Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2015 Jun 4;81(13):4253–4262. doi: 10.1128/AEM.00377-15

BadR and BadM Proteins Transcriptionally Regulate Two Operons Needed for Anaerobic Benzoate Degradation by Rhodopseudomonas palustris

Hidetada Hirakawa 1,*, Yuko Hirakawa 1,*, E Peter Greenberg 1, Caroline S Harwood 1,
Editor: R E Parales
PMCID: PMC4475878  PMID: 25888170

Abstract

The bacterium Rhodopseudomonas palustris grows with the aromatic acid benzoate and the alicyclic acid cyclohexanecarboxylate (CHC) as sole carbon sources. The enzymatic steps in an oxygen-independent pathway for CHC degradation have been elucidated, but it was unknown how the CHC operon (badHI aliAB badK) encoding the enzymes for CHC degradation was regulated. aliA and aliB encode enzymes for the conversion of CHC to cyclohex-1-enecarboxyl–coenzyme A (CHene-CoA). At this point, the pathway for CHC degradation merges with the pathway for anaerobic benzoate degradation, as CHene-CoA is an intermediate in both degradation pathways. Three enzymes, encoded by badK, badH, and badI, prepare and cleave the alicyclic ring of CHene-CoA to yield pimelyl-CoA. Here, we show that the MarR transcription factor family member, BadR, represses transcription of the CHC operon by binding near the transcription start site of badH. 2-Ketocyclohexane-1-carboxyl–CoA, an intermediate of CHC and benzoate degradation, interacts with BadR to abrogate repression. We also present evidence that the transcription factor BadM binds to the promoter of the badDEFGAB (Bad) operon for the anaerobic conversion of benzoate to CHene-CoA to repress its expression. Contrary to previous reports, BadR does not appear to control expression of the Bad operon. These data enhance our view of the transcriptional regulation of anaerobic benzoate degradation by R. palustris.

INTRODUCTION

Alicyclic compounds occur in nature as functional groups on plant secondary products, components of crude oil and polyketide antibiotics (1). Cyclohexanecarboxylate (CHC) is the most structurally simple of these and is of special interest in the context of the overall metabolism of the phototrophic bacterium Rhodopseudomonas palustris, because its degradation pathway shares reactions in common with anaerobic benzoate degradation. The anaerobic benzoate degradation pathway is the main conduit for aromatic ring reduction and cleavage in R. palustris and other anaerobes. Structurally diverse aromatic compounds, including monomeric constituents of lignin, a major plant polymer, are processed by bacteria through peripheral degradation pathways to form benzoate or benzoyl coenzyme A (benzoyl-CoA) (24). In R. palustris, the benzoate degradation pathway involves a dearomatization of benzoyl-CoA by the oxygen-sensitive enzyme benzoyl-CoA reductase followed by a β-oxidation of the reduced product, cyclohex-1-enecarboxyl–CoA (CHene-CoA). This culminates in a ring cleavage that generates pimelyl-CoA (Fig. 1A) (5, 6). Pimelyl-CoA is further degraded to three acetyl-CoAs and one CO2 (7). The β-oxidation segment of anaerobic benzoate degradation is catalyzed by three oxygen-insensitive enzymes: BadK, BadH, and BadI (Fig. 1A) (6, 8, 9). These are encoded by an operon, which also includes aliA and aliB, two genes that allow R. palustris to metabolize exogenously supplied CHC. aliA encodes CHC-CoA ligase, and aliB encodes a dehydrogenase, which catalyzes the conversion of CHC-CoA to CHene-CoA (10, 11, 12). The badHI aliAB badK (CHC) operon is divergently transcribed from badR, which encodes a predicted MarR family transcription factor (Fig. 1B). The badDEFGBA (Bad) operon, encoding genes for conversion of benzoate to CHene-CoA, lies downstream of badR (Fig. 1B) (13). In order to have a complete picture of how benzoate and CHC degradation pathways may be influenced by shifting environmental conditions in R. palustris, it is important to understand how they are regulated. We have presented genetic evidence that BadR and another transcription factor, named BadM, control the expression of the Bad operon (14, 15). However, in these studies, we did not present in vitro evidence to show direct binding of BadR or BadM to the promoter region of this operon.

FIG 1.

FIG 1

The pathways and genes of benzoate and CHC degradation. (A) The sequence of reactions and proteins required for conversion of benzoate or CHC to the common intermediate CHene-CoA is shown, as are subsequent β-oxidation-like reactions leading to formation of the ring cleavage product, pimelyl-CoA. (B) R. palustris gene cluster that encompasses the CHC and Bad operons and encodes the BadR and BadM transcription factors.

Here, we reexamined the functions of BadR and BadM using gel shift and footprinting assays. We also followed expression of select CHC and Bad operon genes in badR and badM mutants using quantitative real-time PCR (qRT-PCR). We confirmed that BadM binds to the Bad operon promoter region and characterized the BadM binding site. We also determined that BadR binds to the CHC operon promoter region and found that such binding is antagonized by 2-ketocyclohexane-1-carboxyl–CoA, an intermediate of benzoate and CHC degradation. Contrary to a previously published report (14), BadR does not appear to control transcription of the Bad operon.

MATERIALS AND METHODS

Bacterial strains.

The strains used in this work are listed in Table 1. We used the badR mutant strain CGA609, a gentamicin cassette insertion mutant, for the experiments shown in Fig. 5. We also constructed a badR in-frame deletion mutant (strain CGA609a) by sequence overlap extension PCR (16) according to the strategy described previously for R. palustris (17) with primer pairs badR-delta1/badR-delta2 and badR-delta3/badR-delta4 (Table 2). The upstream flanking DNA included ∼400 bp and the first three amino acid codons. The downstream flanking DNA included the last two amino acid codons, the stop codon, and ∼400 bp of DNA. The deletion construct was ligated into BamHI- and XbaI-digested suicide vector pJQ200KS (18) and introduced into R. palustris CGA009. We confirmed the resulting mutant strain using PCR analysis and DNA sequencing.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Relevant genotype/phenotypea Reference or source
Strains
    R. palustris
        CGA009 Wild type 13
        CGA609 badR mutant (badR; Gmr) 14
        CGA609a badR in-frame deletion mutant This work
        CGA131 badM in-frame deletion mutant 15
    E. coli
        Rosetta T7-expressing strain, Cmr Novagen/EMD Bioscience
    P. aeruginosa PAO1-T7 T7-expressing strain 23
Plasmids
    pQF5016b.rpa1794 CouR overexpression vector, Apr 20
    pQF5016b.badR N-terminal His-BadR overexpression vector, Apr This work
    pQF5016b.badM N-terminal His-BadM overexpression vector, Apr This work
    pBBPgdh Expression vector, Gmr 21
    pBBR1MCS-2 Broad-host-range vector, Kmr 22
    pBBR1MCS-2badR BadR expression vector, Kmr This work
a

Gmr, gentamicin resistance; Cmr, chloramphenicol resistance; Apr, ampicillin resistance; Kmr, kanamycin resistance.

FIG 5.

FIG 5

The effect of BadR on the transcription of CHC operon genes. (A) qRT-PCR measurements of badH, aliA, and aliB transcript levels (normalized to the fixJ housekeeping gene) of wild-type and badR mutant cells grown on 10 mM succinate with and without 2.5 mM benzoate. (B) Complementation of a badR mutant phenotype by expression of badR in trans. Transcript levels of badH (normalized to the fixJ housekeeping gene) in wild-type cells and the badR mutant carrying a badR expression vector (pBBR1MCS-2badR) or the native vector (pBBR1MCS-2) are shown. Cells were grown with 10 mM succinate. Data are the averages from two biological replicates. The error bars indicate the range.

TABLE 2.

Primers used in this study

Primer name DNA sequence (5′→3′) Description
pETbadR-F GCCCCATGGCCCATCACCATCACCATCACATGGCGAAGAAACGCGTTGC His-BadR expression
pETbadR-R GCCGGATCCTCATTCCAGATCCGTCGCC His-BadR expression
pBBRbadR-F GCCAAGCTTCCTCGCTCGCTCCCCTTTG BadR expression
pBBRbadR-R CCTCTAGAGTCATTCCAGATCCGTCGC BadR expression
badM-F GCCCCATGGCCCCGATGCGGCTGCAGAAATC His-BadM expression
badM-R GCCGGATCCCTAGTGATGGTGATGGTGATGAGCCCGTCCGGCGGAGGA His-BadM expression
badH-R-PF CTTGTTCTGCAGCCGCGCC Gel shift and footprinting assay
badH-R-PR AACGCGTTTCTTCGCCATCATC Gel shift and footprinting assay
badR-C-PF GCGCTGCGGGCGAAACGG Gel shift assay
badR-C-PR ATCGCCGACCTCGATCACC Gel shift assay
badC-D-PF AAGATCGCGATCGATATCTGAG Gel shift assay
badC-D-PR GTGATGCGGCCTGTCGAGC Gel shift assay
badG-A-PF GCTTGCCGACATGGCCCAC Gel shift assay
badG-A-PR GCGGCGTGACCGCTGCGG Gel shift assay
rhlA-PF GCCTGAAGGGGTACGCATC Gel shift assay
rhlA-PR GCCGCATTTCACACCTCCC Gel shift assay
badH-S1-6FAM-R TCCGCCGATGCCGCCTCCG S1 nuclease assay and BadR footprinting
badH -S1-F CAGATCGCCGACGCTCATACC S1 nuclease assay
badC-D-6-FAM GGTGAAACTGAGATCGGAGAACA BadM footprinting
badD-FqPCR ACCACGGCGGACATCATC Quantitative PCR
badD-RqPCR GGTGAAACTGAGATCGGAGAACA Quantitative PCR
badH–FqPCR GCAGGAAGGCGCCAAGA Quantitative PCR
badH-RqPCR CGACCTTCTCGGCAGCAT Quantitative PCR
aliA-FqPCR CCGAAAGGCGTGATGCA Quantitative PCR
aliA-RqPCR CGCGTAGGGCACGATATTG Quantitative PCR
aliB-FqPCR GGCGTGATCCACGAAGAGAT Quantitative PCR
aliB-RqPCR GTTCAGCGAAGCGAGCAGAT Quantitative PCR
fixJ-FqPCR GCGATGCGGGAGTCGAT Quantitative PCR
fixJ-RqPCR TGTCTGCGCGGATTCGTA Quantitative PCR
badR-delta1 GCCGGATCCCAGCCGGCGTTGTTGACCAG badR in-frame deletion
badR-delta2 GCGCCTTGACCAAAGTCATTCCAGCGCCATCATCAACCATCTTG badR in-frame deletion
badR-delta3 GCGTCAAGATGGTTGATGATGGCGCTGGAATGACTTTGGTCAAG badR in-frame deletion
badR-delta4 CCTCTAGAAGGCTCATCTTGGCGCACAG badR in-frame deletion

Culture conditions.

All R. palustris strains were grown photoheterotrophically in mineral medium (PM) supplemented with an appropriate carbon source (succinate, 10 mM; benzoate, cyclohexanecarboxylate, cyclohex-1-ene-1-carboxylate, 2-hydroxycyclohexane-1-carboxylate or 2-ketocyclohexane-1-carboxylate, 2.5 mM) as described previously (19). Escherichia coli and Pseudomonas aeruginosa were grown in Luria broth (LB). Antibiotics were added to growth media at the following concentrations (per milliliter): 100 μg gentamicin and 100 μg kanamycin for R. palustris, 150 μg ampicillin and 15 μg chloramphenicol for E. coli, and 300 μg carbenicillin for P. aeruginosa.

Plasmids.

Primer sequences are given in Table 2. To construct the N-terminal His6-tagged BadR overexpression plasmid pQF5016b.badR, badR was PCR amplified from genomic DNA using primers pETbadR-F and pETbadR-R and cloned into NcoI-BamHI-digested pQF5016b.rpa1794 plasmid (20). To construct pBBR1MCS-2badR for BadR expression in R. palustris, the badR gene was PCR amplified with pBBRbadR-F and pBBRbadR-R primers and cloned into HindIII-XbaI-digested pBBPgdh (21). Next, badR together with the gdh (glyceraldehyde-3-phosphase dehydrogenase) promoter was cut out by KpnI-XbaI digestion and ligated into pBBR1MCS-2 (22). The C-terminal His6-tagged BadM expression plasmid pQF5016b.badM was constructed by PCR amplification of badM from genomic DNA using primers badM-F and badM-R, followed by ligation into NcoI-BamHI-digested pQF5016b.rpa1794 plasmid (20). The plasmid constructions were confirmed by DNA sequencing.

Protein synthesis and purification.

N-terminal hexahistidine-tagged BadR was synthesized and purified from E. coli Rosetta (Novagen/EMD Biosciences, Philadelphia, PA). BadM was expressed in and purified from P. aeruginosa strain PAO1-T7 (23). Bacteria containing pQF5016b.badR or pQF5016b.badM were grown at 37°C to an optical density at 600 nm (OD600) of 0.4 in LB, at which point protein synthesis was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) (0.5 mM), and culture growth was continued at 37°C for another 3 h. Cells were harvested and stored at −80°C overnight. Cell pellets were suspended in buffer (20 mM Tris, pH 7.9), 100 mM NaCl, and 10% glycerol) and lysed by sonication. The lysate was centrifuged, and the resulting supernatant was mixed with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Valencia, CA) for 1 h. The agarose was washed with increasing amounts of imidazole (20, 50, and 100 mM), and the His-tagged fusion protein was subsequently eluted with 200 and 500 mM imidazole. Purified BadR was desalted with HiTrap desalting columns (GE Healthcare, Pittsburgh, PA), eluted with 20 mM Tris (pH 7.5), 50 mM KCl, 1 mM dithiothreitol, and 10% glycerol, and stored at −80°C. Purified His-tagged BadM was quite unstable. Following elution with imidazole, it was diluted into buffer consisting of 20 mM Tris (pH 7.5), 50 mM KCl, 1 mM dithiothreitol, and 8% glycerol to a concentration of 10 nmol/ml and stored at 4°C. Purified His-BadM protein was used in assays within 2 days. BadR and BadM proteins were >95% pure, as estimated by SDS-PAGE electrophoresis and Coomassie brilliant blue staining.

RNA extraction and RT-PCR.

RNA extraction and RT-PCR analyses were performed according to previously published protocols (17, 24). Briefly, R. palustris cultures were grown to mid-logarithmic phase in PM-succinate and then diluted to an OD660 of 0.03 in fresh PM containing 10 mM succinate and grown to an OD660 of 0.1, at which point 2.5 mM benzoate and 10 mM sodium bicarbonate were added. RNA was extracted after an additional 5 h of growth and purified using the RNeasy minikit (Qiagen, Valencia, CA). Real-time PCRs included 1 ng cDNA and 200 nM primers in SYBR green PCR amplification master mix (Applied Biosystems, Foster City, CA). Genomic DNA was used as a standard, and fixJ (rpa4248) (17) was used as an internal control.

Electrophoretic mobility gel shift assays.

For BadR and BadM gel shift assays, we used DNA fragments that included the badH-badR (164 bp), badR-badC (168 bp), badC-badD (212 bp), or badG-badA (169 bp) intergenic region as probes. As a nonspecific probe, we used a 164-bp DNA fragment amplified from the rhlA gene in P. aeruginosa. The probe DNA (0.30 pmol) was mixed with protein in a 10-μl reaction mixture containing 20 mM Tris (pH 7.5), 50 mM KCl, 1 mM dithiothreitol, and 8% glycerol. After incubation for 25 min at room temperature, samples were electrophoresed on a 5% nondenaturing acrylamide Tris-glycine-EDTA gel in Tris-glycine-EDTA buffer at 4°C. The gel was soaked in 10,000-fold-diluted SYBR green I nucleic acid stain (Lonza, Walkersville, MD), and DNA was visualized at 300 nm.

DNase I footprinting analysis.

DNase I footprint analysis was performed using a previously described nonradiochemical capillary electrophoresis method (25). For BadR footprinting, a 6-carboxyfluorescein (FAM)-labeled (5′), 164-bp DNA fragment (starting 21 bp inside the badH coding region and ending 143 bp upstream of the badH start codon) was generated by PCR amplification. The DNA fragment (0.45 pmol) was mixed with purified BadR (0 to 24 pmol) in a 50-μl reaction mixture containing the same buffer as described above. After incubation for 25 min at room temperature, DNase I (0.3 units; Promega Corp., Madison, WI) was added. After 60 s at room temperature, samples were purified. Prepared samples were electrophoresed using an ABI Prism genetic analyzer equipped with an ABI Prism GeneScan, and fragment sizes were determined with ABI Peak Scanner software. For BadM footprinting, a FAM-labeled (5′), 269-bp DNA fragment (starting at 191 bp upstream of the badD start codon and ending 78 bp inside the badD coding region) was generated by PCR amplification. The DNA fragment (0.45 pmol) was mixed with purified BadM (0 to 24 pmol) and analyzed as described above for the BadR samples.

S1 nuclease protection assays.

The S1 nuclease protection assay was performed as previously described (26). The probe was generated by PCR amplification with genomic DNA, denatured by heating for 10 min at 95°C, and immediately chilled. Total RNA (12 μg) from logarithmic phase cultures grown with succinate with or without 2.5 mM benzoate was hybridized with 0.1 pmol FAM-labeled probe in hybridization buffer (38 mM HEPES [pH 7.0], 0.3 M NaCl, 1 mM EDTA, and 0.01% Triton X-100) for 16 h at 55°C. Hybridization products were digested for 30 min at 37°C using S1 nuclease (100 units; Promega Corp., Madison, WI) and purified for GeneScan sequencing analysis.

Chemical reagents and syntheses.

Benzoic acid was purchased from Fisher Scientific (Pittsburgh, PA), cyclohexanecarboxylic acid and 1-cyclohexene-1-carboxylic acid from Acros Organics (Fisher Scientific, Pittsburgh, PA), and pimelic acid and acetyl-CoA from Sigma-Aldrich (St. Louis, MO). 2-Hydroxycyclohexane-1-carboxylic acid and 2-ketocyclohexane-1-carboxylic acid were chemically synthesized from ethyl-2-ketocyclohexane carboxylate (Acros Organics brand; Fisher Scientific, Pittsburgh, PA). To synthesize 2-hydroxycyclohexane-1-carboxylic acid, 6 mmol of ethyl-2-ketocyclohexane carboxylate was stirred with 9 mmol of sodium borohydride in ethanol for 1 h at room temperature to produce ethyl-2-hydroxycyclohexane carboxylate. The ethyl ester product was then hydrolyzed in 5% of NaOH solution at room temperature. When the precipitate was completely dissolved, the solution was extracted with diethyl ether to remove unreacted ester compounds, and the aqueous layer was acidified with concentrated HCl to pH 2 to 3 and then extracted with diethyl ether. The resulting diethyl ether extract was evaporated under a stream of nitrogen gas. To synthesize 2-ketocyclohexane-1-carboxylic acid, ethyl-2-ketocyclohexane carboxylate was hydrolyzed in 5% of NaOH solution at room temperature to form 2-ketocyclohexane-1-carboxylic acid, and the reaction product was extracted with diethyl ether in the same way as 2-hydroxycyclohexane-1-carboxylic acid. The CoA thioester of 2-ketocyclohexane-1-carboxylic acid (2-ketocyclohexane-1-carboxyl–CoA) was synthesized by a CoA-coupling reaction with benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP) as previously described (27). 2-Ketocyclohexane-1-carboxylic acid (70.4 μmol) was stirred with 32.5 μmol of coenzyme A sodium salt (Sigma-Aldrich, St. Louis, MO), 52.5 μmol of PyBOP (Novabiochem/EMD Biosciences, Philadelphia, PA), and 145 μmol of potassium carbonate in 50% water solution of tetrahydrofuran for 15 min on ice and then for 2 h at room temperature. The reaction mixture was separated by silica gel thin-layer chromatography with chloroform-methanol (4/1 [vol/vol]) as the solvent, and a spot corresponding to the resulting CoA product was scraped from the silica gel surface and collected in a tube. The product was eluted with chloroform-methanol (2/1 [vol/vol]) and filtered to remove any remaining silica gel. The solvent was completely evaporated under a stream of nitrogen gas. We confirmed the synthesis of expected products using electrospray ionization-time of flight-mass spectrometry (ESI-TOF-MS). We observed a predominant peak from each synthesized compound at molecular sizes corresponding to m/z 145 (M+H) for 2-hydroxycyclohexane-1-carboxylic acid, m/z 143 (M+H) for 2-ketocyclohexane-1-carboxylic acid, and m/z 890 (M−H) for 2-ketocyclohexane-1-carboxyl–CoA.

RESULTS

BadM binds to the Bad operon promoter.

In gel shift experiments, we found that purified His-tagged BadM retarded the electrophoretic mobility of a DNA fragment encompassing the badC-badD intergenic region, which includes the Bad operon promoter. BadM did not bind to a DNA fragment covering the badH-badR intergenic region, expected to encompass the CHC promoter (Fig. 2). Nor did it show significant binding to the badR-badC or badG-badA intergenic regions (Fig. 2). DNase footprinting revealed a BadM binding site overlapping the previously determined transcription start site of badD, the first gene in the Bad operon (Fig. 3A) (6). This site also overlaps the predicted −10 region of the Bad operon promoter (Fig. 3B). We confirmed by quantitative real-time PCR (qRT-PCR) that wild-type cells grown with succinate had very low levels of badD transcription, whereas levels of badD transcription in a badM mutant approached those of wild-type cells grown with benzoate (Fig. 4A). This confirmed our previous conclusion that BadM is a transcription factor that represses expression of the Bad operon (15). The expression of badH, a CHC operon gene, was not derepressed in a badM mutant background (Fig. 4B). We were unable to show that benzoate or benzoyl-CoA interacts with BadM in vitro in electrophoretic motility shift assays. However, growth with benzoate induced expression of badD, as measured by qRT-PCR. Expression levels of badD were 3-fold higher in wild-type cells grown with benzoate than in cells grown with 4-hydroxybenzoate (Fig. 4C). These in vivo data suggest that benzoate or benzoyl-CoA is the effector for BadM. Growth with CHC or CHene did not induce badD expression.

FIG 2.

FIG 2

Gel shift assay showing binding of BadM to selected intergenic regions near or in the CHC and Bad operons. BadM (0, 4, or 8 pmol) was added to reaction mixtures containing 0.3 pmol of probe DNA, and reaction mixtures were separated on polyacrylamide gels. This experiment was repeated three times with the same result.

FIG 3.

FIG 3

Identification of the BadM binding site in the badD promoter region by DNase I footprinting. (A) A 269-bp FAM-labeled DNA fragment (0.45 pmol) was incubated in the presence or absence of BadM (0, 3, 6, or 24 pmol) and then subjected to DNase I digestion. The fluorescence intensities of the DNA fragments (y axis) are plotted relative to their size (x axis). One region, corresponding to 141 to 163 bp relative to the FAM probe, was protected from DNase I digestion in the presence of BadM (dashed rectangle). This experiment was repeated twice, with the same result. (B) Diagram and sequence of the badC-badD intergenic region. The BadM binding site is outlined. The transcription start site of the badD gene is indicated by an arrow. The badC and badD translational stop and start codons are indicated, as is the −10 region of the badD promoter.

FIG 4.

FIG 4

Transcript levels of badD in the wild-type and badM mutant cells. (A) qRT-PCR measurement of badD transcripts (normalized to the fixJ housekeeping gene) of the wild type and badM mutant grown anaerobically with 10 mM succinate with and without 2.5 mM benzoate. (B) badH transcript levels of the wild type and badM mutant grown anaerobically with 10 mM succinate with and without 2.5 mM benzoate. (C) badD transcript levels in wild-type cells grown on various carbon sources, as indicated. Data are the means from two biological replicates. The error bars indicate the ranges.

BadR represses expression of the CHC operon.

Consistent with a role for BadR as a repressor of CHC operon transcription, a badR in-frame deletion mutant that we constructed grew at the same rate as the wild-type parent with benzoate as the sole carbon source (doubling time of 8.7 h for the wild type versus 9.8 h for the badR mutant). When we measured badH, aliB, and aliA transcript levels by qRT-PCR analysis, we found that wild-type cells grown with benzoate and succinate expressed these genes at high levels relative to those of cells grown with succinate alone (Fig. 5A). We also found that levels of these transcripts were constitutively high in badR mutant cells grown on succinate alone. Expression of badR from a plasmid in trans in the badR mutant grown with succinate resulted in much lower levels of badH transcription (Fig. 5B). These results suggest that BadR functions as a repressor of CHC operon expression.

His-tagged BadR binds to the badH-badR intergenic region.

To determine if BadR could bind to DNA directly and specifically, we tested the ability of BadR to retard the migration through polyacrylamide gels of DNA fragments that encompassed the badH-badR, badR-badC, badC-badD, and badG-badA intergenic regions (Fig. 1B). As shown in Fig. 6, purified His-tagged BadR altered the electrophoretic mobility of the badH-badR intergenic DNA only.

FIG 6.

FIG 6

Gel shift assay showing binding of BadR to the badH-badR intergenic region. BadR protein (0, 0.5, 1, 2, 4, or 8 pmol) was added to reaction mixtures containing 0.3 pmol of DNA probe, and the reaction mixtures were separated on polyacrylamide gels. DNA upstream of rhlA from P. aeruginosa was used as the nonbinding control. This experiment was repeated three times with the same result.

Identification of the BadR DNA binding site.

To characterize the BadR binding site, we determined the transcription start site of the badH gene by S1 nuclease mapping. A badH transcript was detected in total RNA extracted from the wild-type cells grown with benzoate plus succinate but not on succinate alone. Consistent with results shown in Fig. 5, there was a badH transcript in badR mutant cells grown with succinate alone (Fig. 7A). The badH transcription start site mapped to a site 78 bp upstream of its translational start site. Subsequent footprinting analysis showed that an 18-bp region upstream of badH was protected from DNase I digestion by BadR (Fig. 7B). The protected BadR binding site includes an inverted repeat sequence (underlined) that is separated by a 2-bp spacer (lowercase) (CAATacATTG). This site covers the badH transcription start site (Fig. 7C). The CAATacATTG inverted-repeat sequence is also located between the −10 and −35 elements of the previously determined badR promoter (14). These results suggest that BadR represses its own transcription as well as transcription of the CHC operon by blocking access of the RNA polymerase core to both the badR and the badH promoters.

FIG 7.

FIG 7

Identification of the BadR binding site in the badH and badR promoters. (A) The transcription start site of badH as determined by S1 nuclease analysis of the badH transcript from wild-type and badR mutant R. palustris cells grown in PM-succinate with or without benzoate. (B) Identification of a BadR binding site by DNase I footprinting. A 164-bp, FAM-labeled DNA fragment (0.45 pmol) was incubated in the presence or absence of BadR (0, 3, 6, or 24 pmol) and then subjected to DNase I digestion. The fluorescence intensities of the DNA fragments (y axis) are plotted relative to their size (x axis). One region, corresponding to 86 to 103 bp relative to the FAM probe, was protected from DNase I digestion in the presence of 3 pmol BadR (dashed rectangle). (C) Sequence of the badH-badR intergenic region. The BadR binding site is outlined. The converging bold arrows indicate an inverted repeat sequence. The transcriptional start sites are indicated by arrows. The badR and badH translational start codon and predicted −10 and −35 boxes for badR transcription are underlined. The experiments depicted in panels A and B were repeated twice with the same results.

BadR binds 2-ketocyclohexane-1-carboxyl–CoA.

Generally, MarR family proteins bind to target DNA in a ligand-free form to repress gene expression, and DNA binding is antagonized upon ligand binding (28). To identify a BadR-specific ligand, we used qRT-PCR to determine the influence of various growth substrates on expression of badH. We found that badH was expressed when wild-type R. palustris was grown on benzoate, cyclohexanecarboxylate, cyclohex-1-ene-1-carboxylate, 2-hydroxycyclohexane-1-carboxylate, or 2-ketocyclohexane-1-carboxylate as the sole carbon source (not shown). However, growth on pimelate did not induce badH expression. These results led us to test whether 2-ketocyclohexane-1-carboxyl–CoA could antagonize the binding of BadR to its target DNA in gel shift assays. Indeed, we found that 2-ketocyclohexane-1-carboxyl–CoA at a concentration of 40 nmol abolished the ability of BadR to retard the migration of badH promoter DNA through polyacrylamide gels (Fig. 8). In contrast, benzoate, benzoyl-CoA, and acetyl-CoA did not alter the electrophoretic mobility of BadR in gel shift assays. These results indicate 2-ketocyclohexane-1-carboxyl–CoA is an effector that binds to BadR to abolish its activity as a repressor of CHC operon transcription.

FIG 8.

FIG 8

Gel shift assay showing the inhibitory effect of 2-ketocyclohexane-1-carboxyl–CoA on BadR binding to the badH and badR promoters. BadR protein (8 pmol) was incubated with 0.3 pmol of badH-badR promoter DNA in the presence of synthesized 2-ketocyclohexane-1-carboxyl–CoA or acetyl-CoA, and reaction mixtures were separated on polyacrylamide gels. This experiment was repeated three times with the same result.

DISCUSSION

Our work lends clarity to how anaerobic benzoate degradation is regulated in R. palustris. The enzymes required for conversion of benzoate to the ring cleavage product pimelyl-CoA are encoded in two operons. The CHC operon is controlled by the transcription factor BadR, and the Bad operon is controlled by the transcription factor BadM (Fig. 1B). All the genes for CHC degradation, a subset of which are needed for benzoate degradation, are in the CHC operon.

We note that the transcript levels of badD in a badM mutant were about 2.5 times lower than those of the wild-type strain grown with benzoate (Fig. 4A). This raises the possibility that additional regulatory factors may control the Bad operon in addition to the repressor protein BadM. From previous work, we know that expression of the Bad operon is also regulated by AadR, a homologue of the E. coli Fnr protein, which like Fnr controls gene expression in response to anaerobiosis (14, 17, 29). In addition, the activities of BadA and AliA, the two enzymes that catalyze benzoyl-CoA and CHC-CoA synthesis, are downregulated posttranslationally by N-lysine acetylation (30). This may be a mechanism for the end product of benzoate/CHC degradation, acetyl-CoA, to feedback inhibit the activities of these degradation pathways.

Our in vivo and in vitro data show that BadR binds 2-ketocyclohexanecarboxyl–CoA to derepress transcription of the CHC operon in R. palustris. We also provided an in vitro characterization of BadM, a member of the BadM/Rrf2 family of transcription factors that acts as a repressor to control the expression of the Bad operon (15). Purified BadM was quite unstable, but we were able to identify a binding site for this protein in the Bad operon promoter by DNase footprinting experiments. This information, though limited, may be useful in future studies of this understudied family of transcription factors.

We were unable to confirm previous work from our laboratory suggesting that BadR positively regulates Bad operon expression (14). We had worked with a badR mutant created by insertion of a gentamicin cassette. This mutant grew slowly on benzoate, and the expression of a badE-lacZ transcriptional fusion was attenuated in the mutant. We interpreted these phenotypes to suggest that BadR was an activator of Bad operon expression. A badR in-frame deletion that we constructed as part of this study grew at a wild-type rate on benzoate. Thus, we think that our original observations may have been due to downstream effects of the gentamicin cassette insertion in badR on Bad operon expression that were unrelated to BadR function.

BadR is a member of MarR family of bacterial regulatory proteins. Although MarR proteins were originally described as regulators for multidrug and stress resistance genes, e.g., MarR for marAB in E. coli (31) and MexR for mexAB in P. aeruginosa (32), there are also MarR regulators that control aromatic compound metabolism (3337). In general, the ligands for these proteins are ∼100-Da-sized small molecules like protocatechuate and 4-hydroxybenzoic acid, but recently a number of studies showed that there are MarR members which bind CoA-thioesterified phenyl propanoids, including p-coumaroyl–CoA for CouR from R. palustris (20, 38, 39). We show that BadR binds a nonphenolic CoA-thioesterified compound. Although CouR and BadR share low amino acid sequence identity/similarity (20%/34%), a structural comparison of BadR with CouR would be useful for identifying amino acid residues that may interact with the CoA moiety in these proteins.

ACKNOWLEDGMENTS

This study was funded by the U.S. Army Research Office (grant W911NF-09-1-0350). Hidetada Hirakawa received funding from the Japan Society for the Promotion of Science (JSPS), the Uehara Memorial Foundation, and the Cell Science Research Foundation.

We thank Christopher S. Neumann for helping with chemical syntheses of 2-hydroxycyclohexane-1-carboxylic acid, 2-oxocyclohexane-1-carboxylic acid, and 2-ketocyclohexane-1-carboxyl–CoA.

REFERENCES

  • 1.Kung JW, Meier A-K, Mergelsberg M, Boll M. 2014. Enzymes involved in a novel anaerobic cyclohexane carboxylic acid degradation pathway. J Bacteriol 196:3667–3674. doi: 10.1128/JB.02071-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pan C, Oda Y, Lankford PK, Zhang B, Samatova NF, Pelletier DA, Harwood CS, Hettich RL. 2008. Characterization of anaerobic catabolism of p-coumarate in Rhodopseudomonas palustris by integrating transcriptomics and quantitative proteomics. Mol Cell Proteomics 7:938–948. doi: 10.1074/mcp.M700147-MCP200. [DOI] [PubMed] [Google Scholar]
  • 3.Fuchs G, Boll M, Heider J. 2011. Microbial degradation of aromatic compounds—from one strategy to four. Nat Rev Microbiol 9:803–816. doi: 10.1038/nrmicro2652. [DOI] [PubMed] [Google Scholar]
  • 4.Gibson J, Harwood CS. 2002. Metabolic diversity in aromatic compound utilization by anaerobic microbes. Annu Rev Microbiol 56:345–369. doi: 10.1146/annurev.micro.56.012302.160749. [DOI] [PubMed] [Google Scholar]
  • 5.Harwood CS, Fuchs G, Burchhardt G, Herrmann H. 1999. Anaerobic metabolism of aromatic compounds via the benzoyl-CoA pathway. FEMS Microbiol Rev 22:439–458. [Google Scholar]
  • 6.Egland PG, Pelletier DA, Dispensa M, Gibson J, Harwood CS. 1997. A cluster of bacterial genes for anaerobic benzene ring biodegradation. Proc Natl Acad Sci U S A 94:6484–6489. doi: 10.1073/pnas.94.12.6484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Harrison FH, Harwood CS. 2005. The pimFABCDE operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiology 151:727–736. doi: 10.1099/mic.0.27731-0. [DOI] [PubMed] [Google Scholar]
  • 8.Pelletier DA, Harwood CS. 2000. 2-Hydroxycyclohexanecarboxyl coenzyme A dehydrogenase, an enzyme characteristic of the anaerobic benzoate degradation pathway used by Rhodopseudomonas palustris. J Bacteriol 182:2753–2760. doi: 10.1128/JB.182.10.2753-2760.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pelletier DA, Harwood CS. 1998. 2-Ketocyclohexanecarboxyl coenzyme A hydrolase, the ring cleavage enzyme required for anaerobic benzoate degradation by Rhodopseudomonas palustris. J Bacteriol 180:2330–2336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Harwood CS. 2009. Degradation of aromatic compounds by purple nonsulfur bacteria, p 577–594. In Hunter CN, Daldal F, Thurnauer MC, Beatty JT (ed), The purple phototrophic bacteria. Springer Netherlands, Dordrecht, Netherlands. [Google Scholar]
  • 11.Küver J, Xu Y, Gibson J. 1995. Metabolism of cyclohexane carboxylic acid by the photosynthetic bacterium Rhodopseudomonas palustris. Arch Microbiol 164:337–345. doi: 10.1007/BF02529980. [DOI] [PubMed] [Google Scholar]
  • 12.Samanta SK, Harwood CS. 2005. Use of the Rhodopseudomonas palustris genome sequence to identify a single amino acid that contributes to the activity of a coenzyme A ligase with chlorinated substrates. Mol Microbiol 55:1151–1159. doi: 10.1111/j.1365-2958.2004.04452.x. [DOI] [PubMed] [Google Scholar]
  • 13.Larimer FW, Chain P, Hauser L, Lamerdin J, Malfatti S, Do L, Land ML, Pelletier DA, Beatty JT, Lang AS, Tabita FR, Gibson JL, Hanson TE, Bobst C, Torres JLTY, Peres C, Harrison FH, Gibson J, Harwood CS. 2004. Complete genome sequence of the metabolically versatile photosynthetic bacterium Rhodopseudomonas palustris. Nat Biotechnol 22:55–61. doi: 10.1038/nbt923. [DOI] [PubMed] [Google Scholar]
  • 14.Egland PG, Harwood CS. 1999. BadR, a new MarR family member, regulates anaerobic benzoate degradation by Rhodopseudomonas palustris in concert with AadR, an Fnr family member. J Bacteriol 181:2102–2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Peres CM, Harwood CS. 2006. BadM is a transcriptional repressor and one of three regulators that control benzoyl coenzyme A reductase gene expression in Rhodopseudomonas palustris. J Bacteriol 188:8662–8665. doi: 10.1128/JB.01312-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Horton RM, Ho SN, Pullen JK, Hunt HD, Cai Z, Pease LR. 1993. Gene splicing by overlap extension. Methods Enzymol 217:270–279. doi: 10.1016/0076-6879(93)17067-F. [DOI] [PubMed] [Google Scholar]
  • 17.Rey FE, Harwood CS. 2010. FixK, a global regulator of microaerobic growth, controls photosynthesis in Rhodopseudomonas palustris. Mol Microbiol 75:1007–1020. doi: 10.1111/j.1365-2958.2009.07037.x. [DOI] [PubMed] [Google Scholar]
  • 18.Quandt J, Hynes MF. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:15–21. doi: 10.1016/0378-1119(93)90611-6. [DOI] [PubMed] [Google Scholar]
  • 19.Kim MK, Harwood CS. 1991. Regulation of benzoate-CoA ligase in Rhodopseudomonas palustris. FEMS Microbiol Lett 83:199–204. doi: 10.1111/j.1574-6968.1991.tb04440.x-i1. [DOI] [Google Scholar]
  • 20.Hirakawa H, Schaefer AL, Greenberg EP, Harwood CS. 2012. Anaerobic p-coumarate degradation by Rhodopseudomonas palustris and identification of CouR, a MarR repressor protein that binds p-coumaroyl coenzyme A. J Bacteriol 194:1960–1967. doi: 10.1128/JB.06817-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.McKinlay JB, Harwood CS. 2010. Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria. Proc Natl Acad Sci U S A 107:11669–11675. doi: 10.1073/pnas.1006175107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kovach ME, Phillips RW, Elzer PH, Roop RM, Peterson KM. 1994. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16:800–802. [PubMed] [Google Scholar]
  • 23.Hoang TT, Kutchma AJ, Becher A, Schweizer HP. 2000. Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains. Plasmid 43:59–72. doi: 10.1006/plas.1999.1441. [DOI] [PubMed] [Google Scholar]
  • 24.Oda Y, Samanta SK, Rey FE, Wu L, Liu X, Yan T, Zhou J, Harwood CS. 2005. Functional genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium Rhodopseudomonas palustris. J Bacteriol 187:7784–7794. doi: 10.1128/JB.187.22.7784-7794.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wilson DO, Johnson P, McCord BR. 2001. Nonradiochemical DNase I footprinting by capillary electrophoresis. Electrophoresis 22:1979–1986. doi: 10.1002/1522-2683(200106)22:10<1979::AID-ELPS1979>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
  • 26.Hirakawa H, Oda Y, Phattarasukol S, Armour CD, Castle JC, Raymond CK, Lappala CR, Schaefer AL, Harwood CS, Greenberg EP. 2011. Activity of the Rhodopseudomonas palustris p-coumaroyl-homoserine lactone-responsive transcription factor RpaR. J Bacteriol 193:2598–2607. doi: 10.1128/JB.01479-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Belshaw PJ, Walsh CT, Stachelhaus T. 1999. Aminoacyl-CoAs as probes of condensation domain selectivity in nonribosomal peptide synthesis. Science 284:486–489. doi: 10.1126/science.284.5413.486. [DOI] [PubMed] [Google Scholar]
  • 28.Wilkinson SP, Grove A. 2006. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr Issues Mol Biol 8:51–62. [PubMed] [Google Scholar]
  • 29.Dispensa M, Thomas CT, Kim MK, Perrotta JA, Gibson J, Harwood CS. 1992. Anaerobic growth of Rhodopseudomonas palustris on 4-hydroxybenzoate is dependent on AadR, a member of the cyclic AMP receptor protein family of transcriptional regulators. J Bacteriol 174:5803–5813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Crosby HA, Heiniger EK, Harwood CS, Escalante-Semerena JC. 2010. Reversible N epsilon-lysine acetylation regulates the activity of acyl-CoA synthetases involved in anaerobic benzoate catabolism in Rhodopseudomonas palustris. Mol Microbiol 76:874–888. doi: 10.1111/j.1365-2958.2010.07127.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Martin RG, Rosner JL. 1995. Binding of purified multiple antibiotic-resistance repressor protein (MarR) to mar operator sequences. Proc Natl Acad Sci U S A 92:5456–5460. doi: 10.1073/pnas.92.12.5456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Evans K, Adewoye L, Poole K. 2001. MexR repressor of the mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa: identification of MexR binding sites in the mexA-mexR intergenic region. J Bacteriol 183:807–812. doi: 10.1128/JB.183.3.807-812.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Davis JR, Sello JK. 2009. Regulation of genes in Streptomyces bacteria required for catabolism of lignin-derived aromatic compounds. Appl Microbiol Biotechnol 86:921–929. doi: 10.1007/s00253-009-2358-0. [DOI] [PubMed] [Google Scholar]
  • 34.Galán B, Kolb A, Sanz JM, García JL, Prieto MA. 2003. Molecular determinants of the hpa regulatory system of Escherichia coli: the HpaR repressor. Nucleic Acids Res 31:6598–6609. doi: 10.1093/nar/gkg851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Perera IC, Grove A. 2010. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators. J Mol Cell Biol 2:243–254. doi: 10.1093/jmcb/mjq021. [DOI] [PubMed] [Google Scholar]
  • 36.Providenti MA, Wyndham RC. 2001. Identification and functional characterization of CbaR, a MarR-like modulator of the cbaABC-encoded chlorobenzoate catabolism pathway. Appl Environ Microbiol 67:3530–3541. doi: 10.1128/AEM.67.8.3530-3541.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yoshida M, Hiromoto T, Hosokawa K, Yamaguchi H, Fujiwara S. 2007. Ligand specificity of MobR, a transcriptional regulator for the 3-hydroxybenzoate hydroxylase gene of Comamonas testosteroni KH122-3s. Biochem Biophys Res Commun 362:275–280. doi: 10.1016/j.bbrc.2007.07.190. [DOI] [PubMed] [Google Scholar]
  • 38.Calisti C, Ficca AG, Barghini P, Ruzzi M. 2008. Regulation of ferulic catabolic genes in Pseudomonas fluorescens BF13: involvement of a MarR family regulator. Appl Microbiol Biotechnol 80:475–483. doi: 10.1007/s00253-008-1557-4. [DOI] [PubMed] [Google Scholar]
  • 39.Parke D, Ornston LN. 2003. Hydroxycinnamate (hca) catabolic genes from Acinetobacter sp. strain ADP1 are repressed by HcaR and are induced by hydroxycinnamoyl-coenzyme A thioesters. Appl Environ Microbiol 69:5398–5409. doi: 10.1128/AEM.69.9.5398-5409.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES