Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2015 Jul 30;5:11524. doi: 10.1038/srep11524

First mitochondrial genome for the red crab (Charybdis feriata) with implication of phylogenomics and population genetics

Hongyu Ma 1,2, Chunyan Ma 1,2, Chenhong Li 3, Jianxue Lu 1,2, Xiong Zou 1,2, Yangyang Gong 1,2, Wei Wang 1,2, Wei Chen 1,2, Lingbo Ma 1,2,a, Lianjun Xia 1,2,b
PMCID: PMC4520191  PMID: 26225473

Abstract

In this study, we first described the complete mitochondrial genome for the red crab (Charybdis feriata), elucidated its phylogenetic relationship among 20 species within Decapoda, and estimated the population genetic diversity. The mitochondrial genome was 15,660 bp in size and encoded 13 protein-coding genes, 22 transfer RNA (tRNA) genes, and two ribosomal RNA genes. The gene arrangement of the mitochondrial genome was the same as that of its sister species, C. japonica. Phylogenomic analysis suggested that genus Charybdis should be classified into subfamily Portuninae but not into subfamily Thalamitinae. Moreover, a total of 33 haplotypes of complete cytochrome c oxidase subunit I gene were defined in 70 individuals of C. feriata derived from three localities. Haplotype diversity and nucleotide diversity values among three localities indicated a high level of genetic diversity in C. feriata. AMOVA analysis suggested a low level of genetic differentiation among the three localities (FST = 0.0023, P > 0.05). Neutrality tests and mismatch analysis revealed that C. feriata might have undergone a population expansion event that possibly occurred in the last 61,498 to 43,814 years. This study should be helpful to better understand the evolutionary status, and population genetic diversity of C. feriata and related species.


The red crab, Charybdis feriata (Crustacea: Decapoda: Portunidae) (Linnaeus, 1758), also known as the crucifix crab, is a large swimming crab species that is broadly distributed in the Indo-Pacific sea areas, including Japan, China, Indonesia, Australia, India, Pakistan, Oman, and South Africa1,2. C. feriata can be easily distinguished by its striking red and white colour pattern and the distinct cross on the median surface of its carapace3. Young crabs usually live in the sandy shore, whereas adults prefer to inhabit the areas of sandy and muddy bottoms at depths from 30 m to 60 m4. Given its fast growth speed, large size, good flavor, and high market demand, this species is considered as one of most valuable fisheries resources and has become a potentially important target for aquaculture, domestication, and stock enhancement5,6. The wild females usually weigh 200 - 350 g, but the males can grow up to 1 kg7. In the last few decades, the catching production and the wild resources of C. feriata have been decreasing on a yearly basis8 due to over-exploitation and environmental deterioration. Despite its economic importance, studies have been limited to reproductive biology7,8, larvae characteristics9,10, and fishery biology11. Little information could be available about the germplasm resource and population genetic structure for this species by now, except that moderate variation was reported for two wild populations sampled from Shanwei City and Zhoushan City, China based on the cytochrome c oxidase subunit I (COI) gene and microsatellite markers, respectively12,13. To estimate and conserve this important crab resource, genetic studies such as population genetic diversity and evolutionary history should be carried out.

The genus Charybdis (De Haan, 1833) is an important group in family Portunidae. For a long time, the taxonomic status of this genus has remained controversial. Several studies have recommended to classify it into subfamily Portuninae of family Portunidae14,15,16. However, some other studies suggested to assign it to subfamily Thalamitinae of family Portunidae17,18. Molecular studies based on COI, 16S rRNA, and RAPD19,20 supported the latter opinion. However, the phylogenetic analysis based on 13 protein-coding genes from the mitochondrial genome21 supported the former opinion. Thus, in order to better solve this problem, more studies need to be carried out in the future.

Mitochondrial genome is a typically closed-circular molecule ranging approximately from 14 to 18 kb in size, and it consists of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 rRNA genes, and a control region. It is thought to be an ideal marker for studies on population genetic diversity, molecular phylogeny, and species identification because of its high mutation rate, simple structure, abundant distribution, and maternal inheritance22,23,24. Thus far, complete mitochondrial genomes have been reported in many crustacean species, such as Litopenaeus vannamei25, C. japonica21, Scylla serrata26, and S. paramamosain23. Although several mitochondrial gene sequences of C. feriata are present in the GenBank database, the complete mitochondrial genome information is still not available by now. The lack of complete mitochondrial genome has limited the development of population genetic diversity and molecular evolution for this species.

The purpose of this study is to report the complete mitochondrial genome for C. feriata, elucidate its evolutionary status, and estimate population genetic diversity and differentiation. This work should be helpful to better understand the evolutionary status and population genetic diversity of C. feriata and other related crustacean species.

Materials and methods

Sampling and DNA extraction

A total of 70 wild individuals of C. feriata were sampled from the southeastern coasts of China, with 21 from Hainan Island (named HN), 24 from the city of Xiamen (named XM), and 25 from the city of Zhoushan (named ZS) (Fig. 1). Animals were killed by a lethal dose of MS-222. Muscle tissues were collected and fixed in 99% ethanol at room temperature. Genomic DNA was extracted using the traditional proteinase K and phenol-chloroform extraction protocol as described by Ma27.

Figure 1. Three localities of Charybdis feriata collected in this study.

Figure 1

HN, Hainan locality; XM, Xiamen locality; ZS, Zhoushan locality. This map was created by the software Adobe Photoshop 7.0.

Primers, PCR, and sequencing

First, partial sequences of three genes (12 S rRNA, 16 S rRNA, and COI) of C. feriata and the complete mitochondrial genomes of three closely related crab species (C. japonica, S. paramamosain, and Portunus trituberculatus) were downloaded from the GenBank database. Then the three genes were confirmed by resequencing. Next, the complete mitochondrial genome of C. feriata was generated by overlapping PCR with specific or degenerate primers (Supplementary Table 1), and sequencing. Furthermore, the complete COI gene sequence was employed to evaluate the population genetic diversity and genetic differentiation of C. feriata population. A pair of primers (COI-f: 5′–AATAAGAAAGTTAATAACTTGTGTT–3′ and COI-r 5′–GAAGAAAAGTATCTTCCTAGTAGG–3′) with an anealing temperature of 52 °C were successfully designed. Seventy individuals collected from three localities (HN, XM, and ZS) were evaluated in this study.

PCRs were carried out in a 25 μL volume that included 0.4 μM each primer, 0.2 mM each dNTP, 1 × PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA at the following conditions: one cycle of denaturation at 94 °C for 4 min; 37 cycles of 30 s at 94 °C, 50 s at a primer-specific annealing temperature (Supplementary Table 1), and 50 s at 72 °C. As a final step, the products were extended for 7 min at 72 °C. The PCR products were separated on 1.5% agarose gels and directly sequenced in both directions by using an ABI Prism 3730 automated DNA sequencer (PE Corporation). The sequences were edited and assembled using two softwares, EditSeq and SeqMan (DNASTAR).

Complete mitochondrial genome analysis

The graphical map of the complete mitochondrial genome (Fig. 2) was drawn using the online software OrganellarGenomeDRAW (http://ogdraw.mpimp-golm.mpg.de/)28. The genome structure was determined by sequence comparisons with the known complete mitochondrial genomes of the closely related species, including S. paramamosain23 and C. japonica21. tRNAs were identified by their proposed clover-leaf secondary structure and anticodons by using the web-based tRNA-scan SE 1.21 program (http://lowelab.ucsc.edu/tRNAscan-SE/)29 with default search mode. Protein-coding genes were translated into amino acids by using the software MEGA 4.030. The codon usage of protein-coding genes and the nucleotide composition of the mitochondrial genome were also determined using MEGA 4.0. Finally, the complete mitochondrial genome DNA sequence was deposited into the GenBank database by using the software Sequin 12.30 (http://www.ncbi.nlm.nih.gov/Sequin/).

Figure 2. Graphical map of complete mitochondrial genome of Charybdis feriata.

Figure 2

Genes encoded by the heavy strand were shown outside the circle, and encoded by the light strand were shown inside the circle respectively. The inner ring showed the GC content of this genome.

Phylogenomic analysis

The complete mitochondrial genomes of 19 species under Decapoda were downloaded from the GenBank database, including Charybdis japonica (FJ460517), Callinectes sapidus (NC_006281), Eriocheir japonica (NC_011597), Eriocheir hepuensis (NC_011598), Eriocheir sinensis (NC_006992), Geothelphusa dehaani (NC_007379), Fenneropenaeus chinensis (DQ518969), Litopenaeus vannamei (DQ534543), Pagurus longicarpus (NC_003058), Macrobrachium rosenbergii (NC_006880), Marsupenaeus japonicus (NC_007010), Penaeus monodon (NC_002184), Portunus trituberculatus (AB093006), Panulirus japonicus (NC_004251), Pseudocarcinus gigas (NC_006891), Scylla serrata (NC_012565), Scylla tranquebarica (NC_012567), Scylla olivacea (NC_012569), and Scylla paramamosain (JX457150). Furthermore, one species, Harpiosquilla harpax (NC_006916), was used as an outgroup taxon.

Protein-coding genes were aligned using Clustal W in MEGA 4.0 with default settings. As a result, gene ND6 showed high heterogeneity that consistently causes poor phylogenetic performance31. Thus, the remaining 12 protein-coding genes alignments were concatenated to a single multiple sequence alignment. Then the multiple sequence alignment was formatted and analyzed using RAxML web-servers (http://embnet.vital-it.ch/raxml-bb/index.php)32. The CAT model was used to estimate the evolutionary rate of the 12 protein-coding genes. Maximum likelihood (ML) search was carried out after bootstraps. The phylogenetic tree was drawn by the software FigTree v1.4.2.

Population genetic analysis

Haplotypes were identified using software Dna SP version 5.033 and deposited into the GenBank database. For each locality and overall locality, haplotype diversity (h) and nucleotide diversity (π) were calculated using Dna SP version 5.0. Molecular variance (AMOVA) analysis was carried out using software Arlequin version 3.1134 to explain the genetic structure and differentiation among these three localities. Significant level of the test was assessed using 1000 permutations of each pairwise comparison. Neutrality tests including Ewens-Watterson35,36, Chakraborty37, Tajima D38, and Fu’s Fs39 with 1000 permutations were performed using software Arlequin version 3.11. Mismatch analysis40 with 10000 bootstrap replicates were also performed using Arlequin 3.11. The histogram of mismatch distribution was constructed using the software Network version 4.6.1.2 (http://www.fluxus-engineering.com/)41. The median-joining network of haplotypes was also constructed using software Network version 4.6.1.2. The rough time of population expansion was estimated using the following equation t = τ/2u42, where t is the time since population expansion, τ is the mutational time scale, which is calculated using software Arlequin version 3.11, and 2u is calculated using the equation 2u = μ × length of sequence × generation time, where μ is the mutation rate. Given the lack of a calibrated mutation rate of COI gene of C. feriata, the mutation rates of COI gene ranging from 1.66% to 2.33% per million years of Sesarma43 were used. In addition, a generation time of one year was also used.

Results and Discussion

Genome organization

The mitochondrial genome of C. feriata was a typically circular molecule with 15,660 bp in size (GenBank accession no. KF386147) and consisted of 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a control region (Fig. 2) as found in most metazoan species such as Lutra lutra44, C. Japonica21, and S. paramamosain23. This genome was slightly smaller than those of most sequenced crab species under Decapoda but larger than that of P. gigas, whose size was 15,515 bp21,23,26,45. Such a small genome was mainly due to the short size of the control region (762 bp). Moreover, the lengths of other regions of the genome were approximately equal among these species. Heavy strand (H-strand) encoded 23 genes, whereas light strand (L-strand) encoded the remaining 14 genes. The arrangement and order (Table 1) of the 37 genes were completely identical to those of reported species of Portunids, such as C. japonica21 and S. paramamosain23. However, the location of tRNAHis (Table 1) was different from that of most arthropods. In most arthropods, tRNAHis was between NAD4 and NAD5, whereas it was found between tRNAGlu and tRNAPhe in C. feriata. The phenomenon of gene rearrangements in mitochondrial genome was a relatively common event in crustacean species25. The tandem duplication of gene regions was thought to be the most acceptable mechnism of mitochondrial gene rearrangement, in this case, the slipped-strand mispairing took place first, and then followed by gene deletions46.

Table 1. Gene structure of mitochondrial genome of Charybdis feriata.

  Position   Codon    
Gene From To Size (bp) Amino acid Start Stopa Intergenic nucleotide (bp)b Strandc
COI 1 1534 1534 511 ATG T-- 0 H
tRNALeu (UUR) 1535 1601 67       21 H
COII 1623 2307 685 228 ATG T-- 0 H
tRNALys 2308 2375 68       0 H
tRNAAsp 2376 2440 65       0 H
ATP8 2441 2602 162 53 GTG TAG −7 H
ATP6 2596 3273 678 225 ATT TAA −1 H
COIII 3273 4063 791 263 ATG TA- −1 H
tRNAGly 4063 4126 64       0 H
ND3 4127 4480 354 117 ATT TAA 3 H
tRNAAla 4484 4550 67       3 H
tRNAArg 4554 4618 65       0 H
tRNAAsn 4619 4685 67       0 H
tRNASer (AGN) 4686 4754 69       −1 H
tRNAGlu 4754 4819 66       22 H
tRNAHis 4842 4907 66       0 L
tRNAPhe 4908 4971 64       −1 L
ND5 4971 6698 1728 575 ATG TAA 20 L
ND4 6719 8053 1335 444 ATG TAA −7 L
ND4L 8047 8349 303 100 ATG TAA 2 L
tRNAThr 8352 8416 65       0 H
tRNAPro 8417 8482 66       2 L
ND6 8485 8991 507 168 ATG TAA −1 H
Cytb 8991 10125 1135 378 ATG T-- 0 H
tRNASer(UCN) 10126 10192 67       27 H
ND1 10220 11179 960 319 ATA TAA 2 L
tRNALeu(CUN) 11182 11250 69       0 L
16 S rRNA 11251 12571 1321       0 L
tRNAVal 12572 12645 74       0 L
12 S rRNA 12646 13488 843       0 L
Control region 13489 14250 762       0  
tRNAIle 14251 14317 67       −3 H
tRNAGln 14315 14383 69       3 L
tRNAMet 14387 14455 69       0 H
ND2 14456 15463 1008 335 ATG TAA −1 H
tRNATrp 15463 15531 69       −1 H
tRNACys 15531 15595 65       0 L
tRNATyr 15596 15660 65       0 L

a, T-- or TA- represents incomplete stop codons.

b, Numbers correspond to the nucleotides separating adjacent genes. Negative numbers indicate overlapping nucleotides.

c, H or L indicates that the gene is encoded by the H or L strand.

Ten gene overlaps and ten intergenic spacers were found in mitochondrial genome of C. feriata, most of them have been reported in many other species mitochondrial genomes23,24,47. The total length of overlaps and intergenic spacers were 24 and 105 bp, with ranges from 1 to 7 and from 2 to 27 bp, respectively. The overall A + T content of C. feriata mitochondrial genome was 70.15%, which was similar to those of C. japonica, S. olivacea, S. serrata, and P. trituberculatus (Table 2). However, different regions had different A + T contents. The control region had the highest A + T content (78.74%), whereas the protein-coding region had the lowest A + T content (68.60%).

Table 2. Comparison of mitochondrial genomes of partial crustacean species.

    Heavy-strand 13 protein-coding genes 16S rRNAgene 12S rRNA gene 22 tRNA genes Control region  
Species GenBank accession no. Length (bp) A + T (%) No. of amino acid A + T (%) Length (bp) A + T (%) Length (bp) A + T (%) Length (bp) A + T (%) Length (bp) A + T (%) Reference
Charybdis feriata KF386147 15,660 70.15 3,716 68.60 1,321 74.26 843 71.89 1,473 71.76 762 78.74 The present study
Charybdis japonica FJ460517 15,738 69.20 3,712 67.80 1,317 74.20 834 70.30 1,458 70.90 863 74.70 21
Scylla tranquebarica NC_012567 15,833 73.80 3,716 72.00 1,339 77.10 869 75.90 1,486 74.40 854 86.50 Unpublished
Scylla olivacea NC_012569 15,723 69.40 3,715 67.30 1,337 74.40 852 72.40 1,482 72.30 778 79.00 Unpublished
Scylla serrata HM590866 15,721 69.22 3,714 69.20 1,337 74.50 839 71.80 1,478 72.26 788 79.10 26
Scylla paramamosain JX457150 15,824 73.04 3,715 70.88 1,340 77.46 869 75.72 1,482 74.56 833 86.67 23
Portunus trituberculatus AB093006 16,026 70.20 3,715 68.80 1,332 73.80 840 70.10 1,468 72.00 1,104 76.30 46
Callinectes sapidus NC_006281 16,263 69.10 3,712 67.00 1,323 71.80 785 70.30 1,463 71.60 1435 78.20 60
Eriocheir sinensis NC_006992 16,354 71.70 3,718 68.90 1,311 77.40 899 76.60 1,473 72.40 896 83.10 61
Pseudocarcinus gigas NC_006891 15,515 70.50 3,734 68.80 1,324 74.90 821 73.80 1,460 73.20 593 80.30 45
Geothelphusa dehaani NC_007379 18,197 74.90 3,711 71.50 1,315 77.10 821 76.40 1,519 75.80 514 87.20 62
Fenneropenaeus chinensis DQ518969 16,004 68.90 3,710 67.50 1,367 72.70 852 69.90 1,501 65.90 997 82.30 25
Litopenaeus vannamei DQ534543 15,989 67.80 3,710 66.10 1,371 71.80 853 69.60 1,493 65.30 998 82.50 25

Protein-coding genes

A total of 13 protein-coding genes were identified, of which 9 (COI, COII, COIII, APT6, ATP8, ND2, ND3, ND6, and Cyt b) were encoded by H-strand, and 4 (ND1, ND4, ND4L, and ND5) were encoded by L-strand. These genes consisted of 11,182 bp in length and coded 3716 amino acids in total. All 13 genes were initiated by the start codon ATN (ATG, ATA, and ATT), with an exception (GTG) in ATP8 (Table 1). The typical stop codon (TAA or TAG) was detected in nine protein-coding genes (ATP6, ATP8, ND1, ND2, ND3, ND4, ND4L, ND5, and ND6), whereas the remaining four genes (COI, COII, COIII, and Cyt b) were ended by incomplete stop codons (T-- or TA-). Variable start codons and incomplete stop codons have been reported in many other mitochondrial genomes. For example, four types of start codons (ATT, ATG, ATA, and ACG) were detected in mitochondrial genome of Myrmeleon immanis48. Two and one incomplete stop codons were found in Lutjanus russellii and S. paramamosain mitochondrial genomes23,49. For the incomplete stop codon, the missed nucleotides may be produced by post-transcriptional polyadenylation50. In addition, ND6 had the highest A + T content (72.78%), whereas COIII had the lowest A + T content (64.85%) (Table 3).

Table 3. The base composition for different regions of mitochondrial genome of Charybdis feriata (the genes which are encoded by the L-strand are converted to complementary strand sequences).

  Base composition (%)  
Region A G T C A + T content (%)
Protein-coding gene
 COI 26.73 15.65 38.20 19.43 64.93
 COII 31.97 14.01 34.60 19.42 66.57
 ATP8 29.01 9.26 40.12 21.60 69.14
 ATP6 27.73 11.36 40.27 20.65 67.99
 COIII 26.42 15.55 38.43 19.60 64.85
 ND3 29.10 12.15 41.24 17.51 70.34
 ND5 31.89 19.16 39.24 9.72 71.12
 ND4 29.21 18.73 42.25 9.81 71.46
 ND4L 26.07 21.45 42.57 9.90 68.65
 ND6 27.02 7.50 45.76 19.72 72.78
 Cytb 28.28 13.66 38.06 20.00 66.34
 ND1 27.50 19.38 42.08 11.04 69.58
 ND2 27.18 8.53 42.46 21.83 69.64
tRNA gene
 tRNALeu (UUR) 34.33 16.42 35.82 13.43 70.15
 tRNALys 26.47 20.59 30.88 22.06 57.35
 tRNAAsp 41.54 9.23 43.08 6.15 84.62
 tRNAGly 42.19 9.38 34.38 14.06 76.56
 tRNAAla 35.82 14.93 35.82 13.43 71.64
 tRNAArg 32.31 13.85 32.31 21.54 64.62
 tRNAAsn 41.79 14.93 29.85 13.43 71.64
 tRNASer (AGN) 34.78 14.49 33.33 17.39 68.12
 tRNAGlu 33.33 13.64 39.39 13.64 72.73
 tRNAHis 31.82 22.73 36.36 9.09 68.18
 tRNAPhe 40.62 15.62 35.94 7.81 76.56
 tRNAThr 38.46 12.31 38.46 10.77 76.92
 tRNAPro 34.85 16.67 40.91 7.58 75.76
 tRNASer (UCN) 44.78 13.43 34.33 7.46 79.10
 tRNALeu (CUN) 39.13 14.49 37.68 8.70 76.81
 tRNAVal 28.38 22.97 33.78 14.86 62.16
 tRNAIle 35.82 16.42 37.31 10.45 73.13
 tRNAGln 31.88 21.74 34.78 11.59 66.67
 tRNAMet 34.78 13.04 33.33 18.84 68.12
 tRNATrp 43.48 11.59 31.88 13.04 75.36
 tRNACys 36.92 15.38 36.92 10.77 73.85
 tRNATyr 35.38 18.46 35.38 10.77 70.77
rRNA gene
 16 S rRNA 38.23 16.58 36.03 9.16 74.26
 12 S rRNA 37.25 17.79 34.64 10.32 71.89
 Control region 41.99 7.87 36.75 13.39 78.74
 Overall of protein-coding genes 28.55 15.25 40.05 16.14 68.60
 Overall of tRNA genes 36.25 15.61 35.51 12.63 71.76
 Overall of rRNA genes 37.85 17.05 35.49 9.61 73.34
 Overall of the genome 34.09 11.25 36.05 18.60 70.15

Transfer and ribosomal RNA genes

A total of 22 tRNA genes ranging from 64 to 74 bp in length were identified from the mitochondrial genome of C. feriata. All of them were capable of folding into a typically clover-leaf secondary structure (Fig. 3). In the closely related crabs C. japonica and S. paramamosain, tRNASer (AGN) could not form a secondary structure because it lacked the dihydrouracil (DHU) arms21,23. Fourteen tRNA genes were located on H-strand, whereas the remaining eight were located on L-strand. All tRNA genes had a common length of 7 bp for the aminoacyl stem and an invariable size of 7 bp for the anticodon loop. Variable nucleotide lengths of tRNAs were found at the DHU, TΨC, and anticodon arms. All these 22 tRNA genes possessed the common anticodons of Decapods mitochondrial genomes, except that tRNALys and tRNASer (AGN) possessed TTT and TCT anticodons rather than CTT and GCT, respectively. Seven unmatched base pairs were found in 22 tRNA genes, which was lower than the number detected from tRNA genes of S. paramamosain23. The overall A + T content of 22 tRNA was 71.76%, with the highest content (84.62%) in tRNAAsp and the lowest content (57.35%) in tRNALys.

Figure 3. Putative secondary structures of 22 tRNAs detected from mitochondrial genome of Charybdis feriata.

Figure 3

Both 16S and 12S rRNA genes were found on the L-strand of the mitochondrial genome. They were located between tRNALeu (CUN) and the putative control region and were separated by tRNAVal. The sizes of 16S rRNA and 12S rRNA genes were 1321 and 843 bp, and the A + T contents were 74.26% and 71.89%, respectively.

Non-coding regions

A total of 11 non-coding regions were identified in the mitochondrial genome of C. feriata. The major non-coding region (762 bp in length) was found between 12S rRNA and tRNAIle, which was considered to be the putative control region. The other 10 non-coding regions were small, ranging from 2 to 27 bp in length. The A + T content of control region was higher (78.74%) than that of other regions in mitochondrial genome. The high rate of A + T content was due to the existence of A/T repeated motifs. In control region, TA, AT, TAA, AAT, and TTA were found to be the most abundant motifs. Additionally, microsatellite sequences were detected, such as (TA)3, (AT)3, (TA)4, (AT)4, and (TA)11. Microsatellites were also identified from control region of the mitochondrial genome in M. immanis and Nymphes myrmeleonoides48. In addition, the nucleotide composition of control region in this study was 41.99% for A, 7.87% for G, 36.75% for T, and 13.39% for C (Table 3).

Phylogenetic relationship

The taxonomic status of genus Charybdis within Portunidae has been a highly contentious issue for a long time. In this study, we estimated the evolutionary relationship of C. feriata within Decapoda by reconstructing a phylogenetic tree. This tree was created based on 12 concatenated protein-coding genes from the mitochondrial genome of 21 species. From the tree topologies (Fig. 4), we found that C. feriata and C. japonica first formed a monophyletic group and showed the closest relationship to each other. Together with C. sapidus and P. trituberculatus, they then formed another monophyletic group. Furthermore, these four species showed a sister relationship with another four species of genus Scylla. Thus, our results supported the opinion of classifying genus Charybdis into subfamily Portuninae of family Portunidae. The same suggestion was also proposed by Liu and Cui21.

Figure 4. Phylogenetic relationship of Decapoda species based on 12 protein-coding genes.

Figure 4

Population genetic diversity and differentiation

The complete COI gene sequence (1534 bp) was employed to estimate the genetic diversity and differentiation of C. feriata population. A total of 33 haplotypes (Table 4) were identified from 70 individuals, of which 14 were from HN locality, 11 from XM locality, and 16 from ZS locality. H9 was the most abundant haplotype, which was present in each locality. A high level of genetic diversity (Table 5) was found with h ranging from 0.819 to 0.867 and π ranging from 0.0011 to 0.0013 per locality. The h value was slightly higher than that (0.787) reported by Huang12. In our previous study, moderate genetic variation of C. feriata was detected by microsatellite markers13. Moreover, a high genetic diversity was also observed in other marine animals, such as S. serrata51 and Salmo salar52. The following factors, including life history charateristics, environmental heterogeneity, and large population sizes, may help in maintaining a high level of genetic diversity among marine animals53,54. AMOVA analysis indicated that 99.77% of the total genetic variation was contributed by within-localities variation, whereas only 0.23% was caused by among-localities variation (FST = 0.0023, P > 0.05) (Table 6). In addition, no significant genetic differentiation was found among three localities (Table 7). The above analysis showed that the genetic differentiation among three localities of C. feriata was at a low level, suggesting a single population in East China Sea and South China Sea. The summer southwest monsoonal wind and winter northeast monsoonal wind drive seasonal ocean current circulation between South China Sea and East China Sea55,56. This homogenous population structure of C. feriata might be related with the ocean current circulation and the high larval dispersal ability of this crab species.

Table 4. Polymorphic sites of 33 haplotypes of complete COI gene of Charybdis feriata., identical.

 

nucleotide; N, number of haplotype in all three localities; AA1, amino acids translated by H1; AA2, amino acids translated by mutated haplotypes.

Table 5. Genetic diversity of Charybdis feriata from three localities.

Locality NH N h π
HN 14 21 0.867 0.0012
XM 11 24 0.819 0.0013
ZS 16 25 0.850 0.0011
In total 33 70 0.838 0.0012

NH, number of haplotypes; N, number of individuals; h, haplotype diversity; π, nucleotide diversity. HN, Hainan locality; XM, Xiamen locality; ZS, Zhoushan locality.

Table 6. Analysis of molecular variance (AMOVA) of three localities of Charybdis feriata.

Source of variation df Sum of squares Variance components Percentage of variation FST P
Among localities 2 1.898 0.00207 Va 0.23 0.0023 0.293
Within localities 67 60.345 0.90068 Vb 99.77    
Total 69 62.243 0.90274      

Table 7. Genetic distance (below diagonal) and fixation index (FST) (above diagonal) among three localities of Charybdis feriata.

Locality HN XM ZS
HN — −0.0040 −0.0002
XM 0.001 — 0.0098
ZS 0.001 0.001 —

HN, Hainan locality; XM, Xiamen locality; ZS, Zhoushan locality.

Neutrality tests, mismatch analysis and population expansion estimation

Four kinds of neutrality tests, including Ewens-Watterson, Chakraborty, Tajima D, and Fu’s Fs, were carried out in C. feriata. All of them, except Ewens-Watterson, suggested a significant deviation from mutation-drift equilibrium (Table 8). Mismatch distributions analysis (Table 9) indicated that the estimated effective population size after population growth was significantly larger than that before population growth. In addition, a star-like topology was produced based on 33 haplotypes (Fig. 5). Of these haplotypes, H9 was located in the center of this topology, and it was closely linked with the majority of other haplotypes, thereby suggesting that it is the ancestral haplotype in C. feriata. All above analysis indicated that C. feriata might have undergone a population expansion event. Meanwhile, the high h (between 0.819 and 0.867) and low π (between 0.0011 and 0.0013) also suggested that C. feriata underwent population expansion after a period of low effective population size. Sudden population expansion can affect population genetic diversity and haplotypes, and in this process more haplotypes were generated by mutation than were removed by genetic drift57. We further deduced that the population expansion event of C. feriata might have occurred between 61,498 and 43,814 years ago. This period of population expansion is a little bit later than the Last Interglacial complex (140-75 kya)58. This findings showed that the Last Interglacial complex might have played an important role in demographic history of C. feriata. Further, a big changes of nutrient concentrations and sea water temperature could affect the population distribution of marine orgnisms too59.

Table 8. Neutrality tests results of Charybdis feriata.

  Ewens-Watterson Chakraborty    
Locality FO FE NO NE Tajima’s D Fu’s Fs
HN 0.17 0.10 14 5.09* −2.46** −12.19**
XM 0.22 0.15 11 5.53 −2.16** −5.35**
ZS 0.18 0.09 16 5.14** −2.40** −15.73**
Mean 0.19 0.11 13.67 5.25* −2.34** −11.09**

FO, observed F value; FE, expected F value; NO, number of observed alleles; NE, number of expected alleles; HN, Hainan locality; XM, Xiamen locality; ZS, Zhoushan locality; *, P < 0.05; **, P < 0.01.

Table 9. Mismatch distributions analysis of Charybdis feriata.

Locality τ θ0 θ1 SSD (PSSD) Rag (PRag)
HN 1.645 0.000 99999.000 0.013 (0.254) 0.109 (0.172)
XM 1.438 0.000 99999.000 0.012 (0.229) 0.106 (0.190)
ZS 1.617 0.000 99999.000 0.008 (0.332) 0.095 (0.194)
Mean 1.566 0.000 99999.000 0.011 (0.272) 0.103 (0.186)

τ, units of mutational time; θ0, θ before population growth; θ1, θ after population growth; SSD, sum of the square deviations between the observed and expected mismatch; PSSD, the probability of SSD; Rag, raggedness index; PRag, the probability of raggedness; HN, Hainan locality; XM, Xiamen locality; ZS, Zhoushan locality.

Figure 5. The median-joining network of 33 haplotypes of complete COI gene sequence of Charybdis feriata.

Figure 5

XM, Xiamen locality; HN, Hainan locality; ZS, Zhoushan locality.

Conclusion

This study first described the complete mitochondrial genome of C. feriata, which was 15,660 bp in length, including a typical set of 37 genes and a control region. Phylogenomic analysis results supported that genus Charybdis should be classified into subfamily Portuninae rather than into subfamily Thalamitinae. Furthermore, a high level of genetic diversity and a low level of differentiation of C. feriata were found, and a population expansion event was deduced to have occurred between 61,498 and 43,814 years ago. This study should be helpful for studies on evolution and phylogeny, population genetic structure, and conservaton genetics for C. feriata and related species60,61,62.

Additional Information

How to cite this article: Ma, H. et al. First mitochondrial genome for the red crab (Charybdis feriata) with implication of phylogenomics and population genetics. Sci. Rep. 5, 11524; doi: 10.1038/srep11524 (2015).

Supplementary Material

Supplementary Information
srep11524-s1.doc (43.5KB, doc)

Acknowledgments

This study was supported by the Special Scientific Research Funds for Central Non-profit Institutes (East China Sea Fisheries Research Institute) (Grant No. 2012M04), the National Basic Research Special Foundation of China (Grant No. 2013FY110700), the Special Fund for Agroscientific Research in the Public Interest (Grant No. 201303047), and the National Infrastructure of Fishery Germplasm Resources.

Footnotes

Author Contributions H.M., L.M. and L.X. conceived and designed the experiments. H.M., C.M., J.L., X.Z., Y.G., W.W. and W.C. performed the experiments. H.M., C.M., C.L. and L.M. analyzed the data. H.M., L.M. and L.X. contributed reagents and materials. H.M. wrote the paper. H.M., L.M. and L.X. revised the paper.

References

  1. Stephenson W. An annotated check list and key to the Indo-west-Pacific swimming crabs (Crustacea: Decapoda: Portunidae). B Roy Soc New Zeal 10, 1–64 (1972). [Google Scholar]
  2. Apel M. V. & Spiridonov A. Taxonomy and zoogeography of the portunid crabs (Crustacea: Decapoda: Brachyura: Portunidae) of the Arabian Gulf and adjacent waters. Fauna Arabia 17, 159–331 (1998). [Google Scholar]
  3. Padayatti P. S. Notes on population characteristics and reproductive biology of the portunid crab Charybdis feriatus (Linnaeus) at Cochin. Indian J Fish 37, 155–158 (1990). [Google Scholar]
  4. Baylon J. & Suzuki H. Effects of changes in salinity and temperature on survival and development of larvae and juveniles of the crucifix crab Charybdis feriatus (Crustacea: Decapoda: Portunidae). Aquaculture 269, 390–401 (2007). [Google Scholar]
  5. Williams M. J. & Primavera J. H. Choosing tropical portunid species for culture, domestication and stock enhancement in the Indo-Pacific. Asian Fish Sci 14, 121–142 (2001). [Google Scholar]
  6. Parado-Estepa F. D., Quinitio E. T. & Rodriguez E. M. Seed production of the crucifix crab charybdis feriatus. Aqua KE Government Documents 7, 37 (2002). [Google Scholar]
  7. Parado-Estepa F. D., Quinitio E. T. & Rodriguez E. M. Seed production of Charybdis feriatus (Linnaeus). Aquac Res 38, 1452–1458 (2007). [Google Scholar]
  8. Josileen J. Captive spawning, hatching and larval development of crucifix crab, Charybdis feriatus (Linnaeus, 1758). J Mar Biol Ass India 53, 35–40 (2011). [Google Scholar]
  9. Motoh H. & Villaluz A. Larvae of decapod crustaceans of the Philippines. The zoeal stages of a swimming crab, Charybdis cruciata (Herbst), reared in the laboratory. Bull Jpn Soc Sci Fish 42, 523–531 (1976). [Google Scholar]
  10. Fielder D. R., Greenwood J. G. & Campbell G. The megalopa of Charybdis feriata (Linnaeus) with additions to the zoeal larvae descriptions (Decapoda, Portunidae). Crustaceana 46, 160–165 (1984). [Google Scholar]
  11. Sarada P. T. Crab fishery of the Calicut coast with some aspects of the population characteristics of Portunus sanguinolentus, Portunus pelagicus and Charybdis cruciata. Indian J Fish 45, 375–386 (1998). [Google Scholar]
  12. Huang Y. P. Amplification and analysis about Charybdis feriatus COI gene sequence. J Grad Sun Yat-Sen Univ 30, 57–64 (2009). [Google Scholar]
  13. Ma H. Y. et al. Discovery and characterization of a first set of polymorphic microsatellite markers in red crab (Charybdis feriatus). J Genet 92, e113–e115 (2013). [PubMed] [Google Scholar]
  14. Stephenson W. & Campbell B. The Australian portunids (Crustacea: Portunidae) IV: remaining genera. Aust J Mar Freshwater Res 11, 73–122 (1960). [Google Scholar]
  15. Dai A. Y., Yang S. L., Song Y. Z. & Chen G. X. Marine crabs of China 189 (China Ocean Press, 1986). [Google Scholar]
  16. Wee D. P. & Ng P. K. L. Swimming crabs of the genera Charybdis De Haan, 1833 and Thalamita Latreille, 1829 (Crustacea: Decapoda: Brachyura: Portunidae) from peninsular Malaysis and Singapore. Raffles Bull Zool 1, 1–128 (1995). [Google Scholar]
  17. Ng P. K. L., Wang C. H., Ho P. H. & Shih H. T. An annotated checklist of brachyuran crabs from Taiwan (Crustacea: Decapoda). Natl Taiwan Mus Spec Publ Ser 11, 1–86 (2001). [Google Scholar]
  18. Liu J. Y. Checklist of marine biota of China seas 789–791 (Science Press, 2008). [Google Scholar]
  19. Jin S., Zhao Q. S., Wang C. L. & Chen Y. E. RAPD genetic markers in six species of marine crab. Zool Res 25, 172–176 (2004). [Google Scholar]
  20. Zhang S. et al. The application of mitochondrial DNA in phylogeny reconstruction and species identification of portunid crab. Mar Sci 32, 9–18 (2008). [Google Scholar]
  21. Liu Y. & Cui Z. Complete mitochondrial genome of the Asian paddle crab Charybdis japonica (Crustacea: Decapoda: Portunidae): gene rearrangement of the marine brachyurans and phylogenetic considerations of the decapods. Mol Biol Rep 37, 2559–2569 (2010). [DOI] [PubMed] [Google Scholar]
  22. Yu J. N., Azuma N. & Abe S. Genetic differentiation between collections of hatchery and wild masu salmon (Oncorhynchus masou) inferred from mitochondrial and microsatellite DNA analysis. Environ Biol Fish 94, 259–271 (2012). [Google Scholar]
  23. Ma H. Y. et al. The complete mitochondrial genome sequence and gene organization of the mud crab (Scylla paramamosain) with phylogenetic consideration. Gene 519, 120–127 (2013). [DOI] [PubMed] [Google Scholar]
  24. Baek S. Y. et al. Complete mitochondrial genomes of Carcinoscorpius rotundicauda and Tachypleus tridentatus (Xiphosura, Arthropoda) and implications for chelicerate phylogenetic studies. Int J Biol Sci 10, 479–489 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shen X. et al. The complete mitochondrial genomes of two common shrimps (Litopenaeus vannamei and Fenneropenaeus chinensis) and their phylogenomic considerations. Gene 403, 98–109 (2007). [DOI] [PubMed] [Google Scholar]
  26. Jondeung A., Karinthanyakit W. & Kaewkhumsan J. The complete mitochondrial genome of the black mud crab, Scylla serrata (Crustacea: Brachyura: Portunidae) and its phylogenetic position among (pan) crustaceans. Mol Biol Rep 39, 10921–10937 (2012). [DOI] [PubMed] [Google Scholar]
  27. Ma H. Y., Yang J. F., Su P. Z. & Chen S. L. Genetic analysis of gynogenetic and common populations of Verasper moseri using SSR markers. Wuhan Univ J Nat Sci 14, 267–273 (2009). [Google Scholar]
  28. Lohse M., Drechsel O. & Bock R. OrganellarGenomeDRAW (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr Genet 52, 267–274 (2007). [DOI] [PubMed] [Google Scholar]
  29. Lowe T. M. & Eddy S. R. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25, 955–964 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kumar S., Dudley J., Nei M. & Tamura K. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 9, 299–306 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Miya M. & Nishida M. Use of mitogenomic information in teleostean molecular phylogenetics: a tree-based exploration under the maximum-parsimony optimality criterion. Mol Phylogenet Evol 17, 437–455 (2000). [DOI] [PubMed] [Google Scholar]
  32. Stamatakis A., Hoover P. & Rougemont J. A rapid bootstrap algorithm for the RAxML web-servers. Syst Biol 75, 758–771 (2008). [DOI] [PubMed] [Google Scholar]
  33. Librado P. & Rozas J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451–1452 (2009). [DOI] [PubMed] [Google Scholar]
  34. Excoffier L., Laval G. & Schneider S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinform 1, 47–50 (2005). [PMC free article] [PubMed] [Google Scholar]
  35. Ewens W. J. The sampling theory of selectively neutral alleles. Theor Popul Biol 3, 87–112 (1972). [DOI] [PubMed] [Google Scholar]
  36. Watterson G. The homozygosity test of neutrality. Genetics 88, 405–417 (1978). [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Chakraborty R. Mitochondrial DNA polymorphism reveals hidden heterogeneity within some Asian populations. Am J Hum Genet 47, 87–94 (1990). [PMC free article] [PubMed] [Google Scholar]
  38. Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585–595 (1989). [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Fu Y. X. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147, 915–925 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rogers A. Genetic evidence for a pleistocene population explosion. Evolution 49, 608–615 (1995). [DOI] [PubMed] [Google Scholar]
  41. Polzin T. & Daneshmand S. V. On steiner trees and minimum spanning trees in hypergraphs. Oper Res Lett 31, 12–20 (2003). [Google Scholar]
  42. Rogers A. R. & Harpending H. Population growth makes waves in the distribution of pairwise genetic differences. Mol Biol Evol 9, 552–569 (1992). [DOI] [PubMed] [Google Scholar]
  43. Schubart C. D., Diesel R. & Hedges S. B. Rapid evolution to terrestrial life in Jamaican crabs. Nature 393, 363–365 (1998). [Google Scholar]
  44. Ki J., Hwang D., Park T., Han S. & Lee J. A comparative analysis of the complete mitochondrial genome of the Eurasian otter Lutra lutra (Carnivora; Mustelidae). Mol Biol Rep 37, 1943–1955 (2010). [DOI] [PubMed] [Google Scholar]
  45. Miller A. D., Murphy N. P., Burridge C. P. & Austin C. M. Complete mitochondrial DNA sequences of the decapod crustaceans Pseudocarcinus gigas (Menippidae) and Macrobrachium rosenbergii (Palaemonidae). Mar Biotechnol 7, 339–349 (2005). [DOI] [PubMed] [Google Scholar]
  46. Yamauchi M. M., Miya M. U. & Nishida M. Complete mitochondrial DNA sequence of the swimming crab, Portunus trituberculatus (Crustacea: Decapoda: Brachyura). Gene 311, 129–135 (2003). [DOI] [PubMed] [Google Scholar]
  47. Wang Y., Liu X. & Yang D. The first mitochondrial genome for Caddisfly (Insecta: Trichoptera) with phylogenetic implications. Int J Biol Sci 10, 53–63 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yan Y., Wang Y., Liu X., Winterton S. L. & Yang D. The first mitochondrial genomes of antlion (Neuroptera: Myrmeleontidae) and split-footed lacewing (Neuroptera: Nymphidae), with phylogenetic implications of Myrmeleontiformia. Int J Biol Sci 10, 895–908 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Guo Y., Wang Z., Liu C. & Liu Y. Sequencing and analysis of the complete mitochondrial DNA of Russell’s snapper (L. russellii). Prog Nat Sci 18, 1233–1238 (2008). [Google Scholar]
  50. Ojala D., Montoya J. & Attardi G. tRNA punctuation model of RNA processing in human mitochondrial. Nature 290, 470–474 (1981). [DOI] [PubMed] [Google Scholar]
  51. Fratini S., Ragionieri L. & Cannicci S. Stock structure and demographic history of the Indo-West Pacific mud crab Scylla serrata. Estuar Coast Shelf S 86, 51–61 (2010). [Google Scholar]
  52. Karlsson S., Moen T. & Hindar K. Contrasting patterns of gene diversity between microsatellites and mitochondrial SNPs in farm and wild Atlantic salmon. Conserv Genet 11, 571–582 (2010). [Google Scholar]
  53. Nei M. Molecular evolutionary genetics 512 (Columbia University Press, 1987). [Google Scholar]
  54. Avise J. C. Phylogeography: The history and formation of species 447 (Harvard University Press, 2000). [Google Scholar]
  55. Chao S. Y. Circulation of the East China Sea, a numerical study. J Oceanogr Soc Japan 46, 273–295 (1991). [Google Scholar]
  56. Fang G. H. et al. A note on the South China Sea shallow interocean circulation. Adv Atmos Sci 22, 946–954 (2005). [Google Scholar]
  57. Avise J. C., Neigel J. E. & Arnold J. Demographic influences on mitochondrial DNA lineage survivorship in animal populations. J Mol Evol 20, 99–105 (1984). [DOI] [PubMed] [Google Scholar]
  58. Stirling C. H., Esat T. M., Lambeck K. & McCulloch M. T. Timing and duration of the Last Interglacial: evidence for a restricted interval of widespread coral reef growth. Earth Planet Sci Lett 160, 745–762 (1998). [Google Scholar]
  59. Hayes G. C., Richardson A. J. & Robinson C. Climate change and marine plankton. Trends Ecol Evol 20, 337–344 (2005). [DOI] [PubMed] [Google Scholar]
  60. Place A. R., Feng X., Steven C. R., Fourcade H. M. & Boore J. L. Genetic markers in blue crabs (Callinectes sapidus) II. Complete mitochondrial genome sequence and characterization of genetic variation. J Exp Mar Biol Ecol 319, 15–27 (2005). [Google Scholar]
  61. Sun H., Zhou K. & Song D. Mitochondrial genome of the Chinese mitten crab Eriocheir japonica sinenesis (Brachyura: Thoracotremata: Grapsoidea) reveals a novel gene order and two target regions of gene rearrangements. Gene 349, 207–217 (2005). [DOI] [PubMed] [Google Scholar]
  62. Segawa R. D. & Aotsuka T. The mitochondrial genome of the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura): evidence for its evolution via gene duplication. Gene 355, 28–39 (2005). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep11524-s1.doc (43.5KB, doc)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES