Abstract Abstract
The Lacinipolia vicina (Grote) species complex, previously consisting of Lacinipolia vicina, Lacinipolia teligera (Morrison), Lacinipolia pensilis (Grote), and Lacinipolia subalba Mustelin is revised to six species: Lacinipolia vicina (eastern USA), Lacinipolia teligera (southern Great Plains), Lacinipolia pensilis (Pacific Northwest and northern Rocky Mountains), Lacinipolia acutipennis (Grote), stat. rev. (= Lacinipolia subalba syn. n.) (western North America), Lacinipolia sareta (Smith), stat. rev. (Canada and western USA) and Lacinipolia dimocki, sp. n. (California and Pacific Northwest). Lectotypes are designated for Lacinipolia vicina, Lacinipolia teligera and Lacinipolia pensilis.
Keywords: Cryptic species, Pacific Northwest, California
Introduction
Lacinipolia McDunnough is currently one of the largest North American noctuid genera with 61 species, and includes another 10 species described from Mexico and Central America. The diversity centers for Lacinipolia are the arid habitats of the American Southwest and Mexico. Like many of the constituent genera of the Eriopygini, a diverse, largely New World tribe, the current concept of Lacinipolia is not monophyletic and in need of revision. Lloyd Martin initiated this considerable undertaking in the 1960s, but abandoned the project after the loss of all his notes and type photographs (Leuschner 1992). Selman (1975) based his unpublished thesis dissertation on the earlier work of Lloyd Martin, and since Selman’s thesis was never published, Selman and Leuschner (2001) described the nine new species treated therein. Within Lacinipolia (sensu stricto), the Lacinipolia vicina (Grote) group previously consisted of four species, here revised to six species.
Methods and materials
Adult genitalia were prepared following the methods of Lafontaine (2004). Cleaned, stained genitalia were stored and examined in 30% ethanol, and slide-mounted in Euparal before being photographed using a Nikon D200 digital camera. Distribution maps for examined material were generated using SimpleMappr (Shorthouse 2010).
Repository abbreviations are as follows
AMNH
BMNH
CNC
USNM
MCZ
MSU
CUIC
Variation of the ‘barcode’ section of the COI gene was compared among 264 specimens representing all six species (Suppl. material 1). DNA extraction, PCR amplification, and sequencing of the COI barcode region were performed at the (CCDB) and followed standard protocols (Hajibabaei et al. 2005; Ivanova et al. 2006; deWaard et al. 2008; Hebert et al. 2013; http://www.ccdb.ca/resources.php). PCR and sequencing generally used a single pair of primers: LepF1 (ATTCAACCAATCATAAAG ATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) (Hebert et al. 2004) which recovers a 658 bp region near the 5' end of COI including the 648 bp barcode region for the animal kingdom (Hebert et al. 2003). Only sequence records greater than 500 bp (range 500 bp–658 bp) are included.
Systematics
Key to species of the Lacinipolia vicina group
| 1 | Male | 2 |
| – | Female | 7 |
| 2 | Spines posterior to juxta (‘above’ juxta in slide preparations) pointing antero-ventrally and forming spinose crests or simple patch1 (Figs 55–58) | 3 |
| – | Spines posterior to juxta pointing postero-dorsally and situated on inside surface of spade-like plate (Figs 59, 60) | 6 |
| 3 | Medial field of ventrally projecting spines located adjacent to juxta (Figs 55, 56) | 4 |
| – | No medial spine patch adjacent to juxta(Figs 57, 58) | 5 |
| 4 | Clasper with thumb positioned at basal third of distance to apex (Fig. 55); hindwing with dark fuscous terminal shade (Figs 1, 2); occurring east of the Mississippi Valley (Fig. 69) | Lacinipolia vicina |
| – | Clasper with thumb positioned nearly halfway to apex (Fig. 56); hindwing without dark fuscous terminal shade (Figs 4, 5); occurring west of the Mississippi Valley (Fig. 70) | Lacinipolia teligera |
| 5 | Crest of phallus usually with a thin, delicate apically-directed spine (sometimes broken off, in which case base is still evident) (Fig. 61), or if thin spine absent, then entire crest reduced with fewer and smaller cornuti (Fig. 61c); forewing ground colour highly variable, but medial area concolourous with postmedial and antemedial areas, and antemedial line absent or poorly defined; usually with apical pale area that extends through postmedial line into reniform spot; subterminal area usually darker than postmedial area; reniform and orbicular spot often only faintly visible; orbicular spot sometimes flattened and elongated; arid low elevation habitats including shortgrass prairie and sagebrush steppe | Lacinipolia acutipennis |
| – | Crest of phallus never with a thin, delicate basally-directed spine (Fig. 62), rarely with robust cornutus directed apically (Fig. 62h); forewing ground colour varying in saturation but consistent in tone, with medial area containing brown tones that are lacking in the grey-and-black postmedial and antemedial areas; antemedial line usually well defined; pale apical area not extended through postmedial line; subterminal area not darker than postmedial area; reniform and orbicular spot conspicuous, paler than ground; orbicular spot never highly flattened and elongated; low to high elevation woodland, particularly dry, montane pine and Douglas-fir woodlands | Lacinipolia pensilis |
| 6 | Clasper with a thumb-like process on ventral margin, clasper flattened and apex rounded; digitus pointed (Fig. 59); widely distributed, including West Coast states (Fig. 73) | Lacinipolia sareta |
| – | Clasper without process, shaped like a sinuate spine with a pointed apex; digitus rounded (Fig. 60); West Coast states (Fig. 74) | Lacinipolia dimocki |
| 7 | Ostium asymmetrical, like opening of a conch; margin of prevaginal plate straight or slightly convex (Figs 63–66) | 8 |
| – | Ostium symmetrical, opening simple; margin of prevaginal plate strongly convex (Figs 67, 68) | 1 |
| 8 | Ostium complex 1.4–1.5 × longer than wide; caudal portion of ostial slit gradually curved (Figs 65, 66) | 9 |
| – | Ostium complex 1.0–1.1 × longer than wide; caudal portion of ostial slit sinuate (Figs 63, 64) | 10 |
| 9 | Forewing ground colour highly variable, but medial area concolourous with postmedial and antemedial areas, and antemedial line absent or poorly defined; usually with apical pale area extended through postmedial line into reniform spot; subterminal area usually darker than postmedial area; reniform and orbicular spots often only faintly visible; orbicular spot sometimes flattened and elongated; arid low elevation habitats including shortgrass prairie and sagebrush steppe | Lacinipolia acutipennis |
| – | Forewing ground colour varying in saturation but consistent in tone, with medial area containing brown tones that are lacking in grey-and-black postmedial and antemedial areas; antemedial line usually well defined; pale apical area not extended through postmedial line; subterminal area not darker than postmedial area; reniform and orbicular spot conspicuous and paler than ground; orbicular spot never highly flattened and elongated; low to high elevation woodlands, particularly dry, montane pine and Douglas-fir woodland | Lacinipolia pensilis |
| 10 | Basal half of hindwing conspicuously lighter than marginal portion and forewing (Fig. 6); occurring in southern Great Plains west of Mississippi River (Fig. 70) | Lacinipolia teligera |
| – | Basal half of hindwing nearly as dark as marginal portion and forewing (Fig. 3); occurring in the eastern United States east of Mississippi River (Fig. 69) | Lacinipolia vicina |
| 11 | Ductus bursae highly flattened dorsoventrally, with pronounced ribbon-like oblique fold (Fig. 67); corpus bursae 2–2.5 × diameter of ducts bursae; widely distributed, including West Coast states (Fig. 73) | Lacinipolia sareta |
| – | Ductus bursae moderately flattened dorsoventrally, with slight oblique fold; corpus bursae 3–4 × diameter of ductus bursae (Fig. 68); West Coast states from Washington to California (Fig. 74) | Lacinipolia dimocki |
Figures 55–57.
Lacinipolia male genitalia. 55 Lacinipolia vicina MA, Barnstable, CNC Gen. Prep. # CNCLEP16884 56 Lacinipolia teligera TX, 6 mi E Canadian, CNC Gen. Prep. # CNCLEP16886 57 Lacinipolia pensilis BC, Crowsnest, 5 mi NW, CNC Gen. Prep. # CNCLEP16852.
Figures 58–60.
Lacinipolia male genitalia. 58 Lacinipolia acutipennis AB, Steveville, CNC Gen. Prep. # CNCLEP16843 59 Lacinipolia sareta AZ, Prescott, CNC Gen. Prep. # CNCLEP16867 60 Lacinipolia dimocki CA, Mt. Laguna, CNC Gen. Prep. # CNCLEP16871.
Figures 1–27.
Lacinipolia adults. 1 Lacinipolia vicina ♂ NC, Watauga Co., Beech Ck. bog 2 Lacinipolia vicina ♂ PA, Beaver Co., 6 mi SW Darlington 3 Lacinipolia vicina ♀ PA, Beaver Co., 6 mi SW Darlington 4 Lacinipolia teligera ♂ TX, Lampasas Co., Lampasas R. 8 mi S Rte. 190 5 Lacinipolia teligera ♂ TX, Travis Co., Austin 6 Lacinipolia teligera ♀ TX, Lampasas Co., Lampasas R. 8 mi S Rte. 190 7 Lacinipolia sareta ♂ ON, Manitoulin Is., Dominion Bay dunes 8 Lacinipolia sareta ♂ BC, [Lillooet], Kirby Flats Rd. 9 Lacinipolia sareta ♀ ON, Manitoulin Is., Sheguindah 10 Lacinipolia sareta ♂ AB, Waterton Lakes NP, Blakiston Ck. fan 11 Lacinipolia sareta ♂ AB, Manyberries, Pakowki Dunes 12 Lacinipolia sareta ♀ AB, Manyberries, Pakowki Dunes 13 Lacinipolia sareta ♂ CA, Mono Co., Lee Vining 14 Lacinipolia sareta ♂AZ, Cochise Co., Huachuca Mtns, Ash Cyn. Rd. 15 Lacinipolia sareta ♀AZ, [Maricopa Co.], Congress 16 Lacinipolia dimocki ♂CA, Plumas Co., Jackson Ck., DNA voucher # CNCNoctuoidea7972 17 Lacinipolia dimocki ♂ Holotype, CA, Ventura Co., Cuyama Valley, Apache Cyn. 18 Lacinipolia dimocki ♀Paratype, CA, Ventura Co., Cuyama Valley, Apache Cyn. 19 Lacinipolia dimocki ♂ WA, Klickitat Co., Simcoe Butte 20 Lacinipolia dimocki ♂ WA, Klickitat Co., Munson Prairie 21 Lacinipolia dimocki ♀ WA, Yakima Co., South Fork Ahtanum Cr. 22 Lacinipolia pensilis ♂ BC, Squamish, Diamond Head Trail 23 Lacinipolia pensilis ♂ BC, [11 km WSW Invermere], Watch Peak 24 Lacinipolia pensilis ♀ BC, [11 km WSW Invermere], Watch Peak 25 Lacinipolia pensilis ♂ UT, [Utah Co.,] 12 mi N Provo 26 Lacinipolia pensilis ♂ WA, Yakima Co., Bethel Ridge 27 Lacinipolia pensilis ♀ UT, Salt Lake City.
Figures 69–74.
Distribution of examined specimens of Lacinipolia.
Figure 61.
Variation in spined crest of male phallus, Lacinipolia acutipennis. a–c UT, Stockton d NV, Ely e WA, Omak f WA, Tonasket g–h OR, Biggs i BC, Kamloops j BC, Keremeos k AB, Dinosaur PP l MT, Joliet.
Figure 62.
Variation in spined crest of male phallus, Lacinipolia pensilis. a WA, Satus Ck. b UT, Grantsville c MT, Brooks d UT, Logan e–f BC, Squamish g–h BC, Wellington i BC, Riondel j BC, Crowsnest k BC, Okanagan Falls l BC, Squamish.
Figures 63–68.
Lacinipolia female genitalia. 63 Lacinipolia vicina MA, Barnstable, CNC Gen. Prep. # CNCLEP16883 64 Lacinipolia teligera TX, 16 mi ESE Canyon, CNC Gen. Prep. # CNCLEP16885 65 Lacinipolia pensilis BC, Mt. Kobau, CNC Gen. Prep. # CNCLEP16840 66 Lacinipolia acutipennis CA, Truckee, CNC Gen. Prep. # CNCLEP16847 67 Lacinipolia sareta AB, Wainwright Dunes, CNC Gen. Prep. # CNCLEP16837 68 Lacinipolia dimocki CA, Plumas Co., Happy Valley, CNC Gen. Prep. # CNCLEP16881.
Lacinipolia vicina
(Grote, 1874)
Mamestra vicina Grote, 1874a: 156.
Mamestra imbuna Smith, 1905a: 201, syn. rev.
Type material.
Mamestra vicina: The type material of Lacinipolia vicina almost certainly consisted of two species, the eastern species known previously as Lacinipolia imbuna or Lacinipolia teligera (Franclemont and Todd 1983) and represented by a female syntype from Massachusetts (BMNH; examined), in addition to the widespread species previously called Lacinipolia vicina, represented by at least one syntype from St. Catherines, Ontario (lost). I was unable to locate any St. Catherines specimens, stated by Grote to have come from George Norman. Other syntypes from the Norman collection (Crocigrapha normani (Grote) and Xestia normanianus (Grote)) are also considered to be lost (D. Lafontaine pers. comm.). This is unfortunate since it would have been preferable to fix the name vicina as the widespread, well-known species here treated as Lacinipolia sareta, but as the only extant primary type, the following female specimen [BMNH] must be designated as lectotype: “Mamestra / vicina / Type Grote” [red-bordered label]; “Type” [round red-bordered label]; “vicina / TYPE” [small handwritten label]; Grote Coll. / 81-116.” [type-written label]; “U.S.America.” [type-written label]; “Noctuidae / Brit. Mus. slide / No. 8237” [blue type-written label]. Type locality: “Massachusetts”.
Mamestra imbuna: Male lectotype (AMNH; examined), designated by Todd (1982). Type locality: Luzerne Co., Pennsylvania. The original type series of Mamestra imbuna probably also included Lacinipolia sareta from the southern Lake Michigan region, as Smith (1905a) mentions an August specimen from Hessville, Indiana (a suburb of Chicago), but Todd’s lectotype designation fortunately restricts the concept of the name.
Diagnosis.
Within the eastern North American range of Lacinipolia vicina, Lacinipolia sareta is most similar but the two can usually be separated without dissection by the more southern distribution, larger size and bivoltine spring / fall flight (April-May and September - October) of Lacinipolia vicina (univoltine from late June to early August for Lacinipolia sareta). In the male genitalia, Lacinipolia vicina differs most obviously in the arrangement of the spines above the juxta, consisting of two lateral and one medial field of ventrally projecting spines, whereas in Lacinipolia sareta the spines are directed dorsally and are on the inside of a large, rhomboid plate. Females of Lacinipolia vicina have an asymmetrical, invaginated ostium, like the opening of a conch, compared to a simpler ostium with a convex prevaginal plate margin in Lacinipolia sareta.
Although Lacinipolia vicina is most closely related to Lacinipolia teligera, Lacinipolia vicina and Lacinipolia teligera are not likely to be confused given the range disjunction and more extensive dark fuscous shading of the hindwing in Lacinipolia vicina. The male genitalia differ in the shape of the clasper, with the apical lobe narrower and more pointed in Lacinipolia vicina, and the thumb-like lobe situated one third the distance from the base, compared to halfway in Lacinipolia teligera.
Distribution and biology.
Specimens of Lacinipolia vicina were examined from Massachusetts, New York, Pennsylvania, Virginia and North Carolina (Fig. 69); Forbes (1954) also cites New Jersey (Lakehurst) and Indiana records. The Indiana record (Smith 1905a) may be erroneous given the long-standing confusion with Lacinipolia sareta, as discussed in the “Type material” section above. Eastern Ohio records of Lacinipolia teligera from May and September given by Rings et al. (1992) are most likely Lacinipolia vicina. Moore’s (1955) records for Michigan probably all apply to Lacinipolia sareta based on flight dates and the widespread distribution of Lacinipolia sareta in the Great Lakes region. There is no clear indication of habitat preference; in North Carolina Lacinipolia vicina occurs in open oak-hickory forest (B. Sullivan pers. comm.). Despite the relatively broad distribution and apparent lack of specialized habitat requirements, Lacinipolia vicina records are few. Lacinipolia vicina is apparently bivoltine, flying in spring (April–May) and in late summer to early fall (late August to early October), with later dates farther south. The larvae were described and illustrated by Godfrey (1972) (reared vouchers examined; CUIC), and are probably polyphagous ground dwellers like other Lacinipolia (Wagner et al. 2011).
Remarks.
As defined here, Lacinipolia vicina is the same species later described by Smith (1905a) as Mamestra imbuna, differing considerably in morphology from both Lacinipolia sareta (= vicina of authors) and Lacinipolia pensilis, although more closely related to the latter. Lacinipolia imbuna was previously treated as a junior synonym of Lacinipolia teligera (Franclemont and Todd 1983).
Lacinipolia teligera
(Morrison, 1875)
Mamestra teligera Morrison, 1875: 215.
Type material.
Morrison’s original description was based on two specimens, and Wilterding (1997) discussed two Morrison specimens in the MSU collection: a male with two conflicting locality labels (Texas and New York), and a damaged female specimen labelled simply “19/10” and probably not a syntype. A third specimen in MCZ (photo available at http://insects.oeb.harvard.edu/mcz/Species_record.php?id=1585), dissected and labelled as follows, is here designated as lectotype: “Dianthoecia / teligera / Type / Morr”; “Tex.”; 27/10”; “Certainly not / vicina as / refined by Grote”; “Peab. Acad.”; “Type / 1742”; “M.C.Z. Type # / gen. 1742 / 28 Jan. 33 H[?]. B.”; the following label will be added: “Lectotype / Dianthoecia / teligera Morr., 1875 / desig. by Schmidt 2015”. Type locality: Waco, Texas.
Diagnosis.
Although closely related to Lacinipolia vicina, the challenge in identifying Lacinipolia teligera is in separating it from Lacinipolia sareta in the southwestern Great Plains where the ranges of the two can overlap. Compared to Lacinipolia sareta, Lacinipolia teligera is slightly larger with a broader forewing and better-defined, crisper forewing maculation. Reliable identification should be based on genitalic structure, where Lacinipolia teligera males have a medial and lateral field of short, ventrally directed spines above the juxta, rather than two large flanges laterally on the juxta with dorsally directed spines in Lacinipolia sareta. The female Lacinipolia teligera has an asymmetrical, invaginated ostium (like the opening of a conch), whereas that of Lacinipolia sareta has a simple ostium with the margin of the prevaginal plate convex.
Distribution and biology.
Lacinipolia teligera is known from the Great Plains of central Colorado and eastern Kansas southward to central Texas (Fig. 70). Nothing is known of the early stages, although these are undoubtedly similar to those of Lacinipolia vicina.
Remarks.
Lacinipolia teligera is closely related to Lacinipolia vicina, and the two have previously been considered conspecific (as Lacinipolia imbuna; Franclemont and Todd 1983). However the two differ structurally as outlined in the Lacinipolia vicina diagnosis, in addition to a DNA barcode difference of 1.0%. The two species occupy separate ecoregions and different habitats, with teligera in the grasslands of the Great Plains and vicina in deciduous forest of the Appalachian and Atlantic region.
Lacinipolia pensilis
(Grote, 1874)
Figs 22–27 , 57 , 61 , 65 , 71
Dianthoecia pensilis Grote, 1874b: 199.
Type material.
described from at least 1 male and 1 female syntype; the following male [BMNH] is here designated as lectotype: “Dianthoecia / pensilis ♂ / Type Grote” [red-bordered handwritten label]; “Type” [round, red-bordered, typed label]; Vancouver I / Grote Coll. / 81 – 116”; “5597”; Noctuidae / Brit. Mus. slide / No. 4912 ♂” [blue type-written label]; the following label will be added: “Lectotype / Dianthoecia / pensilis Grote, 1874 / desig. by Schmidt 2015.” Type locality: Victoria, [Vancouver Island, British Columbia, Canada].
Diagnosis.
Lacinipolia pensilis is a northwestern montane species that is often confused with Lacinipolia sareta and also Lacinipolia acutipennis in parts of the range. Compared to Lacinipolia sareta, Lacinipolia pensilis flies later (August to September versus June to early August), and differs considerably in genitalic structure of both males and females as outlined in the key and the Lacinipolia sareta account.
Separating pensilis from dark forms of Lacinipolia acutipennis, which are prevalent in montane habitats of the Pacific Northwest, poses the greatest identification challenge in the Lacinipolia vicina group. Lacinipolia pensilis usually has better-defined forewing markings, richer brown tones in the forewing medial area, and no tendency for streaky pale patches in the forewing apical area; Lacinipolia pensilis also averages slightly larger with a broader forewing. The spined crest of the male phallus is more robust and usually with more spines, and never has the thin apically-projecting spine that is normally found in Lacinipolia acutipennis. In montane parts of the Pacific Northwest (interior British Columbia, northern and central Washington) habitat can help to separate the two, with Lacinipolia pensilis occurring from dry montane woodland to high elevation subalpine forest, whereas Lacinipolia acutipennis is characteristic of the dry, low-elevation habitats of the major intermontane valleys. See also remarks in the Lacinipolia acutipennis account.
Distribution and biology.
This species occurs in the western cordilleran region from central British Columbia and western Alberta southward to at least Washington and central Utah. The distribution pattern suggests it may occur farther south along the Cascade–Coast Ranges through Oregon, and further work is needed to establish the southwestern range limits. The larval description and host plants require clarification since the information given by Crumb (1956) and Godfrey (1972) was probably based on both Lacinipolia acutipennis and Lacinipolia pensilis. The larvae likely are ground-dwelling, general feeders on shrubs and herbs.
Lacinipolia acutipennis
(Grote, 1880) stat. rev.
Figs 28–54 , 58 , 62 , 66 , 72
Figures 28–54.
Lacinipolia acutipennis adults. 28 ♂ BC, [Lillooet], Kirby Flats Rd. ♂ BC, Savona, 2 mi SW 30 ♀ BC, [Lillooet], Kirby Flats Rd., DNA voucher # CNCNoctuoidea7978 31 ♀ BC, [Lillooet], Kirby Flats Rd. 32 ♂ WA, [Okanogan Co.], Tonasket, 8 mi S 33 ♀ CA, Plumas Co., Jackson Ck. 34 ♂ WA, Douglas Co., Jameson L. 35 ♂ WA, Grant Co., Dodson Rd. 36 ♀ WA, Yakima Co., South Fork Ahtanum Cr. 37 ♂OR, Crook Co., Suplee 38 ♀ OR, Lake Co., Alkali L. 39 ♀ OR, Baker Co., Burnt River, 20 mi S 40 ♂ CA, Ventura Co., Cuyama Valley, Apache Cyn. 41 ♂ CA, [Monterey Co.], Pinnacles Nat. Mon. 42 ♀ CA, [Monterey Co.], Pinnacles Nat. Mon. 43 ♂ [subalba paratype] CA, San Diego Co., S rim Peñasquitos Cyn. 44 ♂ [subalba paratype] CA, San Diego Co., S rim Peñasquitos Cyn. 45 ♀ [subalba paratype] CA, San Diego Co., NAS Miramar 6 46 ♂ AB, Dinosaur PP 47 ♂ MT, [Philips Co.], Malta, 19 mi NE 48 ♀ WY, [Albany Co.], Laramie 49 ♂ UT, [Juab Co.], Eureka 50 ♂ ID, Owyhee Co., [Castle Ck. Rd.] 51 ♀ UT, Grand Co., Thompson Cyn. 52 ♂ CO, Adams Co., Bennett 53 ♂ CO, Larimer Co., Flatiron Reservoir 54 ♀ CO, Larimer Co., Flatiron Reservoir.
Mamestra acutipennis Grote, 1880: 214.
Mamestra doira Strecker, 1898: 7, syn. rev.
Mamestra ascula Smith, 1905b: 257, syn. rev.
†Polia pensilis ab. indistincta Strand, 1917: 28, unavailable; infrasubspecific name.
Lacinipolia subalba Mustelin, 2000: 13, syn. n.
Type material.
Mamestra acutipennis: type female (BMNH; examined); type locality: Nevada. Mamestra doira: type female (FMNH, examined); type locality: Utah. Mamestra ascula: lectotype male designated by Poole (1982), (AMNH, examined); type locality: Stockton, Utah. Lacinipolia subalba: South rim of Los Peñasquitos Canyon, 76 m, San Diego Co., California (SDNHM).
Diagnosis.
Lacinipolia acutipennis is a western steppe / grassland species that shows considerably greater regional phenotypic variation than others in the Lacinipolia vicina group. In more mesic habitats (including higher elevations) of the Pacific Northwest and central Rocky Mountains Lacinipolia acutipennis is replaced by the very similar Lacinipolia pensilis. The two occur sympatrically in many transitional habitats, mostly dry montane woodlands at moderate elevations. Although phenotypes of Lacinipolia acutipennis from the most arid habitats (e.g., Figs 34–39) can be distinguished from Lacinipolia pensilis with relative ease, many northern Lacinipolia acutipennis populations in the Pacific Northwest are dark, well-marked and very similar to Lacinipolia pensilis, which makes identifying the two very difficult and led previous workers to conclude that they represent the same species. Compounding this difficulty is the lack of conspicuous genitalic differences that are otherwise typical of the genus. Despite the identification difficulties in the Pacific Northwest, other sympatric populations of Lacinipolia acutipennis and Lacinipolia pensilis have clearly different phenotypes. Differences are most pronounced in Great Basin populations (Lacinipolia pensilis, Figs 25, 27 and Lacinipolia acutipennis, Figs 49–51) and in the northern Rockies/Great Plains (e.g., Montana Lacinipolia pensilis, like those in Figs 23, 24, and Lacinipolia acutipennis, Figs 46–48). The two differ in male genitalia structure as discussed below. These differences, in addition to a minimum 2.5% divergence in DNA barcodes (Fig. 75), show that (at least) two species are involved.
Figure 75.
Neighbour-joining tree of representative mtDNA barcode haplotypes in species of the Lacinipolia vicina group. Sample size and locality are given in brackets, with number of specimens indicated after two-letter state/province abbreviation. Lacinipolia sareta variation is divided into five haplogroups, A–E. Voucher specimen data is given in Suppl. material 1.
Similar phenotypes of Lacinipolia acutipennis and Lacinipolia pensilis differ in the shape and size of the forewing, which averages more acute and smaller in Lacinipolia acutipennis; the brown tones of the medial forewing are more muted in Lacinipolia acutipennis compared to Lacinipolia pensilis, giving an overall lower contrast in tone of the medial area with the grey-black antemedial and postmedial areas; the white spot in the anal angle is often more prominent in Lacinipolia acutipennis, particularly in females; the forewing apex has a more contrastingly pale diffuse area that usually extends farther towards the reniform. In the male genitalia of Lacinipolia acutipennis, the spinose crest of the phallus usually has a thin, delicate apically-directed spine (which is sometimes broken off, in which case the spine base is still evident), which is absent in Lacinipolia pensilis; this thin spine is sometimes absent also in Lacinipolia acutipennis, but in such individuals the entire crest is small and with fewer, smaller cornuti (Fig. 61c) compared to Lacinipolia pensilis (Fig. 62).
Two phenotypes have been recognized as separate species, Lacinipolia doira of the Great Basin (Figs 49–51) and Lacinipolia subalba of southern California (Figs 43–45). Clinal phenotypic variation, lack of diagnostic structural characters, and similarity in DNA barcodes, lead me to treat –doira and –subalba as regional forms.
Distribution and biology.
Lacinipolia acutipennis is a western species common throughout xeric, low elevation habitats of western North America. The core range includes the dry, western portions of the Great Plains, the Great Basin, and the western intermontane valleys north of the Sonoran zone, from southern Saskatchewan and Alberta southward to northern Arizona and New Mexico. Reports from Wisconsin (cited in Forbes 1954), Texas and southern Arizona (Hampson 1905) are probably misidentifications of Lacinipolia sareta. Crumb’s (1954) records from Nebraska and Kansas are plausible; the easternmost specimens I examined were from Watford City in western North Dakota. In the intermontane valleys west of the Rocky Mountains Lacinipolia acutipennis occurs from southern British Columbia to southern California and northernmost Arizona and New Mexico (Fig. 72). All Pacific Northwest specimens examined from subalpine habitats and from sites west of the Coast Ranges proved to be Lacinipolia pensilis.
The larval description and host plants require clarification since the information given by Crumb (1956) and Godfrey (1972) was probably based on both Lacinipolia acutipennis and Lacinipolia pensilis. The larvae likely are general feeders and may ascend shrubs to feed. Lacinipolia acutipennis flies in late summer with most specimens recorded from mid-August to late September.
Remarks.
The name acutipennis has historically been associated with the taxon Lacinipolia sareta (i.e. Lacinipolia vicina of authors) rather than Lacinipolia pensilis. This apparently stemmed from the fact that historical Lacinipolia acutipennis specimens from western Nevada (the type locality of Lacinipolia acutipennis) and adjacent northeastern California had been wrongly associated; a series from Truckee, California, examined by Lloyd Martin (and probably others before him, including McDunnough) consists of male Lacinipolia sareta and female Lacinipolia acutipennis, but only the male Lacinipolia sareta were previously dissected. Female Lacinipolia sareta from the northern Sierra Nevada and especially Nevada are considerably paler. Comparison of the type female of Lacinipolia acutipennis to all other Lacinipolia vicina-group taxa occurring in the region of the type locality shows that Lacinipolia acutipennis is a dark female of the low-elevation taxon previously treated as a form of Lacinipolia pensilis.
Variation in the DNA barcodes (Fig. 75) could be indicative of cryptic species, but genitalic structure is highly conserved and phenotypic blending is apparent from regions where adequate samples were available.
Lacinipolia sareta
(Smith, 1906)
Mamestra sareta Smith, 1906: 229.
Type material.
lectotype male (AMNH, examined), designated by Todd (1982); type locality: Minnehaha, Yavapai Co., Arizona.
Diagnosis.
Lacinipolia sareta is the most common and widespread species in the Lacinipolia pensilis group, and most of the identification difficulties are in separating it from Lacinipolia pensilis and Lacinipolia acutipennis in the West. This is most reliably done based on genitalia, where males lack the ventrally projecting, paired spinose crests above the juxta that are found in Lacinipolia acutipennis and Lacinipolia pensilis; females of Lacinipolia sareta have a simple ostium with a strongly convex prevaginal margin, compared to those of Lacinipolia pensilis and Lacinipolia acutipennis which have an asymmetrical, conch-shaped ostium with a straight prevaginal margin. Lacinipolia sareta flies earlier in the year (mostly June–July) than Lacinipolia pensilis and Lacinipolia acutipennis (August–September), although the southernmost Lacinipolia sareta populations in Arizona, New Mexico, and Texas fly again in late September–October after an initial May flight.
The remaining species (Lacinipolia vicina, Lacinipolia teligera, and Lacinipolia dimocki) can, for the most part, be distinguished from Lacinipolia sareta by geographic distribution; in Washington, Oregon and California, where the range of Lacinipolia sareta overlaps that of Lacinipolia dimocki, Lacinipolia sareta is smaller and has a duller white hindwing, in addition to the genitalic characters given under dimocki. From eastern Colorado and New Mexico through western Oklahoma and northern Texas Lacinipolia sareta overlaps with Lacinipolia teligera; characters given in the keys and the Lacinipolia teligera diagnosis will separate the two. The range of Lacinipolia sareta might overlap with that of Lacinipolia vicina in the East (from the Great Lakes region eastward through New York and New England), where the smaller size, different flight period and genitalic differences given under Lacinipolia vicina will reliably separate the two.
Distribution and biology.
Lacinipolia sareta occurs throughout western North America from the southern Yukon and Northwest Territories to Texas, Arizona and California; it undoubtedly also occurs in northern Mexico. It ranges eastward across the southern boreal region to at least Quebec, with an unverified record from Maine (Forbes 1954). Most or all records of Lacinipolia vicina for Michigan (Moore 1955) probably apply to this species, but Lacinipolia sareta is not known from Ohio (Rings et al. 1992) where it would be expected in sandy habitats along Lake Erie. Although found in a huge variety of woodland, steppe and prairie habitats, Lacinipolia sareta particularly favours sandy soils and can be abundant in dune and beach habitats. Crumb (1956) describes the ground-dwelling, polyphagous larva (as Lacinipolia vicina). Godfrey (1972) illustrates the larva, and states that Arizona and Montana larvae are identical.
Remarks.
The vast geographic range and considerable DNA barcode variation suggest that Lacinipolia sareta could be a cryptic species complex. Alternatively, DNA barcode variation simply may not be fully congruent with species limits in the group, a phenomenon that occurs in about 10% of Noctuoidea (Zahiri et al. 2014). In contrast to the mtDNA variation, genitalic structure and wing pattern is highly conserved, and I could find no way to segregate specimens with divergent barcodes or those from different ecoregions. The shape of the digitus varies somewhat, with nominate Lacinipolia sareta from the southwestern United States with a slightly longer, narrower tine-like digitus, compared to most (but not all) northern specimens, which have a shorter more triangular digitus, but the differences are inconsistent and again do not correlate with geographic or molecular differences. This is surprising given that molecular divergence among Lacinipolia sareta haplogroups was greater than the minimum divergence between Lacinipolia sareta and Lacinipolia dimocki (Fig. 75), despite the considerable morphological differences between the two species. Studies of pheromone variation, nuclear DNA sequence data, and immature stages would provide more insight into this difficult group.
Lacinipolia dimocki
Schmidt sp. n.
http://zoobank.org/3818A542-7458-4999-9547-F2DCFB980F1B
Type material.
Holotype ♂. California: Ventura Co., Cuyama Valley, Apache Canyon, 0.6 mi E of Hwy. 33, 34.751193°N, 119.399772°W, 3497’, 19.Jun.2009, T. E. Dimock [CNC]. Paratypes 17♂ 18♀. Same data as holotype, 2♂ 7♀; California: Ventura Co., Pine Mountain, Pine Mountain campground, 6620’, 21.Aug.2000, T. E. Dimock, 1♂ 1♀, 27.Jun.2000, 2♀; Ventura Co., Sespe Creek at Derrydale Creek, 34.583992°N, 119.262757°W, 15.Jul.2009, T. E. Dimock, 2♂ 2♀; Ventura Co., Sespe Creek at Tule Creek, 34.561350°N, 119.264780°W, 1♂; Ventura Co., Upper Ojai Valley, 34.451°N, 119.121°W, 2120’, 31.May.2003, T. E. Dimock, 1♂; Ventura Co., Cuyama Valley, 34.695°N, 119.398°W, 3540’, 14.Jun.2005, T. E. Dimock, 3♂; San Diego Co., Laguna Mountains, Pine Creek Road, 5500’, 1.Jul.2000, T. Mustelin, 2♂; same data, DNA barcode vouchers # CNCNoctuoidea7969 and CNC LEP00053134, 2♂; same locality, 29.Aug.2000, 1♀; San Diego Co., Laguna Mountains, Desertview Overlook, 5800’, 29.Aug.2000, T. Mustelin, 1♂ 1♀; San Diego Co., Laguna Mountains, Kitchen Creek Road, 5500’, 29.Aug.2000, T. Mustelin, 1♂ 1♀; San Bernardino Co., San Bernardino Mountains, Cactus Flats, 34°18.32’ N 116°47.99’ W, 6100’, 25.May.2006, T. Mustelin, 1♀; San Bernardino Co., San Bernardino Mountains, Onyx Summit, 34°11.50’ N 116°43.06’ W, 8500’, 25.May.2006, T. Mustelin, 1♀; 1.Aug.2006, 1♀; Riverside Co., Pinyon Crest, 33.614N 116.446 W 4200’, 29.Sep.2001, R. Leuschner, 1♂. CNC, USNM. The type material is restricted to specimens from southern California.
Etymology.
This species is named in honour of Thomas E. Dimock for his contributions to the knowledge of southern California moths. His efforts to collect research specimens provided most of the type series of Lacinipolia dimocki.
Diagnosis.
This western species was previously included with Lacinipolia sareta (Lacinipolia vicina of authors), but it is a cryptic, mostly parapatric species that replaces Lacinipolia sareta from the Washington coast ranges southward through California. The two occur sympatrically in south-central Washington, and possibly elsewhere along the interface of the Great Basin–Coast Ranges and Sierra Nevada. Externally Lacinipolia dimocki is larger with an overall paler, less contrasting forewing pattern and usually a lighter, more pearly-white hindwing. The male genitalia differ in having a sinuate, tine-like clasper rather than the flattened, two-lobed clasper of Lacinipolia sareta; also the ventral swelling of the phallus is much more pronounced in Lacinipolia dimocki. Females can be difficult to separate from those of Lacinipolia sareta; in addition to the forewing characters mentioned above, Lacinipolia dimocki is generally larger overall and with a less sinuous, less dorsoventrally flattened ductus bursae and a relatively larger corpus bursae.
Description.
Head. Antenna of male appearing filiform, but slightly serrate under magnification; antenna of female filiform; dorsal scaling grey; scape, and vertex with a mix of dull-white and dark-grey scales, these spatulate and bifid apically; frons with thin white, strap-like scales, bordered by transverse band of dark-grey scales at dorsal margin; labial palpi with mix of dull-white and dark-grey scales; 3rd segment 0.4× length of 2nd segment. Thorax. Vestiture of light-grey scales tipped with dark-grey apex; tegula and patagium with subterminal border of black scales, border of the tegula diffuse, but that of patagium forming distinct black prothoracic line; caudal margin with slight tuft; legs with mix of light- and dark-grey scales, tarsi with slight banding pattern formed by border of lighter scales along distal margin of each tarsal segment. Wings. Average forewing length of males 15.0 mm (n = 9, range 14.2–15.8 mm), females 15.1 mm (n = 9, range 13.8–16.9 mm); forewing ground colour pale grey, medial area pale grey brown; antemedial and postmedial line incomplete or absent, when present then best developed toward anal margin and fading out towards costa, antemedial line double, sometimes with slightly paler grey infill; postmedial line double, often forming pale, indistinct crescent opposite claviform spot; subterminal area with diffuse dark shading in subapical and anal areas, latter sometimes with a small white crescent; basal dash black and crisp; orbicular spot slightly oblong to slightly kidney shaped, with incomplete, thin black border and interior slightly paler than ground colour; reniform spot with incomplete thin black border, interior slightly paler than ground, with indistinct, darker inner ring; claviform usually distinct, forming a thin black, open V; fringe dark grey, pale grey at vein terminus resulting in indistinct striping; male hindwing bright, slightly pearlescent white with terminal third of veins, and thin diffuse margin fuscous; female hindwing duller white overall with more extensive fuscous shading on veins and marginal area. Abdomen. Vestiture light grey, first four segments with slight dorsal tufts of darker grey scales; tuft of 4th segment most prominent. Male genitalia. Uncus slender, 10–11× longer than wide, evenly tapered from base to apex, with sparse long setae directed basad; valve with extreme subapical constriction forming a narrow neck, such that apex consists of strongly spatulate cucullus; valve abruptly angled caudoventrally beyond apical third; cucullus anvil shaped, interior surface densely covered with fine long hairs; corona consisting of a single row of flattened marginal spines, and a cluster of spines in tip of caudoventral lobe; sacullus with membranous, rectangular flap (possibly a modified editum), which is densely covered in long setae; clasper forming a long, simple sinuate tine, extending to, or slightly beyond, costa; digitus a simple flattened lobe, 2× longer than wide; juxta with two lateral, rounded triangular plates flanking phallus, these with short, straight dorsally directed spines on inner surface; phallus with ventral swelling 2/3 from base; apical third curving ventrad slightly; phallus with small, broad-based, thorn-like dorsal cornutus at apical ¾; vesica directed left-ventrad, then coiling dorsad and forming extended spiral through one rotation; vesica with small medial patch of spinules, and larger preapical patch extending slightly along axis of vesica. Female genitalia. Bursa copulatrix unisaccate; ductus bursae moderately sclerotized and dorsoventrally flattened, 5× longer than wide; corpus bursae globose, membranous and slightly corrugated, lacking signa; appendix bursae slightly coiled, with ductus seminalis situated preapically; ostium bursae extending caudad as an invaginated slit; prevaginal margin convex and slightly rounded-conical; terminal segments telescopic, with posterior apophysis twice as long as anterior apophysis; papillae small, narrow and lobe-like, membranous and moderately setose.
Distribution and biology.
The early stages and larval food plants are unknown, but like other species in the group, larvae of Lacinipolia dimocki probably are ground-dwelling and polyphagous on herbaceous plants. It occurs from the east slope of the Washington Coast Ranges to southern California.
Supplementary Material
Acknowledgements
I thank Jason Dombroskie (Cornell University, Ithaca, NY) and Michael Pogue (Systematic Entomology Laboratory, National Museum of Natural History, Washington, DC), for the loan of specimens, and Jocelyn Gill (CNC, Ottawa, Canada) for preparing genitalia slides, photography and the colour plates. Lars Crabo, Tom Dimock, Cliff Ferris, Paul Opler, Ken Stead, Bo Sullivan, Jim Troubridge and Jim Vargo kindly contributed specimens for this project. Don Lafontaine and Gary Anweiler provided valuable feedback and editorial comments. Paul Hebert and the staff at the Canadian Centre for DNA Barcoding (Biodiversity Institute of Ontario, University of Guelph, Guelph, Canada) provided data and information from the Barcode of Life Data (BOLD) system. Molecular analyses were carried out through grants from the National Science and Engineering Research Council of Canada and Genome Canada through the Ontario Genomics Institute.
Citation
Schmidt BC (2015) Revision of the Lacinipolia vicina (Grote) complex (Noctuidae, Noctuinae, Eriopygini). In: Schmidt BC, Lafontaine JD (Eds) Contributions to the systematics of New World macro-moths VI. ZooKeys 527: 103–126. doi: 10.3897/zookeys.527.9686
Footnotes
The spine field above the juxta and even the aedeagal cornuti can often be examined without dissection by carefully removing the terminal abdominal hairs with a small brush, especially if the valves have previously been spread by squeezing the base of the genital capsule when specimen is still fresh.
Supplementary materials
Table S1. Specimen data for mtDNA barcode vouchers
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
B. Christian Schmidt
Data type: data spreadsheet
Explanation note: Haplogroup numbers refer to those given in Fig. 75. Abbreviations for specimen depositories are as given in Methods and materials section.
References
- Crumb SE. (1956) The larvae of the Phalaenidae. Technical Bulletin no. 1135, United States Department of Agriculture, Washington, 356 pp. [Google Scholar]
- deWaard JR, Ivanova NV, Hajibabaei M, Hebert PDN. (2008) Assembling DNA barcodes: Analytical protocols. In: Martin Cristofre. (Ed.) In Methods in Molecular Biology: Environmental Genetics. Humana Press Inc., Totowa, USA, 275–293. doi: 10.1007/978-1-59745-548-0_15 [DOI] [PubMed] [Google Scholar]
- Forbes WTM. (1954) Lepidoptera of New York and neighboring states. Part 3 Noctuidae. Cornell University Agriculture Experiment Station, Memoir 329: 1–433. [Google Scholar]
- Franclemont JG, Todd EL. (1983) Noctuidae. In: Hodges RW, Dominick T, Davis DR, Ferguson DC, Franclemont JG, Munroe EG, Powell JA. Check List of the Lepidoptera of America North of Mexico. E. W. Classey Ltd., London: and The Wedge Entomological Research Foundation; Washington, 120–159. [Google Scholar]
- Godfrey GL. (1972) A review and reclassification of larvae of the subfamily Hadeninae (Lepidoptera, Noctuidae) of America north of Mexico. United States department of Agriculture, Technical Bulletin 1450, 265 pp. [Google Scholar]
- Grote AR. (1874a) Notes on American Lepidoptera with descriptions of twenty-one new species. Bulletin of the Buffalo Society of Natural Sciences 2: 145–163. [Google Scholar]
- Grote AR. (1874b) New species of North American Noctuidae. Proceedings of the Academy of Natural Sciences of Philadelphia 1874: 197–214. [Google Scholar]
- Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh R, et al. (2005) Critical factors for the high volume assembly of DNA barcodes. Philosophical Transactions of the Royal Society B 360: 1959–1967. doi: 10.1098/rstb.2005.1727 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hampson GF. (1905) Catalogue of the Lepidoptera Phalaenae in the British Museum; 5: 1–634. [Google Scholar]
- Hebert PDN, Cywinska A, Ball SL, deWaard JR. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270: 313–321. doi: 10.1098/rspb.2002.2218 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hebert PDN, deWaard JR, Zakharov EV, Prosser SWJ, Sones JE, et al. (2013) A DNA ‘Barcode Blitz’: Rapid digitization and sequencing of a natural history collection. PLoS ONE 8: . doi: 10.1371/journal.pone.0068535 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ivanova NV, deWaard JR, Hebert PDN. (2006) An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6: 998–1002. doi: 10.1111/j.1471-8286.2006.01428.x [Google Scholar]
- Lafontaine JD. (2004) The moths of North America. Noctuoidea: Noctuidae (part). Noctuinae (part — Agrotini). Fasc. 27.1. In: Dominick RB, Ferguson DC, Franclemont JG, Hodges RW, Munroe EG. (Eds) The moths of North America. Wedge Entomological Research Foundation, Washington, D.C., 385 pp. [Google Scholar]
- Leuschner R. (1992) An overlooked record of Lacinipolia rodora (Noctuidae) from the United States. Journal of the Lepidopterists’ Society 46: 79–80. [Google Scholar]
- Moore S. (1955) An annotated list of the moths of Michigan exclusive of Tineoidea (Lepidoptera). University of Michigan Museum of Zoology, Miscellaneous Publications No. 88, 87 pp. [Google Scholar]
- Morrison HK. (1875) List of a collection of Texan Noctuidae, with descriptions of new species. Proceedings of the Boston Society of Natural History 17: 209–221. [Google Scholar]
- Rings RW, Metzler EH, Arnold FJ, Harris DH. (1992) The owlet moths of Ohio Order Lepidoptera Family Noctuidae. Ohio Biological Survey Bulletin, New Series 9(2): vi + 1–219, pl. 1–16. [Google Scholar]
- Selman CL. (1975) Revision of the Genus Lacinipolia McDunnough of America North of Mexico (Lepidoptera: Noctuidae). Ph. D. thesis dissertation, Ohio State University. [Google Scholar]
- Selman CL, Leuschner R. (2001) Nine new species of Lacinipolia (Noctuidae) from Arizona, California and vicinity. The taxonomic Report of the International Lepidoptera Survey 2(8): 1–9. [Google Scholar]
- Shorthouse DP. (2010) SimpleMappr, an online tool to produce publication-quality point maps. http://www.simplemappr.net [accessed 2 December 2014]
- Smith JB. (1905a) New species of Noctuidae for 1905. Journal of the New York Entomological Society 13: 188–211. [Google Scholar]
- Smith JB. (1905b) New species of Noctuidae for 1905 – No. 2. The Canadian Entomologist 37: 257–261. doi: 10.4039/Ent37257-7 [Google Scholar]
- Smith JB. (1906) New species of Noctuidae for 1906. No. 2. The Canadian Entomologist 38: 225–238. doi: 10.4039/Ent38225-7 [Google Scholar]
- Strand E. (1917) Neue Aberrationen der Noctuiden – Subfamilien Hadeninae, Erastriinae, Catocalinae, Mominae, und Phytometrinae. Archiv für Naturgeschichte Berlin Abt. A82 2: 28–50. [Google Scholar]
- Todd EL. (1982) The noctuid type material of John B. Smith (Lepidoptera). United States Department of Agriculture, Technical Bulletin 1645: 1–228. [Google Scholar]
- Wagner DL, Schweitzer DF, Sullivan JB. (2011) Owlet Caterpillars of Eastern North America. Princeton University Press, New Jersey. [Google Scholar]
- Zahiri R, Lafontaine JD, Schmidt BC, deWaard JR, Zakharov EV, Hebert PDN. (2014) A transcontinental challenge—a test of DNA barcode performance for 1,541 species of Canadian Noctuoidea (Lepidoptera). PLoS ONE 9: . doi: 10.1371/journal.pone.0092797 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Specimen data for mtDNA barcode vouchers
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
B. Christian Schmidt
Data type: data spreadsheet
Explanation note: Haplogroup numbers refer to those given in Fig. 75. Abbreviations for specimen depositories are as given in Methods and materials section.









