Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Nov 1.
Published in final edited form as: Biochem Pharmacol. 2015 Aug 12;98(1):190–202. doi: 10.1016/j.bcp.2015.08.087

Genome-wide Analysis of Human Constitutive Androstane Receptor (CAR) Transcriptome in Wild-type and CAR-knockout HepaRG cells

Daochuan Li a, Bryan Mackowiak a, Timothy G Brayman b, Michael Mitchell b, Lei Zhang c, Shiew-Mei Huang c, Hongbing Wang a,*
PMCID: PMC4600658  NIHMSID: NIHMS715291  PMID: 26275810

Abstract

The constitutive androstane receptor (CAR) modulates the transcription of numerous genes involving drug metabolism, energy homeostasis, and cell proliferation. Most functions of CAR however were defined from animal studies. Given the known species difference of CAR and the significant cross-talk between CAR and the pregnane X receptor (PXR), it is extremely difficult to decipher the exact role of human CAR (hCAR) in gene regulation, relying predominantly on pharmacological manipulations. Here, utilizing a newly generated hCAR-knockout (KO) HepaRG cell line, we carried out RNA-seq analysis of the global transcriptomes in wild-type (WT) and hCAR-KO HepaRG cells treated with CITCO, a selective hCAR agonist, phenobarbital (PB), a dual activator of hCAR and hPXR, or vehicle control. Real-time PCR assays in separate experiments were used to validate RNA-seq findings. Our results indicate that genes encoding drug-metabolizing enzymes are among the main clusters altered by both CITCO and PB. Specifically, CITCO significantly changed the expression of 135 genes in an hCAR-dependent manner, while PB altered the expression of 227 genes in WT cells of which 94 were simultaneously modulated in both cell lines reflecting dual effects of PB on hCAR/PXR. Notably, we found that many genes promoting cell proliferation and tumorigenesis were up-regulated in hCAR-KO cells, suggesting that hCAR may play an important role in cell growth that differs from mouse CAR. Together, our results reveal both novel and known targets of hCAR and support the role of hCAR in maintaining the homeostasis of metabolism and cell proliferation in the liver.

Keywords: HepaRG, CAR, gene knockout, RNA-seq, phenobarbital, CITCO

1. Introduction

Mounting evidence has established the constitutive androstane receptor (CAR, NR1I3) as a hepatic sensor that regulates the expression of a large array of genes associated with drug metabolism/transport, energy homeostasis, and cell proliferation [14]. Activation of CAR not only affects the biotransformation and excretion of drugs and endobiotic molecules such as the chemotherapeutic cyclophosphamide, the anti-HIV efavirenz, and the heme catabolism breakdown bilirubin, it also influences the homeostasis of glucose, lipids, and fatty acids, holding the potential to function as a drug target for metabolic disorders [58]. Notably, many of these actions of CAR are shared with its closely related nuclear receptor, the pregnane X receptor (PXR, NR1I2) [9, 10]. Cross-talk between CAR and PXR through recognition of each other’s response elements triggers reciprocal activation of a cluster of overlapping target genes that coordinate comprehensive hepatic defensive responses [11, 12]. For instance, CYP2B6, a prototypical target of human CAR (hCAR), can be efficiently induced by rifampicin (RIF), a selective agonist of human PXR (hPXR) [13]. On the other hand, phenobarbital (PB), a well-known inducer of CYP2B6, activates both CAR and PXR in humans [14]. Although cross-talk between CAR and PXR formulates a defensive network against xenobiotic exposure, it generates challenges toward the identification of hCAR specific function and target genes. Moreover, the current paradigm of cross-talk between CAR and PXR relies majorly on animal studies. Significant species differences exist between hCAR and its rodent counterparts [15, 16].

The specific role of mouse CAR (mCAR) in gene regulation was conclusively defined by using CAR-null mice. Induction of cyp2b10 gene, the corresponding isozyme of human CYP2B6, by PB and 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP, a selective agonist of mCAR) was completely abolished in CAR-null mice [17]. At the whole genome level, numerous genes associated with mCAR-dependent induction and repression were also identified in comparison of microarray data between wild-type (WT) and CAR-null mice [18]. Nevertheless, documented species differences of CAR prevent direct extrapolation of such data from mouse to humans. Notably, TCPOBOP activates mouse but not human CAR; on the other hand, the known hCAR agonist 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO) selectively binds and activates hCAR only; while the antiemetic meclizine functions as an agonist of mCAR but inverse agonist of hCAR [16, 19, 20].

Unlike prototypical nuclear receptors, CAR can be activated through either direct ligand binding or ligand-independent mechanisms, involving protein kinase-mediated signaling pathways [21, 22]. Consistent with its initial designation, CAR is constitutively activated in immortalized cell lines and spontaneously accumulated in the nucleus without xenobiotic stimulation [23, 24]. In contrast, CAR is sequestered in the cytoplasm of the more physiologically relevant primary hepatocytes before activation [25]. In primary hepatocytes, CAR forms a cytoplasmic multi-protein complex with a number of chaperone proteins and only translocates to the nucleus upon chemical-stimulated activation [26]. Thus, human primary hepatocytes (HPH) represent a valuable model for understanding the biological function of hCAR. Indeed, many drugs and environmental chemicals have been identified and validated as hCAR activators using HPH [27, 28]. However, both hCAR and hPXR are enriched and functionally intact in HPH, making delineation of the precise role of hCAR difficult. To this end, investigation of the function of hCAR relies predominantly on pharmacological manipulation of this receptor. The majority of the known hCAR activators also influence the activity of the promiscuous hPXR. Thus, the need for a human liver cell system with genetically modified hCAR is evident.

The HepaRG cell line, exhibiting hepatocyte-like morphology and functions, and expressing hepatic specific genes, has been recognized as a promising alternative to HPH [29, 30]. Most recently, we have shown that differentiated HepaRG cells retain hCAR in the cytoplasm, which can be translocated to the nucleus in response to PB treatment (manuscript under review), suggesting that functional hCAR signaling is preserved in these cells. To obtain hCAR-mediated global gene expression profiles, we carried out RNA sequencing (RNA-seq) and RT-PCR assays on WT and CAR knockout (KO) HepaRG cells treated with PB or CITCO. PB and CITCO induced a spectrum of overlapping and distinct genes. Both novel and known genes associated with hCAR activation have been recognized. Importantly, knockout of hCAR alone altered the expression of numerous genes, in particular, those related to cell proliferation and tumor development.

2. Material and methods

2.1. Reagents

PB was purchased from Sigma-Aldrich (St. Louis, MO). CITCO was obtained from BIOMOL Research Laboratories (Plymouth Meeting, PA). PCR primers were synthesized by Integrated DNA Technologies (Coralville, IA). Human CAR antibody was acquired from Perseus Proteomics (Tokyo, Japan). HepaRG WT cells, HepaRG hCAR-KO cells, and related culture medium used were from Sigma-Aldrich.

2.2. HepaRG cell differentiation and RNA sequencing

HepaRG cell differentiation and induction were carried out following instructions from Sigma-Aldrich. HepaRG cells were seeded in 24-well plates in Maintenance Medium at the density of 0.4×106 cells/well on Day 0. Media was changed every 3 days until Day 14. Maintenance Medium was then replaced by Pre-induction Medium and incubated for another 3 days. On day 17, Pre-induction Medium was removed and Serum-Free Induction medium containing PB (1 mM), CITCO (1 μM) or DMSO (0.1% v/v) was added to cell cultures for another 24 h. RNA samples from treated WT and hCAR-KO cells were isolated using the miRNeasy Mini Kit (Qiagen, Valencia, CA) following the manufacturer’s instruction. RNA samples from different treatments were analyzed at Beckman Coulter Genomics (Danvers, USA). In brief, Illumina TruSeq RNA Library Preparation Kit v2 was used in combination with Beckman Coulter Biomek liquid handling automation to perform cDNA synthesis and adaptor ligation. Sequencing was performed on the Illumina HiSeq2500 instrument at 2×100 base pair read length according to the manufacturer’s instruction. Default quality trimming was used for the respective instruments with removal of reads that fall below CASAVA’s passing filter.

2.3. Real-Time RT-PCR

Total RNA was isolated from HepaRG cells using TRIzol reagent (Qiagen), and reverse transcription was performed by using the High Capacity cDNA Archive kit (Applied Biosystems, Foster, CA) according to the manufacturers’ instructions. Quantitative real-time PCR assay was performed by using SYBR Green ROX qPCR Mastermix (Qiagen) on an ABI StepOnePlus System (Life Technologies, Grand Island, NY). Expression values were analyzed by the equation: Fold = 2−ΔΔCt, where ΔCt represents the differences in cycle threshold numbers between each of the target gene and GAPDH, and ΔΔCt represents the relative change between compared groups. All primer sequences are listed in Table 1.

Table 1.

Primer sequences for genomic DNA PCR and Real-time PCR

Forward primer sequence 5′–3′ Reverse primer sequence 5′–3′
Primers for genomic DNA
CAR sequencing AGGCTGAAGTGGAGGATTGC CCTCTGTTATGCCACCAGTT
hCAR exon1 AAGCAGCAGCTTCCAATGAG ACTCCTGGGCTCAAGCGATC
hCAR exon2 AACACGTGACGTCATGGCCAG CCTCTGTTATGCCACCAGTT
Primers for Real-time PCR
ALB GAGACCAGAGGTTGATGTGATG AGTTCCGGGGCATAAAAGTAAG
APOA1 CCCTGGGATCGAGTGAAGGA CTGGGACACATAGTCTCTGCC
CCNB1 AATAAGGCGAAGATCAACATGGC TTTGTTACCAATGTCCCCAAGAG
CDK1 GGATGTGCTTATGCAGGATTCC CATGTACTGACCAGGAGGGATAG
DMBT1 CAAGGACTACAGACTACGCTTCA TCCGAGGGAAATGGAGAACCT
EPO AGGCCCTGTTGGTCAACTCT GCAGTGATTGTTCGGAGTGGA
GCK CCTGGGTGGCACTAACTTCAG TAGTCGAAGAGCATCTCAGCA
GSTA5 CATGAAGGAGAGAGCCCTGA TGGCATCTCTTTCCTCTGGT
IGF1 GCTCTTCAGTTCGTGTGTGGA GCCTCCTTAGATCACAGCTCC
IGFBP1 TTGGGACGCCATCAGTACCTA TTGGCTAAACTCTCTACGACTCT
MAFB TCAAGTTCGACGTGAAGAAGG GTTCATCTGCTGGTAGTTGCT
MAGEA9 TTGGCCTCTCGTGCGATAG AACGCTTCCCAGATAACCTCT
NLGN4X GGTTTACCGCCAATTTGGATACT CCGTGGGCACGTAGATGTT
NXF3 AGCAGTAGGTCTGAACCTGTC CTGCCTTTCCGATTATAGGGTG
SERPINB2 CAGCACCGAAGACCAGATGG CCTGCAAAATCGCATCAGGATAA
TRIML2 GCCACCGAGCTAGAGGAGAT CTTGAGCAATGCCAAGGTGC
GPR56 TAGTCCCGAGGTTTCCTCCT CTCTCCTACGTGGGCTGTGT
CYP2B6 AGACGCCTTCAATCCTGACC CCTTCACCAAGACAAATCCGC
CYP3A4 GTGGGGCTTTTATGATGGTCA GCCTCAGATTTCTCACCAACACA
hGAPDH CCCATCACCATCTTCCAGGAG GTTGTCATGGATGACCTTGGC
GPX2 GCCTCCTTAAAGTTGCCATA GCCCAGAGCTTACCCA
CYP1A1 AGGCTGAGGTCCTGATAAGCA GCTAAGCAGTTCTTGGTGGTTG

2.4. Western blot analysis

Whole cell lysate (40 μg total protein) was loaded and electrophoretically separated on SDS-PAGE gels. The proteins were transferred onto polyvinylidene fluoride membranes at 500 mA for 1h. Subsequently, membranes were blocked and incubated with antibody of hCAR (Perseus Proteomics) or β-actin (Santa Cruz Biotechnology) at 4 °C overnight. Membranes were developed with West Pico/Femto chemiluminescent substrate (Thermo-Scientific, Rockford, IL) after incubation with secondary antibody.

2.5. RNA-seq data analysis

Detailed sequencing data have been uploaded in the Gene Expression Omnibus (GEO) database that can be viewed with the accession number of GSE71446. Sequence mapping was performed using Tophat version 2.0.10 and Bowtie version 1.0.0 on the Ensembl annotation of human genome reference sequence GRCh38. For expression analysis, Cufflinks version 2.1.1 was used to detect genes and transcripts that are expressed by comparing the Tophat2 read mapping with the Ensembl gene models for the grch37 release of the human genome. The easyRNASeq R Bioconductor package was used to establish raw read counts from the Tophat2 generated BAM alignment files before using the edgeR R Bioconductor 2.12 package. A generalized linear model was used instead of a pairwise comparison approach to account for multiple experimental factors according to the edgeR Users Guide to determine differentially expressed genes. We used a 1.5-fold expression change cut-off combined with exclusion of those with p-value greater than 0.05 and logCPM less than −2 in comparison to define the differentially expressed genes. HemI (Heatmap Illustrator, version 1.0) was used to generate the heatmaps of differentially expressed genes. Database for Annotation, Visualization, and Integrated Discovery (DAVID) Bioinformatics Resources 6.7 was used for the gene function categories and pathway analysis (http://david.abcc.ncifcrf.gov/) by selecting GOTERM_BP_FAT and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, respectively.

2.6. General data analysis

Results from real-time PCR are expressed as mean ± standard deviation of triplicate determinations. Statistical comparisons were made between vehicle control and drug treatment or WT vs. hCAR-KO group using one-way analysis of variance followed by post hoc Dunnett’s test and Students’ t test where appropriate. The criterion of significance was set at p < 0.05 or p < 0.01.

3. Results

3.1. Validation of the hCAR-KO HepaRG cell line

The hCAR-KO HepaRG cell line obtained from Sigma-Aldrich is a newly generated cell line that yet requires full validation. Utilizing the Zinc Finger Nuclease technology, the start sequence of hCAR was targeted. Sequencing of the related DNA region revealed the lack of TGGCCAGTAGG in the knockout cells, which can be genotyped by PCR (Fig. 1A). This editing resulted in differential expression of hCAR protein between HepaRG-WT and hCAR-KO cells, where hCAR was undetectable in KO cells (Fig. 1B). To further validate the function of hCAR-KO cell, inductive expression of CYP2B6, the prototypical hCAR target gene, was measured at the mRNA and protein levels in WT and CAR-KO cells treated with PB and CITCO. As shown in Fig. 1C and 1D, PB, a dual activator of hCAR and hPXR, markedly induced the expression of CYP2B6 in both WT and hCAR-KO cells, while CITCO, a selective activator of hCAR, enhanced the expression of CYP2B6 in the WT cells only. These results clearly establish the hCAR-KO HepaRG cells as a novel research tool in elucidating specific functions associated with hCAR.

Figure 1.

Figure 1

Validation of HepaRG hCAR-KO cells. (A) DNA sequencing revealed the deletion of TGGCCAGTAGG from exon 2 of hCAR in the knockout line. The hCAR-KO cells can be genotyped by PCR using primers shown in Table 1. (B) Expression of hCAR protein was analyzed using Western blotting in HepaRG WT and hCAR-KO cells. Induction of CYP2B6 was examined by Real-time PCR (C) and Western blotting (D) in HepaRG WT and hCAR-KO cells treated with PB (1 mM), CITCO (1 μM) or DMSO (0.1% v/v) for 24 h as detailed in Materials and Methods. Each bar represents the mean ± SD (n = 3). **, p < 0.01.

3.2. CITCO-mediated gene expression in WT and hCAR-KO HepaRG cells

CITCO represents one of the most selective agonists of hCAR identified thus far. Differentially expressed gene profiles were obtained by comparing RNA-seq data generated from CITCO and vehicle control treated WT and hCAR-KO HepaRG cells (Fig. 2, Supplementary Table S2 deposited in GEO dataset GSE71446). The numbers of genes induced by CITCO in WT and hCAR-KO cells are 77 and 41, respectively (Fig. 2A). There are also 13 genes induced by CITCO in both cell lines independent of hCAR. Functional categorization revealed that among the 77 genes induced in HepaRG WT cells, many are associated with DNA damage repair, including genes coding for bloom syndrome protein (BLM), histone H2A (H2AFX), and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) (Table 2). In addition, a group of genes related to the nuclear factor-like 2 (Nrf2) signaling pathway such as glutathione peroxidase 2 (GPX2) and Kruppel-like factor 2 (KLF2) were also enriched in this category. On the other hand, many of the 41 genes induced by CITCO in the absence of hCAR are functionally related to ion homeostasis and transmission of nerve impulse (Fig. 2B, Table 2). Among the 13 genes overexpressed in both cell lines, the majority of them encode drug-metabolizing enzymes such as CYP2B6, CYP3A4, and CYP1A1. It is noteworthy that although CYP2B6 was classified as a gene induced by CITCO in both lines in our RNA-seq analysis, CYP2B6 was induced 12-fold in WT cells while only increased around 1.8-fold in hCAR-KO cells. This phenomenon is consistent with previous reports and supports the predominant selectivity of CITCO in hCAR activation and CYP2B6 induction.

Figure 2.

Figure 2

CITCO-mediated gene expression in WT and hCAR-KO HepaRG cells. (A) Venn diagram of up-regulated genes by CITCO in WT and hCAR-KO cells. (B) Heat map illustrating differentially expressed genes in WT and hCAR-KO cells treated with CITCO or vehicle control. (C) The number of genes down-regulated by CITCO in WT and hCAR-KO cells.

Table 2.

Functional categorization of CITCO-mediated gene expression

Term Count % PValue Genes
Induced in WT cells only GO:0010212~response to ionizing radiation 3 4.69 0.02 BLM, H2AFX, DNMT3B
GO:0009314~response to radiation 4 6.25 0.03 SLC1A2, BLM, H2AFX, DNMT3B
GO:0006310~DNA recombination 3 4.69 0.04 BLM, MND1, H2AFX
GO:0051052~regulation of DNA metabolic process 3 4.69 0.05 BLM, PIF1, H2AFX
GO:0000724~double-strand break repair via homologous recombination 2 3.13 0.06 BLM, H2AFX
GO:0045934~negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 5 7.81 0.08 BLM, CCDC85B, TBX20, ST18, DNMT3B

Induced in KO cells only GO:0019226~transmission of nerve impulse 4 12.12 0.02 SCN1A, PDE7B, TAC1, STX1B
GO:0050801~ion homeostasis 4 12.12 0.03 SCN1A, GIPR, SLC7A8, TAC1
GO:0042592~homeostatic process 5 15.15 0.04 SCN1A, GIPR, SLC7A8, TAC1, MB
GO:0055065~metal ion homeostasis 3 9.09 0.05 GIPR, SLC7A8, TAC1
GO:0007268~synaptic transmission 3 9.09 0.1 PDE7B, TAC1, STX1B

Both induced in WT and KO cells GO:0055114~oxidation reduction 7 63.64 0 CYP3A43, CYP3A4, CYP3A7, CYP1A1, CYP2B6, CYP1A2, ALDH3A1
GO:0017144~drug metabolic process 3 27.27 0 CYP3A4, CYP1A1, CYP1A2
GO:0006805~xenobiotic metabolic process 3 27.27 0 CYP3A4, CYP1A1, CYP1A2
GO:0009410~response to xenobiotic stimulus 3 27.27 0 CYP3A4, CYP1A1, CYP1A2
GO:0018894~dibenzo-p-dioxin metabolic process 2 18.18 0 CYP1A1, CYP1A2

Repressed in WT cells only GO:0009746~response to hexose stimulus 3 6.38 0 PTGS2, GCK, PTPRN
GO:0034284~response to monosaccharide stimulus 3 6.38 0 PTGS2, GCK, PTPRN
GO:0009743~response to carbohydrate stimulus 3 6.38 0.01 PTGS2, GCK, PTPRN
GO:0010959~regulation of metal ion transport 3 6.38 0.01 ATP2B2, PTGS2, GCK
GO:0043269~regulation of ion transport 3 6.38 0.01 ATP2B2, PTGS2, GCK

Rpressed in KO cells only GO:0007267~cell-cell signaling 5 17.24 0.01 PGR, GRIK4, GRIK5, STC1, IHH
GO:0001503~ossification 3 10.34 0.01 STC1, IHH, IGFBP5
GO:0042127~regulation of cell proliferation 4 13.79 0.09 PGR, SFTPD, IHH, IGFBP5

In addition to induction, CITCO treatment also resulted in the repression of 58 genes in WT and 33 genes in hCAR-KO cells (Fig. 2C). Many genes down-regulated in a hCAR-dependent manner are related to carbohydrate metabolism and ion transport, including glucokinase (GCK), prostaglandin-endoperoxide synthase 2 (PTGS2), and receptor-type tyrosine-protein phosphatase-like N (PTPRN). The 33 genes only repressed in hCAR-KO cells appear to be associated with cell-cell signaling, cell proliferation, and ossification (Table 2). Notably, there were only 3 genes repressed in both WT and hCAR-KO cells. Together, these results identify both known and novel hCAR target genes. CITCO treatment led to a limited overlap of differentially expressed genes between WT and hCAR-KO cells, consistent with its central action on hCAR.

3.3. PB-mediated gene expression in WT and hCAR-KO HepaRG cells

PB is a potent activator of both hCAR and hPXR and induces a large number of genes associated with drug metabolism and clearance. In this report, we observed a total of 190 genes being induced by PB in WT and/or hCAR-KO HepaRG cells (Fig. 3A), of which 49 genes were induced in a hCAR-dependent manner, 69 genes were induced only in hCAR-KO cells, while 72 genes were overexpressed in both cell lines. As shown in Table 3, genes typically induced by PB via the activation of hCAR and hPXR such as CYP2B6 and CYP3A4 are among the 72 genes. Furthermore, other cytochrome P450 enzymes including CYP3A7, CYP3A43, CYP2C8, CYP2A13, CYP2A6, CYP2C18, CYP1A1, CYP3A5, and CYP4F8 were also induced in both cell lines (Fig. 3B). In addition to P450 enzymes, a group of efflux and uptake transporter proteins such as ATP-binding cassette, sub-family B member 1 (ABCB1), ABCC2, solute carrier family 5 member 12 (SLC5A12), and SLC51B were identified as hCAR and hPXR shared targets. The function of most genes in this group are related to cellular biosynthetic and metabolic processes including the metabolism of drugs, steroids, fatty acids, and hormones, as well as the biosynthesis of carboxylic acids, organic acids, and nitrogen compounds (Table 3). Of the 49 genes induced only in WT cells by PB, a large number of which are associated with hormone metabolism including dehydrogenase/reductase SDR family member 9 (DHRS9), 3-oxo-5-alpha-steroid 4-dehydrogenase 2 (SRD5A2), UDP-glucuronosyltransferase (UGT2B28), and CYP19A1, suggesting that hCAR may play an important role in modulating the hormone balance in humans. Functional categorization of the 69 genes specifically induced in hCAR-KO cells revealed that most genes are involved in regulation of gene transcription and RNA metabolism (Table 3).

Figure 3.

Figure 3

PB-mediated gene expression in WT and hCAR-KO HepaRG cells. (A) Venn diagram of up-regulated genes by PB in WT and hCAR-KO cells. (B) Heat map illustrating differentially expressed genes in WT and hCAR-KO cells treated with PB or vehicle control. (C) The number of genes down-regulated by PB in WT and hCAR-KO cells.

Table 3.

Function categorization of PB-mediated gene expression

Term Count % PValue Genes
Induced in WT cells only GO:0008610~lipid biosynthetic process 6 13.04 0 ISYNA1, DHRS9, SRD5A2, PCYT1B, LPCAT2, CYP19A1
GO:0008654~phospholipid biosynthetic process 3 6.52 0.03 ISYNA1, PCYT1B, LPCAT2
GO:0042445~hormone metabolic process 3 6.52 0.03 DHRS9, RELN, SRD5A2

Induced in KO cells only GO:0003013~circulatory system process 4 6.9 0.01 ADRB1, KCNJ8, NPR2, EPO
GO:0006355~regulation of transcription, DNA-dependent 10 17.24 0.04 MSX1, NR6A1, TGIF2LX, SSX6, ZNF597, CENPK, HDX, ZNF724P, EPO, FOXN4
GO:0042592~homeostatic process 6 10.34 0.05 ADRB1, TRPM8, NPC1L1, GAL3ST1, MB, EPO

Both induced in WT and KO cells GO:0055114~oxidation reduction 20 31.25 0 CYP3A4, CYP3A5, CYP3A7, CYP1A1, CYP2C18, CYP2C9, CYP2B6, CYP2C8, etc
GO:0008202~steroid metabolic process 8 12.5 0 CYP3A4, AKR1C2, CYP3A5, AKR1B15, CYP1A1, SULT2A1, AKR1B10, UGT2B4, AKR1D1
GO:0007586~digestion 5 7.81 0 AKR1C2, AKR1B15, CHIA, SULT2A1, AKR1B10, AKR1D1
GO:0017144~drug metabolic process 4 6.25 0 CYP3A4, CYP1A1, CYP2C9, NECAB2
GO:0009636~response to toxin 4 6.25 0 GLYAT, CYP1A1, EPHX1, SLC7A11
GO:0046395~carboxylic acid catabolic process 4 6.25 0.01 SULT2A1, PRODH2, PAH, AKR1D1
GO:0046394~carboxylic acid biosynthetic process 4 6.25 0.02 PRODH2, PAH, ASNS, AKR1D1

Repressed in WT cells only GO:0007155~cell adhesion 10 13.51 0 APOA4, CLCA2, CLDN19, ITGAX, PDPN, TEK, GPR56, VCAN, POSTN, AMICA1
GO:0042592~homeostatic process 8 10.81 0.01 APOA4, CTSK, PMCH, GIPR, SERPINE1, SFTPD, LGI4, EPO
GO:0006952~defense response 7 9.46 0.02 APOA4, PDPN, SFTPD, DCDC2, AFAP1L2, MST1R, NLRP1
GO:0042127~regulation of cell proliferation 7 9.46 0.05 RARG, RARRES1, TEK, SERPINE1, SFTPD, MST1R, EPO

Rpressed in KO cells only GO:0055114~oxidation reduction 6 13.04 0.03 NOX4, FMO5, HSD3B1, ALOXE3, FMO2, LOXL1
GO:0048562~embryonic organ morphogenesis 3 6.52 0.05 MAFB, CLIC5, GLI1
GO:0016055~Wnt receptor signaling pathway 3 6.52 0.05 NKD2, RSPO3, RSPO2
GO:0048568~embryonic organ development 3 6.52 0.08 MAFB, CLIC5, GLI1

Both repressed in WT and KO cells GO:0001501~skeletal system development 3 13.64 0.03 MATN3, CTGF, IGFBP3
GO:0001503~ossification 2 9.09 0.09 CTGF, IGFBP3

In contrast to induction, 106 genes were repressed by PB in WT cells, while 84 of them were down-regulated in hCAR-dependent fashion (Fig. 3C). Functional classification revealed that a number of genes down-regulated by PB in an hCAR-dependent manner involving cell adhesion and cell-cell interactions, such as the G protein-coupled receptor 56 (GPR56), apoliporotein A4 (APOA4), and angiopoietin-1 receptor (TEK) (Fig. 3B, Table 4). APOA4 and TEK were also reported to have relationship with liver regeneration and cell growth [31]. Genes repressed in the absence of hCAR upon PB treatment appear to be associated with the oxidation and reduction process, embryonic organ morphogenesis, as well as the Wnt signaling pathway (Table 3). We have also observed 22 genes that are repressed by PB in both WT and hCAR-KO cell lines, which modulate skeletal system development and cell growth. Collectively, these results support a role of PB in human liver cell growth by inducing or repressing genes downstream of hCAR.

Table 4.

Classification of genes differentially expressed in PB- and CITCO-treated HepaRG WT cells

Term Count % PValue Genes
PB induced only GO:0055114~oxidation reduction 16 19.5 1.03E-07 NOX4, CYP3A5, CYP2C18, CYP2C9, CYP2C8, DHRS9, PAH, CYB5A, POR, GPX2, etc
GO:0008202~steroid metabolic process 8 9.8 3.29E-05 AKR1C2, CYP3A5, SULT2A1, DHRS9, UGT2B4, SRD5A2, AKR1D1, CYP19A1
GO:0006706~steroid catabolic process 4 4.9 0.00011 SULT2A1, UGT2B4, SRD5A2, AKR1D1
GO:0008209~androgen metabolic process 3 3.7 0.001072 DHRS9, SRD5A2, AKR1D1

CITCO induced only GO:0010212~response to ionizing radiation 3 6.4 0.008809 BLM, H2AFX, DNMT3B
GO:0009314~response to radiation 4 8.5 0.01152 SLC1A2, BLM, H2AFX, DNMT3B
GO:0006310~DNA recombination 3 6.4 0.025441 BLM, MND1, H2AFX

Both induced by PB and CITCO GO:0055114~oxidation reduction 8 28.6 1.55E-05 CYP3A43, CYP3A4, CYP2A13, AKR1B15, CYP3A7, CYP1A1, CYP2B6, AKR1B10, CYP2A6
GO:0017144~drug metabolic process 3 10.7 2.22E-04 CYP3A4, CYP1A1, NECAB2
GO:0042359~vitamin D metabolic process 2 7.1 1.12E-02 CYP3A4, CYP1A1
GO:0008202~steroid metabolic process 3 10.7 3.21E-02 CYP3A4, AKR1B15, CYP1A1, AKR1B10
GO:0006775~fat-soluble vitamin metabolic process 2 7.1 4.54E-02 CYP3A4, CYP1A1

PB repressed only GO:0007155~cell adhesion 9 10.7 0.006228 APOA4, CLCA2, PDPN, CTGF, TEK, GPR56, VCAN, POSTN, etc
GO:0009611~response to wounding 7 8.3 0.018475 PDPN, CTGF, SERPINE1, VCAN, AFAP1L2, IGFBP1, EPO
GO:0031099~regeneration 3 3.6 0.030943 SERPINE1, VCAN, IGFBP1
GO:0042127~regulation of cell proliferation 8 9.5 0.035969 RARG, RARRES1, TEK, SERPINE1, SFTPD, MST1R, IGFBP3, EPO

CITCO repressed only GO:0009743~response to carbohydrate stimulus 3 1.1 0.003848 PTGS2, GCK, PTPRN

Both repressed by PB and CITCO GO:0019226~transmission of nerve impulse 2 16.7 9.96E-02 CLDN19, LGI4

3.4. Comparison of gene expression between PB and CITCO treatment

We next analyzed the transcription profiles between PB and CITCO treated WT and hCAR-KO HepaRG cells. As shown in Figure 4, the number of differentially expressed genes upon PB treatment was markedly greater than that of affected by CITCO exposure. Among the 180 genes up-regulated by PB and/or CITCO in HepaRG-WT cells, 31 genes were found to be induced by both drugs and nearly half of them are involved in the metabolism of xenobiotics, hormones, or vitamins (Fig. 4A, Table 4). Many drug-metabolizing enzymes induced by PB and CITCO, such as CYP3A4, CYP3A7, and CYP2B6 are known targets shared by hCAR and hPXR (Fig. 4B). PB and CITCO treatment also led to the down-regulation of 106 and 60 genes in WT cells, respectively. Of the down-regulated genes, 15 were suppressed by both drugs, including genes associated with the promotion of cell proliferation such as TEK, PTGS2, and the regulator of cell cycle (RGCC). Combined, these results are consistent with the promiscuous role of PB in gene regulation that involves both hCAR and hPXR.

Figure 4.

Figure 4

Comparison of gene expression between PB and CITCO treatment. (A) Up- and down-regulated genes in HepaRG WT cells exposure to PB or CITCO. (B) Heat maps illustrating genes co-regulated by both PB and CITCO in WT and hCAR-KO cells. (C) Up- and down-regulated genes in hCAR-KO cells exposure to PB or CITCO.

3.5. Differential gene expression in WT and hCAR-KO HepaRG cells

Besides responding to xenobiotic stimulation, CAR may hold inherent endobiotic functions that cannot be appropriately elucidated through pharmacological manipulations. The pair of WT and hCAR-KO HepaRG cells provides a unique model to investigate the importance of endogenous hCAR expression on gene expression. We compared the differential transcriptomes between WT and hCAR-KO cells and identified a great number of genes shown significant differences at the transcriptional level, suggesting endogenously expressed “quiescent” hCAR is of particular physiological importance via gene regulation. A total of 2057 genes were up-regulated in WT HepaRG cells (Fig. 5A, Supplementary Table S5 deposited in GEO dataset). Subsequent pathway analysis revealed that a large number of these genes belong to the families of cytochrome P450, UGT, glutathione S-transferases, ABC transporters, and alcohol dehydrogenases, which are involved in the metabolism of xenobiotics, carbohydrates, lipids, and amino acids. Therefore, hCAR itself is important in the maintenance and modulation of the basal expression of metabolizing enzymes in human liver cells.

Figure 5.

Figure 5

Differential gene expression in WT and hCAR-KO HepaRG cells. The gene expression profiles between WT and hCAR-KO cells were compared without activator stimulation. (A) The number of genes up-regulated and enriched pathways in WT HepaRG cells. (B) The number of genes up-regulated and enriched pathways in hCAR-KO cells.

Additionally, up to 2009 genes were repressed in WT cells in comparison to hCAR-KO cells (Fig. 5B). It is worth noting that genes associated with cancer biology, cell cycle, and cardiovascular diseases are among the most enriched pathways down-regulated. Among these genes, 51 are known targets in cancer-related signaling pathways including BCL2-like 1 (BCL2L1), insulin-like growth factor 1 (IGF1), jun proto-oncogene (JUN), and epidermal growth factor receptor (EGFR) and, 19 play important check-point roles at different phases of cell cycle such as cyclin-dependent kinase CDK1, CDK2, cell division cycle 20 (CDC20), cycline B1 (CCNB1), and cyclin E2 (CCNE2), suggesting that hCAR may inhibit cell cycle progression at its native status. Pathway analysis also revealed that several critical cancerous pathways including the TGF-β, p53, and Jak-STAT signaling were repressed in the presence of hCAR (Fig. 5B). Together, these results indicate that even without the presence of xenobiotic agonists or antagonists, hCAR functions as an important modulator in maintaining the homeostasis of metabolism, cell cycle and proliferation in the liver cells.

3.6. Validation of RNA-seq results in HepaRG cells

To validate the RNA-seq findings, we performed real-time PCR to examine a select set of genes differentially expressed in HepaRG WT and hCAR-KO cells in the presence or absence of chemical stimulation. CYP3A4, the most abundant human hepatic CYP, is a representative target of hPXR with hCAR playing a moderate role in its inductive expression. In agreement with the RNA-seq data, our PCR results indicated that expression of CYP3A4 was markedly induced by PB, the dual activator hPXR/CAR, in both cell lines, while only affected by CITCO to a minimal extent (Fig. 6A). Intriguingly, PB-mediated induction of CYP3A4 in hCAR-KO cells was markedly higher than that in WT cells, which was also observed with a number of other hPXR activators (data not shown), suggesting the role of hPXR might be enhanced in the absence of hCAR competition. GPX2 is a downstream target of the Nrf2 signaling pathway, which can be activated by oxidative stress [32]. We identify GPX2 as a novel hCAR target gene that was induced by CITCO in WT but not hCAR-KO cells (Fig. 6B). CYP1A1 is a prototypical target of the aryl hydrocarbon receptor (AhR) and catalyzes the metabolism of many drugs and environmental chemicals [33]. Both our RNA-seq and PCR data demonstrated that expression of CYP1A1 was significantly increased by CITCO regardless of the presence or absence of hCAR (Fig. 6C). Other than induction, a number of genes selectively repressed by PB and/or CITCO were also examined using RT-PCR. Consistent with RNA-seq findings, GCK, which is critical in glucose metabolism, was repressed by CITCO in WT only (Fig. 6D). GPR56, a member of G-protein coupled receptor family that is functional associated with tumor cell growth suppression and apoptosis induction, was selectively repressed in WT HepaRG cells upon PB treatment [34, 35] (Fig. 6E); whereas GSTA5, a glutathione S-transferase which can catalyze the conjugation of carcinogens, was induced by PB only in hCAR-KO cells (Fig. 5F). Furthermore, a batch of genes differentially expressed in WT and hCAR-KO cells without chemical stimulation were subjected to PCR validation. As shown in Figure 7, knockout of hCAR increased the expression of genes known to be involved in cell cycle and tumorigenesis, including CCNB1, CDK1, DMBT1, EPO, IGF1, IGFBP1, MAFB, MAGEA9, NLGN4X, NXF3 and TRIML2. On the other hand, genes associated with metabolism such as ALB, APOA1, and GSTA5 were confirmed to be down-regulated. Collectively, these results reconfirmed that hCAR exhibits extensive regulatory roles ranging from xenobiotic/endobiotic metabolism to energy homeostasis, cell proliferation and cancer development.

Figure 6.

Figure 6

Real-time PCR validation of genes altered in RNA-seq analysis. WT and hCAR-KO HepaRG cells were cultured and treated with vehicle control (0.1% DMSO), CITCO (1 μM) or PB (1 mM) for 24 h. Real-time PCR was used to analyze expression of CYP3A4 (A), GPX2 (B), CYP1A1 (C), GCK (D), GPR56 (E), and GSTA5 (F) as detailed in Materials and Methods. Data are represented as mean ± SD (n = 3). *, p<0.05, **, p<0.01.

Figure 7.

Figure 7

Real-time PCR validation of differentially expressed genes in WT and hCAR-KO cells. Total RNA was harvested in WT and hCAR-KO cells in the absence of chemical treatment. A panel of selected genes exhibited altered expression in RNA-seq analysis was subjected to real-time PCR validation, which include (A) up-regulated genes and (B) down-regulated genes as indicated in the figures. Data are represented as mean ± SD (n = 3). *, p<0.05, **, p<0.01.

4. Discussion

Despite major progress in deciphering the role of rodent CAR by using genetically modified animal models, the function of hCAR has been investigated predominantly via the use of chemical modulators which often lack specificity [36, 37]. In this report, we have examined the hCAR-associated transcriptome employing a newly generated hCAR-KO HepaRG cell line in comparison to its WT parent cells. RNA-seq was used to obtain global expression profiles between WT and hCAR-KO HepaRG cells challenged with PB, CITCO, or vehicle control. Our data revealed numerous new and previously reported genes that are associated with the presence or activation of hCAR in human liver cells. Consistent with previous reports, the main function of hCAR in the liver involves up-regulation of drug metabolism upon PB and CITCO stimulation. Activation of hCAR is also involved in the regulation of important physiological and/or pathophysiological functions including cell proliferation, hormone homeostasis, energy metabolism, and oxidative stress. Notably, we found that endogenous expression of hCAR alone was sufficient to alter the expression of many genes known to be involved in critical biological functions.

HepaRG cells, a human liver cell line, originally derived from human hepatocellular carcinoma [38], exhibit prototypical human primary hepatocyte-like features such as the inductive expression of major P450s, the efflux function of transporters, and the physiologically relevant expression of a number of liver enriched transcription factors. Notably, these hepatic characteristics are lost in widely used human hepatoma cell lines including HepG2 cells, making HepaRG cells an attractive surrogate for HPH [39, 40]. CITCO, a compound that activates hCAR with relatively high specificity, was chosen as the model agonist for the investigation of hCAR and its prototypical target gene, CYP2B6. Our data demonstrated that the expression of CYP2B6 was robustly induced in HepaRG cells by CITCO to an extent which challenges that of HPH. Whereas such induction was disrupted at both mRNA and protein levels when hCAR was knocked out in HepaRG cells, establishing this line an excellent model for deciphering hCAR functions in a human hepatic cellular environment.

We first determined the global transcriptomes between WT and hCAR-KO HepaRG cells in the presence or absence of CITCO stimulus. Clearly, a significantly higher number of genes were up- or down-regulated by CITCO in WT over hCAR-KO cells, reflecting the overall high selectivity of CITCO for hCAR. Interestingly, other than the known drug metabolism-coding genes, a group of genes associated with oxidative stress response were induced by CITCO treatment in a hCAR-dependent manner. Among others, expression of GPX2, an antioxidant and anti-inflammatory enzyme, was enhanced by CITCO in WT cells only. It has been known that GPX2 is transcriptionally regulated by Nrf2 and Wnt/β-catenin pathways. GPX2 promoter harboring multiple binding sites for Nrf2 and β-catenin/TCF was induced by prototypical Nrf2 activators such as sulforaphane and t-butyl hydrochinone [41, 42]. Notably, the Nrf2 activator Oltipraz was reported to activate CAR and induce cyp2b10 expression in mice [43], while Nrf2 knockout mice exhibited decreased expression of CAR target genes [44]. Whether CITCO-induced expression of GPX2 relies on the interplay between CAR and Nrf2 is an intriguing question that needs be address next. In addition to hCAR-dependent gene regulation, CITCO also altered the expression of a number of genes independent of hCAR. For instance, CYP1A1, a prototypical target gene of AhR, was potently induced by CITCO in both WT and hCAR-KO HepaRG cells (Fig. 6C). Likewise, mCAR-independent induction of CYP1A1 and/or CYP1A2 by pyrene and TCPOBOP was observed in both WT and CAR-KO mice [45, 46]. Whereas cell-based CYP1A1 luciferase reporter assays revealed that CITCO does not active AhR (Data not shown). Thus, CITCO may induce CYP1A1 in a yet unknown mechanism(s) that requires future investigation.

Although PB is a selective CAR activator in animal models, it induces the expression of CYP2B6 and CYP3A4 through activation of both hCAR and hPXR [47]. Consistent with the known cross-talk between hCAR and hPXR and dual effects of PB on these receptors, we have observed a set of largely overlapping genes induced by PB in both WT and hCAR-KO cells. PB also influences the expression of a significantly greater number of genes than CITCO, which is more selective towards hCAR. In line with the reported central roles of these two compounds, genes up-regulated by both PB and CITCO in WT HepaRG cells are enriched majorly in drug and steroid metabolism, including CYP3A4, CYP2B6, CYP2A6, AKR1B10, and SLC5A12. On the other hand, differentially expressed genes related to glucose and lipid metabolism were limited after PB or CITCO treatment in our RNA-seq analysis, which differs significantly from studies in mice. Previous microarray studies revealed that PB represses multiple genes associated with fatty acid oxidation and glucose synthesis in a CAR-dependent manner [18]. The beneficial effects of CAR activation on obesity and diabetes were functionally confirmed in WT and CAR-KO mice using another mCAR activator, TCPOBOP, in which activation of mCAR down-regulates the process of gluconeogenesis, lipogenesis, and fatty acid synthesis [48, 49]. Studies using HPH however indicated that although activation of hCAR remarkably repressed the expression of genes corresponding to gluconeogenesis, its role on lipogenesis and fatty acid synthesis in human liver is contentious [50]. Thus, it appears that modulation of CAR may exhibit greater species selectivity in energy homeostasis than in drug metabolism.

Emerging evidence reveals that CAR has evolved into a dual xenobiotic/endobiotic sensor, dictating both prototypical agonists/antagonists and endogenous signaling molecules [17, 51]. Although the biological function of CAR relies predominantly on chemical modulation, expression of CAR itself may affect the downstream regulation of its target genes. Positive correlation between the expression of hCAR and CYP2B6 was observed in human liver samples [52]. In animal studies, fasting and caloric restriction increased the expression and activity of mCAR leading to diminished energy expenditure, while such compensatory adjustment was lost in CAR-KO animals [53]. By comparing the transcriptomes of HepaRG WT and hCAR-KO cells, we found that absence of hCAR suppressed many drug-metabolizing enzymes, while unexpectedly promoted cell proliferation. Among others, the basal level of CYP2E1 was drastically repressed, while expression of CYP3A4 and CYP2B6 was largely unchanged in hCAR-KO cells, suggesting maintenance of CYP2E1 expression requires the presence of hCAR. Interestingly, many genes encoding energy metabolizing enzymes were also down-regulated in the absence of hCAR, indicating the importance of hCAR in energy metabolism and homeostasis. A total of 2009 genes were up-regulated in hCAR-KO cells. To our surprise many genes associated with cell proliferation and tumorigenesis were enriched in this category. Considering that activation of hCAR by both CITCO and PB also repressed the expression of cell growth promoting genes such as TEK and RGCC, hCAR could have a role in suppressing cell proliferation and potential tumor development in human liver. Indeed, activation of hCAR by CITCO was reported to cause cell cycle arrest and enhanced apoptosis in human brain tumor stem cells [54], whereas overexpression of hCAR in human embryonic stem cells increased albumin secretion and promoted the differentiation and maturation of hepatic-like cells [55]. Nonetheless, these findings in human are in contrast to what has been reported previously in animal models, in which the tumor promotion effects of TCPOBOP and PB rely predominantly on a functional mCAR [17, 56]. Collectively, these studies support a presumptive role of hCAR in cell proliferation that is contrary to that of mCAR, further emphasizing the significance of species variations between hCAR and its rodent counterparts.

In summary, our results demonstrate that selective modulation of hCAR both pharmacologically and genetically lead to altered expression of numerous genes involving drug metabolism and transportation, oxidative stress, and energy balance, as well as cell proliferation and differentiation. Overlapping, distinct, and even opposite functions were shown between human and mouse CAR, with the differences lying mainly in the areas of energy metabolism and cell proliferation. These findings warrant more detailed investigation to eventually define the biological functions of human CAR and explore its possibilities as a therapeutic drug target.

Table 5.

Classification of genes differentially expressed in PB- and CITCO-treated hCAR-KO cells

Term Count % PValue Genes
PB induced only GO:0055114~oxidation reduction 16 15.4 8.59E-07 CYP3A5, MDH1B, CYP2C18, CYP2C9, CYP2C8, PAH, CYB5A, POR, GPX2, CYP2A13, CYP4F8, AKR1C2, etc
GO:0008202~steroid metabolic process 8 7.7 8.84E-05 AKR1C2, CYP3A5, AKR1B15, SULT2A1, AKR1B10, APOF, NPC1L1, UGT2B4, AKR1D1
GO:0007586~digestion 6 5.8 0.000113 AKR1C2, AKR1B15, PNLIPRP2, SULT2A1, AKR1B10, NPC1L1, AKR1D1
GO:0006706~steroid catabolic process 3 2.9 0.005347 SULT2A1, UGT2B4, AKR1D1
GO:0016042~lipid catabolic process 5 4.8 0.012916 AZGP1P1, PNLIPRP2, SULT2A1, UGT2B4, AKR1D1
GO:0030573~bile acid catabolic process 2 1.9 0.015664 SULT2A1, AKR1D1

CITCO induced only GO:0055114~oxidation reduction 5 27.8 0.001247 CYP3A43, CYP3A4, CYP3A7, CYP1A1, CYP2B6
GO:0042359~vitamin D metabolic process 2 11.1 0.006488 CYP3A4, CYP1A1

Both induced by PB and CITCO GO:0019226~transmission of nerve impulse 4 15.4 0.016162 SCN1A, PDE7B, TAC1, STX1B
GO:0050801~ion homeostasis 4 15.4 0.024352 SCN1A, GIPR, SLC7A8, TAC1
GO:0055065~metal ion homeostasis 3 11.5 0.039729 GIPR, SLC7A8, TAC1

PB repressed only GO:0055114~oxidation reduction 7 11.5 0.014917 NOX4, FMO5, HSD3B1, ALOXE3, FMO2, CYP4Z1, LOXL1
GO:0001501~skeletal system development 5 8.2 0.018185 MATN3, CTGF, ACAN, IGFBP3, GLI1
GO:0001503~ossification 3 4.9 0.051608 CTGF, IGFBP3, GLI1

CITCO repressed only GO:0007267~cell-cell signaling 4 16 0.026514 PGR, GRIK4, STC1, IHH
GO:0050678~regulation of epithelial cell proliferation 2 8 0.075936 PGR, IHH

Acknowledgments

The authors thank Sigma-Aldrich for providing the Wild-type and hCAR-KO HepaRG cells. This work was partly supported by the National Institutes of Health grants: DK061652 and GM107058. DL is supported by the FDA Oak Ridge Institute for Science and Education (ORISE) postdoctoral fellowship.

Abbreviations

CAR

constitutive androstane receptor

CITCO

6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime

CYP

cytochrome P450

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GPR56

G protein-coupled receptor 56

GPX2

glutathione peroxidase 2

HPH

human primary hepatocytes

Nrf2

nuclear factor (erythroid-derived 2)-like 2

PB

phenobarbital

PXR

pregnane X receptor

TCPOBOP

1,4-bis[2-(3,5-dichloropyridyloxy)]benzene

TEK

angiopoietin-1 receptor

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Qatanani M, Moore DD. CAR, the continuously advancing receptor, in drug metabolism and disease. Curr Drug Metab. 2005;6:329–39. doi: 10.2174/1389200054633899. [DOI] [PubMed] [Google Scholar]
  • 2.Kakizaki S, Yamazaki Y, Takizawa D, Negishi M. New insights on the xenobiotic-sensing nuclear receptors in liver diseases--CAR and PXR. Curr Drug Metab. 2008;9:614–21. doi: 10.2174/138920008785821666. [DOI] [PubMed] [Google Scholar]
  • 3.Wada T, Gao J, Xie W. PXR and CAR in energy metabolism. Trends Endocrinol Metab. 2009;20:273–9. doi: 10.1016/j.tem.2009.03.003. [DOI] [PubMed] [Google Scholar]
  • 4.Staudinger JL, Madan A, Carol KM, Parkinson A. Regulation of drug transporter gene expression by nuclear receptors. Drug Metab Dispos. 2003;31:523–7. doi: 10.1124/dmd.31.5.523. [DOI] [PubMed] [Google Scholar]
  • 5.Wang D, Li L, Yang H, Ferguson SS, Baer MR, Gartenhaus RB, et al. The constitutive androstane receptor is a novel therapeutic target facilitating cyclophosphamide-based treatment of hematopoietic malignancies. Blood. 2013;121:329–38. doi: 10.1182/blood-2012-06-436691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yan J, Chen B, Lu J, Xie W. Deciphering the roles of the constitutive androstane receptor in energy metabolism. Acta Pharmacol Sin. 2015;36:62–70. doi: 10.1038/aps.2014.102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Faucette SR, Zhang TC, Moore R, Sueyoshi T, Omiecinski CJ, LeCluyse EL, et al. Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. J Pharmacol Exp Ther. 2007;320:72–80. doi: 10.1124/jpet.106.112136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sugatani J, Kojima H, Ueda A, Kakizaki S, Yoshinari K, Gong QH, et al. The phenobarbital response enhancer module in the human bilirubin UDP-glucuronosyltransferase UGT1A1 gene and regulation by the nuclear receptor CAR. Hepatology. 2001;33:1232–8. doi: 10.1053/jhep.2001.24172. [DOI] [PubMed] [Google Scholar]
  • 9.Banerjee M, Robbins D, Chen T. Targeting xenobiotic receptors PXR and CAR in human diseases. Drug Discov Today. 2014 doi: 10.1016/j.drudis.2014.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gao J, Xie W. Targeting xenobiotic receptors PXR and CAR for metabolic diseases. Trends Pharmacol Sci. 2012;33:552–8. doi: 10.1016/j.tips.2012.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xie W, Barwick JL, Simon CM, Pierce AM, Safe S, Blumberg B, et al. Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev. 2000;14:3014–23. doi: 10.1101/gad.846800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen Y, Kissling G, Negishi M, Goldstein JA. The nuclear receptors constitutive androstane receptor and pregnane X receptor cross-talk with hepatic nuclear factor 4alpha to synergistically activate the human CYP2C9 promoter. J Pharmacol Exp Ther. 2005;314:1125–33. doi: 10.1124/jpet.105.087072. [DOI] [PubMed] [Google Scholar]
  • 13.Goodwin B, Moore LB, Stoltz CM, McKee DD, Kliewer SA. Regulation of the human CYP2B6 gene by the nuclear pregnane X receptor. Mol Pharmacol. 2001;60:427–31. [PubMed] [Google Scholar]
  • 14.Wang H, Negishi M. Transcriptional regulation of cytochrome p450 2B genes by nuclear receptors. Curr Drug Metab. 2003;4:515–25. doi: 10.2174/1389200033489262. [DOI] [PubMed] [Google Scholar]
  • 15.Ross J, Plummer SM, Rode A, Scheer N, Bower CC, Vogel O, et al. Human constitutive androstane receptor (CAR) and pregnane X receptor (PXR) support the hypertrophic but not the hyperplastic response to the murine nongenotoxic hepatocarcinogens phenobarbital and chlordane in vivo. Toxicol Sci. 2010;116:452–66. doi: 10.1093/toxsci/kfq118. [DOI] [PubMed] [Google Scholar]
  • 16.Huang W, Zhang J, Wei P, Schrader WT, Moore DD. Meclizine is an agonist ligand for mouse constitutive androstane receptor (CAR) and an inverse agonist for human CAR. Mol Endocrinol. 2004;18:2402–8. doi: 10.1210/me.2004-0046. [DOI] [PubMed] [Google Scholar]
  • 17.Wei P, Zhang J, Egan-Hafley M, Liang S, Moore DD. The nuclear receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature. 2000;407:920–3. doi: 10.1038/35038112. [DOI] [PubMed] [Google Scholar]
  • 18.Ueda A, Hamadeh HK, Webb HK, Yamamoto Y, Sueyoshi T, Afshari CA, et al. Diverse roles of the nuclear orphan receptor CAR in regulating hepatic genes in response to phenobarbital. Mol Pharmacol. 2002;61:1–6. doi: 10.1124/mol.61.1.1. [DOI] [PubMed] [Google Scholar]
  • 19.Xiao L, Cui X, Madison V, White RE, Cheng KC. Insights from a three-dimensional model into ligand binding to constitutive active receptor. Drug Metab Dispos. 2002;30:951–6. doi: 10.1124/dmd.30.9.951. [DOI] [PubMed] [Google Scholar]
  • 20.Maglich JM, Parks DJ, Moore LB, Collins JL, Goodwin B, Billin AN, et al. Identification of a novel human constitutive androstane receptor (CAR) agonist and its use in the identification of CAR target genes. J Biol Chem. 2003;278:17277–83. doi: 10.1074/jbc.M300138200. [DOI] [PubMed] [Google Scholar]
  • 21.Yang H, Wang H. Signaling control of the constitutive androstane receptor (CAR) Protein Cell. 2014;5:113–23. doi: 10.1007/s13238-013-0013-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mutoh S, Osabe M, Inoue K, Moore R, Pedersen L, Perera L, et al. Dephosphorylation of threonine 38 is required for nuclear translocation and activation of human xenobiotic receptor CAR (NR1I3) J Biol Chem. 2009;284:34785–92. doi: 10.1074/jbc.M109.048108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, Moore DD. A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol Cell Biol. 1994;14:1544–52. doi: 10.1128/mcb.14.3.1544-1552.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li H, Chen T, Cottrell J, Wang H. Nuclear translocation of adenoviral-enhanced yellow fluorescent protein-tagged-human constitutive androstane receptor (hCAR): a novel tool for screening hCAR activators in human primary hepatocytes. Drug Metab Dispos. 2009;37:1098–106. doi: 10.1124/dmd.108.026005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K, Negishi M. Phenobarbital-responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Biol. 1999;19:6318–22. doi: 10.1128/mcb.19.9.6318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kobayashi K, Sueyoshi T, Inoue K, Moore R, Negishi M. Cytoplasmic accumulation of the nuclear receptor CAR by a tetratricopeptide repeat protein in HepG2 cells. Mol Pharmacol. 2003;64:1069–75. doi: 10.1124/mol.64.5.1069. [DOI] [PubMed] [Google Scholar]
  • 27.Lynch C, Pan Y, Li L, Ferguson SS, Xia M, Swaan PW, et al. Identification of novel activators of constitutive androstane receptor from FDA-approved drugs by integrated computational and biological approaches. Pharm Res. 2013;30:489–501. doi: 10.1007/s11095-012-0895-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Omiecinski CJ, Coslo DM, Chen T, Laurenzana EM, Peffer RC. Multi-species analyses of direct activators of the constitutive androstane receptor. Toxicol Sci. 2011;123:550–62. doi: 10.1093/toxsci/kfr191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Aninat C, Piton A, Glaise D, Le Charpentier T, Langouet S, Morel F, et al. Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metab Dispos. 2006;34:75–83. doi: 10.1124/dmd.105.006759. [DOI] [PubMed] [Google Scholar]
  • 30.Lubberstedt M, Muller-Vieira U, Mayer M, Biemel KM, Knospel F, Knobeloch D, et al. HepaRG human hepatic cell line utility as a surrogate for primary human hepatocytes in drug metabolism assessment in vitro. J Pharmacol Toxicol Methods. 2011;63:59–68. doi: 10.1016/j.vascn.2010.04.013. [DOI] [PubMed] [Google Scholar]
  • 31.Chiba M, Yasue H, Ohkohchi N. Gene expression profiling of sense and antisense transcripts in liver regeneration by microarray analysis. Biomed Rep. 2013;1:383–8. doi: 10.3892/br.2013.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Dewa Y, Nishimura J, Muguruma M, Jin M, Saegusa Y, Okamura T, et al. beta-Naphthoflavone enhances oxidative stress responses and the induction of preneoplastic lesions in a diethylnitrosamine-initiated hepatocarcinogenesis model in partially hepatectomized rats. Toxicology. 2008;244:179–89. doi: 10.1016/j.tox.2007.11.010. [DOI] [PubMed] [Google Scholar]
  • 33.Ma Q. Induction of CYP1A1. The AhR/DRE paradigm: transcription, receptor regulation, and expanding biological roles. Curr Drug Metab. 2001;2:149–64. doi: 10.2174/1389200013338603. [DOI] [PubMed] [Google Scholar]
  • 34.Ke N, Sundaram R, Liu G, Chionis J, Fan W, Rogers C, et al. Orphan G protein-coupled receptor GPR56 plays a role in cell transformation and tumorigenesis involving the cell adhesion pathway. Mol Cancer Ther. 2007;6:1840–50. doi: 10.1158/1535-7163.MCT-07-0066. [DOI] [PubMed] [Google Scholar]
  • 35.Saito Y, Kaneda K, Suekane A, Ichihara E, Nakahata S, Yamakawa N, et al. Maintenance of the hematopoietic stem cell pool in bone marrow niches by EVI1-regulated GPR56. Leukemia. 2013;27:1637–49. doi: 10.1038/leu.2013.75. [DOI] [PubMed] [Google Scholar]
  • 36.Smirlis D, Muangmoonchai R, Edwards M, Phillips IR, Shephard EA. Orphan receptor promiscuity in the induction of cytochromes p450 by xenobiotics. J Biol Chem. 2001;276:12822–6. doi: 10.1074/jbc.M005930200. [DOI] [PubMed] [Google Scholar]
  • 37.Kohle C, Bock KW. Coordinate regulation of human drug-metabolizing enzymes, and conjugate transporters by the Ah receptor, pregnane X receptor and constitutive androstane receptor. Biochem Pharmacol. 2009;77:689–99. doi: 10.1016/j.bcp.2008.05.020. [DOI] [PubMed] [Google Scholar]
  • 38.Parent R, Marion MJ, Furio L, Trepo C, Petit MA. Origin and characterization of a human bipotent liver progenitor cell line. Gastroenterology. 2004;126:1147–56. doi: 10.1053/j.gastro.2004.01.002. [DOI] [PubMed] [Google Scholar]
  • 39.Gerets HH, Tilmant K, Gerin B, Chanteux H, Depelchin BO, Dhalluin S, et al. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biol Toxicol. 2012;28:69–87. doi: 10.1007/s10565-011-9208-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hart SN, Li Y, Nakamoto K, Subileau EA, Steen D, Zhong XB. A comparison of whole genome gene expression profiles of HepaRG cells and HepG2 cells to primary human hepatocytes and human liver tissues. Drug Metab Dispos. 2010;38:988–94. doi: 10.1124/dmd.109.031831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Banning A, Deubel S, Kluth D, Zhou Z, Brigelius-Flohe R. The GI-GPx gene is a target for Nrf2. Mol Cell Biol. 2005;25:4914–23. doi: 10.1128/MCB.25.12.4914-4923.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kipp A, Banning A, Brigelius-Flohe R. Activation of the glutathione peroxidase 2 (GPx2) promoter by beta-catenin. Biol Chem. 2007;388:1027–33. doi: 10.1515/BC.2007.137. [DOI] [PubMed] [Google Scholar]
  • 43.Merrell MD, Jackson JP, Augustine LM, Fisher CD, Slitt AL, Maher JM, et al. The Nrf2 activator oltipraz also activates the constitutive androstane receptor. Drug Metab Dispos. 2008;36:1716–21. doi: 10.1124/dmd.108.020867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Aleksunes LM, Klaassen CD. Coordinated regulation of hepatic phase I and II drug-metabolizing genes and transporters using AhR-, CAR-, PXR-, PPARalpha-, and Nrf2-null mice. Drug Metab Dispos. 2012;40:1366–79. doi: 10.1124/dmd.112.045112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang XJ, Shi Z, Lyv JX, He X, Englert NA, Zhang SY. Pyrene is a novel constitutive androstane receptor (CAR) activator and causes hepatotoxicity by CAR. Toxicol Sci. 2015 doi: 10.1093/toxsci/kfv142. [DOI] [PubMed] [Google Scholar]
  • 46.Zhang J, Huang W, Chua SS, Wei P, Moore DD. Modulation of acetaminophen-induced hepatotoxicity by the xenobiotic receptor CAR. Science. 2002;298:422–4. doi: 10.1126/science.1073502. [DOI] [PubMed] [Google Scholar]
  • 47.Elcombe CR, Peffer RC, Wolf DC, Bailey J, Bars R, Bell D, et al. Mode of action and human relevance analysis for nuclear receptor-mediated liver toxicity: A case study with phenobarbital as a model constitutive androstane receptor (CAR) activator. Crit Rev Toxicol. 2014;44:64–82. doi: 10.3109/10408444.2013.835786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Gao J, He J, Zhai Y, Wada T, Xie W. The constitutive androstane receptor is an anti-obesity nuclear receptor that improves insulin sensitivity. J Biol Chem. 2009;284:25984–92. doi: 10.1074/jbc.M109.016808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Dong B, Saha PK, Huang W, Chen W, Abu-Elheiga LA, Wakil SJ, et al. Activation of nuclear receptor CAR ameliorates diabetes and fatty liver disease. Proc Natl Acad Sci U S A. 2009;106:18831–6. doi: 10.1073/pnas.0909731106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Lynch C, Pan Y, Li L, Heyward S, Moeller T, Swaan PW, et al. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes. Toxicol Appl Pharmacol. 2014;279:33–42. doi: 10.1016/j.taap.2014.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Honkakoski P, Zelko I, Sueyoshi T, Negishi M. The nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital-responsive enhancer module of the CYP2B gene. Mol Cell Biol. 1998;18:5652–8. doi: 10.1128/mcb.18.10.5652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Chang TK, Bandiera SM, Chen J. Constitutive androstane receptor and pregnane X receptor gene expression in human liver: interindividual variability and correlation with CYP2B6 mRNA levels. Drug Metab Dispos. 2003;31:7–10. doi: 10.1124/dmd.31.1.7. [DOI] [PubMed] [Google Scholar]
  • 53.Maglich JM, Watson J, McMillen PJ, Goodwin B, Willson TM, Moore JT. The nuclear receptor CAR is a regulator of thyroid hormone metabolism during caloric restriction. J Biol Chem. 2004;279:19832–8. doi: 10.1074/jbc.M313601200. [DOI] [PubMed] [Google Scholar]
  • 54.Chakraborty S, Kanakasabai S, Bright JJ. Constitutive androstane receptor agonist CITCO inhibits growth and expansion of brain tumour stem cells. Br J Cancer. 2011;104:448–59. doi: 10.1038/sj.bjc.6606064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Chen F, Zamule SM, Coslo DM, Chen T, Omiecinski CJ. The human constitutive androstane receptor promotes the differentiation and maturation of hepatic-like cells. Dev Biol. 2013;384:155–65. doi: 10.1016/j.ydbio.2013.10.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Yamamoto Y, Moore R, Goldsworthy TL, Negishi M, Maronpot RR. The orphan nuclear receptor constitutive active/androstane receptor is essential for liver tumor promotion by phenobarbital in mice. Cancer Res. 2004;64:7197–200. doi: 10.1158/0008-5472.CAN-04-1459. [DOI] [PubMed] [Google Scholar]

RESOURCES