmc2.pdf (6.6MB, pdf)

Articles from Meta Gene are provided here courtesy of Elsevier

RESOURCES