Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Dec 1.
Published in final edited form as: Schizophr Res. 2014 Nov 14;160(0):80–87. doi: 10.1016/j.schres.2014.10.026

Influence of kynurenine 3-monooxygenase (KMO) gene polymorphism on cognitive function in schizophrenia✰,✰✰

Ikwunga Wonodi a,*, Robert P McMahon a, Nithin Krishna a, Braxton D Mitchell b, Judy Liu a, Matthew Glassman a, L Elliot Hong a, James M Gold a
PMCID: PMC4516229  NIHMSID: NIHMS706991  PMID: 25464917

Abstract

Background

Cognitive deficits compromise quality of life and productivity for individuals with schizophrenia and have no effective treatments. Preclinical data point to the kynurenine pathway of tryptophan metabolism as a potential target for pro-cognitive drug development. We have previously demonstrated association of a kynurenine 3-monooxygenase (KMO) gene variant with reduced KMO gene expression in postmortem schizophrenia cortex, and neurocognitive endophenotypic deficits in a clinical sample. KMO encodes kynurenine 3-monooxygenase (KMO), the rate-limiting microglial enzyme of cortical kynurenine metabolism. Aberration of the KMO gene might be the proximal cause of impaired cortical kynurenine metabolism observed in schizophrenia. However, the relationship between KMO variation and cognitive function in schizophrenia is unknown. This study examined the effects of the KMO rs2275163C>T C (risk) allele on cognitive function in schizophrenia.

Methods

We examined the association of KMO polymorphisms with general neuropsychological performance and P50 gating in a sample of 150 schizophrenia and 95 healthy controls.

Results

Consistent with our original report, the KMO rs2275163C>T C (risk) allele was associated with deficits in general neuropsychological performance, and this effect was more marked in schizophrenia compared with controls. Additionally, the C (Arg452) allele of the missense rs1053230C>T variant (KMO Arg452Cys) showed a trend effect on cognitive function. Neither variant affected P50 gating.

Conclusions

These data suggest that KMO variation influences a range of cognitive domains known to predict functional outcome. Extensive molecular characterization of this gene would elucidate its role in cognitive function with implications for vertical integration with basic discovery.

Keywords: Kynurenine, KMO, Genetic association, Cognition, P50, Schizophrenia

1. Introduction

Cognitive deficits profoundly reduce the quality of life of individuals with schizophrenia, and have no effective treatments (Green, 1996; Gold et al., 2000; Green et al., 2000; Harvey et al., 2003; Jaaskelainen et al., 2013). Cognitive impairments predict functional outcomes (Green et al., 2000; Prouteau et al., 2005; Martinez-Aran et al., 2007), including unemployment status (Gold et al., 2002; Caspi et al., 2003; Goldberg and Gomar, 2009; Harvey et al., 2012; Sheffield et al., 2013), which partly underlie the high healthcare costs associated with schizophrenia (Insel, 2008; Kessler et al., 2008; Soni 2009). Elucidating the neurobiological substrates of cognition could identify targets for developing rational pro-cognitive pharmacology for schizophrenia (Hyman and Fenton, 2003; Gold, 2004; Tamminga, 2006; Millan et al., 2012).

Preclinical evidence indicates that the kynurenine pathway (KP) of tryptophan metabolism is a valuable target for pro-cognitive drug development (Shepard et al., 2003; Erhardt et al., 2004; Chess et al., 2007, 2009; Potter et al., 2010; Wonodi and Schwarcz, 2010; Pocivavsek et al., 2012; Stone and Darlington, 2013). In the brain as in the periphery (Wolf, 1974; Stone, 1993; Guillemin et al., 1999), the KP generates two neuroactive metabolites - kynurenic acid (KYNA) and quinolinic acid (QUIN) - shown to modulate critical glutamatergic and cholinergic systems that regulate cognitive processes (Morris et al., 1986; Davis et al., 1992; Buffalo et al., 1994; Krystal et al., 1994; Newcomer and Krystal, 2001; Stone and Darlington, 2013) (Fig. 1). The excitotoxin QUIN is an agonist at glutamatergic N-methyl-d-aspartate receptors (NMDAR) (Stone and Perkins, 1981; Schwarcz et al., 1983), while KYNA is a competitive, broad-spectrum antagonist at ionotropic glutamate receptors, with its greatest affinity at the allosteric site on NMDAR (Perkins and Stone, 1982; Birch et al., 1988; Moroni et al., 1988; Foster et al., 1992; Stone, 1993; Parsons et al., 1997; Scharfman et al., 2000; Carpenedo et al., 2001; Erhardt et al., 2001b; Rassoulpour et al., 2005; Stone et al., 2013).

Fig. 1.

Fig. 1

The kynurenine pathway of tryptophan metabolism. Tryptophan metabolism is initiated by oxidative cleavage by tryptophan 2,3-dioxygenase (TDO) and indoleamine 2,3-dioxygenase (IDO). In the brain, the pivotal metabolite and substrate kynurenine is enzymatically converted to the neuroactive metabolites, quinolinic acid (QUIN) and kynurenic acid (KYNA) in microglia and astrocytes, respectively. No neuroactivity has been determined for anthranilic acid and 3-HK to date (Stone, 1993). A persistent downregulation of microglial KMO mRNA would shunt KP metabolism towards enhanced KYNA formation, which would result in increased inhibition of NMDA receptors (NMDA-R) and neuronal α7 nicotinic receptors (α7nACh-R), with effects on fundamental cognitive processes.

Another action attributed to KYNA is antagonism of α7 nicotinic acetylcholine receptors (α7nAChR) (Hilmas et al., 2001; Alkondon et al., 2004; Lopes et al., 2007; Alkondon et al., 2011a, 2011b), although some studies failed to demonstrate this (Mok et al., 2009; Dobelis et al., 2012). Notwithstanding, the emerging hypothesis of KYNA’s role in cognition is based on the established roles of NMDAR (Krystal et al., 1994; Malhotra et al., 1996; Newcomer et al., 1999; Lahti et al., 2001) and α7nAChR (Kim and Levin, 1996; Newhouse et al., 1997; Levin and Simon, 1998; Rusted et al., 2000) in fundamental cognitive processes.

Elevated KYNA levels have been demonstrated in several psychiatric diseases marked by cognitive dysfunction, including schizophrenia (Schwarcz et al., 2001; Erhardt et al., 2001a; Nilsson et al., 2005; Linderholm et al., 2010; Sathyasaikumar et al., 2011), psychotic bipolar disorder (Olsson et al., 2010, 2012; Lavebratt et al., 2014), HIV-associated neurocognitive disorders (Baran et al., 2000, 2012), and Alzheimer’s disease (Baran et al., 1999). Relevant to schizophrenia, KYNA’s role as an endogenous primary NMDAR antagonist converges with the established hypoglutamatergic hypothesis of schizophrenia (see reviews, Coyle, 1996; Coyle et al., 2003; Javitt, 2007). Evidence from our group suggests that downregulation of the KMO gene (OMIM 603538), which encodes kynurenine 3-monooxygenase (KMO) (EC 1.14.13.9), the rate-limiting microglial enzyme of the KP, might be the proximal cause of elevated KYNA levels observed in schizophrenia (Sathyasaikumar et al., 2010; Wonodi et al., 2011), a relationship recently investigated in KMO knockout mice (Giorgini et al., 2013). We previously showed an association between the CC genotype of KMO single nucleotide polymorphism (SNP) rs2275163C>T and significantly reduced KMO gene expression in postmortem schizophrenia prefrontal cortex from a region related to cognitive function; and in a clinical sample, the KMO risk allele (C) was associated with poor performance on oculomotor measures of predictive pursuit and visuospatial working memory (Wonodi et al., 2011). However, the relationship between KMO variation and cognitive function in humans is unknown. In the present study, we hypothesized that the rs2275163C>T risk allele, which was associated with reduced KMO messenger RNA (mRNA) expression (which would shunt KP metabolism towards enhanced KYNA formation) in our original report, would be associated with poor cognitive performance. Because a second non-synonymous variant in KMO, the C (Arg452) allele of rs1053230>NT (Arg452Cys) has also recently been associated with reduced KMO mRNA expression in brain and lymphoblastoid tissues, and with increased KYNA levels in cerebrospinal fluid (Holtze et al., 2012; Lavebratt et al., 2014), we additionally tested as a secondary aim, the association of this SNP with cognitive function in our sample. Lastly, we explored the effect of the KMO risk allele on P50 gating. Since P50 gating has been shown to not be correlated with general cognitive abilities, we anticipated association between the risk allele and cognitive function, but not necessarily with P50 suppression.

2. Methods

2.1. Participants

We enrolled a total of 245 unrelated individuals with minimal overlap with participants in our original study. Schizophrenia participants (n = 150) were recruited from outpatient clinics at the Maryland Psychiatric Research Center. Healthy controls (n = 95) were recruited through media advertisements. Since neurophysiological measures may be affected by age, particularly in individuals above 60 years (Ross et al., 1999), our endophenotypic studies are restricted to subjects between 18 and 58 years. Participants were evaluated with the Structured Clinical Interview for DSM-IV (SCID-IV) (First et al., 1997). Diagnosis of schizophrenia was based on SCID-IV (patient version). Healthy controls did not meet the criteria for Axis I or II disorders (SCID-IV, nonpatient version). Respondents were excluded if they had substance dependence within 6 months prior to study enrollment, current substance abuse, or mental retardation. All participants provided written informed consent.

2.2. Cognitive assessment

All participants (n = 245) were administered a broad battery of tests assessing general intellectual ability (the Wechsler Abbreviated Scale of Intelligence (WASI)) (Wechsler, 1999), reading (Wechsler Test of Adult Reading), episodic memory (Logical Memory subtest from the WMS III and the Warrington Recognition Memory Test administered with a 60 minute delay) (Warrington, 1984), processing speed (Digit Symbol Substitution, Trail Making Tests A and B, Semantic Fluency), problem solving (the Wisconsin Card Sorting Test and the Making Groups Test), and working memory using the Spatial Span and Letter-Number Sequencing Tests from the WMS III (Battery, 1944; Reitan and Wolfson, 1971; Wechsler, 1997).

2.3. Laboratory procedures

2.3.1. P50 suppression

The P50 gating measures were recorded and processed as previously described (Hong et al., 2008) in a subsample of 184 participants (118 schizophrenia) (Table 1). Smokers refrained from smoking 1 h prior to testing. Participants sat in a semi-reclining chair in a sound-attenuated booth and 150 paired-click auditory stimuli were presented through headphones. Single trial records were baseline-corrected, bandpass filtered, and averaged to obtain the P50 waves. P50 response to the first stimulus (S1) was defined as the largest positive-going wave occurring 35-75 ms after the stimulus, measured from the trough of the preceding wave to the P50 peak. The S2 P50 was set to ±10 ms of the latency to S1 P50. Scoring was blinded to diagnostic grouping. The P50 gating endpoint outcome measure was the S2/S1 ratio.

Table 1.

Demographic and phenotypic measures of study participants.

Mean (SD)a


Healthy control
participantsb
Schizophrenia
patientsc
P
value
Age, years 39.24 ± 12.6 40.97 ± 11.0 .26
Female sex, % 43.2 48.7 .43
Ethnicity (EA/AA), % 62.1/37.9 72.0/28.0 .12
Global cognitive
composite
 scored
0.46 ± 0.83 −0.31 ± 0.96 <.001
P50 Gatinge 0.62 ± 0.21
(n = 66)
0.76 ± 0.27
(n = 118)
<.001

Abbreviations: AA, African-American; EA, European-American.

a

Data are presented as mean (SD) unless otherwise indicated.

b

n = 95 unless otherwise indicated.

c

n = 150 unless otherwise indicated.

d

On the basis of the first principle component of the Neuropsychological Test Battery.

e

Based on P50 suppression of auditory event-related potential.

2.3.2. SNP genotyping

We genotyped rs2275163C>T and rs1053230C>T (Table 2), using TaqMan technology as previously described (Wonodi et al., 2009).

Table 2.

SNP genotyping.

Gene symbol Chromosome TaqMan assay
identification no.
SNP Function RefSNP alleles MA Context
sequence
KMO 1q42-q44 (C_8856260_10) rs1053230 Nonsyn T/C T CTACATGTCACCACGATCTTTCCTC[C/T]GCTTGAGAAGACCATGGAACTGGAT
KMO 1q42-q44 (C_16183814_10) rs2275163a Intron C/T T CAGAAACCTACATTAGAGCAAAAGT[C/T]TAAGTGGATATTGTGCTGTGAGCAG

Abbreviations: RefSNP alleles, National Center for Biotechnology Information reference SNP alleles; MA, minor allele; Nonsyn, nonsynonymous; TaqMan assay ID, ABI Life Technologies TaqMan Genotyping Assay.

a

Haplotype-tagged SNP (htSNP).

2.4. Statistical analysis

2.4.1. Cognitive and P50 analyses

To combine results from the individual tests in the neuropsychological battery into a single global cognitive composite score, we used the following procedure. The primary analysis was done using the composite score calculated using weights for individual test scores estimated from analysis of the first principal component of the cognitive tests. This composite score (“global cognitive composite score”) explained 52% of the variance from the cognitive measures, and was examined using ANOVA with diagnosis, genotype (presence of minor allele genotype), and diagnosis by genotype interaction. The diagnosis by genotype interaction tested whether the magnitude of genotype effects was similar between schizophrenia and control participants. Similar models were used to examine scores on individual cognitive tests, and P50 gating analysis (S1/S2 ratio).

2.4.2. Phenotype and SNP association analyses

Prior to SNP analysis, the distributions of rs2275163C>T and rs1053230C>T genotypes were evaluated, separately, in European-American and African-American participants for their fit with expectations under the Hardy Weinberg equilibrium (Hardy, 1908). Furthermore, we determined the minor allele frequencies (MAF) of both SNPs in both ethnic groups and compared them with the Global MAF (GMAF) for rs2275163C>T (0.30) and rs1053230C>T (0.12) from dbSNP based on 1000 Genomes (Consortium and Abecasis GR, 2010). We further compared allele frequencies of rs2275163C>T between our control groups and 1000 Genomes and found similar MAF in both European Americans (34.00 in our control samples vs. 35.00 in 1000 Genomes European Ancestry) and African Americans (17.00 in our control samples vs. 16.00 in 1000 Genomes African Ancestry). Based on our previous findings (Wonodi et al., 2011), we compared phenotypes across 2 genotype groups (homozygous CC vs. combined CT/TT genotypes). We restricted secondary analysis of the effects of rs1053230C>T on cognitive measures to European-American participants only because the current sample of African-Americans was too small to reliably test whether the effects of this genotype were different in that population.

3. Results

3.1. Cognitive performance and P50 suppression

Schizophrenia and controls were not significantly different on the demographic variables of age, sex, or ethnicity (Table 1). Schizophrenia participants had significantly reduced global cognitive composite scores (mean [SD], −0.31 [0.96]; n = 150) compared with controls (0.46 [0.83]; n = 95) (P < .001), and worse P50 gating (mean [SD], 0.76 [0.27]; n = 118) compared with controls (0.62 [0.21]; n = 66) (P < .001).

3.2. Phenotype and SNP association

3.2.1. KMO rs2275163C>T and Cognition (Table 3)

Table 3.

Influence of KMO rs2275163C>T risk allele on cognitive performance in control and schizophrenia participants.

Healthy controlsc
Schizophreniad
Combined schizophrenia and
healthy controls
CC
(n = 51)
CT/TT
(n = 44)
CC
(n = 94)
CT/TT
(n = 56)
Main effect of genotype Interaction








Cognitive performance Mean SD Mean SD P-value Effect size
(d)
Mean SD Mean SD P-value Effect size
(d)
P-value P-value
WCST PEa −.13 .99 −.28 .61 .38 .18 −.36 1.16 .24 .73 <.001 −.62 .003 .08
WCST Cata .11 .92 .19 1.01 .67 −.08 −.37 .92 .26 .94 <.001 −.68 .004 .03
Digit Symbola .34 1.11 .36 .77 .92 −.02 −.42 .93 −.07 .91 .02 −.38 .14 .18
Logical MemM1SSa .42 .78 .29 .94 .45 .15 −.30 .94 −.16 1.02 .37 −.14 .97 .30
IQa .23 .86 .47 .84 .15 −.28 −.52 .97 .09 1.02 <.001 −.61 .001 .14
LNSEQa .15 1.01 .45 .99 .14 −.29 −.47 .88 .12 .91 <.001 −66 <.001 .24
MGTa .27 .94 .54 .89 .17 −.29 −.52 .88 .06 .92 <.001 −.64 .001 .20
Spatial Spana .27 1.04 .40 .88 .52 −.13 −.48 .97 .08 .87 <.001 −.61 .006 .08
Semantic Fluencya .57 .97 .29 .88 .15 .30 −.49 .94 −.01 .94 .002 −.51 .40 .002
Trails Aa .38 .89 .27 .94 .57 .12 −.31 .96 −.05 .93 .09 −.27 .53 .14
Trails Ba .30 .96 .48 .84 .34 −.19 −.46 .99 .01 .82 .002 −.52 .008 .22
WRMT Facesa .18 .89 .40 .78 .21 −.26 −.41 .99 .07 .86 .002 −.52 .004 .28
WRMT Wordsa .21 .75 .23 .64 .92 −.03 −.19 1.04 .05 .89 .13 −.25 .27 .33
WTARSSa .16 1.10 .44 .85 .17 −.28 −.40 .95 .17 .88 <.001 −.62 .001 .24
Global cognitive composite score b .37 .89 .55 .73 .311 −.22 −.56 .92 .12 .88 <.001 −.76 <.001 .03

Abbreviations: WCST PE, Wisconsin Card Sorting Test (perseverative errors); WCST Cat, Wisconsin Card Sorting Test (total number of categories achieved); Digit Symbol, Digit Symbol Substitution Test; Logical MemM1SS, Logical Memory Test, Immediate Recall; IQ, Intelligence Quotient; LNSEQ, Letter-Number Sequencing; MGT, Making Groups Test; Spatial Span, Spatial Span Test; Semantic Fluency; Trails A, Trail Making Test: Part A; Trails B, Trail Making Test: Part B; WRMT Faces, Warrington Recognition Memory Test for Faces; WRMT Words, Warrington Recognition Memory Test for Words; WTARSS, Wechsler Test of Adult Reading;

a

Based on standardized z-scores of Neuropsychological test scores.

b

On the basis of the first principle component of the Neuropsychological Test Battery in Table 3.

c

n = 95 unless otherwise indicated.

d

n = 150 unless otherwise indicated.

Individuals homozygous for the rs2275163C>T (risk) C allele genotype (CC) had a significantly reduced global cognitive composite score (mean [SD], −0.23 [1.02]; n = 144) compared with CT/TT genotype individuals (0.31 [0.84]; n = 101) (P < .001; effect size = .57). The effect of CC vs. CT/TT was smaller in control compared with schizophrenia [Cohen’s d = −0.22 versus d = −0.76, respectively; test for interaction; (P = .03)]. In controls, estimated effect sizes for CC vs. CT/TT genotype effect were small for all measures (all effect sizes < ±0.3; all P > 0.15). In schizophrenia participants, only 3 tests (Logical Memory Test, immediate recall; Warrington Recognition Memory Test for Words; Trail Making Test: Part A) for CC vs. CT/TT genotype differences were not statistically significant (P < 0.05); for the remainder of the tests in schizophrenia individuals, effect sizes for CC vs. CT/TT genotype ranged from Cohen’s d = −0.37 to d = −0.76, with all but one > d = −0.50 (Table 3).

3.2.2. KMO rs2275163C>T and P50

There was no main effect of genotype on P50 gating (P = .16; effect size = −.25), and no statistically significant genotype by diagnosis interaction (P = .70). P50 gating in controls with CC genotype was not different from CT/TT genotype controls (P = .45; effect size = .19). P50 gating was not different between CC and CT/TT genotype schizophrenia participants (P = .17; effect size = −.24) (Fig. 2).

Fig. 2.

Fig. 2

No effect of KMO rs2275163C>T risk variant on P50 suppression. A: Schizophrenia participants showed significantly reduced mean P50 suppression compared with healthy controls: **P = .001 (analysis of variance). Error bars indicate SD. HC, healthy control: n = 66; SZ, schizophrenia: n = 118. B: No effect of KMO risk variant on mean P50 suppression in pooled schizophrenia and healthy control participants. The collapsed carriers of the minor allele (TT and CT) (blue bar) are compared with carriers that are homozygous for the major allele (CC) (red bar): P = .16 [NS] (analysis of variance). TT and CT: n = 68; CC: n = 116. HC, healthy control: n = 66; SZ, schizophrenia: n = 118. Error bars indicate SD. C: No effect of KMO risk variant on mean P50 suppression in schizophrenia participants. The collapsed carriers of the minor allele (TT and CT) (blue bar) are compared with carriers that are homozygous for the major allele (CC) (red bar): P = .17 [NS] (analysis of variance post hoc test). TT and CT: n = 42; CC: n = 76. Effect size, Cohen’s d = −.24. SZ, schizophrenia: n = 118. Error bars indicate SD. D: No effect of KMO risk variant on mean P50 suppression in healthy control participants. The collapsed carriers of the minor allele (TT and CT) (blue bar) are compared with carriers that are homozygous for the major allele (CC) (red bar): P = .45 [NS] (analysis of variance post hoc test). TT and CT: n = 26; CC: n = 40. Effect size, Cohen’s d = .19. HC, healthy control: n = 66. Error bars indicate SD.

3.2.3. KMO rs1053230C>T (Arg452Cys) and cognition

Exploratory analyses of rs1053230C>T effects on global cognitive composite score in pooled European-American control and schizophrenia participants showed a significant main effect of genotype with C (Arg452) homozygotes showing poorer global cognitive composite scores (mean [SD], 0.01 [1.08]; n = 107) compared with CT/TT genotype individuals (0.37 [0.96]; n = 51) (P = .04; effect size = .35). However, there was no main effect of diagnosis (P = .33) or genotype × diagnosis interaction (P = .80). Global cognition composite score in C (Arg452) homozygous controls (0.73 [0.77]; n = 32) was not different from CT/TT genotype controls (0.85 [0.65]; n = 25) (P = .56; effect size = −0.16). Global cognition composite score in C (Arg452) homozygous schizophrenia participants (−0.30 [1.06]; n = 75) was not different from CT/TT genotype patients (−0.10 [1.00]; n = 26) (P = .37; effect size = −0.21).

3.2.4. KMO rs1053230C>T (Arg452Cys) and P50

Exploratory analyses of rs1053230C>T effects on P50 gating in pooled European-American control and schizophrenia participants showed no main effect of genotype in P50 gating between C (Arg452) homozygotes (mean [SD], 0.69 [0.24]; n = 76) and CT/TT genotype individuals (0.69 [0.32]; n = 40) (P = .80). While the CC vs. CT/TT genotype difference was not significantly different from zero in either control or schizophrenia participants, the effects of genotype were in opposite directions in the two groups and were significantly different (test for genotype × diagnosis interaction, P = .02). P50 gating in C (Arg452) homozygote controls (0.64 [0.19]; n = 21) was not significantly different from CT/TT genotype controls (0.53 [0.21]; n = 19) (P = .10; effect size = 0.54). P50 gating in C (Arg452) homozygous schizophrenia participants (0.72 [0.28]; n = 55) was not significantly different from CT/TT genotype patients (0.85 [0.33]; n = 21) (P = .07; effect size = −0.44).

4. Discussion

To our knowledge, this is the first report suggesting that KMO could be a valid candidate gene for general cognitive abilities in humans. While there was some variability in the extent of impairment across cognitive measures, the rs2275163C>T CC group performed more poorly (arithmetically) on each and every measure. These findings are consistent with our original report and preclinical data that demonstrate impairments in spatial working memory (Chess et al., 2007) and cognitive flexibility (Pocivavsek et al., 2012, Alexander et al., 2013) in rodents following experimental manipulation of KMO function. Of note however, two of three measures that did not differ significantly as a function of genotype in our sample (effect sizes of −.14 and −.25) were both measures of verbal memory, raising the possibility that this particular cognitive function may be less sensitive to KMO variation. It is conceivable that the growing evidence linking KMO variation and elevated KYNA levels to schizophrenia and psychotic bipolar disorder may be explained by indirect relationships with cognitive deficits intrinsic to both disorders. Notably, the original report of association of rs2275163C>T and schizophrenia in a Japanese sample was not replicated in an independent Japanese sample (Aoyama et al., 2006). We initially used a well-phenotyped discovery sample for an endophenotype-based genome wide association screen to prioritize biologically plausible candidate genes based on top SNP-hits. Two KMO SNPs, including rs2275163C>T, were among the top SNP-hits, which met our criteria to prioritize KMO as a plausible candidate for schizophrenia-related impairments. This motivated further studies leading up to our original report in which we found no association with schizophrenia but demonstrated an effect on neurocognitive endophenotypes and KMO gene expression (Wonodi et al., 2011).

A recent report by Lavebratt et al. (2014) supports and extends our original findings by showing downregulated KMO in schizophrenia and psychotic bipolar disorder cortical tissues compared with normal control and non-psychotic bipolar disorder specimens. The study further showed that KMO polymorphism influenced both KYNA levels in cerebrospinal fluid of psychotic bipolar disorder individuals, and KMO mRNA expression in lymphoblastoid cell lines. Importantly, similar to schizophrenia, individuals with psychotic bipolar disorder exhibit more impaired cognitive performance compared with non-psychotic bipolar disorder patients (Martinez-Aran et al., 2008; Hill et al., 2009, 2013; Reilly et al., 2013). In participants with minimal overlap with our original sample, we show that rs2275163C>T CC genotype individuals display marked deficits on a number of measures of cognitive performance compared with CT/TT genotype individuals. These genotype differences were significantly enhanced in schizophrenia relative to controls, and the effect is broad, impacting cognitive functioning in general, rather than being limited to specific cognitive abilities. Based on our original findings, we hypothesized that this intronic KMO SNP might be in linkage disequilibrium (LD) with a causal variant(s) (Reich et al., 2001; Consortium, 2003) that reduces KMO gene function. Further, this risk variant might also be in LD with multiple biologically active variants, which interact with each other, epigenetic factors, and the environment to increase the risk of cognitive impairments, perhaps, by effects on NMDAR function (Maher and LoTurco, 2012; Wang and Zhu, 2014; Wei et al., 2014) via interaction with AKT3, a recently identified schizophrenia risk gene that maps to the same chromosomal region (1q42-44) as KMO (Ripke et al., 2013). Indeed, rs2275163C>T is a haplotype tagging SNP, which indicates that it maps to a genomic region with high LD and “tags” variation in a particular combination of alleles (Johnson et al., 2001; Gabriel et al., 2002). Alternatively, rs2275163C>T might influence KMO mRNA expression by post-transcriptional and post-translational modifications, including effects on microRNAs (miRNAs), which are regulated by genes in intronic regions of protein-coding genes via interactions with the 3′ UTRs (Conne et al., 2000; Hobert, 2008; Dahan et al., 2011; Schizophrenia Psychiatric Genome-Wide Association Study, 2011; Ripke et al., 2013).

Our finding of a more marked influence of this KMO risk variant on cognitive abilities in schizophrenia compared with controls is consistent with “multiple hit” theories of schizophrenia (Bayer et al., 1999). In this model, the interplay of multiple susceptibility genes (“first hit”) disrupts the intra-and intercellular signaling pathways involved in neurodevelopment and primes them for a sustained pathological response to environmental insults (“second hit”) that contribute, additively, to increased vulnerability and pathogenesis in schizophrenia (Maynard et al., 2001; Cannon et al., 2003). Thus, as previously shown with COMT gene (Egan et al., 2001; Thaker et al., 2004) a putative risk variant may be associated with more severe cognitive impairments in schizophrenia than in controls. Further, evidence suggests that several schizophrenia candidate genes converge on NMDAR function (Stahl, 2007). Exploratory analyses in European-Americans in the current sample showed an effect of the functional KMO Arg452Cys variant on global cognitive composite score in pooled patients and controls, although there was no genotype by diagnosis interaction. Nevertheless, this trend level effect accords with reports showing effects of this variant on KMO expression and KYNA levels in European samples (Holtze et al., 2012; Lavebratt et al., 2014).

We found no statistically significant association of either KMO variant with P50 suppression. This implies that KMO variation may influence complex cognition through interactions with brain circuitry that are distinct from the inhibitory neuronal mechanisms involved in sensory gating (Adler et al., 1982; Freedman et al., 1983). Although the P50 gating deficit is a highly validated schizophrenia endophenotype (Adler et al., 1992; Leonard et al., 1996; Freedman et al., 1997; Adler et al., 1998; Hong et al., 2008), the strongest evidence for a relationship of P50 with cognition has been with measures of sustained attention and vigilance (Cullum et al., 1993; Erwin et al., 1998; Potter et al., 2006; Smith et al., 2010). Accordingly, our results tentatively provide genetic evidence indicating that the P50 gating deficit is unrelated to complex cognitive abilities in schizophrenia (Thoma et al., 2003; Sanchez-Morla et al., 2013). However, for the Arg452Cys, we did find that the estimated effects of genotype in control and schizophrenia participants, while not significantly different from zero in either group, were significantly different from each other, suggesting further investigation of the effects of this genotype on P50 is warranted. Important limitations of this study include the absence of measures of KMO gene expression, KYNA, and QUIN. Additionally, we acknowledge that cryptic population substratification may have confounded our results in this sample of self-reported ethnicity (Pritchard and Rosenberg, 1999). Though we conducted analyses separately in both ethnic groups prior to combined genotype-phenotype analyses, and limited the exploratory analyses of the functional Arg452Cys variant to European-American participants, we did not use a full ancestry informative marker (AIMS) panel for ancestry inference and thus could not adjust for potential population admixture (Pritchard et al., 2000). Lastly, the lack of comprehensive information on participants’ educational levels is a further limitation in this study.

In summary, our results support the need for further studies to extensively characterize the diversity of KMO variation in combination with expression quantitative trait loci (eQTLs) (Nica et al., 2010; Montgomery and Dermitzakis, 2011) to ascertain their relationship with cognitive abilities in humans. This would generate new knowledge for vertical integration with basic discovery and could uncover novel targets for developing procognitive pharmacology for people with schizophrenia.

Acknowledgments

The authors would like to thank the MPRC research study participants for making this study possible.

Role of funding source

This work was supported in part by grants MH-K12RR023250, MH075101, and MH085174 from the National Institute of Mental Health (NIMH), NARSAD, and the Passano Foundation.

Footnotes

✰

Financial disclosure: None.

✰✰

Previous presentations: None.

Contributors

Dr. Wonodi had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Wonodi, Gold. Acquisition of data: Wonodi, Gold, Krishna, Glassman, Hong, Liu. Analysis and interpretation of data: McMahon, Gold, Wonodi, Hong, Mitchell. Drafting of manuscript: Wonodi, Gold, McMahon. Critical revision of the manuscript for important intellectual content: Gold, McMahon, Mitchell, Hong, Wonodi. Statistical analysis: McMahon, Mitchell, Gold, Wonodi. Obtained funding: Wonodi. Administrative, technical, and material support: Wonodi, Gold, McMahon, Mitchell, Liu, Krishna, Glassman, Hong. Study supervision: Wonodi.

Conflict of interest

All authors declare that they have no conflict of interest.

References

  1. Adler LE, Pachtman E, Franks RD, Pecevich M, Waldo MC, Freedman R. Neurophysiological evidence for a defect in neuronal mechanisms involved in sensory gating in schizophrenia. Biol. Psychiatry. 1982;17(6):639–654. [PubMed] [Google Scholar]
  2. Adler LE, Hoffer LJ, Griffith J, Waldo MC, Freedman R. Normalization by nicotine of deficient auditory sensory gating in the relatives of schizophrenics. Biol. Psychiatry. 1992;32(7):607–616. doi: 10.1016/0006-3223(92)90073-9. [DOI] [PubMed] [Google Scholar]
  3. Adler LE, Olincy A, Waldo M, Harris JG, Griffith J, Stevens K, Flach K, Nagamoto H, Bickford P, Leonard S, Freedman R. Schizophrenia, sensory gating, and nicotinic receptors. Schizophr. Bull. 1998;24(2):189–202. doi: 10.1093/oxfordjournals.schbul.a033320. [DOI] [PubMed] [Google Scholar]
  4. Alexander KS, Pocivavsek A, Wu HQ, Pershing ML, Schwarcz R, Bruno JP. Early developmental elevations of brain kynurenic acid impair cognitive flexibility in adults: reversal with galantamine. Neuroscience. 2013;238:19–28. doi: 10.1016/j.neuroscience.2013.01.063. http://dx.doi.org/10.1016/j.neuroscience.2013.01.063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Alkondon M, Pereira EF, Yu P, Arruda EZ, Almeida LE, Guidetti P, Fawcett WP, Sapko MT, Randall WR, Schwarcz R, Tagle DA, Albuquerque EX. Targeted deletion of the kynurenine aminotransferase ii gene reveals a critical role of endogenous kynurenic acid in the regulation of synaptic transmission via alpha7 nicotinic receptors in the hippocampus. J. Neurosci. 2004;24(19):4635–4648. doi: 10.1523/JNEUROSCI.5631-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Alkondon M, Pereira EF, Albuquerque EX. Endogenous activation of nAChRs and NMDA receptors contributes to the excitability of CA1 stratum radiatum interneurons in rat hippocampal slices: effects of kynurenic acid. Biochem. Pharmacol. 2011a;82(8):842–851. doi: 10.1016/j.bcp.2011.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Alkondon M, Pereira EF, Eisenberg HM, Kajii Y, Schwarcz R, Albuquerque EX. Age dependency of inhibition of alpha7 nicotinic receptors and tonically active N-methyl-d-aspartate receptors by endogenously produced kynurenic acid in the brain. J. Pharmacol. Exp. Ther. 2011b;337(3):572–582. doi: 10.1124/jpet.110.177386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Aoyama N, Takahashi N, Saito S, Maeno N, Ishihara R, Ji X, Miura H, Ikeda M, Suzuki T, Kitajima T, Yamanouchi Y, Kinoshita Y, Yoshida K, Iwata N, Inada T, Ozaki N. Association study between kynurenine 3-monooxygenase gene and schizophrenia in the Japanese population. Genes Brain Behav. 2006;5(4):364–368. doi: 10.1111/j.1601-183X.2006.00231.x. [DOI] [PubMed] [Google Scholar]
  9. Baran H, Jellinger K, Deecke L. Kynurenine metabolism in Alzheimer’s disease. J. Neural Transm. 1999;106(2):165–181. doi: 10.1007/s007020050149. [DOI] [PubMed] [Google Scholar]
  10. Baran H, Hainfellner JA, Kepplinger B, Mazal PR, Schmid H, Budka H. Kynurenic acid metabolism in the brain of HIV-1 infected patients. J. Neural Transm. 2000;107(10):1127–1138. doi: 10.1007/s007020070026. [DOI] [PubMed] [Google Scholar]
  11. Baran H, Hainfellner JA, Kepplinger B. Kynurenic acid metabolism in various types of brain pathology in HIV-1 infected patients. Int. J. Tryptophan. Res. 2012;5:49–64. doi: 10.4137/IJTR.S10627. http://dx.doi.org/10.4137/IJTR.S10627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Battery, Army Individual Test . Manual of Directions and Scoring. War Dept, Adjutant General’s Office; Washington, DC: 1944. [Google Scholar]
  13. Bayer TA, Falkai P, Maier W. Genetic and non-genetic vulnerability factors in schizophrenia: the basis of the “two hit hypothesis”. J. Psychiatr. Res. 1999;33(6):543–548. doi: 10.1016/s0022-3956(99)00039-4. [DOI] [PubMed] [Google Scholar]
  14. Birch PJ, Grossman CJ, Hayes AG. Kynurenic acid antagonises responses to NMDA via an action at the strychnine-insensitive glycine receptor. Eur. J. Pharmacol. 1988;154(1):85–87. doi: 10.1016/0014-2999(88)90367-6. [DOI] [PubMed] [Google Scholar]
  15. Buffalo EA, Gillam MP, Allen RR, Paule MG. Acute behavioral effects of MK-801 in rhesus monkeys: assessment using an operant test battery. Pharmacol. Biochem. Behav. 1994;48(4):935–940. doi: 10.1016/0091-3057(94)90203-8. [DOI] [PubMed] [Google Scholar]
  16. Cannon TD, van Erp TG, Bearden CE, Loewy R, Thompson P, Toga AW, Huttunen MO, Keshavan MS, Seidman LJ, Tsuang MT. Early and late neurodevelopmental influences in the prodrome to schizophrenia: contributions of genes, environment, and their interactions. Schizophr. Bull. 2003;29(4):653–669. doi: 10.1093/oxfordjournals.schbul.a007037. [DOI] [PubMed] [Google Scholar]
  17. Carpenedo R, Pittaluga A, Cozzi A, Attucci S, Galli A, Raiteri M, Moroni F. Presynaptic kynurenate-sensitive receptors inhibit glutamate release. Eur. J. Neurosci. 2001;11:2141–2147. doi: 10.1046/j.0953-816x.2001.01592.x. [DOI] [PubMed] [Google Scholar]
  18. Caspi A, Reichenberg A, Weiser M, Rabinowitz J, Kaplan Z, Knobler H, Davidson-Sagi N, Davidson M. Cognitive performance in schizophrenia patients assessed before and following the first psychotic episode. Schizophr. Res. 2003;65(2-3):87–94. doi: 10.1016/s0920-9964(03)00056-2. [DOI] [PubMed] [Google Scholar]
  19. Chess AC, Simoni MK, Alling TE, Bucci DJ. Elevations of endogenous kynurenic acid produce spatial working memory deficits. Schizophr. Bull. 2007;33(3):797–804. doi: 10.1093/schbul/sbl033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chess AC, Landers AM, Bucci DJ. l-Kynurenine treatment alters contextual fear conditioning and context discrimination but not cue-specific fear conditioning. Behav. Brain Res. 2009;201(2):325–331. doi: 10.1016/j.bbr.2009.03.013. [DOI] [PubMed] [Google Scholar]
  21. Conne B, Stutz A, Vassalli JD. The 3′ untranslated region of messenger RNA: a molecular ‘hotspot’ for pathology? Nat. Med. 2000;6(6):637–641. doi: 10.1038/76211. [DOI] [PubMed] [Google Scholar]
  22. Consortium, 1000 Genomes Project, and Altshuler D. Abecasis GR, Auton A, Brooks LD, Durbin RM, Gibbs RA, Hurles ME, McVean GA, Xue Yali, Cartwright Reed A, Altshuler David, Keebler Jonathan, Kokko-Gonzales Paula, Nickerson Deborah A. A map of human genome variation from population-scale sequencing. Nature. 2010;467(7319):1061–73. doi: 10.1038/nature09534. added. added. doi:10.1038/nature09534. Erratum in: Nature. 2011 May 26;473(7348):544. (467):1061-1073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Consortium, International HapMap The International HapMap Project. Nature. 2003;18(426):789–796. doi: 10.1038/nature02168. [DOI] [PubMed] [Google Scholar]
  24. Coyle JT. The glutamatergic dysfunction hypothesis for schizophrenia. Harv. Rev. Psychiatry. 1996;3(5):241–253. doi: 10.3109/10673229609017192. [DOI] [PubMed] [Google Scholar]
  25. Coyle JT, Tsai G, Goff D. Converging evidence of NMDA receptor hypofunction in the pathophysiology of schizophrenia. Ann. N. Y. Acad. Sci. 2003;1003:318–327. doi: 10.1196/annals.1300.020. [DOI] [PubMed] [Google Scholar]
  26. Cullum CM, Harris JG, Waldo MC, Smernoff E, Madison A, Nagamoto HT, Griffith J, Adler LE, Freedman R. Neurophysiological and neuropsychological evidence for attentional dysfunction in schizophrenia. Schizophr. Res. 1993;10(2):131–141. doi: 10.1016/0920-9964(93)90048-n. [DOI] [PubMed] [Google Scholar]
  27. Dahan O, Gingold H, Pilpel Y. Regulatory mechanisms and networks couple the different phases of gene expression. Trends Genet. 2011;27(8):316–322. doi: 10.1016/j.tig.2011.05.008. http://dx.doi.org/10.1016/j.tig.2011.05.008. [DOI] [PubMed] [Google Scholar]
  28. Davis S, Butcher SP, Morris RG. The NMDA receptor antagonist D-2-amino-5-phosphonopentanoate (D-AP5) impairs spatial learning and LTP in vivo at intracerebral concentrations comparable to those that block LTP in vitro. J. Neurosci. 1992;12(1):21–34. doi: 10.1523/JNEUROSCI.12-01-00021.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Dobelis P, Staley KJ, Cooper DC. Lack of modulation of nicotinic acetylcholine alpha-7 receptor currents by kynurenic acid in adult hippocampal interneurons. PLoS One. 2012;7(7):e41108. doi: 10.1371/journal.pone.0041108. http://dx.doi.org/10.1371/journal.pone.0041108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub RE, Goldman D, Weinberger DR. Effect of COMT Val108/158 Met genotype on frontal lobe function and risk for schizophrenia. Proc. Natl. Acad. Sci. U. S. A. 2001;98(12):6917–6922. doi: 10.1073/pnas.111134598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Erhardt S, Blennow K, Nordin C, Skogh E, Lindström LH, Engberg G. Kynurenic acid levels are elevated in the cerebrospinal fluid of patients with schizophrenia. Neurosci. Lett. 2001a;313(1-2):96–98. doi: 10.1016/s0304-3940(01)02242-x. [DOI] [PubMed] [Google Scholar]
  32. Erhardt S, Oberg H, Mathe JM, Engberg G. Pharmacological elevation of endogenous kynurenic acid levels activates nigral dopamine neurons. Amino Acids. 2001b;20(4):353–362. doi: 10.1007/s007260170032. [DOI] [PubMed] [Google Scholar]
  33. Erhardt S, Schwieler L, Emanuelsson C, Geyer M. Endogenous kynurenic acid disrupts prepulse inhibition. Biol. Psychiatry. 2004;56(4):255–260. doi: 10.1016/j.biopsych.2004.06.006. [DOI] [PubMed] [Google Scholar]
  34. Erwin RJ, Turetsky BI, Moberg P, Gur RC, Gur RE. P50 abnormalities in schizophrenia: relationship to clinical and neuropsychological indices of attention. Schizophr. Res. 1998;33(3):157–167. doi: 10.1016/s0920-9964(98)00075-9. [DOI] [PubMed] [Google Scholar]
  35. First MB, Spitzer RL, Gibbon M, Williams JBW. Structured Clinical Interview for DSM-IV Axis I Disorders. American Psychiatric Publishing, Inc.; Arlington: 1997. Reprint, NOT IN FILE. [Google Scholar]
  36. Foster AC, Kemp JA, Leeson PD, Grimwood S, Donald AE, Marshall GR, Priestley T, Smith JD, Carling RW. Kynurenic acid analogues with improved affinity and selectivity for the glycine site on the N-methyl-d-aspartate receptor from rat brain. Mol. Pharmacol. 1992;41(5):914–922. [PubMed] [Google Scholar]
  37. Freedman R, Adler LE, Waldo MC, Pachtman E, Franks RD. Neurophysiological evidence for a defect in inhibitory pathways in schizophrenia: comparison of medicated and drug-free patients. Biol. Psychiatry. 1983;18(5):537–551. [PubMed] [Google Scholar]
  38. Freedman R, Coon H, Myles-Worsley M, Orr-Urtreger A, Olincy A, Davis A, Polymeropoulos M, Holik J, Hopkins J, Hoff M, Rosenthal J, Waldo MC, Reimherr F, Wender P, Yaw J, Young DA, Breese CR, Adams C, Patterson D, Adler LE, Kruglyak L, Leonard S, Byerley W. Linkage of a neurophysiological deficit in schizophrenia to a chromosome 15 locus. Proc. Natl. Acad. Sci. U. S. A. 1997;94(2):587–592. doi: 10.1073/pnas.94.2.587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DeFelice M, Lochner A, Faggart M, Liu-Cordero SN, Rotimi C, Adeyemo A, Cooper R, Ward R, Lander ES, Daly MJ, Altshuler D. The structure of haplotype blocks in the human genome. Science. 2002;296(5576):2225–2229. doi: 10.1126/science.1069424. [DOI] [PubMed] [Google Scholar]
  40. Giorgini F, Huang SY, Sathyasaikumar KV, Notarangelo FM, Thomas MA, Tararina M, Wu HQ, Schwarcz R, Muchowski PJ. Targeted deletion of kynurenine 3-monooxygenase in mice: a new tool for studying kynurenine pathway metabolism in periphery and brain. J. Biol. Chem. 2013;288(51):36554–36566. doi: 10.1074/jbc.M113.503813. http://dx.doi.org/10.1074/jbc.M113.503813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Gold JM. Cognitive deficits as treatment targets in schizophrenia. Schizophr. Res. 2004;72(1):21–28. doi: 10.1016/j.schres.2004.09.008. [DOI] [PubMed] [Google Scholar]
  42. Gold JM, Rehkemper G, Binks SW, III, Carpenter CJ, Fleming K, Goldberg TE, Weinberger DR. Learning and forgetting in schizophrenia. J. Abnorm. Psychol. 2000;109(3):534–538. [PubMed] [Google Scholar]
  43. Gold JM, Goldberg RW, McNary SW, Dixon LB, Lehman AF. Cognitive correlates of job tenure among patients with severe mental illness. Am. J. Psychiatry. 2002;159(8):1395–1402. doi: 10.1176/appi.ajp.159.8.1395. [DOI] [PubMed] [Google Scholar]
  44. Goldberg TE, Gomar JJ. Targeting cognition in schizophrenia research: from etiology to treatment. Am. J. Psychiatry. 2009;166(6):631–634. doi: 10.1176/appi.ajp.2009.09040497. http://dx.doi.org/10.1176/appi.ajp.2009.09040497. [DOI] [PubMed] [Google Scholar]
  45. Green MF. What are the functional consequences of neurocognitive deficits in schizophrenia? Am. J. Psychiatr. 1996;153:321–330. doi: 10.1176/ajp.153.3.321. [DOI] [PubMed] [Google Scholar]
  46. Green MF, Kern RS, Braff DL, Mintz J. Neurocognitive deficits and functional outcome in schizophrenia: are we measuring the “right stuff”? Schizophr. Bull. 2000;26(1):119–136. doi: 10.1093/oxfordjournals.schbul.a033430. [DOI] [PubMed] [Google Scholar]
  47. Guillemin GJ, Kerr SJ, Smythe GA, Armati PJ, Brew BJ. Kynurenine pathway metabolism in human astrocytes. Adv. Exp. Med. Biol. 1999;467:125–131. doi: 10.1007/978-1-4615-4709-9_18. [DOI] [PubMed] [Google Scholar]
  48. Hardy GH. Mendelian proportions in a mixed population. Science. 1908;28:49–50. doi: 10.1126/science.28.706.49. Reprinted in Jameson 1977. [DOI] [PubMed] [Google Scholar]
  49. Harvey PD, Geyer MA, Robbins TW, Krystal JH. Cognition in schizophrenia: from basic science to clinical treatment. Psychopharmacology (Berl) 2003;169(3-4):213–214. doi: 10.1007/s00213-003-1581-0. http://dx.doi.org/10.1007/s00213-003-1581-0. [DOI] [PubMed] [Google Scholar]
  50. Harvey PD, Heaton RK, Carpenter WT, Jr., Green MF, Gold JM, Schoenbaum M. Functional impairment in people with schizophrenia: focus on employability and eligibility for disability compensation. Schizophr. Res. 2012;140(1-3):1–8. doi: 10.1016/j.schres.2012.03.025. http://dx.doi.org/10.1016/j.schres.2012.03.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Hill SK, Reilly JL, Harris MS, Rosen C, Marvin RW, Deleon O, Sweeney JA. A comparison of neuropsychological dysfunction in first-episode psychosis patients with unipolar depression, bipolar disorder, and schizophrenia. Schizophr. Res. 2009;113(2-3):167–175. doi: 10.1016/j.schres.2009.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Hill SK, Reilly JL, Keefe RS, Gold JM, Bishop JR, Gershon ES, Tamminga CA, Pearlson GD, Keshavan MS, Sweeney JA. Neuropsychological impairments in schizophrenia and psychotic bipolar disorder: findings from the Bipolar-Schizophrenia Network on Intermediate Phenotypes (B-SNIP) study. Am. J. Psychiatry. 2013;170(11):1275–1284. doi: 10.1176/appi.ajp.2013.12101298. http://dx.doi.org/10.1176/appi.ajp.2013.12101298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque EX. The brain metabolite kynurenic acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications. J. Neurosci. 2001;21(19):7463–7473. doi: 10.1523/JNEUROSCI.21-19-07463.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Hobert O. Gene regulation by transcription factors and microRNAs. Science. 2008;319(5871):1785–1786. doi: 10.1126/science.1151651. http://dx.doi.org/10.1126/science.1151651. [DOI] [PubMed] [Google Scholar]
  55. Holtze M, Saetre P, Engberg G, Schwieler L, Werge T, Andreassen OA, Hall H, Terenius L, Agartz I, Jonsson EG, Schalling M, Erhardt S. Kynurenine 3-monooxygenase polymorphisms: relevance for kynurenic acid synthesis in patients with schizophrenia and healthy controls. J. Psychiatry Neurosci. 2012;37(1):53–57. doi: 10.1503/jpn.100175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Hong LE, Summerfelt A, Mitchell BD, McMahon RP, Wonodi I, Buchanan RW, Thaker GK. Sensory gating endophenotype based on its neural oscillatory pattern and heritability estimate. Arch. Gen. Psychiatry. 2008;65(9):1008–1016. doi: 10.1001/archpsyc.65.9.1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Hyman SE, Fenton WS. Medicine. What are the right targets for psychopharmacology? Science. 2003;299(5605):350–351. doi: 10.1126/science.1077141. [DOI] [PubMed] [Google Scholar]
  58. Insel TR. Assessing the economic costs of serious mental illness. Am. J. Psychiatry. 2008;165(6):663–665. doi: 10.1176/appi.ajp.2008.08030366. http://dx.doi.org/10.1176/appi.ajp.2008.08030366. [DOI] [PubMed] [Google Scholar]
  59. Jaaskelainen E, Juola P, Hirvonen N, McGrath JJ, Saha S, Isohanni M, Veijola J, Miettunen J. A systematic review and meta-analysis of recovery in schizophrenia. Schizophr. Bull. 2013;39(6):1296–1306. doi: 10.1093/schbul/sbs130. http://dx.doi.org/10.1093/schbul/sbs130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Javitt DC. Glutamate and schizophrenia: phencyclidine, N-methyl-d-aspartate receptors, and dopamine-glutamate interactions. Int. Rev. Neurobiol. 2007;78:69–108. doi: 10.1016/S0074-7742(06)78003-5. [DOI] [PubMed] [Google Scholar]
  61. Johnson GC, Esposito L, Barratt BJ, Smith AN, Heward J, Di Genova G, Ueda H, Cordell HJ, Eaves IA, Dudbridge F, Twells RC, Payne F, Hughes W, Nutland S, Stevens H, Carr P, Tuomilehto-Wolf E, Tuomilehto J, Gough SC, Clayton DG, Todd JA. Haplotype tagging for the identification of common disease genes. Nat. Genet. 2001;29(2):233–237. doi: 10.1038/ng1001-233. http://dx.doi.org/10.1038/ng1001-233. [DOI] [PubMed] [Google Scholar]
  62. Kessler RC, Heeringa S, Lakoma MD, Petukhova M, Rupp AE, Schoenbaum M, Wang PS, Zaslavsky AM. Individual and societal effects of mental disorders on earnings in the United States: results from the national comorbidity survey replication. Am. J. Psychiatry. 2008;165(6):703–711. doi: 10.1176/appi.ajp.2008.08010126. http://dx.doi.org/10.1176/appi.ajp.2008.08010126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Kim JS, Levin ED. Nicotinic, muscarinic and dopaminergic actions in the ventral hippocampus and the nucleus accumbens: effects on spatial working memory in rats. Brain Res. 1996;725(2):231–240. doi: 10.1016/0006-8993(96)00213-2. [DOI] [PubMed] [Google Scholar]
  64. Krystal JH, Karper LP, Seibyl JP, Freeman GK, Delaney R, Bremner D, Heninger GR, Bowers MB, Charney DS. Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans: psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Arch. Gen. Psychiatry. 1994;51:199–214. doi: 10.1001/archpsyc.1994.03950030035004. [DOI] [PubMed] [Google Scholar]
  65. Lahti AC, Weiler MA, Tamara Michaelidis BA, Parwani A, Tamminga CA. Effects of ketamine in normal and schizophrenic volunteers. Neuropsychopharmacology. 2001;25(4):455–467. doi: 10.1016/S0893-133X(01)00243-3. [DOI] [PubMed] [Google Scholar]
  66. Lavebratt C, Olsson S, Backlund L, Frisen L, Sellgren C, Priebe L, Nikamo P, Traskman-Bendz L, Cichon S, Vawter MP, Osby U, Engberg G, Landen M, Erhardt S, Schalling M. The KMO allele encoding Arg(452) is associated with psychotic features in bipolar disorder type 1, and with increased CSF KYNA level and reduced KMO expression. Mol. Psychiatry. 2014;19(3):334–341. doi: 10.1038/mp.2013.11. http://dx.doi.org/10.1038/mp.2013.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Leonard S, Adams C, Breese CR, Adler LE, Bickford P, Byerley W, Coon H, Griffith JM, Miller C, Myles-Worsley M, Nagamoto HT, Rollins Y, Stevens KE, Waldo M, Freedman R. Nicotinic receptor function in schizophrenia. Schizophr. Bull. 1996;22(3):431–445. doi: 10.1093/schbul/22.3.431. [DOI] [PubMed] [Google Scholar]
  68. Levin ED, Simon BB. Nicotinic acetylcholine involvement in cognitive function in animals. Psychopharmacology (Berl) 1998;138(3-4):217–230. doi: 10.1007/s002130050667. [DOI] [PubMed] [Google Scholar]
  69. Linderholm KR, Skogh E, Olsson SK, Dahl ML, Holtze M, Engberg G, Samuelsson M, Erhardt S. Mayy. Increased levels of kynurenine and kynurenic acid in the CSF of patients with schizophrenia. Schizophr Bull. 2012 Aug 20;38(3):426–432. doi: 10.1093/schbul/sbq086. http://dx.doi.org/10.1093/schbul/sbq086 Epub 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Lopes C, Pereira EF, Wu HQ, Purushottamachar P, Njar V, Schwarcz R, Albuquerque EX. Competitive antagonism between the nicotinic allosteric potentiating ligand galantamine and kynurenic acid at alpha7* nicotinic receptors. J. Pharmacol. Exp. Ther. 2007;322(1):48–58. doi: 10.1124/jpet.107.123109. [DOI] [PubMed] [Google Scholar]
  71. Maher BJ, LoTurco JJ. Disrupted-in-schizophrenia (DISC1) functions presynaptically at glutamatergic synapses. PLoS One. 2012;7(3):e34053. doi: 10.1371/journal.pone.0034053. http://dx.doi.org/10.1371/journal.pone.0034053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Malhotra AK, Pinals DA, Weingartner H, Sirocco K, Missar CD, Pickar D, Breier A. NMDA receptor function and human cognition: the effects of ketamine in healthy volunteers. Neuropsychopharmacology. 1996;14(5):301–307. doi: 10.1016/0893-133X(95)00137-3. [DOI] [PubMed] [Google Scholar]
  73. Martinez-Aran A, Vieta E, Torrent C, Sanchez-Moreno J, Goikolea JM, Salamero M, Malhi GS, Gonzalez-Pinto A, Daban C, Alvarez-Grandi S, Fountoulakis K, Kaprinis G, Tabares-Seisdedos R, Ayuso-Mateos JL. Functional outcome in bipolar disorder: the role of clinical and cognitive factors. Bipolar Disord. 2007;9(1-2):103–113. doi: 10.1111/j.1399-5618.2007.00327.x. http://dx.doi.org/10.1111/j.1399-5618.2007.00327.x. [DOI] [PubMed] [Google Scholar]
  74. Martinez-Aran A, Torrent C, Tabares-Seisdedos R, Salamero M, Daban C, Balanza-Martinez V, Sanchez-Moreno J, Manuel Goikolea J, Benabarre A, Colom F, Vieta E. Neurocognitive impairment in bipolar patients with and without history of psychosis. J. Clin. Psychiatry. 2008;69(2):233–239. doi: 10.4088/jcp.v69n0209. [DOI] [PubMed] [Google Scholar]
  75. Maynard TM, Sikich L, Lieberman JA, LaMantia AS. Neural development, cell-cell signaling, and the “two-hit” hypothesis of schizophrenia. Schizophr. Bull. 2001;27(3):457–476. doi: 10.1093/oxfordjournals.schbul.a006887. [DOI] [PubMed] [Google Scholar]
  76. Millan MJ, Agid Y, Brune M, Bullmore ET, Carter CS, Clayton NS, Connor R, Davis S, Deakin B, DeRubeis RJ, Dubois B, Geyer MA, Goodwin GM, Gorwood P, Jay TM, Joels M, Mansuy IM, Meyer-Lindenberg A, Murphy D, Rolls E, Saletu B, Spedding M, Sweeney J, Whittington M, Young LJ. Cognitive dysfunction in psychiatric disorders: characteristics, causes and the quest for improved therapy. Nat. Rev. Drug Discov. 2012;11(2):141–168. doi: 10.1038/nrd3628. [DOI] [PubMed] [Google Scholar]
  77. Mok MH, Fricker AC, Weil A, Kew JN. Electrophysiological characterisation of the actions of kynurenic acid at ligand-gated ion channels. Neuropharmacology. 2009;57(3):242–249. doi: 10.1016/j.neuropharm.2009.06.003. [DOI] [PubMed] [Google Scholar]
  78. Montgomery SB, Dermitzakis ET. From expression QTLs to personalized transcriptomics. Nat. Rev. Genet. 2011;12(4):277–282. doi: 10.1038/nrg2969. http://dx.doi.org/10.1038/nrg2969. [DOI] [PubMed] [Google Scholar]
  79. Moroni F, Russi P, Carla V, Lombardi G. Kynurenic acid is present in the rat brain and its content increases during development and aging processes. Neurosci. Lett. 1988;94(1-2):145–150. doi: 10.1016/0304-3940(88)90285-6. [DOI] [PubMed] [Google Scholar]
  80. Morris RG, Anderson E, Lynch GS, Baudry M. Selective impairment of learning and blockade of long-term potentiation by an N-methyl-d-aspartate receptor antagonist, AP5. Nature. 1986;319(6056):774–776. doi: 10.1038/319774a0. [DOI] [PubMed] [Google Scholar]
  81. Newcomer JW, Krystal JH. NMDA receptor regulation of memory and behavior in humans. Hippocampus. 2001;11(5):529–542. doi: 10.1002/hipo.1069. http://dx.doi.org/10.1002/hipo.1069. [DOI] [PubMed] [Google Scholar]
  82. Newcomer JW, Farber NB, Jevtovic-Todorovic V, Selke G, Melson AK, Hershey T, Craft S, Olney JW. Ketamine-induced NMDA receptor hypofunction as a model of memory impairment and psychosis. Neuropsychopharmacology. 1999;20(2):106–118. doi: 10.1016/S0893-133X(98)00067-0. [DOI] [PubMed] [Google Scholar]
  83. Newhouse PA, Potter A, Levin ED. Nicotinic system involvement in Alzheimer’s and Parkinson’s diseases. Implications for therapeutics. Drugs Aging. 1997;11(3):206–228. doi: 10.2165/00002512-199711030-00005. [DOI] [PubMed] [Google Scholar]
  84. Nica AC, Montgomery SB, Dimas AS, Stranger BE, Beazley C, Barroso I, Dermitzakis ET. Candidate causal regulatory effects by integration of expression QTLs with complex trait genetic associations. PLoS Genet. 2010;6(4):e1000895. doi: 10.1371/journal.pgen.1000895. http://dx.doi.org/10.1371/journal.pgen.1000895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Nilsson LK, Linderholm KR, Engberg G, Paulson L, Blennow K, Lindström LH, Nordin C, Karanti A, Persson P, Erhardt S. Elevated levels of kynurenic acid in the cerebrospinal fluid of male patients with schizophrenia. Schizophr. Res. 2005;80(2-3):315–322. doi: 10.1016/j.schres.2005.07.013. [DOI] [PubMed] [Google Scholar]
  86. Olsson SK, Samuelsson M, Saetre P, Lindstrom L, Jonsson EG, Nordin C, Engberg G, Erhardt S, Landen M. Elevated levels of kynurenic acid in the cerebrospinal fluid of patients with bipolar disorder. J. Psychiatry Neurosci. 2010;35(3):195–199. doi: 10.1503/jpn.090180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Olsson SK, Sellgren C, Engberg G, Landen M, Erhardt S. Cerebrospinal fluid kynurenic acid is associated with manic and psychotic features in patients with bipolar I disorder. Bipolar Disord. 2012;14(7):719–726. doi: 10.1111/bdi.12009. http://dx.doi.org/10.1111/bdi.12009. [DOI] [PubMed] [Google Scholar]
  88. Parsons CG, Danysz W, Quack G, Hartmann S, Lorenz B, Wollenburg C, Baran L, Przegalinski E, Kostowski W, Krzascik P, Chizh B, Headley PM. Novel systemically active antagonists of the glycine site of the N-methyl-d-aspartate receptor: electrophysiological, biochemical and behavioral characterization. J. Pharmacol. Exp. Ther. 1997;283(3):1264–1275. [PubMed] [Google Scholar]
  89. Perkins MN, Stone TW. An iontophoretic investigation of the actions of convulsant kynurenines and their interaction with the endogenous excitant quinolinic acid. Brain Res. 1982;247(1):184–187. doi: 10.1016/0006-8993(82)91048-4. [DOI] [PubMed] [Google Scholar]
  90. Pocivavsek A, Wu HQ, Elmer GI, Bruno JP, Schwarcz R. Pre- and postnatal exposure to kynurenine causes cognitive deficits in adulthood. Eur. J. Neurosci. 2012;35(10):1605–1612. doi: 10.1111/j.1460-9568.2012.08064.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Potter D, Summerfelt A, Gold J, Buchanan RW. Review of clinical correlates of P50 sensory gating abnormalities in patients with schizophrenia. Schizophr. Bull. 2006;32(4):692–700. doi: 10.1093/schbul/sbj050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Potter MC, Elmer GI, Bergeron R, Albuquerque EX, Guidetti P, Wu HQ, Schwarcz R. Jul. Reduction of endogenous kynurenic acid formation enhances extracellular glutamate, hippocampal plasticity, and cognitive behavior. Neuropsychopharmacology. 2010 Mar 24;35(8):1734–1742. doi: 10.1038/npp.2010.39. http://dx.doi.org/10.1038/npp.2010.39 Epub 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Pritchard JK, Rosenberg NA. Use of unlinked genetic markers to detect population stratification in association studies. Am. J. Hum. Genet. 1999;65(1):220–228. doi: 10.1086/302449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155(2):945–959. doi: 10.1093/genetics/155.2.945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Prouteau A, Verdoux H, Briand C, Lesage A, Lalonde P, Nicole L, Reinharz D, Stip E. Cognitive predictors of psychosocial functioning outcome in schizophrenia: a follow-up study of subjects participating in a rehabilitation program. Schizophr. Res. 2005;77(2-3):343–353. doi: 10.1016/j.schres.2005.03.001. [DOI] [PubMed] [Google Scholar]
  96. Rassoulpour A, Wu HQ, Ferre S, Schwarcz R. Nanomolar concentrations of kynurenic acid reduce extracellular dopamine levels in the striatum. J. Neurochem. 2005;93(3):762–765. doi: 10.1111/j.1471-4159.2005.03134.x. http://dx.doi.org/10.1111/j.1471-4159.2005.03134.x. [DOI] [PubMed] [Google Scholar]
  97. Reich DE, Cargill M, Bolk S, Ireland J, Sabeti PC, Richter DJ, Lavery T, Kouyoumjian R, Farhadian SF, Ward R, Lander ES. Linkage disequilibrium in the human genome. Nature. 2001;411(6834):199–204. doi: 10.1038/35075590. [DOI] [PubMed] [Google Scholar]
  98. Reilly JL, Frankovich K, Hill S, Gershon ES, Keefe RS, Keshavan MS, Pearlson GD, Tamminga CA, Sweeney JA. Elevated antisaccade error rate as an intermediate phenotype for psychosis across diagnostic categories. Schizophr. Bull. 2013 doi: 10.1093/schbul/sbt132. http://dx.doi.org/10.1093/schbul/sbt132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Reitan RM, Wolfson D. The Halstead-Reitan Neuropsychological Test Battery. Neuropsychology Press; Tuscon, AZ: 1971. [Google Scholar]
  100. Ripke S, Ripke S, O’Dushlaine C, Chambert K, Moran JL, Kahler AK, Akterin S, Bergen SE, Collins AL, Crowley JJ, Fromer M, Kim Y, Lee SH, Magnusson PK, Sanchez N, Stahl EA, Williams S, Wray NR, Xia K, Bettella F, Borglum AD, Bulik-Sullivan BK, Cormican P, Craddock N, de Leeuw C, Durmishi N, Gill M, Golimbet V, Hamshere ML, Holmans P, Hougaard DM, Kendler KS, Lin K, Morris DW, Mors O, Mortensen PB, Neale BM, O’Neill FA, Owen MJ, Milovancevic MP, Posthuma D, Powell J, Richards AL, Riley BP, Ruderfer D, Rujescu D, Sigurdsson E, Silagadze T, Smit AB, Stefansson H, Steinberg S, Suvisaari J, Tosato S, Verhage M, Walters JT, Consortium Multicenter Genetic Studies of Schizophrenia. Levinson DF, Gejman PV, Kendler KS, Laurent C, Mowry BJ, O’Donovan MC, Owen MJ, Pulver AE, Riley BP, Schwab SG, Wildenauer DB, Dudbridge F, Holmans P, Shi J, Albus M, Alexander M, Campion D, Cohen D, Dikeos D, Duan J, Eichhammer P, Godard S, Hansen M, Lerer FB, Liang KY, Maier W, Mallet J, Nertney DA, Nestadt G, Norton N, O’Neill FA, Papadimitriou GN, Ribble R, Sanders AR, Silverman JM, Walsh D, Williams NM, Wormley B, Consortium Psychosis Endophenotypes International. Arranz MJ, Bakker S, Bender S, Bramon E, Collier D, Crespo-Facorro B, Hall J, Iyegbe C, Jablensky A, Kahn RS, Kalaydjieva L, Lawrie S, Lewis CM, Lin K, Linszen DH, Mata I, McIntosh A, Murray RM, Ophoff RA, Powell J, Rujescu D, Van Os J, Walshe M, Weisbrod M, Wiersma D, Consortium Wellcome Trust Case Control. Donnelly P, Barroso I, Blackwell JM, Bramon E, Brown MA, Casas JP, Corvin AP, Deloukas P, Duncanson A, Jankowski J, Markus HS, Mathew CG, Palmer CN, Plomin R, Rautanen A, Sawcer SJ, Trembath RC, Viswanathan AC, Wood NW, Spencer CC, Band G, Bellenguez C, Freeman C, Hellenthal G, Giannoulatou E, Pirinen M, Pearson RD, Strange A, Su Z, Vukcevic D, Donnelly P, Langford C, Hunt SE, Edkins S, Gwilliam R, Blackburn H, Bumpstead SJ, Dronov S, Gillman M, Gray E, Hammond N, Jayakumar A, McCann OT, Liddle J, Potter SC, Ravindrarajah R, Ricketts M, Tashakkori-Ghanbaria A, Waller MJ, Weston P, Widaa S, Whittaker P, Barroso I, Deloukas P, Mathew CG, Blackwell JM, Brown MA, Corvin AP, McCarthy MI, Spencer CC, Bramon E, Corvin AP, O’Donovan MC, Stefansson K, Scolnick E, Purcell S, McCarroll SA, Sklar P, Hultman CM, Sullivan PF. Genome-wide association analysis identifies 13 new risk loci for schizophrenia. Nat. Genet. 2013;45(10):1150–1159. doi: 10.1038/ng.2742. http://dx.doi.org/10.1038/ng.2742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Ross RG, Olincy A, Harris JG, Radant A, Adler LE, Compagnon N, Freedman R. The effects of age on a smooth pursuit tracking task in adults with schizophrenia and normal subjects. Biol. Psychiatry. 1999;46(3):383–391. doi: 10.1016/s0006-3223(98)00369-2. [DOI] [PubMed] [Google Scholar]
  102. Rusted JM, Newhouse PA, Levin ED. Nicotinic treatment for degenerative neuropsychiatric disorders such as Alzheimer’s disease and Parkinson’s disease. Behav. Brain Res. 2000;113(1-2):121–129. doi: 10.1016/s0166-4328(00)00207-2. [DOI] [PubMed] [Google Scholar]
  103. Sanchez-Morla EM, Santos JL, Aparicio A, Garcia-Jimenez MA, Soria C, Arango C. Neuropsychological correlates of P50 sensory gating in patients with schizophrenia. Schizophr. Res. 2013;143(1):102–106. doi: 10.1016/j.schres.2012.10.017. http://dx.doi.org/10.1016/j.schres.2012.10.017. [DOI] [PubMed] [Google Scholar]
  104. Sathyasaikumar KV, Stachowski EK, Wonodi I, Roberts RC, Rassoulpour A, McMahon RP, Schwarcz R. Impaired kynurenine pathway metabolism in the prefrontal cortex of individuals with schizophrenia. Schizophr Bull. 2011;37(6):1147–1156. doi: 10.1093/schbul/sbq112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  105. Scharfman HE, Goodman JH, Schwarcz R. Electrophysiological effects of exogenous and endogenous kynurenic acid in the rat brain: studies in vivo and in vitro. Amino Acids. 2000;19(1):283–297. doi: 10.1007/s007260070060. [DOI] [PubMed] [Google Scholar]
  106. Schizophrenia Psychiatric Genome-Wide Association Study, Consortium Genome-wide association study identifies five new schizophrenia loci. Nat. Genet. 2011;43(10):969–976. doi: 10.1038/ng.940. http://dx.doi.org/10.1038/ng.940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  107. Schwarcz R, Whetsell WO, Jr., Mangano RM. Quinolinic acid: an endogenous metabolite that produces axon-sparing lesions in rat brain. Science. 1983;219(4582):316–318. doi: 10.1126/science.6849138. [DOI] [PubMed] [Google Scholar]
  108. Schwarcz R, Rassoulpour A, Wu HQ, Medoff D, Tamminga CA, Roberts RC. Increased cortical kynurenate content in schizophrenia. Biol. Psychiatry. 2001;50(7):521–530. doi: 10.1016/s0006-3223(01)01078-2. [DOI] [PubMed] [Google Scholar]
  109. Sheffield JM, Gold JM, Strauss ME, Carter CS, Macdonald AW, III, Ragland JD, Silverstein SM, Barch DM. Common and specific cognitive deficits in schizophrenia: relationships to function. Cogn. Affect. Behav. Neurosci. 2013 doi: 10.3758/s13415-013-0211-5. http://dx.doi.org/10.3758/s13415-013-0211-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  110. Shepard PD, Joy B, Clerkin L, Schwarcz R. Micromolar brain levels of kynurenic acid are associated with a disruption of auditory sensory gating in the rat. Neuropsychopharmacology. 2003;28(8):1454–1462. doi: 10.1038/sj.npp.1300188. [DOI] [PubMed] [Google Scholar]
  111. Smith AK, Edgar JC, Huang M, Lu BY, Thoma RJ, Hanlon FM, McHaffie G, Jones AP, Paz RD, Miller GA, Canive JM. Cognitive abilities and 50- and 100-msec paired-click processes in schizophrenia. Am. J. Psychiatry. 2010;167(10):1264–1275. doi: 10.1176/appi.ajp.2010.09071059. http://dx.doi.org/10.1176/appi.ajp.2010.09071059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  112. Soni A. Statistical Brief #248. Agency for Healthcare Research and Quality; Rockville, MD: Jul, 2009. The Five Most Costly Conditions, 1996 and 2006: Estimates for the U.S. Civilian Noninstitutionalized Population. http://www.meps.ahrq.gov/mepsweb/data_files/publications/st248/stat248.pdf. [Google Scholar]
  113. Stahl SM. The genetics of schizophrenia converge upon the NMDA glutamate receptor. CNS Spectr. 2007;12(8):583–588. doi: 10.1017/s1092852900021374. [DOI] [PubMed] [Google Scholar]
  114. Stone TW. Neuropharmacology of quinolinic and kynurenic acids. Pharmacol. Rev. 1993;45(3):309–379. [PubMed] [Google Scholar]
  115. Stone TW, Darlington LG. The kynurenine pathway as a therapeutic target in cognitive and neurodegenerative disorders. Br. J. Pharmacol. 2013;169(6):1211–1227. doi: 10.1111/bph.12230. http://dx.doi.org/10.1111/bph.12230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  116. Stone TW, Perkins MN. Quinolinic acid: a potent endogenous excitant at amino acid receptors in CNS. Eur. J. Pharmacol. 1981;72(4):411–412. doi: 10.1016/0014-2999(81)90587-2. [DOI] [PubMed] [Google Scholar]
  117. Stone TW, Stoy N, Darlington LG. An expanding range of targets for kynurenine metabolites of tryptophan. Trends Pharmacol. Sci. 2013;34(2):136–143. doi: 10.1016/j.tips.2012.09.006. http://dx.doi.org/10.1016/j.tips.2012.09.006. [DOI] [PubMed] [Google Scholar]
  118. Tamminga CA. The neurobiology of cognition in schizophrenia. J. Clin. Psychiatry. 2006;67(9):e11. [PubMed] [Google Scholar]
  119. Thaker GK, Wonodi I, Avila MT, Hong LE, Stine OC. Catechol O-methyltransferase polymorphism and eye tracking in schizophrenia: a preliminary report. Am. J. Psychiatry. 2004;161(12):2320–2322. doi: 10.1176/appi.ajp.161.12.2320. [DOI] [PubMed] [Google Scholar]
  120. Thoma RJ, Hanlon FM, Moses SN, Edgar JC, Huang M, Weisend MP, Irwin J, Sherwood A, Paulson K, Bustillo J, Adler LE, Miller GA, Canive JM. Lateralization of auditory sensory gating and neuropsychological dysfunction in schizophrenia. Am. J. Psychiatry. 2003;160(9):1595–1605. doi: 10.1176/appi.ajp.160.9.1595. [DOI] [PubMed] [Google Scholar]
  121. Wang G, Zhu JJ. DISC1 dynamically regulates synaptic N-methyl-d-aspartate responses in excitatory neurons. Biol. Psychiatry. 2014;75(5):348–350. doi: 10.1016/j.biopsych.2013.12.003. http://dx.doi.org/10.1016/j.biopsych.2013.12.003. [DOI] [PubMed] [Google Scholar]
  122. Warrington EK. Recognition Memory Test manual. NFER-Nelson; UK: 1984. [Google Scholar]
  123. Wechsler D. The Psychological Corporation; San Antonio, Texas: 1997. Manual for the Wechsler Adult Intelligence Scale, Third edition. Reprint, NOT IN FILE. [Google Scholar]
  124. Wechsler D. WASI. Psychological Group; San Antonio: 1999. Wechsler Abbreviated Scale of Intelligence. [Google Scholar]
  125. Wei J, Graziane NM, Wang H, Zhong P, Wang Q, Liu W, Hayashi-Takagi A, Korth C, Sawa A, Brandon NJ, Yan Z. Regulation of N-methyl-d-aspartate receptors by disrupted-in-schizophrenia-1. Biol. Psychiatry. 2014;75(5):414–424. doi: 10.1016/j.biopsych.2013.06.009. http://dx.doi.org/10.1016/j.biopsych.2013.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  126. Wolf H. Studies on tryptophan metabolism in man. Scand. J. Clin. Lab. Invest. 1974;136S:1–186. [Google Scholar]
  127. Wonodi I, Schwarcz R. Cortical kynurenine pathway metabolism: a novel target for cognitive enhancement in Schizophrenia. Schizophr. Bull. 2010;36(2):211–218. doi: 10.1093/schbul/sbq002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  128. Wonodi I, Hong LE, Stine OC, Mitchell BD, Elliott A, Roberts RC, Conley RR, McMahon RP, Thaker GK. Dopamine transporter polymorphism modulates oculomotor function and DAT1 mRNA expression in schizophrenia. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2009;150B(2):282–289. doi: 10.1002/ajmg.b.30811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  129. Wonodi I, Stine OC, Sathyasaikumar KV, Roberts RC, Mitchell BD, Hong LE, Kajii Y, Thaker GK. Downregulated kynurenine 3-monooxygenase gene expression and enzyme activity in schizophrenia and genetic association with schizophrenia endophenotypes. Arch. Gen. Psychiatry. 2011;68(7):665–674. doi: 10.1001/archgenpsychiatry.2011.71. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES