Abstract
Thorough sampling is necessary to delineate lineage diversity for polytypic “species” such as Cyprinella lutrensis. We conducted extensive mtDNA sampling (cytochrome b and ND4) from the Pecos River, Rio Grande, and South Canadian River, New Mexico. Our study emphasized the Pecos River due to its complex geological history and potential to harbor multiple lineages. We used geometric-morphometric, morphometric, and meristic analyses to test for phenotypic divergence and combined nucDNA with mtDNA to test for cytonuclear disequilibrium and combined our sequences with published data to conduct a phylogenetic re-assessment of the entire C. lutrensis clade. We detected five co-occurring mtDNA lineages in the Pecos River, but no evidence for cytonuclear disequilibrium or phenotypic divergence. Recognized species were interspersed amongst divergent lineages of “C. lutrensis”. Allopatric divergence among drainages isolated in the Late Miocene and Pliocene apparently produced several recognized species and major divisions within “C. lutrensis”. Pleistocene re-expansion and subsequent re-fragmentation of a centralized lineage founded younger, divergent lineages throughout the Rio Grande basin and Edwards Plateau. There is also evidence of recent introductions to the Rio Grande, Pecos and South Canadian Rivers. Nonetheless, deeply divergent lineages have coexisted since the Pleistocene.
Keywords: allopatric speciation, cryptic diversity, lineage persistence, phylogenetic sampling, polytypic taxa, species introductions, widespread species
INTRODUCTION
Allopatric speciation depends on geographical separation of lineages, divergence in allopatry, and emergence of intrinsic barriers to gene flow allowing coexistence in secondary sympatry (Wiens, 2004). Divergence and reproductive incompatibility typically increase with time (Coyne & Orr, 1997; Bolnick & Near, 2005; Stelkens, Young & Seehausen, 2009), so probability of speciation should increase with duration of allopatry. However, lineage persistence and rate of divergence differ (Bolnick, Near & Wainwright, 2006; Dynesius & Jansson, 2014). Further, species of geographical regions that are geomorphically or climatically dynamic may diverge when gene flow is severed, but re-converge once gene flow resumes (Borden & Krebs, 2009; Bagley et al., 2011), creating potential for polyphyly and introgression among divergent lineages (Bossu & Near, 2009; Bagley et al., 2011). In these cases, comprehensive phylogeographic sampling is critical (Funk & Omland, 2003).
The river systems of North America have complex geomorphic histories that include periods of fragmentation, coalescence, and reorganization (e.g. Blum & Hattier-Womack, 2009; Galloway, Whiteaker & Ganey-Curry, 2011). Pre-historic fragmentation of river basins corresponds with patterns of fish endemism (Oberdorff, Lek & Guégan, 1999; Hoagstrom, Ung & Taylor, 2014). However, distributions of some North American fishes remain contiguous and transcend drainage divides. Some including Ictalurus punctatus (Hardman & Hardman 2008), Percina caprodes (Near & Benard, 2004), and Micropterus dolomieu, M. punctulatus, and M. salmoides (Near et al., 2003) are relatively young (i.e. Pleistocene), but others (e.g. Pylodictis olivaris) are ancient (i.e. PaleocenePaleocene-Eocene, Hardman & Hardman, 2008). Widespread ancient species may harbor undetected cryptic diversity (e.g. Blanton, Page & Hilber, 2013) or if not, are interesting as exceptions to the general trend of allopatric speciation.
Cyprinella lutrensis, a widespread taxon of uncertain history
Cyprinella lutrensis (Red Shiner) is a widespread generalist found across watersheds of south-central North America that exhibits broad ecological tolerances (Matthews, 1985) and exhibits molecular evidence of range expansion northward since the last glacial retreat (Richardson & Gold, 1995; Osborne et al., 2014). To the southwest, its distribution transcends geographic boundaries associated with endemism in other plains and prairie fishes (e.g. Hoagstrom, Brooks & Davenport, 2011), including members of the genus Cyprinella (Schönhuth & Mayden, 2010). It has also recently invaded northeastern areas modified for agriculture (Page & Smith, 1970) and has been widely translocated by humans within and outside of its native range (Husemann et al., 2012; Poulos et al., 2012). Although, its morphology is locally variable (Dugas & Franssen, 2011, 2012), there are no broad geographic breaks to indicate a history of allopatric divergence (Matthews, 1987). Further, C. lutrensis hybridizes with some congeners (e.g. Walters et al., 2008; Schönhuth & Mayden, 2010; Broughton et al., 2011) indicating gene flow can extend beyond taxonomic boundaries.
Richardson and Gold (1995) concluded the progenitor of C. lutrensis inhabited southern portions of the present range by the Late Miocene. There it was potentially exposed to extended periods of population fragmentation within and among dynamic river systems (Hoagstrom et al., 2014). Matthews (1995) suggested such range fragmentation accounted for variation in nuptial coloration among southwestern populations. Further, southwestern taxa recognized as distinct species are nested within “C. lutrensis” (Schönhuth & Mayden, 2010), indicating either: (1) C. lutrensis is polytypic and includes peripheral “species”, (2) more cryptic “species” are present within “C. lutrensis”, or (3) C. lutrensis is a complex taxon that has both founded peripheral taxa appropriately recognized as species and maintained cryptic diversity within “C. lutrensis”.
To fully discover and define the taxonomic status of all populations within the C. lutrensis clade will require numerous detailed molecular and taxonomic studies. An important step is to better determine biogeographical patterns within and among southwestern populations. Schönhuth and Mayden (2010) tentatively elevated (or re-elevated) two putative southwestern species, that warranted further sampling. Broughton et al. (2011) found divergence of mtDNA sequences among C. lutrensis of adjacent, southwestern river basins, also needing further attention. Here we pair extensive new data from the Pecos River, Rio Grande, and South Canadian River, New Mexico with existing phylogenetic data (Schönhuth & Mayden, 2010; Broughton et al. 2011). The focal rivers are adjacent to those more intensively sampled by Schönhuth and Mayden (2010) and Broughton et al. (2011) and represent the western-most native populations (Fig. 1).
Figure 1.
Map of the southwestern United States and northern Mexico indicating tentative boundaries of the lineages identified in this study. Open polygons enclosed with solid lines indicate Peripheral sub-clades of estimated Miocene to Pliocene origin. Shaded polygons enclosed with dashed lines indicate Central group sub-clades of estimated Pleistocene origin.
In this study, we combined data obtained herein with available Genbank sequences from Schönhuth and Mayden (2010) and those in Broughton et al. (2011) to help identify evolutionary origins of fishes in the Pecos River, and to place our results into deeper phylogenetic context. We adopted this strategy because preliminary sampling revealed evidence of deep phylogenetic divergence in this river system and hence was the focus of our study. We used mtDNA and nucDNA sequences to determine whether cytonuclear disequilibrium was evident and conducted morphometric, geometric-morphometric, and meristic comparisons to assess the presence of phenotypic divergence. We also estimated divergence times among lineages in our gene tree based on mtDNA. Our goals were to: (1) expand understanding of phylogenetic structure within the C. lutrensis clade, (2) use the expanded phylogeny to reconstruct the clades’ historical biogeography in light of geological evidence, and (3) use detailed data from Pecos River samples to study causes of lineage complexity, including the role of recent translocations, to gain a better understanding of the evolutionary processes that gave rise to this remarkably diverse and ecologically important species complex.
MATERIALS AND METHODS
Study area history
The Pecos River is a textbook example of a river basin formed by stream piracy (Hunt, 1974; DiPietro, 2013). Its formation began in the Late Miocene as streams flowing southeast across the Great Plains, from the easternmost mountains of the Basin and Range Province, were diverted south, into the subsiding Roswell and Delaware basins (Gustavson & Winkler, 1988; Hawley, 1993; Hill, 1996). The stream system of these basins was integrated, flowing from north to south (Hill, 1996), so the collective name “Capitan basins” is used to refer to this Late Miocene-Pliocene drainage (Hoagstrom et al., 2014, Fig. 2A). The name comes from prominent geological features surrounding the Roswell and Delaware basins: El Capitan peak, Capitan Reef, Capitan Escarpment, Capitan Platform, and Capitan Mountains.
Figure 2.
Putative scenario of expansion and fragmentation of southwestern Cyprinella lutrensis. (A) Beginning Pliocene: mountain ranges (gray polygons) border High Plains (i.e. Ogallala surface); mountain-fed rivers cross High Plains to Edwards Plateau and Coastal Plain (east and south of mapped area), except for endorheic drainage into Delaware (DB) and Roswell (RB) subsidence basins (collectively Capitan basins); sediments fill deep dissolution basins (e.g. Toyah Basin, TB); Central group C. lutrensis (CG) isolated in lower Rio Grande (shiner icon). (B) Beginning Pleistocene: dissolution subsidence forms Caprock Escarpment and High Plains is desiccated; Rio Grande Rift drainage (northwest of mapped area) and Rio Conchos overflow basins and connect; Capitan basins overflow Delaware Basin to join Rio Grande; incipient Pecos River expands headward, capturing Arroyo del Macho (Macho) of Colorado River; Central Group C. lutrensis (CG) expand north and west into interconnected rivers, colonizing Colorado River via Pecos River or Coastal Plain; incipient South Canadian River expands headward, capturing headwaters of east-flowing rivers; Mississippi River sub-clade (checkerboard shiner icon) invades South Canadian River. (C) Late Pleistocene: Caprock Escarpment prominent around desiccated Llano Estacado (e.g. Portales and Simanola valleys abandoned); swollen Conchos, Pecos, and Rio Grande form canyons (gray river outlines) that fragment Central group C. lutrensis: (i) Chihuahuan Desert sub-clade (Chi), (ii) Capitan basins sub-clade (Cap), (iii) Rio Grande - Burgos basins sub-clade (RGB), and (iv) Colorado River sub-clade (Col); Peripheral-group lineages expand westward: (i) Red River (polka dot shiner icon) and (ii) Brazos River (striped shiner icon). (D) Today: post-glacial aridity and human water uses diminish rivers; widespread translocations (pickup icons) include C. lutrensis: (i) Red River sub-clade introduced to South Canadian and Pecos, (ii) Brazos and Mississippi sub-clades introduced to Pecos (pickups) and Middle Rio Grande (arrows), and (iii) Colorado River sub-clade introduced to Pecos. State lines provided for reference. Other abbreviations mentioned in text: CM - Capitan Mountains; DR - Delaware River; EC - El Capitan Peak; GM-CP - Guadalupe Mountains- Capitan Platform; TCC = Terlingua Creek confluence.
The early history of the Capitan basins was one of isolation (Fig. 2A). Streams diverted into these basins were previously part of the Middle Miocene Guadalupe River, which flowed across the Great Plains and Edwards Plateau toward the Gulf of Mexico (Galloway et al., 2011). Although diversion into the Capitan basins directed surface flow toward the lower Rio Grande, a lack of sediments from this region in deposits in the Gulf of Mexico suggests the developing river basin remained small and isolated through the Pliocene (Galloway et al., 2011). Severe aridity (Chapin, 2008) likely limited runoff and dissolution subsidence in the Delaware Basin may have outpaced surface flow and alluviation. Karstification in the eastern Delaware Basin diverted surface waters underground (Hill, 1996; Stafford et al., 2009).
Isolation ceased in the early Pleistocene (Fig. 2B). Accelerated incision in the lower Pecos River and adjacent Rio Grande canyons (Kastning, 1983; Veni, 1994) caused headward advance toward the Delaware Basin. Simultaneously, increased streamflow in the Capitan basins promoted basin filling and overflow, forming the Pecos River. By the late Pleistocene (Fig. 2C) the Pecos River extended from the Sangre de Cristo Mountains to the lower Rio Grande (Hill, 1996; Galloway et al., 2011).
Sample collection
Our study focused on C. lutrensis present in the Pecos River within the Roswell Basin portion of the Capitan basins (Fig. 2A) and upstream to the Fort Sumner Valley. Upstream sites are from reaches captured from the Colorado and Brazos rivers in the Pleistocene (Fig. 2B). Cyprinella lutrensis specimens (n = 222) were collected from eight sites, using a 1.2 × 1.8 m seine with 3mm mesh. Whole fish ≥ 30 mm standard length (SL) were retained and euthanized. Caudal-fin clips for DNA extraction were removed and preserved in 95% ethanol. Clipped specimens were fixed in 10% formalin for morphometric analysis.
Fin clips were also collected from: (i) the Middle Rio Grande between Albuquerque and Elephant Butte Reservoir, which is in the central portion of the Rio Grande Rift (n = 36), (ii) the South Canadian River between Ute Dam and the Texas border (n = 19), and (iii) the Delaware River near its confluence with the Pecos River (n = 31, this was a disjunct location within the Capitan basins). These specimens were intended only for the phylogenetic portion of the study. Samples from the South Canadian River included locations associated with recent (within the last 100 years) introductions of other fish species to the Pecos River (Moyer, Osborne & Turner 2005; Osborne, Diver & Turner, 2013).
Molecular methods
DNA was isolated and polymerase chain reactions (PCR) were performed for partial mitochondrial NADH dehydrogenase subunit 4 gene (ND4, 314 base pairs [bp]) for 308 specimens from the Pecos River and surrounding basins using primers and methods outlined in Osborne, Carson & Turner (2012). This locus has been used previously to identify shared haplotypes among drainages in Hybognathus placitus and Notropis girardi (Moyer et al., 2005; Osborne et al., 2013). Individuals with unique ND4 haplotypes were sequenced for a 962 bp fragment of mitochondrial cytochrome b to allow phylogenetic analysis with other data available on Genbank (see above). Cytochrome b was amplified using the primers LA and HA (Schmidt, Bielawski & Gold, 1998) with an annealing temperature of 50°C. Following initial screening, and identification of two major lineages using mitochondrial data (called ‘Central’ and ‘Peripheral’) a subset of individuals (Table 1) from each lineage (n = 57 individuals total) were sequenced for partial nuclear recombination-activating 1 exon (RAG-1, 359 bp) to test for cytonuclear disequilibrium between nucDNA and mtDNA. We conducted this test because we hypothesized that divergent mtDNA lineages were reproductively isolated. RAG-1 was sequenced using PCR primers designed for C. lutrensis (RAG-1 F: 5′ TGGCAGCCGGCTTTAAAAAACG and RAG-1 R: 5′ AAACATGAGGCACAAAGGTCT) with the following protocol: template DNA, 1x reaction buffer, 2 mM MgCl2, 125μM dNTPs, 0.5 μM of each primer, and 0.375 units Promega GoTaq® and the following PCR conditions: initial denaturation at 95°C for 3 minutes (min), 20 cycles of denaturation at 95°C for 1 min, annealing at 60°C for 40 seconds (s), and extension at 72°C for 40 s, followed by 20 cycles of denaturation at 95°C for 1 min, annealing at 48°C for 40 s, extension at 72°C for 40 s, and final extension at 72°C for 10 min. PCR products were purified with Omega CyclePure kits, sequenced with the Big Dye sequencing kit (ver.1.1), and analyzed on an ABI3130 automated DNA sequencer (Applied Biosystems, Inc.). Genbank accession numbers for ND4 and cytochrome b are provided in Table 2 and 3, and for RAG-1 were KM389180-KM389197 (Table S1).
Table 1.
Number of individuals from each river sequenced for genetic and morphological analyses.
| River | ND4 | Cytb | RAG-1 | Meristics | Geomorph |
|---|---|---|---|---|---|
| ^ Pecos | 255 | 18 | 41 | 38 | 38 |
| Rio Grande | 36 | 5 | 10 | 0 | 0 |
| South Canadian | 19 | 5 | 6 | 0 | 0 |
| Total | 308 | 28 | 57 | 38 | 38 |
Also includes samples from the Delaware River that is a tributary of the Pecos River.
Table 2.
ND4 haplotype frequencies and Genbank accession numbers. Haplotype sub-clades as identified in Fig. 3 and Fig. 4 are also given. Asterisks indicate contemporary transfer of haplotypes between drainages.
| Haplotype | Genbank Accession | ^ Pecos | South Canadian | Rio Grande | ||
|---|---|---|---|---|---|---|
| Peripheral | Red | U | KM199673 | -- | 0.05 | -- |
| V | KM199674 | 0.019 | 0.150* | -- | ||
| W | KM199675 | -- | 0.05 | -- | ||
| X | KM199676 | 0.004 | -- | -- | ||
| Y | KM199677 | 0.016 | -- | -- | ||
| Z | KM199678 | 0.035 | 0.250* | -- | ||
| BB | KM199680 | 0.019 | 0.100* | -- | ||
| CC | KM199681 | -- | 0.05 | -- | ||
|
| ||||||
| Brazos | P1** | KM504967 | 0.004 | -- | -- | |
| P2** | KM504968 | 0.004 | -- | -- | ||
| P3 | KP987457 | 0.004 | -- | -- | ||
|
| ||||||
| Mississippi | P | KM199668 | -- | 0.250* | 0.087 | |
| R | KM199670 | -- | 0.1 | - | ||
| Q | KM199669 | -- | -- | 0.087 | ||
| S | KM199671 | -- | -- | 0.087 | ||
|
| ||||||
| Central | Capitan | A | KM199653 | 0.728 | -- | -- |
| B | KM199654 | 0.031 | -- | -- | ||
| C | KM199655 | 0.004 | -- | -- | ||
| D | KM199656 | 0.004 | -- | -- | ||
| E | KM199657 | 0.008 | -- | -- | ||
| F | KM199658 | 0.031 | -- | -- | ||
| G | KM199659 | 0.004 | -- | -- | ||
| I | KM199661 | 0.004 | -- | -- | ||
|
| ||||||
| Chihuahuan | J | KM199662 | -- | -- | 0.043 | |
| K | KM199663 | -- | -- | 0.696 | ||
|
| ||||||
| Colorado | L | KM199664 | 0.008 | -- | -- | |
| M | KM199665 | 0.062 | -- | -- | ||
| N | KM199666 | 0.012 | -- | -- | ||
Sequences obtained in an earlier study of Pecos River cyprinids are indicated by **, these were not detected in the present study but reflect a divergent lineage.
Includes Pecos and Delaware River samples.
Table 3.
Cytochrome-b Genbank accession numbers. Phylogenetic sub-clades corresponding to Fig. 3 and Fig. 4- are also given.
| Cytochrome b Haplotype | Genbank Accession | Pecos | Canadian | Rio Grande | ||
|---|---|---|---|---|---|---|
| PERIPHERAL | Red River | E | KM082996 | × | -- | -- |
| K | KM083001 | × | -- | -- | ||
| I | KM083000 | ×* | × | -- | ||
| G | KM082998 | -- | × | -- | ||
| H | KM082999 | -- | × | -- | ||
| T | KM083008 | × | -- | -- | ||
|
| ||||||
| Brazos River | D | KM082994 | × | -- | -- | |
| DD | KM082995 | × | -- | -- | ||
| DDD | KP769968 | × | -- | -- | ||
|
| ||||||
| Mississippi River | A | KM082991 | -- | -- | × | |
| B | KM082992 | -- | -- | × | ||
| C | KM082993 | -- | × | -- | ||
| CB2 | KP769970 | -- | × | -- | ||
|
| ||||||
| CENTRAL | Colorado River | CBL | KP769965 | × | -- | -- |
| CBM | KP769966 | × | -- | -- | ||
| CBN | KP769967 | × | -- | -- | ||
|
| ||||||
| Chihuahuan Desert | BB | KP769974 | -- | -- | × | |
| M | KM083002 | -- | -- | × | ||
|
| ||||||
| Capitan basins | CBQ | KM083006 | × | -- | -- | |
| CB1 | KP769969 | × | -- | -- | ||
| CB3 | KP769971 | × | -- | -- | ||
| CB4 | KP769972 | × | -- | -- | ||
| CB5 | KP769973 | × | -- | -- | ||
Asterisks indicate probable contemporary transfer of haplotypes. ×-- indicates presence of haplotype in the Pecos River, Canadian River or Rio Grande.
Molecular data analyses
Nucleotide sequences were aligned using Sequencher Version 4.9 (Genecodes). The most appropriate model of nucleotide substitution was selected using jModeltest2 (Darriba et al., 2012) for both cytochrome b and ND4. Median-joining networks were constructed for ND4 haplotypes with Network Ver. 4.5.1.6 (Bandelt, Forster & Röhl, 1999). Relationships among cytochrome b haplotypes are shown in the phylogenetic tree (see below).
Phylogenetic update for the “Cyprinella lutrensis” clade (cytochrome b)
To revise the gene tree of the C. lutrensis clade, our cytochrome b sequences and those reported in Broughton et al. (2011) (Broughton pers. comm.) were aligned with Genbank Popset (number: 283147685, Schönhuth & Mayden, 2010). Phylogenetic trees were estimated using MrBayes (Huelsenbeck & Ronquist, 2001) and the GTR+G model of nucleotide substitution (six general time-reversible substitution rates, assuming gamma rate heterogeneity). The analysis was run for 1 × 107 generations; sampling the Markov chain every 100 generations resulting in 100,000 trees of which 10,000 were discarded as burn-in. Support for nodes was determined by posterior probabilities obtained from the majority-rule consensus tree. Three runs were conducted with different starting trees to ensure consistency. We included representative Cyprinella species from the most closely related clades (I, II, III) identified by Schönhuth and Mayden (2010) and rooted with the C. analostana. We interpreted the evolutionary history of the C. lutrensis clade with the updated phylogeny and a review of relevant geological and biogeographical evidence.
Tests of Population Expansion- (ND4 and cytochrome b)
To examine mitochondrial sequences for signals of recent demographic expansion or bottlenecks, we used DnaSP (Librado & Rozas, 2009) to calculate Tajima’s D (Tajima, 1989), Fu’s Fs (Fu, 1997), and R2 (Ramos-Onsins & Rozas, 2002). These statistics employ different aspects (including mutation frequency and haplotype distribution) of the data and vary in their power to detect departures from a constant population size. Significantly negative Tajima’s D and Fu’s Fs are indicative of recent population expansion (or purifying selection) as are small values of R2. Positive values of Tajima’s D and Fu’s Fs suggest population bottlenecks (or a selective sweep). For small sample size and low number of segregating site the R2 statistic is the most powerful for detecting population growth (Ramos-Onsins & Rozas 2002). Statistical significance was assessed by creating a test distribution with 10,000 coalescent simulations. We conducted these analyses using cytochrome b and ND4 haplotypes for all clade and subclades with at least four haplotypes, including the Central and Peripheral groups and the Capitan basins, Mississippi, and Red River sub-clades.
Divergence time estimates (cytochrome b)
Divergence-time estimates among lineages identified herein were estimated from cytochrome b sequences using the program BEAST 2.1.2 (Bouckaert et al., 2014). Dates derived from fossil data are best used to calibrate an external node to estimate time of divergence for a split of interest, but Cyprinella has no known sister taxa within the fossil record. Spencer, Smith & Dowling (2008) estimated ages of drainage isolation events based on fish cytochrome b distances between allopatric sister lineages, calibrated with Miocene and Pliocene fossil ages (Smith et al., 2002). Using this methodology an average substitution rate for western minnows of 1.1% per million years (myr) (equivalent to 0.55 per my single lineage clock rate) was estimated by Spencer et al. (2008). However, dates of divergence among the major clades identified here (Central and Peripheral) would predate the origin of genus Cyprinella (estimated at ~24 mya by Hollingsworth et al., 2013) if this clock rate is used. Moreover, Estabrook, Smith & Dowling (2007) suggested that this rate based on fossils of large, northern cyprinid fish underestimated evolutionary rates in small-bodied and southern fishes. A higher level of divergence in small-bodied fishes (located in warmer climates) is supported by the observation that variability in rates of sequence change occurs as a function of metabolic rate, which is affected by temperature and body size (Martin & Palumbi, 1993; Gillooly et al., 2005). Recently, Hollingsworth et al. (2013) used cytochrome b sequences and fossil data to calibrate the molecular clock and obtain divergence dates for members of the open posterior myodome cyprinids, including Cyprinella. Using dates of Hollingsworth et al. (2013, available in TreeBase) and percent sequence divergence among species, a per lineage clock rate of 1% per myr was obtained for members of Cyprinella. We employed this rate using an uncorrelated lognormal relaxed clock to account for rate variation across nodes (Ho & Phillips 2009) and the Yule tree prior. We used the RBS (reversible base-jump model) Beast add-on; which automatically adjusts the analysis to select the best substitution model for a number of specified partitions (Bouckaert, Alvarado-Mora & Pinho, 2013). We conducted three independent runs using 50 million generations for each, sampling every 5000 generations. Tracer v.1.6 (http://Beast.bio.ed.ac.uk/Tracer) was used to check for convergence of model parameter estimates. Log and tree files from multiple runs were combined using LogCombiner v.2.1.2 (http://Beast.bio.ed.ac.uk/LogCombiner) with the first 10% of trees discarded as burnin. Trees were annotated using TreeAnnotator v. 2.1.2 and mean heights and 95% highest posterior density of divergence times were visualized on the chronogram with Figtree v.1.4 (http://Beast.bio.ed.ac.uk/FigTree). Divergence-time estimates were presented as a framework for understanding patterns divergence among lineages but should be viewed with the appropriate level of caution as they are derived from a single gene tree which may overestimate the age of lineage divergence.
NucDNA diversity and tests of cytonuclear disequilibrium
We used PHASE (as implemented in DnaSP v5, Librado & Rozas, 2009) to determine RAG-1 alleles from heterozygous individuals. A median-joining network was constructed for RAG-1 alleles with Network Ver. 4.5.1.6 (Bandelt et al., 1999) to assess whether there was concordance with the mtDNA network. Nonrandom association of alleles at nuclear loci with mitochondrial haplotypes is referred to as cytonuclear disequilibrium (Asmussen, Arnold & Avise, 1987; Schnabel & Asmussen 1989) and is equivalent to linkage disequilibrium between nuclear loci. Cytonuclear disequilibrim can be influenced by a variety of factors including migration between genetically distinct sources, hybridization (e.g. Asmussen, Arnold & Avise, 1989), selection (e.g. Cruzan & Arnold, 1993), and drift (Fu & Arnold, 1992). To test for cytonuclear disequilibrium, we examined 41 individuals sampled from the Pecos River. Individuals were selected to represent the two most divergent mtDNA lineages (n = 21 Central lineage, n = 20 Peripheral lineage) and these were cross-tabulated with genotype frequencies at RAG-1 after binning alleles into groups to improve statistical robustness (i.e., to reduce the number of cells with zero values in the contingency table). The binning procedure grouped alleles that differed by no more than two mutational steps. Thus, from a total of twelve RAG-1 alleles observed in the Pecos River (A through L, Fig S1), we obtained five allelic groups: A = 1; B, C, D, E = 2; F = 3; G, H, I, J, K = 4; and L = 5. This resulted in a two row (mtDNA lineage) by 15 column (RAG-1 genotype) contingency table. We then followed the approach of Basten and Asmussen (1997), using the program CNDm (http://statgen.ncsu.edu/cnd/CNDm.php) to estimate a standardized estimate an allelic D′ between RAG-1 allelic groups and mtDNA lineages. In CNDm we employed Fisher’s exact test for significant deviations from the null hypothesis of no allelic association (Basten & Asmussen, 1997).
Morphological diversity in the Pecos River
We used geometric-morphometric analysis, meristic characters, and morphometric measurements on samples from the Pecos River to test whether morphological variation was concordant with molecular results. Two-dimensional images of each fish from each major group (i.e. Central and Peripheral, n = 19 each) were taken for geometric-morphometric analysis using tps software (life.bio.sunysb.edu/morph). Photos were randomized prior to digitization to reduce bias associated with digitization order. Sixteen homologous landmarks were set based on easily-identified features (i.e. fin origin, snout tip, center of the eye, etc.). Generalized Procrustes Analysis (GPA) was performed to remove variation in landmark configurations due to differences in size, position, and orientation in tpsRelw (Rohlf & Slice 1990). Shape variables consisting of relative warps and uniform components (i.e. weight matrix) and centroid size (i.e. fish size; the square root of the summed squared distances of each landmark from the centroid) were calculated and retained for statistical analyses.
We tested for shape differences between the Central and Peripheral groups using multivariate analysis of covariance (MANCOVA) implemented in R (R Development Core Team, 2008). Because we had more shape variables (n = 28) than individuals per group, we first reduced dimensionality of the shape data using the covariance matrix from a principal components analysis (PCA). Only axes with eigenvalues >1.0 were retained for interpretation. Nine PCA axes (explaining 91% of the variance) were entered as dependent variables in a MANCOVA model with centroid size as a covariate to control for effects of allometry and lineage set as a fixed factor to test for morphological differences between mitochondrial lineages. We tested for heterogeneity of slopes with the group × centroid interaction, but it was not significant and was thus removed from the final model. To visualize shape variation between groups, we conducted another PCA on size-corrected shape variables (i.e. residuals of a preparatory MANCOVA with the nine PC axes as dependent variables and centroid size as a covariate) and visualized variation between the groups on the first two PC axes.
Meristic characters and morphological measures were collected from the same individuals used for geometric-morphometric analysis. Counts and measurements were made on formalin-fixed specimens (Museum of Southwestern Biology Catalog Numbers 95697-95705) following Hubbs and Lagler (1964). Eleven morphometric characters were used: SL, body depth, caudal peduncle depth, caudal peduncle length, pre-dorsal length, head length, eye width, snout length, and pelvic and pectoral fin length. Morphometric characters were measured to the nearest 0.01 mm using digital-slide calipers. Meristic measures included counts of dorsal-fin rays, anal-fin rays, pelvic-fin rays, pectoral-fin rays, lateral-line scales, scales above lateral line, and scales below lateral line.
We used MANCOVA of log10-transformed morphometric and standard-length variables to test for differences in morphometric and meristic variation between lineages. After transformation, we reduced the dimensionality of the data by PCA (using correlation a matrix) and retained four axes explaining 100% of the variance. The MANCOVA model included the four PCA axes as dependent variables, SL as a covariate, and lineage as a fixed factor. The lineage × SL term was not significant and removed from the final model. We then visualized morphometric and meristic variation between lineages by assessing variation along the first two PCA axes from a PCA on the size-corrected morphometric and meristic variables (as described above).
RESULTS
MtDNA (ND4) haplotype diversity
Twenty-eight haplotypes were identified from 308 ND4 sequences obtained. A median-joining haplotype network indicated two major groups with mean sequence divergence of 20% (GTR+G) (Fig. 3A). We refer to these groups as “Central” and “Peripheral” based on comparative geographical distributions determined by cytochrome b relationships (Fig. 1). The Peripheral group is ancient (late Tertiary, Fig. 3B) and its distribution (as presently known) includes disjunct representatives north, south, east, and west of areas inhabited by the Central group. Peripheral group haplotypes mainly persist in drainages that were isolated from, or peripheral to, streams of the Rio Grande basin and Edwards Plateau in the Pleistocene including Brazos, Red and Mississippi Rivers.
Figure 3.
(A) Median-joining haplotype network based on ND4 sequence data. Accession numbers for ND4 haplotypes obtained here are given in Table 2. Circle size is proportional to haplotype frequencies. Distinct ND4 haplotypes are indicated by letters. Shading distinguishes distinct drainages: Pecos River in black, Rio Grande in gray and Canadian in white. Numeric values adjacent to branches indicate the number of base changes between haplotypes (single base changes are not accompanied by a number). (B) Chronogram from Beast analysis based on cytochrome b shows estimated time (mya) to most recent common ancestor. 95% HPD (highest posterior density) intervals are below these values, letters within triangles refer to cytochrome b haplotypes (MISSISSI—Mississippi subclade).
ND4 haplotypes of the Peripheral lineage occurred at low frequencies in the Pecos River, being more prevalent in the South Canadian River (Table 2). Three Peripheral sub-clades were designated in our samples: (i) Red River (haplotypes U-CC) (cytochrome b haplotypes E,G-K, T) (Table 3), found in the Pecos and South Canadian rivers, (ii) Brazos River (haplotypes P1-P3, cytochrome b haplotypes D, DD, DDD) found in Pecos River, and (iii) Mississippi River (haplotypes P-S, cytochrome b haplotypes A-C, CB2), found in the Middle Rio Grande and South Canadian Rivers. Sub-clade names are explained below.
Divergence within the Central group is more recent (Pleistocene, Fig. 3B, see below) and representatives only occur in basins accessible from the Rio Grande or Edwards Plateau in the Pleistocene. Three sub-clades were identified within the Central group based on ND4 sequences and are consistent with cytochrome b data. Listed in order of haplotype number (Fig. 3A) and frequency (Table 2) within the Pecos River, we designated them: (i) Capitan basins sub-clade (haplotypes A-I) found in samples from the Pecos River basin, including the Delaware River (cytochrome b haplotypes CB1, CB3-CB5, Q), (ii) Colorado River sub-clade (haplotypes L-N) found in the Pecos River (cytochrome b haplotypes CBL, CBM, CBN) and (iii) Chihuahuan Desert sub-clade (haplotypes J and K) found in the Rio Grande (cytochrome b haplotypes M and BB).
Phylogenetic update for the “Cyprinella lutrensis” clade (cytochrome b)
We identified 23 haplotypes from 962 base pairs of cytochrome b obtained from the same 28 individuals used in the analysis of ND4. These differed by 15.5% (GTR+G). All haplotypes grouped within the C. lutrensis clade of Schönhuth and Mayden (2010), but were distributed broadly therein and expanded the clade (Fig. 4).
Figure 4.
Bayesian tree from mtDNA cytochrome b sequences from C. lutrensis from the Rio Grande, Pecos River, and Canadian River and from the previously published sequences from Schönhuth and Mayden (2010) and those reported in Broughton (2011) (Broughton pers. comm.). Posterior probabilities are reported by nodes when greater than 0.70. Asterisks indicate sequences obtained in this study. Genbank accession numbers are also provided.
Cytochrome b sequences revealed that branches of the Peripheral group represented divergent basal clades. Within the Peripheral group, a Red River sub-clade was well supported (posterior probability = 1.0) (Fig. 4). Here, representatives of the Red River sub-clade were present in the Pecos and South Canadian rivers and in the Wichita River, a Red River tributary. Broughton et al. (2011) found these haplotypes widespread in the Red River basin. Members of the Red River sub-clade have not been previously included in a whole-clade phylogeny, so these results also expand the C. lutrensis clade. A Brazos River sub-clade of the Peripheral group was also well supported (posterior probability = 1.0) in the branch immediately above those of Frio River C. lepida, C. forlonensis, and the C. bocagrande-C. formosa clade. The Brazos sub-clade haplotypes occurred in the Brazos and Pecos Rivers, and Middle Rio Grande (Fig. 4).
The next higher branch on the cytochrome b tree was a Mississippi River sub-clade (Fig. 4). Being most inclusive, it included samples of Broughton et al. (2011) from the North Canadian River, with relatively low branch support (62% posterior probability). With these excluded, samples from the Middle Rio Grande, Pecos River, and throughout the Mississippi River basin formed a well-supported branch (posterior probability = 98%); concordant with the phylogenies of Schönhuth and Mayden (2010) and Broughton et al. (2011).
The Central group (Fig. 3) corresponded to the crown of the cytochrome b tree (Fig. 4), as in Broughton et al. (2011) and Schönhuth and Mayden (2010). The haplotypes identified here included three well-supported branches that formed an unresolved polytomy (Fig. 4). First, the Chihuahuan Desert sub-clade with haplotypes from the Middle Rio Grande, Río Conchos and adjacent Rio Grande, and from tributaries to the lower Rio Grande. Second, the Capitan basins sub-clade is an expansion of a singleton branch presented in Schönhuth and Mayden (2010). So far, it is only known from the Pecos River (Figs. 3 and 4). Third, the Colorado River sub-clade comprised haplotypes from the Pecos and Colorado rivers (Fig. 4). Haplotypes on this branch were found in both locations sampled in the upper Colorado River basin by Broughton et al. (2011).
Tests of Constant Population Size
Fu’s FS and R2 statistics were significantly negative for cytochrome b and ND4, suggesting recent population expansion for the Capitan basin subclade (Table 4). In contrast, there was no evidence of departures from constant population sizes in the Peripheral subclades.
Table 4.
Test statistics (Tajima’s D, Fu’s Fs and R2) and associated p-values for all cytochrome b (Cyt-b) and ND4 haplotypes, for Central and Peripheral haplotypes and for the Capitan, Mississippi and Red sub-clades. Grey shading indicates significant departures from a constant population size; that is consistent with recent population expansion/growth.
| Gene | All | Central | Peripheral | Capitan | Mississippi | Red | |
|---|---|---|---|---|---|---|---|
| Tajima’s | |||||||
| D | Cyt-b | 1.354 | 0.462 | 1.483 | −1.295 | 1.254 | −0.794 |
| P | 0.95 | 0.72 | 0.959 | 0.061 | 0.91 | 0.269 | |
| Tajima’s | |||||||
| D | ND4 | 1.746 | −0.546 | 1.335 | −1.284 | 0.18 | −0.414 |
| P | 0.976 | 0.322 | 0.943 | 0.126 | 0.71 | 0.371 | |
| Fu’s Fs | Cyt-b | 1.189 | −0.512 | 1.684 | −3.047 | 2.747 | −1.157 |
| P | 0.71 | 0.32 | 0.753 | 0.003 | 0.897 | 0.144 | |
| Fu’s Fs | ND4 | −4.867 | −6.422 | −0.817 | −5.694 | −1.082 | −1.754 |
| P | 0.049 | 0.002 | 0.289 | 0.0003 | 0.097 | 0.088 | |
| R2 | Cyt-b | 0.201 | 0.177 | 0.213 | 0.11 | 0.256 | 0.188 |
| P | 0.996 | 0.759 | 0.989 | 0.003 | 0.677 | 0.379 | |
| R2 | ND4 | 0.198 | 0.112 | 0.206 | 0.097 | 0.232 | 0.144 |
| P | 0.993 | 0.147 | 0.972 | 0.001 | 0.258 | 0.084 |
Divergence time estimates (cytochrome b)
Central and Peripheral groups were estimated to have diverged in the Miocene (15.99 to 7.63 mya) (Fig. 3B). Within the Peripheral group, the Red River sub-clade diverged from the Brazos and Mississippi river sub-clades between the Middle Miocene and Pliocene (14.15 to 6.69 mya), whilst the Brazos and Mississippi river sub-clades diverged in the Late Miocene to Pliocene (9.74 to 4.34 mya) (Fig. 3B). Central-group sub-clades diverged in the Pleistocene: the Colorado sub-clade diverged from the Chihuahuan and Capitan basins sub-clades 2.22 to 1.32 mya (Fig. 3B).
NucDNA diversity and tests of cytonuclear disequilibrium
Eighteen RAG-1 alleles were identified for individuals used for detailed morphometric and meristic comparisons between the Central and Peripheral groups (Table 1). Seven of these were shared between mtDNA groups (Figure S1) and were randomly distributed in the RAG-1 network with respect to mtDNA lineage (Figure S1). In contrast, four were restricted to the Central group and seven to the Peripheral group. Fisher’s exact tests as employed in CNDm revealed scant evidence of cytonuclear disequilibrium. Only group 4 genotypes (RAG-1 allele K is the most frequent) showed marginal association with mtDNA lineage (nominal P = 0.048, Bonferroni-adjusted alpha = 0.003). Otherwise, P-values were greater than 0.18. This supports the hypothesis of random mating amongst divergent mtDNA lineages in the Pecos River.
Morphological diversity in the Pecos River
Multivariate Analysis of Covariance (MANCOVA) of geometric-morphometric data revealed substantial overlap of body-shape dimensions with no significant difference between Central and Peripheral groups (F9,27=1.06, P = 0.42 ). Visual inspection of the first two PCA axis scores of the shape variables demonstrated broad overlap (Fig. 5A). Likewise, MANCOVA results of morphometric measures and meristic characters indicated no difference between groups as (F4,32 0.44, P=0.78) with the first two PCA scores explaining 67% of total variation (Fig. 5B).
Figure 5.
Principal components analysis of (A) geometric weight-matrix and (B) combined morphometric and meristic data. The Peripheral group is represented in black squares and the Central group is represented by gray triangles. Percent of variation explained is given within each axis title.
Discussion
Phylogenetic expansion of the “C. lutrensis” clade
This study adds to abundant evidence that “C. lutrensis” is a complex taxon with a long evolutionary history throughout a broad, geologically dynamic region (Matthews, 1995; Richardson & Gold, 1995). As concluded by Schönhuth and Mayden (2010), precise delimitation of clades within C. lutrensis requires comprehensive study. Inclusion of our samples and those of Broughton et al. (2011) in a cytochrome b phylogeny expanded the C. lutrensis clade of Schönhuth and Mayden (2010), adding the well-supported basal Red River sub-clade to their phylogeny along with another well-supported crown lineage (Colorado River sub-clade). In addition, two “singleton” branches reported by Schönhuth and Mayden (2010) were supported as distinct lineages and the known geographical distribution of each was expanded. Further, the geographic distribution of the C. suavis and C. sp.1 cf. lutrensis branches is greater than reported by Schönhuth and Mayden (2010), with geographical overlap between them. Importantly, our most thoroughly sampled area, the Capitan basins, produced the most haplotypes. Hence, more sampling elsewhere (including all portions of the Rio Grande, Brazos and Red River basins, and drainages of the Edwards Plateau) is required to accurately delimit lineage distributions and phylogenetic relationships and to identify cryptic diversity. Thus, the hypotheses presented below are provisional, for the purposes of directing future research. Putative geographic lineages identified thus far may eventually be found to be more broadly distributed and additional lineages likely remain undetected.
Pre-historic biogeography (river-basin evolution)
Deep divergence between the Central and Peripheral groups and among sub-clades of the Peripheral group indicates range fragmentation in the Late Miocene and Pliocene. Divergence-time estimates produced by Hollingsworth et al. (2013, available in TreeBase) indicate the C. lutrensis clade diverged from other Cyprinella roughly 16 mya (Early-Middle Miocene). Divergence from the C. spiloptera-C. venusta clade at this time may reflect an east-west split caused by separation of the ancestral Mississippi River basin from the ancestral Tennessee River basin (sensu Galloway et al., 2011; Hoagstrom et al., 2014).
The progenitor of the C. lutrensis clade must have been widespread in the western Gulf of Mexico basin during the Middle-Late Miocene in order to found populations that became C. forlonensis (Río Pánuco, Mexico), the C. bocagrande-C. formosa clade (Cabeza de Vaca Basin, Mexico), and C. lepida (Frio River, Texas) along with the Central and Peripheral groups of C. lutrensis (Fig. 1). The basal position of the Red River sub-clade indicates it is the oldest known extant lineage of the clade (i.e. older than recognized species). Presumably, this lineage diverged while isolated in the ancient Red River basin, which arose in the Early Miocene (Galloway et al., 2011). The fact that these lineages presently demonstrate random mating where sympatric suggests divergence must have occurred in allopatry.
The lineage that gave rise to all other (i.e. non-Red River) sub-clades likely occupied the Miocene Guadalupe River, Rio Bravo, and Rio Grande basins of Galloway et al. (2011). These basins were dynamic and interconnected. Tectonic activity and increasing aridity eventually isolated peripheral populations that gave rise to C. forlonensis, C. bocagrande-C. formosa, and C. lepida (sensu Hoagstrom et al., 2014). Isolation of the Brazos River sub-clade apparently occurred during the Mio-Pliocene transition as the Brazos River formed on the Edwards Plateau’s northern flank. This pattern of basal lineages persisting in peripheral drainages was originally noted by Contreras-Balderas (1977). In this case, the late Miocene to early Pliocene divergence estimate between the Mississippi and Brazos river lineages generally agrees with estimated Late Miocene divergence between C. lepida and C. bocagrande-C. formosa (Hollingsworth et al., 2013) and estimated Pliocene divergence between Brazos and Trinity river C. lutrensis (Richardson & Gold, 1995).
Increasing aridity through the Late Miocene (Chapin, 2008) and eastward expansion of Great Plains Ogallala apron (Seni, 1980; Galloway et al., 2011) filled river valleys and buried the eroded landscape (Harrell 1993; Cather, Chapin & Kelley, 2012). Rivers traversing the Great Plains were sediment laden and perched upon porous alluvium (Menzer & Slaughter, 1971; Seni, 1980; Gustavson & Finley, 1985). High rates of infiltration presumably combined with aridity to reduce or eliminate freshwater habitats. If so, then the marginalization of river valleys around the periphery of the Great Plains surface (Galloway et al., 2011) could have corresponded with depopulation of ancestral C. lutrensis from the High Plains, explaining the lack of evidence for pre-Pleistocene lineages (Fig. 2A). Late Tertiary and early Pleistocene volcanism in the region (Galloway et al., 2011; Nereson et al., 2013) may have reduced habitat suitability if (for instance) it produced frequent ash deposition.
The sister relation of the Mississippi River sub-clade and Central group suggests the common ancestor was subdivided within the Gulf Coastal Plain. The Mississippi River sub-clade persisted to the east and eventually invaded the Mississippi River basin. Accordingly, Richardson and Gold (1995) found that some C. lutrensis in the Trinity and Calcasieu rivers were close relatives of northern individuals. The Mississippi Embayment and adjacent Gulf Coast was likely a climatic refugium (Richardson & Gold, 1995). Similarly, the ancestor of the Central group apparently survived the Late Miocene and Pliocene in the Rio Grande Embayment and Burgos Basin region (Fig. 2A), which was a climatic refugium for vascular plants (Sorrie & Weakley, 2001) and Neotropical hymenopterans (Porter, 1977, 1981).
Short branch lengths within the Central group are consistent with inferences of recent population (and hence possible population/range) expansion of the Central-group ancestor in the Pleistocene. The basal sub-clade of the Central group has been called C. suavis (Schönhuth & Mayden, 2010), but we refer to it only as the Rio Grande-Burgos Basin (RGB) sub-clade because this branch had poorer support and a broader distribution compared to previous studies. More sampling is needed to determine the distribution and phylogeny of these haplotypes.
Assimilation of isolated Pliocene river basins to form the modern Rio Grande (Galloway et al., 2011; Hoagstrom et al., 2014) opened new dispersal corridors to Central-group C. lutrensis (Fig. 2B). The Middle Rio Grande, within the Rio Grande Rift, overflowed the Hueco Bolson approximately 2.25 mya (Gustavson, 1991). Overflow of the Río Conchos into the Rio Grande likely occurred in this period (King & Adkins, 1946; Hawley, 1969) and river valleys were filled with alluvium and canyons were shallow (Hawley, 1969; Veni, 1994; Mack et al., 2006). These conditions may have favored range expansion of Central-group C. lutrensis, given that all C. lutrensis favor aggraded, plains-like environments with turbid streams (Matthews, 1995). Inclusion of Nueces River C. lepida in the Central group indicates that ancestral Central-group C. lutrensis were the ones that interbred with resident C. lepida, causing mitochondrial introgression (Broughton et al., 2011; Carson et al., 2014). To the east, the Mississippi River sub-clade also expanded its distribution (Richardson & Gold, 1995; Osborne et al., 2014).
Central-group C. lutrensis apparently invaded the Parras Basin and founded a disjunct population giving rise to C. garmani. Both nucDNA (Schönhuth & Mayden, 2010) and mtDNA (Schönhuth & Mayden, 2010; this study) nested C. garmani within the Central Group of C. lutrensis. Arellano (1951) provided evidence that pluvial lakes of the Parras Basin flowed toward the Rio Grande via the Río Salado (a Rio Grande tributary) in the Pleistocene (see also Contreras-Balderas, 1977). This connection was likely severed due to tectonic activity and increasing aridity. Distributions of several aquatic reptiles (Conant 1963), a mesic-adapted lizard (Montanucci, 1974), and pupfishes (Echelle et al., 2005) support pre-historic existence of this fluvial corridor. Alternatively, it is possible ancestral C. garmani reached the Parras Basin via exchanges with the Río Conchos and Río Mezquital (Minckley et al., 2005), but in this scenario C. garmani would be expected to be sister with the Chihuahuan Desert sub-clade, which it is not. Hence, we favor the former hypothesis.
Canyon formation could account for divergence of Chihuahuan Desert C. lutrensis from Capitan basins-Colorado River C. lutrensis ~1.98 mya. Pluvial climates and glacial runoff accelerated valley incision throughout the basin and narrowed the Rio Grande corridor (Hawley, 1969; Kastning, 1983; Veni, 1994; Mack et al., 2006). As streamflow increased and canyon incision progressed, canyon reaches likely became less suitable for C. lutrensis perhaps restricting gene flow (Fig. 2C). Although characteristic of low-gradient streams, C. lutrensis is relatively rare in larger rivers (Quist, Hubert & Rahel, 2004; Hoagstrom et al., 2006a, 2006b). Sustained high flows suppress C. lutrensis populations (Gido & Propst, 2012) and floods in steep-walled canyons incised into bedrock displace them (Minckley & Mefee, 1987). Populations become fragmented where unsuitable habitats are interspersed amidst suitable ones (e.g. Lynch & Roh, 1996). The Capitan basins sub-clade was possibly isolated upstream of the lower Pecos River canyon in a similar fashion.
The unresolved relation between the Capitan basins and Colorado River (Texas) sub-clades presents two possible scenarios for their divergence. In one scenario, Central group C. lutrensis may have colonized the ancestral Colorado River from the Capitan basins via the Simanola Valley, during the period when the Pecos River captured Arroyo del Macho from the Colorado River basin (sensu Gustavson & Finley, 1985; Fig. 2B). In this case, formation of the Caprock Escarpment and Llano Estacado (Figs. 2B and C) created separation. In the alternative scenario, Central group C. lutrensis may have independently colonized the proto Colorado River through east-flowing rivers of the Edwards Plateau that paralleled the Balcones Escarpment (sensu Woodruff & Abbott, 1986). These rivers were later fragmented by stream captures across the escarpment (Woodruff & Abbott, 1986), isolating the Colorado River population. These alternatives need not be mutually exclusive and it is possible progenitors of the Capitan basins sub-clade reached the Pecos River via the Simanola Valley (Fig. 2B). Regardless, both sub-clades were isolated in the Pleistocene (Fig. 2C).
Fish faunas of the Capitan basins, Edwards Plateau, Rio Grande, and Río Conchos have clear affinities that demonstrate close biogeographical relations consistent with their inclusion within the Central group. The genus Dionda (Schönhuth et al., 2012), Gambusia nobilis species group (Rauchenberger, 1989), and Etheostoma subgenus Austroperca (Near et al., 2011), exhibit largely overlapping distributions with the Central group of C. lutrensis and each is represented by geographically divergent taxa. This suggests similar patterns of range expansion and fragmentation have affected each clade. The distribution of Clade III of Cyprinella (a lineage basal to the C. lutrensis clade) is also largely nested within the range of Central group C. lutrensis (Schönhuth & Mayden, 2010), suggesting the process of river drainage expansion and fragmentation, which has occurred repeatedly over time (Galloway et al., 2011), has facilitated sequential bouts of allopatric speciation.
Recent biogeography (human-mediated translocation)
It is well established that humans have broadly distributed C. lutrensis outside its native range (e.g. Hubbs, 1954; Poulos, et al., 2012). Until recently, there has been limited interest in translocations within the native range, but Husemann et al. (2012) found multiple highly divergent haplotypes coexisting in the Trinity and Brazos River basins and attributed this pattern to anthropogenic translocations. Our study documents similar conditions in the Pecos, Rio Grande, and South Canadian basins and provides insight into the sources of translocated haplotypes.
Red River (ND4 and cytochrome b) haplotypes shared between the South Canadian and Pecos rivers suggest representatives of these sub-clades were recently transferred to the Pecos River. We infer transfer direction because it mirrors introductions of other fishes (Moyer et al., 2005; Osborne et al., 2013). Further, if the Pecos River was the source of haplotypes shared with the South Canadian and Red rivers, then the more common Capitan basins haplotypes would be expected in samples from those rivers (i.e. 73% of Pecos River individuals had Capitan basins haplotypes). But, Red river haplotypes were prevalent in samples from the South Canadian River (65% and 35% respectively) while Capitan basins haplotypes were absent. Red River sub-clade haplotypes in the South Canadian River could also reflect recent translocations as Notropis bairdi (Red River shiner) and Cyprinodon rubrufluviatilis (Red River Pupfish) have both been introduced there (Ashbaugh, Echelle & Echelle, 1994; Luttrell et al., 1995; Pigg, Gibbs & Luttrell, 1995). In contrast, non-native invaders are relatively rare in the Red River basin (Gido, Schaefer & Pigg, 2004) and Capitan basins haplotypes of C. lutrensis have yet to be found there (Broughton et al., 2011).
The presence of Brazos and Colorado River (ND4 and cytochrome b) sub-clade haplotypes in the Pecos River is also likely the results of human mediated translocations, as biogeographic evidence does not support a link between them (e.g. distinct ichthyofaunas found in the Brazos and Pecos Rivers). Sequence divergence (cytochrome b) between the Brazos clade haplotypes found in the Pecos and the natal Brazos haplotype is 0.3%–1.1% (p-distance) however only a single Brazos individual was included. One haplotype was identical between the Colorado and the Pecos (CBL, Delaware River) consistent with recent translocation and two others were slightly divergent. We cannot therefore exclude the possibility that further sampling in the Brazos and Colorado will reveal other shared haplotypes between these systems and the Pecos, supporting recent human-aided translocation. It is worth noting that other fishes from the Colorado River basin (Texas) have been inadvertently distributed throughout New Mexico (Mueller & Brooks, 2004; Davenport & Remshardt, 2008).
The presence of Mississippi River (ND4 and cytochrome b) and Brazos (cytochrome b) sub-clade haplotypes in the Middle Rio Grande is highly likely a result of recent translocation as there is no known “natural” connection between these basins and the Rio Grande Rift since the Early Miocene (Galloway et al., 2011), so shared and similar haplotypes with individuals from the South Canadian River suggests recent translocation. Consistent with these conclusions, molecular study of non-native White Sucker (Catostomus commersonii) also indicated multiple introductions to the Middle Rio Grande from multiple sources including the Pecos River (McPhee & Turner, 2009).
Evolutionary and biogeographic implications
“Cyprinella lutrensis” is a complex lineage owing to: (i) a late Tertiary expansion-fragmentation sequence that founded peripheral southwestern populations, giving rise to divergent species and cryptic lineages (Hoagstrom et al., 2014; this study), (ii) later Pleistocene expansions that led to independent colonization of areas integrated into the Rio Grande basin (Central group, this study), (iii) secondary contact between some late Tertiary isolates and Pleistocene invaders (Broughton et al., 2011), (iv) fragmentation of Central group populations in the Pleistocene (this study), and (v) most recently human mediated translocations. Persistence of deeply divergent but morphologically similar “C. lutrensis” lineages contrasts with isolated clades that are phenotypically distinct (e.g. C. bocagrande; C. forlonensis; C. formosa; C. garmani; C. lepida), especially given that the C. lutrensis-like Red River sub-clade is basal to all of these recognized species. While molecular and morphological distinctiveness apparently justify recognition of divergent peripheral species (Schönhuth, Doadrio & Mayden, 2006), this perspective confounds the taxonomic status of undifferentiated Peripheral lineages with similar antiquity. Thus, if recognized species of the C. lutrensis clade are valid, then “C. lutrensis” is polyphyletic without recognizable phenotypic differentiation or apparent reproductive barriers. In other words, allopatric speciation has not occurred in these lineages despite ample opportunity.
To determine the taxonomic status of undifferentiated Peripheral lineages, it will be critical to understand how they differ. It may be worthwhile to conduct more extensive comparisons of morphology (Berendzen, Olson & Barron, 2009) and nuptial coloration (Matthews, 1995). Chihuahuan Desert and Capitan basins sub-clades remain numerically dominant in their putative native ranges, which is somewhat surprising given that, in other cases, introduced congeners have rapidly displaced some sympatric native fishes (Childs, Echelle & Dowling, 1996; Moyer et al., 2005; Hoagstrom et al., 2010). Hence, it is critical to understand the nature of interbreeding amongst “C. lutrensis” lineages. Persistence of introduced mtDNA lineages suggests maternal contribution is conserved, but contrary to other studies (e.g. Garrett, 1988; Holtmeier, 2001; Ward et al., 2012) this did not increase morphological diversity within the Pecos River population.
In this context, the basal Red River sub-clade is of particular interest. Detailed comparative study of its distribution, physiology, and ecology relative to other members of the C. lutrensis clade is warranted. Declines of native populations have primarily been detected within the Red River basin (Matthews & Marsh-Matthews, 2007). Although the haplotypes of declining populations are unknown, if they were representatives of the basal Red River sub-clade, it is possible that this lineage may be more vulnerable to anthropogenic disturbance than for C. lutrensis as a whole (Poulos et al., 2012). However, it is possible declines occurring elsewhere may have gone unnoticed.
Given that C. lutrensis demonstrates potential for rapid adaptation to changing environments (King, Zimmerman, & Beitinger, 1985), the C. lutrensis clade exhibits some characteristics of a phylogenetic raceme (Williams, 1992) (phylogeny with many transient branches that die out quite quickly, sensu Bell & Foster, 1994) where centralized lineages are persistent and evolutionarily conservative, whereas remote, peripheral isolates diverge. This creates instances in which speciation does not alter the stem (i.e. parental) species (Bell, 1979). However, the longevity of isolates in the C. lutrensis clade greatly exceeds the expectations of this paradigm. Clades with prolonged histories of peripheral isolation from a stable stem are said to speciate via peripheral budding or centrifugal speciation (Hodge et al., 2012; Puckridge, Last & Andreakis, 2015). However, the C. lutrensis clade does not fit this paradigm either because multiple conservative lineages are interspersed phylogenetically with divergent peripheral isolates.
Broughton et al. (2011) suggested that potential for outbreeding may be conserved in freshwater fishes because extrinsic barriers to movement among river drainages preclude a need for intrinsic reproductive barriers during allopatric speciation. The conservative lineages of C. lutrensis have broad distributions likely to preclude genetic drift and all still inhabit ecologically similar, turbid streams of grasslands and deserts (Matthews, 1987, 1995). In contrast, divergent lineages have narrow distributions in isolated habitats with much higher potential for genetic drift (especially where climatic conditions are highly variable) and many are confined to spring-fed habitats with different ecological conditions than streams typically occupied by C. lutrensis (Miller, 2005; Carson et al., 2014). These distinct environments are associated with peripheral isolates in other genera (e.g. Gambusia, Hubbs, 2001). Thus, for C. lutrensis, geographical isolation over an extended time appears inadequate to ensure allopatric speciation. Thus, other ecological divergence (Funk, Nosil & Etges, 2006) or genetic drift may be required to initiate speciation.
Supplementary Material
Acknowledgments
Stephen Davenport and Sarah Blocker (U.S. Fish and Wildlife Service) are gratefully acknowledged for facilitating field collections. Thanks are also extended to Trevor Krabbenhoft, Nathan Franssen, Tyler Pilger, Steven Zipper, Peter Unmack and Donald Shepard for analytical advice. We thank Mike Schwemm, Evan Carson, Richard Broughton and two anonymous reviewers who provided insightful manuscript reviews. Gerald Smith and Phillip Hollingsworth provided critical advice regarding clock rates. All specimens were collected according to regulations described under IACUC protocol # 10-100492-MC. We gratefully acknowledge George Rosenberg and the UNM Molecular Biology Facility, which is supported by NIH grant number P20GM103452. Alexandra Snyder and assistants (Museum of Southwestern Biology) expertly curated specimens used in this study.
Footnotes
Data Archiving: Genbank Accession numbers are provided for sequences obtained in this study. Geometric-morphometric and meristic data are available in Supplementary Table S2. Specimens used for geometric-morphometric are deposited at the Museum of Southwestern Biology (Catalog Numbers 95697-95705).
LITERATURE CITED
- Arellano ARV. Research on the continental Neogene of Mexico. American Journal of Science. 1951;249:604–616. [Google Scholar]
- Ashbaugh NA, Echelle AA, Echelle AF. Genic diversity in Red River pupfish Cyprinodon rubrofluviatilis (Atheriniformes: Cyprinodontidae) and its implications for the conservation genetics of the species. Journal of Fish Biology. 1994;45:291–302. [Google Scholar]
- Asmussen MA, Arnold J, Avise JC. Definition and properties of disequilibrium statistics for associations between nuclear and cytoplasmic genotypes. Genetics. 1987;115:755–768. doi: 10.1093/genetics/115.4.755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Asmussen MA, Arnold J, Avise JC. The effects of assortative mating and migration on cytonuclear associations in hybrid zones. Genetics. 1989;122:923–934. doi: 10.1093/genetics/122.4.923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bagley JC, Mayden RL, Roe KJ, Holznagel W, Harris PM. Congeneric phylogeographical sampling reveals polyphyly and novel biodiversity within black basses (Centrarchidae: Micropterus) Biological Journal of Linnaean Society. 2011;104:346–363. [Google Scholar]
- Bandelt HJ, Forster P, Röhl A. Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution. 1999;16:37–48. doi: 10.1093/oxfordjournals.molbev.a026036. [DOI] [PubMed] [Google Scholar]
- Basten CJ, Asmussen MA. The exact test for cytonuclear disequilibria. Genetics. 1997;146:1165–1171. doi: 10.1093/genetics/146.3.1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bell MA. Persistence of ancestral-sister species. Systematic Zoology. 1979;28:85–88. [Google Scholar]
- Bell MA, Foster SA. Introduction to the evolutionary biology of the three-spine stickleback. In: Bell MA, Foster SA, editors. The Evolutionary Biology of the Threespine Stickleback. Oxford University Press; 1994. pp. 1–27. [Google Scholar]
- Berendzen PB, Olson WM, Barron SM. The utility of molecular hypotheses for uncovering morphological diversity in the Notropis rubellus species complex (Cypriniformes: Cyprinidae) Copeia. 2009;2009:661–673. [Google Scholar]
- Blanton RE, Page LM, Hilber SA. Timing of clade divergence and discordant estimates of genetic and morphological diversity in the slender madtom, Noturus exilis (Ictaluridae) Molecular Phylogenetics and Evolution. 2013;66:679–693. doi: 10.1016/j.ympev.2012.10.022. [DOI] [PubMed] [Google Scholar]
- Blum MD, Hattier-Womack J. Climate change, sea-level change, and fluvial sediment supply to deepwater depositional systems. SEPM Special Publications. 2009;92:15–39. [Google Scholar]
- Bolnick DI, Near TJ. Tempo of hybrid inviability in centrarchid fishes (Teleostei: Centrarchidae) Evolution. 2005;59:1754–1767. [PubMed] [Google Scholar]
- Bolnick DI, Near TJ, Wainwright PC. Body size divergence promotes post-zygotic reproductive isolation in centrarchids. Evolutionary Ecology Research. 2006;8:903–913. [Google Scholar]
- Borden WC, Krebs RA. Phylogeography and postglacial dispersal of smallmouth bass (Micropterus dolomieu) into the Great Lakes. Canadian Journal of Fisheries and Aquatic Sciences. 2009;66:2142–2156. [Google Scholar]
- Bossu CM, Near TJ. Gene trees reveal repeated instances of mitochondrial DNA introgression in orange-throat darters (Percidae: Etheostoma) Systematic Biology. 2009;58:114–129. doi: 10.1093/sysbio/syp014. [DOI] [PubMed] [Google Scholar]
- Bouckaert R, Heled J, Kühnert D, Vaughan TG, Wu C-H, Xie D, Suchard MA, Rambaut A, Drummond AJ. BEAST2: A software platform for Bayesian evolutionary analysis. PLOS Computational Biology. 2014;10 doi: 10.1371/journal.pcbi.1003537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bouckaert R, Alvarado-Mora M, Pinho JR. Evolutionary rates and hbv: issues of rate estimation with Bayesian molecular methods. Antiviral Therapy. 2013;18:497–503. doi: 10.3851/IMP2656. [DOI] [PubMed] [Google Scholar]
- Broughton RE, Vedala KC, Crowl TM, Ritterhouse LL. Current and historical hybridization with differential introgression among three species of cyprinid fishes (genus: Cyprinella) Genetica. 2011;139:699–707. doi: 10.1007/s10709-011-9578-9. [DOI] [PubMed] [Google Scholar]
- Carson EW, Hanna AH, Garrett GP, Edwards RJ, Gold JR. Conservation genetics of cyprinid fishes in the upper Nueces River basin in central Texas. Southwestern Naturalist. 2014;59:1–8. [Google Scholar]
- Cather SM, Chapin CE, Kelley SA. Diachronous episodes of Cenozoic erosion in southwestern North America and their relationship to surface uplift, paleoclimate, paleodrainage, and paleoaltimetry. Geosphere. 2012;8:1177–1206. [Google Scholar]
- Chapin CE. Interplay of oceanographic and paleoclimate events with tectonism during middle to late Miocene sedimentation across the southwestern USA. Geosphere. 2008;4:976–991. [Google Scholar]
- Childs MR, Echelle AA, Dowling TE. Development of the hybrid swarm between Pecos pupfish (Cyprinodontidae: Cyprinodon pecosensis) and sheepshead minnow (Cyprinodon variegatus): a perspective from allozymes and mtDNA. Evolution. 1996;50:2014–2022. doi: 10.1111/j.1558-5646.1996.tb03588.x. [DOI] [PubMed] [Google Scholar]
- Conant R. Semiaquatic snakes of the genus Thamnophis form the isolated drainage system of the Río Nazas and adjacent areas in Mexico. Copeia. 1963;1963:473–499. [Google Scholar]
- Contreras-Balderas S. Speciation aspects and man-made composition changes in Chihuahuan Desert fishes. National Park Service Trans Proc Ser. 1977;3:405–431. [Google Scholar]
- Coyne JA, Orr HA. “Patterns of speciation in Drosophila” revisited. Evolution. 1997;51:295–303. doi: 10.1111/j.1558-5646.1997.tb02412.x. [DOI] [PubMed] [Google Scholar]
- Cruzan MB, Arnold ML. Ecological and genetic associations in an Iris hybrid zone. Evolution. 1993;47:1432–1445. doi: 10.1111/j.1558-5646.1993.tb02165.x. [DOI] [PubMed] [Google Scholar]
- Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods. 2012;9:772–772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davenport SR, Remshardt WJ. Range extensions for Pimephales vigilax and Percina macrolepida in the Rio Grande, New Mexico. Southwestern Naturalist. 2008;53:125–128. [Google Scholar]
- DiPietro JA. Landscape Evolution in the United States. Elsevier; Amsterdam: 2013. [Google Scholar]
- Dugas MB, Franssen NR. Nuptial coloration of red shiners (Cyprinella lutrensis) is more intense in turbid habitats. Naturwissenschaften. 2011;98:247–251. doi: 10.1007/s00114-011-0765-4. [DOI] [PubMed] [Google Scholar]
- Dugas MB, Franssen NR. Red shiners (Cyprinella lutrensis) have larger eyes in turbid habitats. Canadian Journal of Zoology. 2012;90:1431–1436. [Google Scholar]
- Dynesius M, Jansson R. Persistence of within-species lineages: a neglected control of speciation rates. Evolution. 2013;68:923–934. doi: 10.1111/evo.12316. [DOI] [PubMed] [Google Scholar]
- Echelle AA, Carson EW, Echelle AF, Van Den Bussche RA, Dowling TE, Meyer A. Historical biogeography of the New-World pupfish genus Cyprinodon (Teleostei: Cyprinodontidae) Copeia. 2005;2005:320–339. [Google Scholar]
- Estabrook GF, Smith GR, Dowling TE. Body mass and temperature influence rates of mitochondrial DNA evolution in North American cyprinid fish. Evolution. 2007;61:1176–1187. doi: 10.1111/j.1558-5646.2007.00089.x. [DOI] [PubMed] [Google Scholar]
- Fu YX. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics. 1997;147:915–925. doi: 10.1093/genetics/147.2.915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fu YX, Arnold J. Dynamics of cytonuclear disequilibria in finite populations and comparison with a two-locus nuclear system. Theoretical Population Biology. 1992;41:1–25. doi: 10.1016/0040-5809(92)90047-w. [DOI] [PubMed] [Google Scholar]
- Funk DJ, Omland KE. Species-level paraphyly and polyphyly, frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology and Evolutionary Systematics. 2003;34:397–423. [Google Scholar]
- Funk DJ, Nosil P, Etges WJ. Ecological divergence exhibits consistently positive associations with reproductive isolation across disparate taxa. Proceedings of the National of Sciences. 2006;103:3209–3213. doi: 10.1073/pnas.0508653103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Galloway WE, Whiteaker TL, Ganey-Curry P. History of Cenozoic North American drainage basin evolution, sediment yield, and accumulation in the Gulf of Mexico basin. Geosphere. 2011;7:938–973. [Google Scholar]
- Garrett GP. Maternal influence on phenotypic expression in hybrids between two species of Micropterus. Southwestern Naturalist. 1988;33:405–411. [Google Scholar]
- Gido KB, Propst DL. Long-term dynamics of native and nonnative fishes in the San Juan River, New Mexico and Utah, under a partially managed flow regime. Transactions of the American Fisheries Society. 2012;141:645–659. [Google Scholar]
- Gido KB, Schaefer JF, Pigg J. Patterns of fish invasions in the Great Plains of North America. Biological Conservation. 2004;118:121–131. [Google Scholar]
- Gillooly JF, Allen AP, West GB, Brown JH. The rate of DNA evolution: effects of body size and temperature on the molecular clock. Proceedings of the National Academy of Sciences. 2005;102:140–145. doi: 10.1073/pnas.0407735101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gustavson TC. Report of Investigations. 198. Bureau of Economic Geology, University of Texas; Austin: 1991. Arid basin depositional systems and paleosols: Fort Hancock and Camp Rice formations (Pliocene-Pleistocene), Hueco Bolson, west Texas and adjacent Mexico. [Google Scholar]
- Gustavson TC, Finley RJ. Report of Investigations. 148. Bureau of Economic Geology, University of Texas; Austin: 1985. Late Cenozoic geomorphic evolution of the Texas Panhandle and northeastern New Mexico—case studies of structural controls on regional drainage development. [Google Scholar]
- Gustavson TC, Winkler DA. Depositional facies of the Miocene-Pliocene Ogallala Formation, northwestern Texas and eastern New Mexico. Geology. 1988;16:203–206. [Google Scholar]
- Hardman M, Hardman LM. The relative importance of body size and paleoclimatic change as explanatory variables influencing lineage diversification rate: an evolutionary analysis of bullhead catfishes (Siluriformes: Ictaluridae) Systematic Biology. 2008;57:116–130. doi: 10.1080/10635150801902193. [DOI] [PubMed] [Google Scholar]
- Harrell JA. Granite platforms in the Wichita Mountains, Oklahoma: pediment outliers of the southern High Plains in Texas and New Mexico. Journal of Geology. 1993;101:397–403. [Google Scholar]
- Hawley JW. Notes on the geomorphology and late Cenozoic geology of northwestern Chihuahua. New Mexico Geological Society Field Conference. 1969;20:132–138. [Google Scholar]
- Hawley JW. The Ogallala and Gatuña formations in the southeastern New Mexico region, a progress report. New Mexico Geological Society Guidebook, 44th Field Conference, Carlsbad Region; New Mexico and West Texas. Socorro: New Mexico Geological Society; 1993. pp. 261–269. [Google Scholar]
- Hill CA. Permian Basin Section-SEPM. Midland: 1996. Geology of the Delaware Basin, Guadalupe, Apache, and Glass mountains, New Mexico and west Texas. Permian Basin Section-SEPM, Publication 96–39. [Google Scholar]
- Ho SY, Phillips MJ. Accounting for calibration uncertainty in phylogenetic estimation of evolutionary divergence times. Systematic Biology. 2009;58:367–380. doi: 10.1093/sysbio/syp035. [DOI] [PubMed] [Google Scholar]
- Hodge JR, Read CI, van Herwerden L, Bellwood DR. The role of peripheral endemism in species diversification: evidence from the coral reef fish genus Anampses (Family: Labridae) Molecular Phylogenetics and Evolution. 2012;62:653–663. doi: 10.1016/j.ympev.2011.11.007. [DOI] [PubMed] [Google Scholar]
- Hoagstrom CW, Brooks JE, Davenport SR. A large-scale conservation perspective considering endemic fishes of the North American plains. Biological Conservation. 2011;144:21–34. [Google Scholar]
- Hoagstrom CW, DeWitte AC, Gosch NJC, Berry CR., Jr Perennial-warmwater fish communities of the Cheyenne River drainage: a seasonal assessment. Proceedings South Dakota Academy Sciences. 2006a;85:213–245. [Google Scholar]
- Hoagstrom CW, Ung V, Taylor K. Miocene rivers and taxon cycles clarify the comparative biogeography of North American highland fishes. Journal of Biogeography. 2014;41:644–658. [Google Scholar]
- Hoagstrom CW, Wall SS, Duehr JP, Berry CR., Jr River size and fish assemblages in southwestern South Dakota. Great Plains Research. 2006b;16:117–126. [Google Scholar]
- Hoagstrom CW, Zymonas ND, Davenport SR, Propst DL, Brooks JE. Rapid species replacements between fishes of the North American plains: a case history from the Pecos River. Aquatic Invasions. 2010;5:141–153. [Google Scholar]
- Hollingsworth PR, Simons AM, Fordyce JA, Hulsey CD. Explosive diversification following a benthic to pelagic shift in freshwater fishes. BMC Evolutionary Biology. 2013;13:272. doi: 10.1186/1471-2148-13-272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holtmeier CL. Heterochrony, maternal effects, and phenotypic variation among sympatric pupfishes. Evolution. 2001;55:330–338. doi: 10.1554/0014-3820(2001)055[0330:HMEAPV]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
- Hubbs CL. Environmental correlates to the abundance of spring-adapted versus stream-adapted fishes. Texas Journal of Science. 2001;53:299–326. [Google Scholar]
- Hubbs CL. Establishment of a forage fish, the red shiner (Notropis lutrensis), in the lower Colorado River system. California Fish and Game. 1954;40:287–294. [Google Scholar]
- Hubbs CL, Lagler KF. Fishes of the Great Lakes region. University of Michigan Press; Ann Arbor: 1964. [Google Scholar]
- Hunt CB. Natural Regions of the United States and Canada. W.H. Freeman and Company; San Francisco: 1974. [Google Scholar]
- Husemann M, Ray JW, King RS, Hooser EA, Danley PD. Comparative biogeography reveals differences in population genetic structure of five species of stream fishes. Biological Journal of Linnean Society. 2012;107:867–885. [Google Scholar]
- Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
- Kastning EH. Relict caves as evidence of landscape and aquifer evolution in a deeply dissected carbonate terrain: southwest Edwards Plateau, Texas, U.S.A. Journal of Hydrology. 1983;61:89–112. [Google Scholar]
- King RE, Adkins WS. Geology of a part of the lower Conchos Valley, Chihuahua, Mexico. Geological Society America Bulletin. 1946;57:25–294. [Google Scholar]
- King TL, Zimmerman EG, Beitinger TL. Concordant variation in thermal tolerance and allozymes of the red shiner, Notropis lutrensis, inhabiting tailwater sections of the Brazos River, Texas. Environmental Biology Fishes. 1985;13:49–57. [Google Scholar]
- Librado P, Rozas J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:1451–1452. doi: 10.1093/bioinformatics/btp187. [DOI] [PubMed] [Google Scholar]
- Luttrell GR, Underwood DM, Fisher WL, Pigg J. Distribution of the Red River shiner, Notropis bairdi, in the Arkansas River drainage. Proceedings Oklahoma Academy Sciences. 1995;75:61–62. [Google Scholar]
- Lynch JD, Roh BR. An ichthyological survey of the forks of the Platte River in western Nebraska. Transactions Nebraska Academy Sciences. 1996;23:65–84. [Google Scholar]
- Mack GH, Seager WR, Leeder MR, Perez-Arlucca M, Salyards SL. Pliocene and Quaternary history of the Rio Grande, the axial river of the southern Rio Grande rift, New Mexico, USA. Earth-Science Review. 2006;79:141–162. [Google Scholar]
- Martin AP, Palumbi SR. Body size, metabolic rate, generation time, and the molecular clock. Proceedings of the National Academy Science. 1993;90:4087–4091. doi: 10.1073/pnas.90.9.4087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matthews WJ. Distribution of Midwestern fishes on multivariate environmental gradients, with emphasis on Notropis lutrensis. American Midland Naturalist. 1985;113:225–237. [Google Scholar]
- Matthews WJ. Geographic variation in Cyprinella lutrensis (Pisces: Cyprinidae) in the United States, with notes on Cyprinella lepida. Copeia. 1987;1987:616–637. [Google Scholar]
- Matthews WJ. Geographic variation in nuptial colors of red shiner (Cyprinella lutrensis; Cyprinidae) within the United States. Southwestern Naturalist. 1995;40:5–10. [Google Scholar]
- Matthews WJ, Marsh-Matthews E. Extirpation of red shiner in direct tributaries of Lake Texoma (Oklahoma-Texas): a cautionary case history from a fragmented river-reservoir system. Transactions American Fisheries Society. 2007;136:1041–1062. [Google Scholar]
- McPhee MV, Turner TF. Genealogical diversity suggests multiple introductions of white suckers (Catostomus commersonii) into the Rio Grande, New Mexico. Southwestern Naturalist. 2009;54:485–492. [Google Scholar]
- Menzer FJ, Jr, Slaughter BH. Upland gravels in Dallas County, Texas and their bearing on the former extent of the High Plains physiographic province. Texas Journal of Science. 1971;22:217–222. [Google Scholar]
- Miller RR. Freshwater Fishes of México. The University of Chicago Press; 2005. [Google Scholar]
- Minckley WL, Meffe GK. Differential selection by flooding in stream-fish communities of the arid American southwest. In: Matthews WJ, Heins DC, editors. Community and Evolutionary Ecology of North American Stream Fishes. University of Oklahoma Press; 1987. pp. 93–104. [Google Scholar]
- Minckley WL, Miller RR, Barbour CD, Schmitter Soto JJ, Norris SM. Historical ichthyogeography. In: Miller RR, editor. Freshwater Fishes of México. The University of Chicago Press; 2005. pp. 24–47. [Google Scholar]
- Montanucci RR. Convergence, polymorphism or introgressive hybridization? An analysis of interaction between Crotaphytus collaris and C. reticulates (Sauria: Iguanidae) Copeia. 1974;1974:87–101. [Google Scholar]
- Moyer GR, Osborne MJ, Turner TF. Genetic and ecological dynamics of species replacement in an arid-land river. Molecular Ecology. 2005;14:1263–1273. doi: 10.1111/j.1365-294X.2005.02481.x. [DOI] [PubMed] [Google Scholar]
- Mueller GA, Brooks JE. Collection of an adult gizzard shad (Dorosoma cepedianum) from the San Juan River, Utah. Western North American Naturalist. 2004;64:135–136. [Google Scholar]
- Near TJ, Benard MF. Rapid allopatric speciation in logperch darters (Percidae: Percina) Evolution. 2004;58:2798–2808. doi: 10.1111/j.0014-3820.2004.tb01631.x. [DOI] [PubMed] [Google Scholar]
- Near TJ, Bossu CM, Bradburd GS, Carlson RL, Harrington RC, Hollingsworth PR, Jr, Keck BP, Etnier DA. Phylogeny and temporal diversification of darters (Percidae: Etheostomatinae) Systematic Biology. 2011;60:565–595. doi: 10.1093/sysbio/syr052. [DOI] [PubMed] [Google Scholar]
- Near TJ, Kassler TW, Koppleman JB, Dillman CB, Phillipp DP. Speciation in North American black basses, Micropterus (Actinopterygii: Centrarchidae) Evolution. 2003;57:1610–1621. doi: 10.1111/j.0014-3820.2003.tb00368.x. [DOI] [PubMed] [Google Scholar]
- Nereson A, Stroud J, Karlstrom K, Heizler M, McIntosh Dynamic topography of the western Red River: geomorphic and 40Ar/39Ar evidence for mantle-driven uplift associated with the Jemez lineament of NE New Mexico and SE Colorado. Geosphere. 2013;9:521–545. [Google Scholar]
- Oberdorff T, Lek S, Guégan J-F. Patterns of endemism in riverine fish of the northern hemisphere. Ecology Letters. 1999;2:75–81. [Google Scholar]
- Osborne MJ, Carson EW, Turner TF. Genetic monitoring and complex population dynamics: insights from a 12-year study of the Rio Grande silvery minnow. Evolutionary Applications. 2012;5(6):553–574. doi: 10.1111/j.1752-4571.2011.00235.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Osborne MJ, Diver TA, Turner TF. Introduced populations as genetic reservoirs for imperiled species: a case study of the Arkansas River Shiner (Notropis girardi) Conservation Genetics. 2013;1:1–11. [Google Scholar]
- Osborne MJ, Perkin JS, Gido KB, Turner TF. Comparative riverscape genetics reveals reservoirs of genetic diversity for conservation and restoration of Great Plains fishes. Molecular Ecology. 2014;23:5663–5679. doi: 10.1111/mec.12970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Page LM, Smith RL. Recent range adjustments and hybridization of Notropis lutrensis and Notropis spilopterus in Illinois. Transactions of Illinois Academy of Sciences. 1970;63:264–272. [Google Scholar]
- Pigg J, Gibbs R, Luttrell GR. Distribution of the Red River pupfish, Cyprinodon rubrofluviatilis Fowler, in the South Canadian River in Texas and Oklahoma. Proceedings Oklahoma Academy Science. 1995;75:59–60. [Google Scholar]
- Porter CC. Ecology, zoogeography and taxonomy of the lower Rio Grande valley mesostenines (Hymenoptera, Ichneumonidae) Psyche. 1977;84:28–91. [Google Scholar]
- Porter CC. Scoliidae (Hymenoptera) of the lower Río Grande valley. Florida Entomology. 1981;64:441–453. [Google Scholar]
- Poulos HM, Chernoff B, Fuller PL, Butman D. Mapping the potential distribution of the invasive red shiner, Cyprinella lutrensis (Teleostei: Cyprinidae) across waterways of the conterminous United States. Aquatic Invasions. 2012;7:377–385. [Google Scholar]
- Puckridge M, Last PR, Andreakis N. The role of peripheral endemism and habitat associations in the evolution of the Indo-West Pacific tuskfishes (Labridae: Choerodon) Molecular Phylogenetics and Evolution. 2015;84:64–72. doi: 10.1016/j.ympev.2014.11.007. [DOI] [PubMed] [Google Scholar]
- Quist MC, Hubert WA, Rahel FJ. Elevation and stream-size thresholds affect distributions of native and exotic warm-water fishes in Wyoming. Journal of Freshwater Ecology. 2004;19:227–236. [Google Scholar]
- Ramos-Onsins SE, Rozas J. Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution. 2002;19:2092–2100. doi: 10.1093/oxfordjournals.molbev.a004034. [DOI] [PubMed] [Google Scholar]
- Rauchenberger M. Systematics and biogeography of the genus Gambusia (Cyprinodontiformes: Poecilidae) American Museum Novitates. 1989;2951:1–74. [Google Scholar]
- Richardson LR, Gold JR. Evolution of the Cyprinella lutrensis species group. III. Geographic variation in the mitochondrial DNA of Cyprinella lutrensis – the influence of Pleistocene glaciation on population dispersal and divergence. Molecular Ecology. 1995;4:163–171. [Google Scholar]
- Rohlf FJ, Slice DE. Extensions of the Procrustes method for the optimal superimposition of landmarks. Systematic Zoology. 1990;39:40–59. [Google Scholar]
- Schmidt TR, Bielawski JP, Gold JR. Molecular phylogenetics and evolution of the cytochrome b gene in the cyprinid genus Lythrurus (Actinopterygii: Cypriniformes) Copeia. 1998;1988:14–22. [Google Scholar]
- Schnabel A, Asmussen MA. Definition and properties of disequilibria within nuclear-mitochondrial-chloroplast and other nuclear-dicytoplasmic systems. Genetics. 1989;123:199–215. doi: 10.1093/genetics/123.1.199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schönhuth S, Mayden RL. Phylogenetic relationships in the genus Cyprinella (Actinopterygii: Cyprinidae) based on mitochondrial and nuclear gene sequences. Molecular Phylogenetics and Evolution. 2010;55:77–98. doi: 10.1016/j.ympev.2009.10.030. [DOI] [PubMed] [Google Scholar]
- Schönhuth S, Doadrio I, Mayden RL. A biogeographic perspective of the phylogeny of Mexican cyprinids (Actinopterygii, Cyprinidae) In: Lozano-Vilano L, Contreras-Balderas AJ, editors. Studies of North American Desert Fishes in Honor of EP (Phil) Pister, Conservationist. Universidad Autónoma de Nuevo León; 2006. pp. 102–124. [Google Scholar]
- Schönhuth S, Hillis DM, Neely DA, Lozano-Vilano L, Perdices A, Mayden RL. Phylogeny, diversity, and species delimitation of the North American round-nosed minnows (Teleostei: Dionda), as inferred from mitochondrial and nuclear DNA sequences. Molecular Phylogenetics and Evolution. 2012;62:427–446. doi: 10.1016/j.ympev.2011.10.011. [DOI] [PubMed] [Google Scholar]
- Seni SJ. Report of Investigations. 105. Bureau of Economic Geology, University of Texas; Austin: 1980. Sand-body geometry and depositional systems, Ogallala Formation, Texas. [Google Scholar]
- Smith GR, Dowling TE, Gobalet KW, Lugaski T, Shiozawa DK, Evans RP. Biogeography and timing of evolutionary events among Great Basin fishes. Great Basin Aquatic Systems History. 2002;33:175–234. [Google Scholar]
- Sorrie BA, Weakley AS. Coastal Plain vascular plant endemics: phytogeographic patterns. Castanea. 2001;66:50–82. [Google Scholar]
- Spencer JE, Smith G, Dowling TE. Middle to late Cenozoic geology, hydrology, and fish evolution in the American Southwest. Geological Society of America Special Papers. 2008;439:279–299. [Google Scholar]
- Stafford KW, Klimchouk AB, Land L, Gary MO. The Pecos River hypogene speleogenetic province: a basin-scale karst paradigm for eastern New Mexico and west Texas, USA. NCKRI Symposium. 2009;1:121–135. [Google Scholar]
- Stelkens RB, Young KA, Seehausen O. The accumulation of reproductive incompatibilities in African cichlid fish. Evolution. 2009;64:617–633. doi: 10.1111/j.1558-5646.2009.00849.x. [DOI] [PubMed] [Google Scholar]
- Tajima F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123(3):585–595. doi: 10.1093/genetics/123.3.585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Veni G. Hydrogeology and evolution of caves and karst in the southwestern Edwards Plateau, Texas. In: Elliott WR, Veni G, editors. Hydrogeology and Evolution of Caves and Karst in the southwestern Edwards Plateau, Texas. National Speleological Society; Huntsville, Alabama: 1994. pp. 13–30. [Google Scholar]
- Ward JL, Blum MJ, Walters DM, Porter BA, Burkhead N, Freeman B. Discordant introgression in a rapidly expanding hybrid swarm. Evolutionary Applications. 2012;5:380–392. doi: 10.1111/j.1752-4571.2012.00249.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walters DM, Blum MJ, Rashleigh B, Freeman BJ, Porter BA, Burkhead NM. Red shiner invasion and hybridization with blacktail shiner in the upper Coosa River, USA. Biological Invasions. 2008;10:1229–1242. [Google Scholar]
- Wiens JJ. What is speciation and how should we study it? American Naturalist. 2004;163:914–923. doi: 10.1086/386552. [DOI] [PubMed] [Google Scholar]
- Williams GC. Natural selection: domains, levels, and challenges. Oxford University Press; Oxford, U.K: 1992. [Google Scholar]
- Woodruff CM, Jr, Abbott PL. Stream piracy and evolution of the Edwards Aquifer along the Balcones Escarpment, central Texas. In: Abbott PL, Woodruff CM Jr, editors. The Balcones Escarpment. Geological Society of America; 1986. pp. 77–89. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






