Skip to main content
Biophysical Journal logoLink to Biophysical Journal
. 2015 Oct 6;109(7):1410–1419. doi: 10.1016/j.bpj.2015.08.006

Differential Redox Regulation of Ca2+ Signaling and Viability in Normal and Malignant Prostate Cells

Christian Holzmann 1, Tatiana Kilch 1,2, Sven Kappel 1, Kathrin Dörr 1, Volker Jung 3, Michael Stöckle 3, Ivan Bogeski 1, Christine Peinelt 1,2,∗
PMCID: PMC4601090  PMID: 26445441

Abstract

In prostate cancer, reactive oxygen species (ROS) are elevated and Ca2+ signaling is impaired. Thus, several novel therapeutic strategies have been developed to target altered ROS and Ca2+ signaling pathways in prostate cancer. Here, we investigate alterations of intracellular Ca2+ and inhibition of cell viability caused by ROS in primary human prostate epithelial cells (hPECs) from healthy tissue and prostate cancer cell lines (LNCaP, DU145, and PC3). In hPECs, LNCaP and DU145 H2O2 induces an initial Ca2+ increase, which in prostate cancer cells is blocked at high concentrations of H2O2. Upon depletion of intracellular Ca2+ stores, store-operated Ca2+ entry (SOCE) is activated. SOCE channels can be formed by hexameric Orai1 channels; however, Orai1 can form heteromultimers with its homolog, Orai3. Since the redox sensor of Orai1 (Cys-195) is absent in Orai3, the Orai1/Orai3 ratio in T cells determines the redox sensitivity of SOCE and cell viability. In prostate cancer cells, SOCE is blocked at lower concentrations of H2O2 compared with hPECs. An analysis of data from hPECs, LNCaP, DU145, and PC3, as well as previously published data from naive and effector TH cells, demonstrates a strong correlation between the Orai1/Orai3 ratio and the SOCE redox sensitivity and cell viability. Therefore, our data support the concept that store-operated Ca2+ channels in hPECs and prostate cancer cells are heteromeric Orai1/Orai3 channels with an increased Orai1/Orai3 ratio in cells derived from prostate cancer tumors. In addition, ROS-induced alterations in Ca2+ signaling in prostate cancer cells may contribute to the higher sensitivity of these cells to ROS.

Introduction

Numerous studies have demonstrated a contribution of reactive oxygen species (ROS) to the development of cancer hallmarks. In prostate cancer, ROS levels are elevated and contribute to altered DNA and protein structures, enhanced epithelial cell proliferation, and neoplasia (1–5). Remarkably, even though ROS production in cancer cells is elevated, cancer cells (including prostate cancer cells) are more sensitive to oxidative stress than nonmalignant cells—a phenomenon that is utilized in the development of novel anticancer drugs (6,7). ROS-inducing substances and ROS scavengers have been investigated as therapeutics; however, the outcome and benefit of such strategies remain largely unclear (8). Therefore, a better understanding of the underlying mechanisms and key players in redox-regulated signaling pathways is required for future therapeutic approaches.

There are multiple links between ROS and the universal second messenger Ca2+ (9–11). In prostate cancer cells, ROS-induced signaling is well known to include elevated Ca2+. In PC3 prostate cancer cells, ROS was shown to induce an increase of intracellular Ca2+ levels, which is necessary for ROS-induced apoptosis (12). In DU145 cells, ROS-activated cell apoptosis depends on elevated Ca2+ signaling for a full response (13). Several Ca2+ transporters, including transient receptor potential (TRP) channels and inositol 1,4,5-trisphosphate receptors (IP3R), which are activated and/or regulated by ROS, contribute to ROS-induced Ca2+ signaling (14–17). The cell-type-specific subset of Ca2+ transporters and the distinct and spatially complex regulation of ROS by ROS-producing and -scavenging enzymes ensure precise ROS-induced Ca2+ signaling patterns (14,18).

The main Ca2+ entry mechanism in nonexcitable cells is known as store-operated Ca2+ entry (SOCE). Upon Ca2+ release from internal Ca2+ stores, endoplasmic reticulum Ca2+ sensor proteins (e.g., stromal interaction molecule 1 (STIM1)) cluster and activate Orai1 Ca2+ channels that are located in the plasma membrane (19). The SOCE underlying current is referred to as Ca2+ release activated Ca2+ current (ICRAC). Store-operated Orai1 channels have been described as either tetramers (20–25) or hexamers (26–29) in the past. Besides Orai1, Orai2 and Orai3 are ubiquitously expressed and form heteromers with Orai1 (30–33). Compared with homomeric Orai1 channels, heteromeric store-operated Orai1/Orai3 channels differ in certain properties, such as the Ca2+ current amplitude, ion selectivity, pharmacological profile, and ROS sensitivity (33–36). A very recent report demonstrated that one Orai3 subunit within a heteromeric channel complex is sufficient to completely abrogate the ROS sensitivity of ICRAC (37). The ROS sensitivity of Orai1 has been attributed to the oxidation of one cysteine (Cys-195). Since Cys-195 is absent in Orai3, the Orai1/Orai3 expression ratio impacts the ROS-mediated block of SOCE and cellular viability upon ROS-mediated stress. In effector T cells, Orai3 is upregulated, as reflected by a decreased mRNA ratio (Orai1/Orai3 ratio ∼70 in naive TH cells and ∼25 in effector TH cells) (35). Subsequently, the IC50 for the immediate H2O2-induced block of SOCE is shifted from 7 μM for naive TH cells to 51 μM for effector TH cells. As a physiological consequence, the lowered Orai1/Orai3 ratio increases the cellular viability upon oxidative stress (IC50 = 39 μM H2O2 in naive TH cells, and IC50 = 199 μM H2O2 in effector TH cells) (35). These relatively high levels of H2O2 seem to be physiologically relevant. Based on our recent findings (38,39), and taking into account previous concepts regarding the existence of ROS microdomains (40–42), it seems very likely that in inflamed tissues the levels of H2O2 might well exceed 200–300 μM.

Recently, we reported an outstandingly low Orai1/Orai3 mRNA ratio (∼4) in primary human prostate epithelial cells (hPECs) from healthy tissue and a downregulation of Orai3 in prostate cancer cell lines (Orai1/Orai3 ratio ∼26 in lymph node carcinoma of the prostate (LNCaP) and ∼17 in DU145) (34).

Here, we sought to determine whether ROS-induced Ca2+ signaling and SOCE in cells under oxidative stress are altered in prostate cancer. In addition, we investigated whether the low Orai1/Orai3 ratio in hPECs is associated with a low redox sensitivity of SOCE, and whether this sensitivity might be increased in prostate cancer cells.

Materials and Methods

Cell culture

This study was approved by the local ethics review board (approval No. 168/05, Ärztekammer des Saarlandes) and performed in accordance with the Declaration of Helsinki. Informed consent was obtained from all patients. Prostate tissue was obtained from prostectomy specimens, and hPECs obtained from healthy tissue were isolated and cultured according to Gmyrek et al. (43) with slight modifications (34). The prostate cancer lines LNCaP, DU145, and PC3 were purchased from the American Type Cell Culture Collection (ATCC, Rockville, MD). Cell lines were cultured with RPMI Medium 1640 (Life Technologies) supplemented with 10% fetal calf serum and 1% penicillin/streptomycin (Life Technologies).

Small interfering RNA transfection

Small interfering RNA (siRNA) transfections were performed as described previously (34). We performed the siRNA transfections with 0.12 nmol of siRNA using the Nucleofector II Transfection Kit R for hPECs and LNCaP, the Nucleofactor IV Kit SE for DU145, and the Kit SF for PC3 (all from Lonza) according to the manufacturer’s instructions. All siRNAs were obtained from Qiagen or Microsynth and were partially modified according to Mantei et al. (44). The Orai1 siRNAs were Hs_TMEM142A_1, #SI03196207 (sense: 5′OMeC-OMeG-GCCUGAUCUUUAUCGd (UCU)OMeU-OMeT-OMeT3′; antisense: 3′OMeG-OMeC-CGGACUAGAAAUAGCAGAd (A)5′) and Hs_TMEM142A_2, #SI04215316 (sense: 5′OMeC-OMeA-ACAUCGAGGCGGUGA) d(GCA) OMeA-OMeT-OMeT3′; antisense: 3′OMeG-OMeT-UGUAGCUCCGCCACUCGUd (U)5′). The Orai3 siRNAs were Hs_TMEM142C_2, #SI04174191 (sense: 5′OMeC-OMeA-CCAGUGGCUACCUCCd(CUU) OMeA-OMeTOMeT3′; antisense: 3′OMeG-OMeT-GGUCACCGAUGGAGGGAAd(U)5′) and Hs_TMEM142C_5, #SI04348876 (sense: 5′OMeT-OMeC-CUUAGCCCUUGAAAU)d(ACA) OMeA-OMeT-OMeT3′; antisense: 3′OMeA-OMeG-GAAUCGGGAACUUUAUGUd(U)5′). The STIM1 siRNAs were Hs_STIM1_5, #SI03235442 (sense: 5′OMeU-OMeGAGGUGGAGGUGCAAUd (AUU) dOMeA-dOMeT-dOMeT3′; antisense: 3′OMeA-OMeC-UCCACCUCCACGUUAUAAd (U)5′) and Hs_STIM1_6, #SI04165175 (sense: 5′OMeC-OMeU-GGUGGUGUCUAUCGUd (UAU) OMeU-OMeT-OMeT3′; antisense: 3′OMeG-OMeA-CCACCACAGAUAGCAAUAd (A)5′).

Control cells were transfected with nonsilencing RNA MS_control_mod (sense: 5′OmeA-OMeA-AGGUAGUGUAAUCGCd(CUU) OMeG-OmeT-OMeT3′; antisense: 3′OmeT-OmeT-UCCAUCACAUUAGCGGAAdC 5′).

Quantitative real-time PCR

Quantitative real-time PCR (qRT-PCR) was performed as previously described (34). Total RNA from LNCaP, DU145, PC3, and hPECs was isolated with TRIzol Reagent (Life Technologies). For reverse transcription, 0.8 μg of isolated total RNA was used.

The QuantiTect SYBR Green Kit (Qiagen) was used with 0.5 μL of complementary DNA and 300 nM of primer. The PCR conditions were as follows: 15 min at 95°C; 45 cycles, 30 s at 95°C; 45 s at 58°C; and 30 s at 72°C, and finally a cycle (60 s, 95°C; 30 s 55°C; 30 s 95°C) to determine specificity by a dissociation curve using the MX3000 cycler (Stratagene). Expression of target genes were normalized to the expression of the reference genes RNA polymerase II (RNAPol, NM_000937) and/or TATA box binding protein (TBP, NM_003194). The primer sequences were as follows: Orai1, 5′atgagcctcaacgagcact3′ (forward) and 5′gtgggtagtcgtggtcag3′ (reverse); Orai3, 5′gtaccgggagttcgtgca3′ (forward) and 5′ggtactcgtggtcactct3′ (reverse); STIM1, 5′ cagagtctgcatgaccttca 3′ (forward) and 5′ gcttcctgcttagcaaggtt 3′ (reverse); TBP, 5′ cggagagttctgggattgt 3′ (forward) and 5′ ggttcgtggctctcttatc 3′ (reverse); and RNAPol, 5′ ggagattgagtccaagttca 3′ (forward) and 5′ gcagacacaccagcatagt 3′ (reverse).

Ca2+ imaging experiments

Cells were loaded with the ratiometric dye Fura-2AM (hPECs: 1 μM/37°C/20 min; LNCaP and DU145: 2 μM/37°C/15 min; and PC3: 4 μM/room temperature/45 min). Excitation light alternated between 340 nm and 380 nm, and emitted light was detected every 5 s at an emission wavelength of 440 nm. Data were analyzed with TILLVision software (TILL Photonics) and IGOR Pro (WaveMetrics), and intracellular Ca2+ concentrations were determined as described previously (45,46).

The bath solution contained (in mM) 155 NaCl, 4.5 KCl, 2 MgCl2, 10 glucose, and 5 HEPES (pH 7.4 with NaOH). H2O2, CaCl2, and 1 μM thapsigargin (Tg) were added as indicated.

Electrophysiology

Cells (LNCaP and DU145) were patched in a whole-cell configuration as described previously (47,48). The pipette resistance was 2–4 MΩ. Every 2 s, 50 ms spanning ramps from −150 to +100 mV were delivered from a holding potential of 0 mV by a HEKA EPC-10 patch-clamp amplifier and the data were filtered (2.9 Hz), recorded, and analyzed with the use of Patchmaster and Fitmaster software (HEKA). The liquid junction potential was corrected for 10 mV. For analysis, currents were extracted at −80 mV, normalized to the cell capacity, averaged, and plotted versus time. Current was plotted versus ramp voltage (I/V), and current density (CD) was plotted versus H2O2 dose and fitted with a Hill function. The pipette solution contained (in mM) 120 Cs-glutamate, 10 BAPTA, 10 HEPES, 3 MgCl2, and 0.05 IP3. The bath solution contained (in mM) 95 NaCl, 2.8 KCl, 20 CaCl2, 2 MgCl2, 10 HEPES, 10 TEA-Cl, 10 CsCl, and 10 glucose. The pH was adjusted with NaOH to 7.2 and the osmolarity was 300 mosmol/L. H2O2 was added as indicated and cells were incubated for 10–30 min before patch-clamp experiments were conducted.

Cell viability

hPEC, LNCaP, DU145, and PC3 cells were seeded to ∼80% density in 96-well cell culture plates (BD) and incubated at 37°C, 5% CO2, and 95% humidity. Living cells were detected by means of a CellTiter-Blue assay (Promega). The sample size was n = 12 for LNCaP, n = 9 for DU145, n = 3 for PC3, and n = 22 from three donors of hPECs.

Data analysis

Data were analyzed using TILLVision, Fitmaster, Igor Pro, and Microsoft Excel. Data are given as the mean ± SE. (For the data plotted in Fig. 7, Pearson’s coefficient was calculated and is indicated as the R value.)

Figure 7.

Figure 7

Correlation between the Orai3/Orai1 ratio and the H2O2-dependent block of SOCE and cell viability. (A) The logarithmic IC50 of the H2O2-induced block of SOCE is plotted against the Orai3/Orai1 ratio in different cell types (naive T cells (35), effector T cells (35), LNCaP cells (34), and DU145 cells (34)). Data were fitted with an exponential fit function and Pearson’s coefficient is indicated as the R value. (B) The IC50 of the H2O2-induced block of viability is plotted against the Orai3/Orai1 ratio of the same cell types as in (A), as well as in PC3 and hPEC. Data were fitted with a stretched exponential fit function and Pearson’s coefficient is indicated as the R value. (C) The IC50 of the H2O2-induced block of viability is plotted versus the IC50 of the H2O2-induced block of SOCE. Data were fitted with a Hill function and Pearson’s coefficient is indicated as the R value.

Results

hPECs and prostate cancer cells differ in Ca2+ signaling upon incubation with H2O2

We first tested the effect of H2O2 on Ca2+ signaling in a Fura-2-based Ca2+ imaging assay in hPECs and the cancer cell lines LNCaP and DU145. For the later analysis of previously published data and data from this study, we exactly followed the procedure published earlier (35). Cells were incubated with different concentrations of H2O2, and SOCE was activated with the SERCA inhibitor Tg.

Average Ca2+ responses with different H2O2 concentrations are shown in Fig. 1, A–C. Incubation of hPECs, LNCaP, and DU145 with H2O2 first induced an initial increase of intracellular Ca2+. Upon application of Tg, intracellular Ca2+ increased (Fig. 1, A–C). To test the contribution of STIM/Orai-mediated signaling, we next analyzed the dependence of the initial Ca2+ increase and the Tg-induced intracellular Ca2+ increase on the main molecular components of SOCE, STIM1 and Orai1.

Figure 1.

Figure 1

ROS dependence of Ca2+ signaling in hPECs, LNCaP, and DU145. (A) Average [Ca2+]i responses (mean ± SE) from a Fura-2-based Ca2+ imaging assay when hPECs were incubated with different concentrations of H2O2 and 1 μM Tg was added (n = 93 for 0 H2O2, n = 146 for 50 μM H2O2, n = 67 for 500 μM H2O2, and n = 180 for 1 mM H2O2). (B) Same as (A) for LNCaP cells (n = 144 for 0 μM H2O2, n = 69 for 10 μM H2O2, n = 70 for 100 μM H2O2, and n = 46 for 1 mM H2O2). (C) Same as (A) and (B) for DU145 (n = 172 for 0 μM H2O2, n = 43 for 100 μM H2O2, n = 57 for 5 mM H2O2, and n = 55 for 15 mM H2O2).

Dependence of the initial Ca2+ increase and the Tg-induced intracellular Ca2+ increase on STIM1 and Orai1

To investigate whether the initial Ca2+ increase and the Tg-induced intracellular Ca2+ increase depend on SOCE, we performed an siRNA-based knockdown of the main molecular components of SOCE, STIM1 and Orai1.

In LNCaP cells, knockdown of STIM1 and Orai1 efficiently reduced the mRNA levels of STIM1 and Orai1 (Fig. 2 A). We then performed the same Fura-2-based imaging experiment shown in Fig. 1 in cells that were transfected with control RNA or siRNA targeting STIM1 and Orai1 (Fig. 2 B), and were either not treated with H2O2 or incubated with 10 mM of H2O2. We found that 10 mM of H2O2 induced an initial Ca2+ increase in both control transfected cells and cells transfected with STIM1/Orai1 siRNA (Fig. 2 B). The initial Ca2+ increase was analyzed as the average intracellular Ca2+ concentration at 1180 s (before application of Tg) and plotted for each condition (Fig. 2 C). Upon incubation with 10 mM of H2O2, the initial Ca2+ increase remained unchanged after knockdown of STIM1 and Orai1 (Fig. 2 C). Therefore, we conclude that the initial Ca2+ increase is independent of STIM1/Orai1-mediated signaling.

Figure 2.

Figure 2

Dependence of the initial Ca2+ increase and Tg-induced intracellular Ca2+ increase on the STIM1/Orai1 machinery in LNCaP cells. (A) qRT-PCR analysis of Orai1 and STIM1 expression levels in LNCaP cells transfected with control RNA or siRNA targeting STIM1 and Orai1 normalized to TBP. (B) Average [Ca2+]i responses (mean ± SE) from a Fura-2-based Ca2+ imaging assay when cells from (A) were not treated with H2O2 or were incubated with 10 mM of H2O2 and 1 μM of Tg was added (n = 135 for control RNA, 0 H2O2; n = 98 for control RNA and 10 mM H2O2; n = 74 for siRNA STIM1 and Orai1 and 0 H2O2; n = 49 for siRNA STIM1 and Orai1 and 10 mM H2O2). (C) Average [Ca2+]i responses (mean ± SE) from cells in (B) at t = 1180 s. (D) For each cell, the Ca2+ before application of Tg was subtracted from the maximal Ca2+ after application of Tg. The average ΔCa2+ values for cells in (B) are plotted.

In addition, this experiment demonstrates that the initial Ca2+ increase is not based on Ca2+ release from intracellular Ca2+ stores. Ca2+ release from intracellular Ca2+ stores leads to an activation of SOCE. Therefore, STIM1 and Orai1 knockdown would result in a reduction of the initial Ca2+ increase, which we did not observe.

To analyze the Tg-induced Ca2+ increase for each cell, we subtracted the Ca2+ level before application of Tg from the maximal Ca2+ level after application of Tg. The average ΔCa2+ is plotted for each condition in Fig. 2 D. When STIM1 and Orai1 were knocked down or cells were incubated with 10 mM of H2O2, or both, ΔCa2+ was significantly reduced to the same level (Fig. 2 D). When cells were incubated with 10 mM of H2O2, knockdown of STIM1 and Orai1 did not significantly reduce the remaining Ca2+ elevation. Consequently, this remaining Ca2+ elevation is independent of the STIM1/Orai1 machinery and for the most part is based on Tg-induced Ca2+ release from intracellular Ca2+ stores, as shown in a previous study (34). As the remaining Ca2+ elevation was the same in all three conditions (when STIM1 and Orai1 were knocked down or cells were incubated with 10 mM of H2O2, or both), we conclude that our further analysis of the H2O2-induced block of SOCE may include a small offset, but half minimal inhibitory concentrations were not affected. We performed the same set of experiments in DU145 and obtained very similar results (Fig. S1 A in the Supporting Material). Taken together, these results suggest that the initial effect is independent of Ca2+ release from intracellular stores and SOCE. Next, to investigate the H2O2-induced block of SOCE, we analyzed ΔCa2+.

hPECs and prostate cancer cells differ in the initial increase of Ca2+ upon incubation with H2O2

Upon incubation with H2O2, the initial increase of Ca2+ varied among the tested cells. Incubation of hPECs with H2O2 concentrations of ≥100 μM induced an initial increase of intracellular Ca2+ levels, up to ∼150 nM when cells were incubated with 1 mM of H2O2 (Fig. 3 A). In LNCaP and DU145, incubation with H2O2 induced an initial increase of intracellular Ca2+ (Fig. 3 B), and we detected maximal intracellular Ca2+ upon incubation with 300 μM and 1 mM of H2O2, respectively. Incubation of LNCaP and DU145 with H2O2 concentrations exceeding these maxima blocked the initial Ca2+ increase.

Figure 3.

Figure 3

Initial H2O2-induced Ca2+ increase in hPEC and cancer cell lines. (A) Initial increase of intracellular Ca2+ when hPECs were incubated for 1000 s with H2O2 (before Tg was added). Same cells as in Fig. 1A; n = 71 for 10 nM H2O2, n = 46 for 100 nM H2O2, n = 133 for 1 μM H2O2, n = 158 for 10 μM H2O2, n = 160 for 100 μM H2O2, and n = 157 for 300 μM H2O2. (B) Initial increase of Ca2+ when LNCaP or DU145 was incubated for 1000 s with H2O2 (before Tg was added). For LNCaP, same cells as in Fig. 1B; n = 67 for 30 μM H2O2, and n = 61 for 3 mM H2O2. For DU145, same cells as in Fig. 1C; n = 29 for 1 mM H2O2, n = 32 for 3 mM H2O2, n = 64 for 10 mM H2O2, n = 84 for 12.5 mM H2O2, and n = 45 for 20 mM H2O2.

hPECs and prostate cancer cells differ in ΔCa2+ upon incubation with H2O2

Addition of the SERCA inhibitor Tg depleted intracellular Ca2+ stores and activated SOCE. The H2O2 dose dependency of ΔCa2+ in hPECs, LNaP, and DU145 is shown in Fig. 4, A and B.

Figure 4.

Figure 4

ΔCa2+ in hPEC and cancer cell lines. (A) ΔCa2+ after addition of Tg in hPECs upon incubation with different H2O2 concentrations, showing the same cells as in Figs. 1A and 3A. The line was drawn to guide the eye. (B) ΔCa2+ in LNCaP and DU145 cells after addition of Tg upon incubation with different H2O2 concentrations. Average ΔCa2+ values (mean ± SE) are plotted versus H2O2 concentration; same cells as in Figs. 1, B and C, and 3B; n = 44 for 7.5 mM H2O2 for DU145. Data were fitted with a Hill function (please see text and Table 1 for IC50 values).

In hPECs, ΔCa2+ was increased by incubation with H2O2 up to a concentration of 500 μM. When cells were incubated with 1 mM H2O2, the increment was reduced but ΔCa2+ was still elevated compared with ΔCa2+ at low H2O2 concentrations (Fig. 4 A). Upon incubation with H2O2 concentrations above 1 mM, hPECs started to detach during the measurements; however, from our data, we conclude that the IC50 of the H2O2-induced block of ΔCa2+ is above 1 mM.

Upon addition of Tg, the maximal increase in ΔCa2+ was detected with 30 μM and 300 μM of H2O2 in LNCaP and DU145, respectively. The dose-response curves for the H2O2-induced inhibition of ΔCa2+ in LNCaP and DU145 are shown in Fig. 4 B. The data were fitted with a Hill equation, and the IC50 values for H2O2-induced inhibition of ΔCa2+ were 114 μM and 5.1 mM for LNCaP and DU145 cells, respectively.

Upon incubation with H2O2, LNCaP and DU145 differ in ICRAC

As ΔCa2+ includes a small offset that is mainly caused by Ca2+ release from intracellular stores, we challenged our concept and directly assessed the H2O2-induced block of CRAC channels. For this purpose, we incubated LNCaP and DU145 cells with various concentrations of H2O2 and performed a whole-cell patch-clamp analysis. Under these conditions, we detected Ca2+ currents via ICRAC channels without any contribution of Ca2+ from intracellular stores.

ICRAC was evoked with 50 μM of IP3 and 10 mM of BAPTA in the patch pipette. For LNCaP, the CD was plotted versus time (Fig. 5 A; corresponding current-voltage curves are shown in Fig. 5 A, inset).

Figure 5.

Figure 5

Inhibition of ICRAC by H2O2 in cancer cell lines. (A) ICRAC in LNCaP cells incubated with different concentrations of H2O2 (black curve, n = 14, 1 nM H2O2; dark gray curve, n = 8, 100 μM H2O2; light gray curve, n = 9, 10 mM H2O2) and corresponding I/V (inset). (B) Dose responses for H2O2-induced block of ICRAC in LNCaP (same cells as in A; n = 15 for 10 nM H2O2, n = 14 for 100 nM H2O2, n = 12 for 1 μM H2O2, n = 15 for 10 μM H2O2, and n = 9 for 1 mM H2O2) and DU145 (n = 10 for 1 nM H2O2, n = 8 for 100 nM H2O2, n = 5 for 1 μM H2O2, n = 8 for 10 μM H2O2, n = 5 for 1 mM H2O2, and n = 4 for 10 mM H2O2).

With increasing H2O2 concentrations, CD development in LNCaP and DU145 cells was blocked in a dose-dependent manner (Fig. 5 B). For the H2O2-induced block of ICRAC, the dose-response curves exhibit an IC50 of 26.6 μM for LNCaP cells and 2.5 mM for DU145 cells (Fig. 5 B). This analysis shows that a higher ratio of Orai3/Orai1 is accompanied by a higher IC50 for the H2O2-induced block of ICRAC. In our hands, a gigaseal could not be formed with hPECs upon incubation with H2O2; therefore, under these conditions, ICRAC could not be detected via the patch-clamp technique in these cells.

hPECs, LNCaP, DU145, and PC3 differ in cell viability upon incubation with H2O2

To compare the viability of hPECs and prostate cancer cell lines upon incubation with H2O2, we performed fluorescence-based viability assays. The H2O2-induced decrease of cell viability exhibited an IC50 of ∼6 mM in hPECs, ∼2 mM in PC3, 871 μM in DU145, and 422 μM in LNCaP (Fig. 6). These findings clearly support the concept of higher ROS sensitivity in prostate cancer lines than in hPECs.

Figure 6.

Figure 6

Fluorescence-based viability assay of hPECs and cancer cell lines upon incubation with different concentrations of H2O2. Fluorescence intensity is plotted versus H2O2 concentration for LNCaP (▪), DU145 (●), PC3 (▼), and hPEC (▲). The sample size was n = 12 for LNCaP, n = 9 for DU145, n = 3 for PC3, and n = 22 from three donors for hPEC.

Analysis of Orai3/Orai1 ratios and the H2O2-dependent block of SOCE and cell viability

We next combined our data and previous findings (34,35) regarding Orai1/Orai3 mRNA ratios and the dependence of SOCE and cell viability on H2O2 in different cell types (summarized in Table 1).

Table 1.

Orai1/Orai3 Ratio, SOCE, and cell viability

Cell Type Orai1/Orai3 IC50 H2O2-Induced Block of SOCE (μM) IC50 H2O2-Induced Block of ICRAC (μM) IC50 H2O2-Dependent Viability (μM)
Naive TH cell 70 (35) 7 (35) ND 39 (35)
Effector TH cell 25 (35) 51 (35) ND 199 (35)
LNCaP 26 (34) 114 26 422
DU145 17 (34) 5114 2500 871
PC3 8 ND ND 2085
Primary prostate epithelial cells 4 (34) >1000 ND 5947

The table lists the Orai1/Orai3 ratios of the indicated cell types and IC50 values for the H2O2-induced block of SOCE, H2O2-induced block of ICRAC, and H2O2-dependent cell viability.

We analyzed the correlation between the H2O2-dependent block of SOCE (ΔCa2+) and dependence of viability on the Orai1/Orai3 ratio. For this purpose, we decided to use the inverse Orai1/Orai3 ratio and instead plot Orai3/Orai1. For prostate-derived cells, a detailed representation of Orai1 and Orai3 mRNA levels and the corresponding Orai3/Orai1 ratios is given in Fig. S2.

In Fig. 7 A, the logarithmic IC50 of the H2O2-induced block of SOCE is plotted against different Orai3/Orai1 ratios expressed by several types of cells. When we analyze the correlation between the Orai3/Orai1 ratio and the logarithmic IC50 for the H2O2-induced block of SOCE, we find a Pearson’s coefficient of 0.97, reflecting the very strong correlation between the two parameters. Fig. 7 B demonstrates the relationship between Orai3/Orai1 ratios and cell viability. Here, we included data from PC3 cells without analyzing Ca2+ signaling in these cells in depth. With our protocol, we cannot determine IC50 for the H2O2-induced block of SOCE because in PC3 the initial effect depends on STIM1/Orai1, whereas the Tg-induced Ca2+ is nearly independent of STIM1/Orai1 (Fig. S3). The Pearson’s coefficient between the Orai3/Orai1 ratio and cell viability is 0.99, reflecting the very strong correlation between the Orai3/Orai1 ratio and H2O2-induced inhibition of cell viability. When the IC50 of the H2O2-induced block of cell viability is plotted against the H2O2-induced block of SOCE, the dependency can best be described with a Hill function (Fig. 7 C). The Pearson’s coefficient for the logarithmic data is 0.91, reflecting the strong correlation between the H2O2-induced block of SOCE and cell viability.

Effect of a siRNA-based knockdown of Orai3 on Ca2+ signaling and cell viability

To directly determine the role of Orai3 in the H2O2-induced block of SOCE and cell viability, we performed a siRNA-based knockdown of Orai3. Upon knockdown, Orai3 mRNA was reduced (Fig. 8 A). Upon knockdown of Orai3, no specific effect on the IC50 of H2O2-induced inhibition of ΔCa2+ (Fig. 8 B) and cell viability (Fig. 8 C) could be detected. The cell transfection led to a general shift in the IC50 for the H2O2-induced inhibition of ΔCa2+ and cell viability.

Figure 8.

Figure 8

Effect of a siRNA-based knockdown of Orai3 on Ca2+ signaling and cell viability. (A) qRT-PCR analysis of Orai3 expression levels in LNCaP cells transfected with control RNA or siRNA targeting Orai3 normalized to TBP. (B) Average ΔCa2+ from a Fura-2-based Ca2+ imaging assay when cells were nontransfected (same data as in Fig. 4B), control transfected (n = 76 for 0.01 mM H2O2, n = 144 for 0.1 mM H2O2, n = 164 for 0.3 mM H2O2, n = 159 for 1 mM H2O2, n = 157 for 3 mM H2O2 and n = 82 for 10 mM H2O2), or transfected with siRNA targeting Orai3 (n = 84 for 0.01 mM H2O2, n = 146 for 0.1 mM H2O2, n = 165 for 0.3 mM H2O2, n = 182 for 1 mM H2O2, n = 152 for 3 mM H2O2, and n = 94 for 10 mM H2O2). (C) Viability assay of cells in (B) (n = 2); for nontransfected cells, the same data as in Fig. 6 were used.

Discussion

Our data on H2O2-dependent cell viability support the concept that hPECs are less sensitive to ROS than LNCaP and DU145. This finding is in line with an earlier study that demonstrated that cells derived from prostate cancer tumors are more sensitive to arsenic-trioxide-induced ROS compared with normal prostate epithelium cells (49). It was shown that blocking the ROS-scavenging system of prostate cancer cells shifted the IC50 for arsenic-trioxid-induced cell death in prostate cancer cells to clinical achievable concentrations, with a negligible cytotoxicity for normal cells. It is known that in prostate cancer cells, ROS induce elevations of intracellular Ca2+ (12,13). Here, we investigated the H2O2-induced initial rise of intracellular Ca2+, the H2O2-induced amplification of ΔCa2+, the block of SOCE, and cell viability upon incubation with ROS in hPECs and prostate cancer cell lines. The ROS-induced initial increase of Ca2+ is independent of the STIM1/Orai1 machinery and may be caused by Ca2+ channels, e.g., TRP channels that are activated or modulated by ROS, including TRPM2, TRPC5, TRPV1, and TRPA1 (14,16). The initial H2O2-induced increase of intracellular Ca2+ is maximally activated at lower concentrations of H2O2 in LNCaP cells than in hPECs and DU145 (300 μM vs. 1 mM H2O2). In prostate cancer cell lines, these values reflect the maxima, and the initial Ca2+ increase is blocked upon incubation with higher concentrations of H2O2. In hPECs, 1 mM of H2O2 induces the maximal initial increase of intracellular Ca2+. The detection of Ca2+ signals from cells incubated with higher concentrations of H2O2 was technically not feasible. It is known that ROS-induced transcription factors that activate ROS-scavenging systems (e.g., NF-E2-related factor 2) (50) depend on elevation of intracellular Ca2+ (51). Hence, the block of initial ROS-induced Ca2+ signaling in cancer cell lines may contribute to their higher sensitivity to ROS.

SOCE is activated during proliferation; however, elevated SOCE signals can drive cells into apoptosis (52). When cells were preincubated with different H2O2 concentrations, the maximal amplification of ΔCa2+ occurred with 500 μM of H2O2 in hPECs, 30 μM of H2O2 in LNCaP, and 300 μM of H2O2 in DU145. Thus, in cancer cell lines, these maximally amplified ΔCa2+ signals at lower H2O2 concentrations may contribute to the overall higher sensitivity of cell viability to ROS.

Within the last few years, several reports have demonstrated a role for Orai3 in breast cancer (53–56). Two very recent studies reported controversial results regarding the role of Orai3 in prostate cancer. Dubois et al. (57) found elevated Orai3 expression levels in prostate cancer tissue samples. In their study, elevated levels of Orai3 led to increased formation of arachidonic-acid-induced Ca2+ channels by Orai1/Orai3 heteromers and a lower number of homomeric Orai1 SOCE channels. Thus, the elevated Orai3 levels may act as a switch and lead to increased arachidonic-acid-induced proliferation and decreased Orai1-dependent apoptosis (57,58). In contrast to Dubois et al. (57), we found a downregulation of Orai3 in prostate cancer tissue samples, an outstandingly low Orai1/Orai3 ratio of ∼4 in hPECs, and elevated Orai1/Orai3 ratios in prostate cancer cell lines, with consequences for SOCE signaling in the membrane androgen receptor pathway and the pharmacological profile of ICRAC (34). The H2O2-dependent block of SOCE (ΔCa2+) differs among hPECs (IC50 > 1 mM), DU145 (IC50 ∼5 mM), and LNCaP (IC50 ∼114 μM). In combination with previous findings (34,35), our results demonstrate a strong correlation between the Orai3/Orai1 ratio and the ROS sensitivity of SOCE and cell viability. Taken together, these findings support the concept of heteromeric store-operated Orai1/Orai3 channels. However, upon cell transfection, the IC50 values of the H2O2-induced block of SOCE and cell viability exhibited unspecific shifts, as described previously (35). This unspecific shift may cover specific effects of Orai3 knockdown and thus prevent the acquisition of direct evidence. The correlation between the ROS-dependent block of SOCE and cell viability demonstrates that cells need functional SOCE Ca2+ signaling for survival and that the ROS-induced block of SOCE contributes to decreased cell viability when ROS are increased. The apparent IC50 of the H2O2-induced block of SOCE in DU145 (∼5 mM) and hPECs (>1 mM) points to a blocking mechanism that could be independent of Orai3/Orai1 ratios. In these cells, all ICRAC channels may be Orai3/Orai1 heteromeric channels, and one Orai3 subunit is sufficient to abolish the ROS sensitivity of SOCE (37). An alternative explanation is that increasing H2O2 levels lead to intracellular acidification (59) and CRAC channels are inhibited by intracellular acidification (60). It has been suggested that STIM1/Orai1 uncouple at low intracellular pH and Ca2+ influx via Orai channels is abolished (61). To test this hypothesis, we performed patch-clamp experiments to determine whether the H2O2-induced block was still apparent when we used pH 8 in the patch pipette (Fig. S4). Indeed, the block was not abolished, pointing to a channel-specific mechanism rather than an unspecific block. On the other hand, it was previously demonstrated in snail neurons that even under buffering conditions, pH microdomains below the plasma membrane could be formed (62). Thus, we cannot exclude the possibility of a channel-unspecific mechanism such as acidic pH, decoupling of STIM/Orai complexes, induction of high Ca2+ levels, and/or membrane depolarization.

In the future, therapeutic strategies based on ROS induction may include the appropriate concentrations of drugs targeting SOCE channels to reduce the viability of prostate cancer cells without affecting nontransformed cells, as there is a clear role for Ca2+ in ROS-mediated signaling in prostate cancer. Finally, the overall high Orai3/Orai1 ratios in hPEC and androgen-insensitive cancer cells contribute to their ROS resistance and thereby may have a share in making the prostate one of the most prominent cancer susceptible organs.

Conclusions

In this study, we investigated H2O2-dependent Ca2+ signaling in hPECs from healthy tissue and prostate cancer cell lines (LNCaP, DU145, and PC3). ROS-induced changes in Ca2+ signaling reflect the contributions of very different enzymes, including Ca2+ transporters and ROS-producing and -scavenging enzymes. Our findings suggest that the block of ROS-induced initial Ca2+ elevations in prostate cancer cells, as well as the amplification of ΔCa2+ and the H2O2-dependent block of SOCE at lower concentrations of H2O2, could contribute to the higher sensitivity of prostate cancer cells to ROS-induced cell death. In addition, our findings regarding the H2O2-dependent block of SOCE in hPECs and cancer cell lines support our concept of heteromeric store-operated Orai1/Orai3 channels in hPECs and store-operated Orai channels characterized by elevated Orai1/Orai3 ratios in prostate cancer cells.

Author Contributions

C.P. designed the study, analyzed data, and wrote the manuscript. C.H., T.K., S.K., and K.D. performed experiments, analyzed data, helped design the study, and helped write the manuscript. I.B. helped design the study and develop the manuscript. V.J. and M.S. helped design the study.

Acknowledgments

We thank Helga Angeli, Andrea Armbrüster, Petra Frieß, Sandra Janku, Gertrud Schwär, and Cora Stephan for technical support, and Sandra Janku for a careful reading of the manuscript. C.P. thanks Markus Hoth for constant and extraordinary support.

This study was supported by grants from the Deutsche Forschungsgemeinschaft (SFB 1027 (C4) and BO 3643/3-1 to I.B., and SFB 894 (A2) and PE1478/5-1 to C.P.). I.B. received funding from the HOMFORexcellent program of Saarland University. V.J. received funding from the Stiftung Europrofession and HOMFOR of Saarland University.

Editor: Michael Pusch.

Footnotes

Supporting Material

Document S1. Four figures
mmc1.pdf (1.1MB, pdf)
Document S2. Article plus Supporting Material
mmc2.pdf (2.1MB, pdf)

References

  • 1.Malins D.C., Johnson P.M., Vinson M.A. Age-related radical-induced DNA damage is linked to prostate cancer. Cancer Res. 2001;61:6025–6028. [PubMed] [Google Scholar]
  • 2.Miyake H., Hara I., Eto H. Oxidative DNA damage in patients with prostate cancer and its response to treatment. J. Urol. 2004;171:1533–1536. doi: 10.1097/01.ju.0000116617.32728.ca. [DOI] [PubMed] [Google Scholar]
  • 3.Bostwick D.G., Alexander E.E., Oberley T.D. Antioxidant enzyme expression and reactive oxygen species damage in prostatic intraepithelial neoplasia and cancer. Cancer. 2000;89:123–134. [PubMed] [Google Scholar]
  • 4.Khandrika L., Kumar B., Koul H.K. Oxidative stress in prostate cancer. Cancer Lett. 2009;282:125–136. doi: 10.1016/j.canlet.2008.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lim S.D., Sun C., Arnold R.S. Increased Nox1 and hydrogen peroxide in prostate cancer. Prostate. 2005;62:200–207. doi: 10.1002/pros.20137. [DOI] [PubMed] [Google Scholar]
  • 6.Harrison I.P., Selemidis S. Understanding the biology of reactive oxygen species and their link to cancer: NADPH oxidases as novel pharmacological targets. Clin. Exp. Pharmacol. Physiol. 2014;41:533–542. doi: 10.1111/1440-1681.12238. [DOI] [PubMed] [Google Scholar]
  • 7.Yang Y., Karakhanova S., Bazhin A.V. Reactive oxygen species in cancer biology and anticancer therapy. Curr. Med. Chem. 2013;20:3677–3692. doi: 10.2174/0929867311320999165. [DOI] [PubMed] [Google Scholar]
  • 8.Paschos A., Pandya R., Pinthus J.H. Oxidative stress in prostate cancer: changing research concepts towards a novel paradigm for prevention and therapeutics. Prostate Cancer Prostatic Dis. 2013;16:217–225. doi: 10.1038/pcan.2013.13. [DOI] [PubMed] [Google Scholar]
  • 9.Rosado J.A., Redondo P.C., Pariente J.A. Calcium signalling and reactive oxygen species in non-excitable cells. Mini Rev. Med. Chem. 2006;6:409–415. doi: 10.2174/138955706776361466. [DOI] [PubMed] [Google Scholar]
  • 10.Yan Y., Wei C.L., Liu J. Cross-talk between calcium and reactive oxygen species signaling. Acta Pharmacol. Sin. 2006;27:821–826. doi: 10.1111/j.1745-7254.2006.00390.x. [DOI] [PubMed] [Google Scholar]
  • 11.Gordeeva A.V., Zvyagilskaya R.A., Labas Y.A. Cross-talk between reactive oxygen species and calcium in living cells. Biochemistry (Mosc.) 2003;68:1077–1080. doi: 10.1023/a:1026398310003. [DOI] [PubMed] [Google Scholar]
  • 12.Kim K.Y., Cho H.J., Ahn S.C. Interplay of reactive oxygen species, intracellular Ca2+ and mitochondrial homeostasis in the apoptosis of prostate cancer cells by deoxypodophyllotoxin. J. Cell. Biochem. 2013;114:1124–1134. doi: 10.1002/jcb.24455. [DOI] [PubMed] [Google Scholar]
  • 13.Savino J.A., 3rd, Evans J.F., Carter T.H. Multiple, disparate roles for calcium signaling in apoptosis of human prostate and cervical cancer cells exposed to diindolylmethane. Mol. Cancer Ther. 2006;5:556–563. doi: 10.1158/1535-7163.MCT-05-0355. [DOI] [PubMed] [Google Scholar]
  • 14.Bogeski I., Kappl R., Niemeyer B.A. Redox regulation of calcium ion channels: chemical and physiological aspects. Cell Calcium. 2011;50:407–423. doi: 10.1016/j.ceca.2011.07.006. [DOI] [PubMed] [Google Scholar]
  • 15.Grupe M., Myers G., Fleig A. Activation of store-operated I(CRAC) by hydrogen peroxide. Cell Calcium. 2010;48:1–9. doi: 10.1016/j.ceca.2010.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shimizu S., Takahashi N., Mori Y. TRPs as chemosensors (ROS, RNS, RCS, gasotransmitters) Handbook Exp. Pharmacol. 2014;223:767–794. doi: 10.1007/978-3-319-05161-1_3. [DOI] [PubMed] [Google Scholar]
  • 17.Parekh A.B., Penner R. Activation of store-operated calcium influx at resting InsP3 levels by sensitization of the InsP3 receptor in rat basophilic leukaemia cells. J. Physiol. 1995;489:377–382. doi: 10.1113/jphysiol.1995.sp021058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bogeski I., Kilch T., Niemeyer B.A. ROS and SOCE: recent advances and controversies in the regulation of STIM and Orai. J. Physiol. 2012;590:4193–4200. doi: 10.1113/jphysiol.2012.230565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lewis R.S. Store-operated calcium channels: new perspectives on mechanism and function. Cold Spring Harb. Perspect. Biol. 2011;3:a003970. doi: 10.1101/cshperspect.a003970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ji W., Xu P., Chen L. Functional stoichiometry of the unitary calcium-release-activated calcium channel. Proc. Natl. Acad. Sci. USA. 2008;105:13668–13673. doi: 10.1073/pnas.0806499105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Penna A., Demuro A., Cahalan M.D. The CRAC channel consists of a tetramer formed by Stim-induced dimerization of Orai dimers. Nature. 2008;456:116–120. doi: 10.1038/nature07338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Demuro A., Penna A., Parker I. Subunit stoichiometry of human Orai1 and Orai3 channels in closed and open states. Proc. Natl. Acad. Sci. USA. 2011;108:17832–17837. doi: 10.1073/pnas.1114814108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Madl J., Weghuber J., Schütz G.J. Resting state Orai1 diffuses as homotetramer in the plasma membrane of live mammalian cells. J. Biol. Chem. 2010;285:41135–41142. doi: 10.1074/jbc.M110.177881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Maruyama Y., Ogura T., Sato C. Tetrameric Orai1 is a teardrop-shaped molecule with a long, tapered cytoplasmic domain. J. Biol. Chem. 2009;284:13676–13685. doi: 10.1074/jbc.M900812200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Thompson J.L., Shuttleworth T.J. How many Orai’s does it take to make a CRAC channel? Sci. Rep. 2013;3:1961. doi: 10.1038/srep01961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hou X., Pedi L., Long S.B. Crystal structure of the calcium release-activated calcium channel Orai. Science. 2012;338:1308–1313. doi: 10.1126/science.1228757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wu M.M., Covington E.D., Lewis R.S. Single-molecule analysis of diffusion and trapping of STIM1 and Orai1 at endoplasmic reticulum-plasma membrane junctions. Mol. Biol. Cell. 2014;25:3672–3685. doi: 10.1091/mbc.E14-06-1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Balasuriya D., Srivats S., Edwardson J.M. Atomic force microscopy (AFM) imaging suggests that stromal interaction molecule 1 (STIM1) binds to Orai1 with sixfold symmetry. FEBS Lett. 2014;588:2874–2880. doi: 10.1016/j.febslet.2014.06.054. [DOI] [PubMed] [Google Scholar]
  • 29.Amcheslavsky A., Wood M.L., Cahalan M.D. Molecular biophysics of Orai store-operated Ca2+ channels. Biophys. J. 2015;108:237–246. doi: 10.1016/j.bpj.2014.11.3473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhang S.L., Kozak J.A., Cahalan M.D. Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3. J. Biol. Chem. 2008;283:17662–17671. doi: 10.1074/jbc.M801536200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lis A., Peinelt C., Penner R. CRACM1, CRACM2, and CRACM3 are store-operated Ca2+ channels with distinct functional properties. Curr. Biol. 2007;17:794–800. doi: 10.1016/j.cub.2007.03.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gwack Y., Srikanth S., Rao A. Biochemical and functional characterization of Orai proteins. J. Biol. Chem. 2007;282:16232–16243. doi: 10.1074/jbc.M609630200. [DOI] [PubMed] [Google Scholar]
  • 33.Schindl R., Frischauf I., Romanin C. Plasticity in Ca2+ selectivity of Orai1/Orai3 heteromeric channel. Proc. Natl. Acad. Sci. USA. 2009;106:19623–19628. doi: 10.1073/pnas.0907714106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Holzmann C., Kilch T., Peinelt C. ICRAC controls the rapid androgen response in human primary prostate epithelial cells and is altered in prostate cancer. Oncotarget. 2013;4:2096–2107. doi: 10.18632/oncotarget.1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bogeski I., Kummerow C., Niemeyer B.A. Differential redox regulation of ORAI ion channels: a mechanism to tune cellular calcium signaling. Sci. Signal. 2010;3:ra24. doi: 10.1126/scisignal.2000672. [DOI] [PubMed] [Google Scholar]
  • 36.Mignen O., Thompson J.L., Shuttleworth T.J. The molecular architecture of the arachidonate-regulated Ca2+-selective ARC channel is a pentameric assembly of Orai1 and Orai3 subunits. J. Physiol. 2009;587:4181–4197. doi: 10.1113/jphysiol.2009.174193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Alansary D., Bogeski I., Niemeyer B.A. Facilitation of Orai3 targeting and store-operated function by Orai1. Biochim. Biophys. Acta. 2015;1853:1541–1550. doi: 10.1016/j.bbamcr.2015.03.007. [DOI] [PubMed] [Google Scholar]
  • 38.Gulaboski R., Bogeski I., Kappl R. Hydroxylated derivatives of dimethoxy-1,4-benzoquinone as redox switchable earth-alkaline metal ligands and radical scavengers. Sci. Rep. 2013;3:1865. doi: 10.1038/srep01865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bufe B., Schumann T., Zufall F. Recognition of bacterial signal peptides by mammalian formyl peptide receptors: a new mechanism for sensing pathogens. J. Biol. Chem. 2015;290:7369–7387. doi: 10.1074/jbc.M114.626747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Davidson S.M., Duchen M.R. Calcium microdomains and oxidative stress. Cell Calcium. 2006;40:561–574. doi: 10.1016/j.ceca.2006.08.017. [DOI] [PubMed] [Google Scholar]
  • 41.Singleton P.A., Pendyala S., Natarajan V. Dynamin 2 and c-Abl are novel regulators of hyperoxia-mediated NADPH oxidase activation and reactive oxygen species production in caveolin-enriched microdomains of the endothelium. J. Biol. Chem. 2009;284:34964–34975. doi: 10.1074/jbc.M109.013771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kaludercic N., Deshwal S., Di Lisa F. Reactive oxygen species and redox compartmentalization. Front. Physiol. 2014;5:285. doi: 10.3389/fphys.2014.00285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Gmyrek G.A., Walburg M., Knudsen B.S. Normal and malignant prostate epithelial cells differ in their response to hepatocyte growth factor/scatter factor. Am. J. Pathol. 2001;159:579–590. doi: 10.1016/S0002-9440(10)61729-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Mantei A., Rutz S., Scheffold A. siRNA stabilization prolongs gene knockdown in primary T lymphocytes. Eur. J. Immunol. 2008;38:2616–2625. doi: 10.1002/eji.200738075. [DOI] [PubMed] [Google Scholar]
  • 45.Grynkiewicz G., Poenie M., Tsien R.Y. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 1985;260:3440–3450. [PubMed] [Google Scholar]
  • 46.Alansary D., Kilch T., Lis A. The minimal requirements to use calcium imaging to analyze ICRAC. Cold Spring Harb. Protoc. 2014;2014:638–642. doi: 10.1101/pdb.prot073262. [DOI] [PubMed] [Google Scholar]
  • 47.Alansary D., Kilch T., Lis A. Patch-clamp measurement of ICRAC and ORAI channel activity. Cold Spring Harb. Protoc. 2014;2014:602–607. doi: 10.1101/pdb.top066795. [DOI] [PubMed] [Google Scholar]
  • 48.Alansary D., Kilch T., Lis A. Measuring endogenous ICRAC and ORAI currents with the patch-clamp technique. Cold Spring Harb. Protoc. 2014;2014:630–637. doi: 10.1101/pdb.prot073254. [DOI] [PubMed] [Google Scholar]
  • 49.Maeda H., Hori S., Kakizuka A. Effective treatment of advanced solid tumors by the combination of arsenic trioxide and L-buthionine-sulfoximine. Cell Death Differ. 2004;11:737–746. doi: 10.1038/sj.cdd.4401389. [DOI] [PubMed] [Google Scholar]
  • 50.Kobayashi M., Yamamoto M. Molecular mechanisms activating the Nrf2-Keap1 pathway of antioxidant gene regulation. Antioxid. Redox Signal. 2005;7:385–394. doi: 10.1089/ars.2005.7.385. [DOI] [PubMed] [Google Scholar]
  • 51.Lee J.M., Shih A.Y., Johnson J.A. NF-E2-related factor-2 mediates neuroprotection against mitochondrial complex I inhibitors and increased concentrations of intracellular calcium in primary cortical neurons. J. Biol. Chem. 2003;278:37948–37956. doi: 10.1074/jbc.M305204200. [DOI] [PubMed] [Google Scholar]
  • 52.Roderick H.L., Cook S.J. Ca2+ signalling checkpoints in cancer: remodelling Ca2+ for cancer cell proliferation and survival. Nat. Rev. Cancer. 2008;8:361–375. doi: 10.1038/nrc2374. [DOI] [PubMed] [Google Scholar]
  • 53.Faouzi M., Kischel P., Ouadid-Ahidouch H. ORAI3 silencing alters cell proliferation and cell cycle progression via c-myc pathway in breast cancer cells. Biochim. Biophys. Acta. 2013;1833:752–760. doi: 10.1016/j.bbamcr.2012.12.009. [DOI] [PubMed] [Google Scholar]
  • 54.Motiani R.K., Abdullaev I.F., Trebak M. A novel native store-operated calcium channel encoded by Orai3: selective requirement of Orai3 versus Orai1 in estrogen receptor-positive versus estrogen receptor-negative breast cancer cells. J. Biol. Chem. 2010;285:19173–19183. doi: 10.1074/jbc.M110.102582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Motiani R.K., Zhang X., Trebak M. Orai3 is an estrogen receptor α-regulated Ca²+ channel that promotes tumorigenesis. FASEB J. 2013;27:63–75. doi: 10.1096/fj.12-213801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Faouzi M., Hague F., Ouadid-Ahidouch H. Down-regulation of Orai3 arrests cell-cycle progression and induces apoptosis in breast cancer cells but not in normal breast epithelial cells. J. Cell. Physiol. 2011;226:542–551. doi: 10.1002/jcp.22363. [DOI] [PubMed] [Google Scholar]
  • 57.Dubois C., Vanden Abeele F., Prevarskaya N. Remodeling of channel-forming ORAI proteins determines an oncogenic switch in prostate cancer. Cancer Cell. 2014;26:19–32. doi: 10.1016/j.ccr.2014.04.025. [DOI] [PubMed] [Google Scholar]
  • 58.Flourakis M., Lehen’kyi V., Prevarskaya N. Orai1 contributes to the establishment of an apoptosis-resistant phenotype in prostate cancer cells. Cell Death Dis. 2010;1:e75. doi: 10.1038/cddis.2010.52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ahmad K.A., Iskandar K.B., Pervaiz S. Hydrogen peroxide-mediated cytosolic acidification is a signal for mitochondrial translocation of Bax during drug-induced apoptosis of tumor cells. Cancer Res. 2004;64:7867–7878. doi: 10.1158/0008-5472.CAN-04-0648. [DOI] [PubMed] [Google Scholar]
  • 60.Beck A., Fleig A., Peinelt C. Regulation of endogenous and heterologous Ca2+ release-activated Ca2+ currents by pH. Cell Calcium. 2014;56:235–243. doi: 10.1016/j.ceca.2014.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Mancarella S., Wang Y., Gill D.L. Hypoxia-induced acidosis uncouples the STIM-Orai calcium signaling complex. J. Biol. Chem. 2011;286:44788–44798. doi: 10.1074/jbc.M111.303081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Schwiening C.J., Willoughby D. Depolarization-induced pH microdomains and their relationship to calcium transients in isolated snail neurones. J. Physiol. 2002;538:371–382. doi: 10.1113/jphysiol.2001.013055. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Four figures
mmc1.pdf (1.1MB, pdf)
Document S2. Article plus Supporting Material
mmc2.pdf (2.1MB, pdf)

Articles from Biophysical Journal are provided here courtesy of The Biophysical Society

RESOURCES