Abstract
Background
Almost all Helicobacter pylori infected person develop gastritis and severe gastritis is supposed to be the denominator of peptic ulcer diseases, which may lead to gastric cancer. However, it is still an enigma why few strains are associated with ulcer formation, while others are not related with any disease outcome. Although a number of putative virulence factors have been reported for H. pylori, there are contradictory results regarding their connotation with diseases. Recently, there has been a significant attention in strain-specific genes outside the cag pathogenicity island, especially genes within plasticity regions. Studies demonstrated that certain genes in this region may play important roles in the pathogenesis of H. pylori-associated diseases. The aim of this study was to assess the role of selected genes (jhp0940, jhp0945, jhp0947 and jhp0949) in the plasticity region in relation to risk of H. pylori-related diseases in Indian population.
Methods
A total of 113 H. pylori strains isolated from duodenal ulcer (DU) (n = 61) and non-ulcer dyspepsia (NUD) subjects (n = 52) were screened by PCR and Dot-Blot to determine the presence of these genes. The comparative study of IL-8 production and apoptosis were also done by co-culturing the AGS cells with H. pylori strains of different genotype.
Results
PCR and Dot-Blot results indicated that the prevalence rates of jhp0940, jhp0945, jhp0947 and jhp0949 in the H. pylori strains were 9.8, 47.5, 50.8, 40.9 % and 17.3, 28.8, 26.9, 19.2 % isolated from DU and NUD, respectively. IL-8 production and apoptotic cell death were significantly higher in H. pylori strains containing jhp0945, jhp0947 and jhp0949 than the strains lacking those genes. Results indicated that the prevalence of jhp0945, jhp0947 and jhp0949 are associated with increased risk of severe diseases in India.
Conclusion
Our study showed that presence of jhp0945, jhp0947 and jhp0949 were significantly associated with symptomatic expressions along with the increased virulence during in vitro study whereas jhp0940 seems to be negatively associated with the disease. These results suggest that jhp0945, jhp0947 and jhp0949 could be useful prognostic markers for the development of duodenal ulcer in India.
Keywords: Helicobacter pylori, Plasticity region, Duodenal ulcer, IL-8, Apoptosis
Background
Helicobacter pylori is a Gram negative microaerophilic bacterium that infects more than 50 % of world population by selectively colonizing the human stomach [1]. Although most infections are asymptomatic, 10–15 % of H. pylori infected individuals develop chronic inflammation leading to atrophic gastritis, peptic ulcer as well as gastric adenocarcinoma and gastric mucosa-associated lymphoid tissue lymphoma (MALT) [2–4]. It may also contribute to childhood malnutrition and increase the risk or severity of infection by other gastrointestinal pathogens such as Vibrio cholerae, especially in developing countries. In India, around 65–70 % populations are infected with H. pylori [5, 6]. The conundrum of H. pylori study is that infection remains latent in majority of the infected patients, while only approximately 15–20 % of infected individuals become symptomatic for peptic ulcer (duodenal or gastric) as a long-term consequence of infection. Infection usually starts in early childhood and the bacteria have a unique capacity to live in gastric milieu for lifelong unless eradicated by specific antibiotic treatment. It is still unclear what determines the outcome of an infection and the apparent paradox suggests that mere presence of H. pylori in the stomach is insufficient to cause gastric disease, rather requiring additional conditions. However, it is thought to involve interplay between the virulence of the infecting strain, host genetics and environmental factors. Experience with other bacterial pathogens suggests that H. pylori-specific factors may exist that influence the pathogenicity of H. pylori.
H. pylori bear an arsenal of specific virulence factors. Among them the cytotoxin-associated gene-pathogenicity island (cag-PAI), vacuolating associated cytotoxin gene A (vacA), outer inflammatory protein A (oipA), blood group antigen binding adhesin (babA), lipases and lipopolysaccharides (LPS) are potentially toxigenic to initiate the process of inflammation in the host gastric tissues and have been studied in great details to understand their association with gastroduodenal diseases. The gene that encodes CagA is part of a ~40 kb horizontally acquired DNA segment in the H. pylori genome known as cag-PAI [7]. cagA was the first reported gene in H. pylori strains that considered as a marker for the presence of cag-PAI, which include a number of other genes associated with increased virulence [8]. The cag-PAI also contain genes encoding a type IV secretion system, to ensure efficient translocation of the CagA protein into the host epithelium. One potential discordant that has complicated identification of certain disease-specific H. pylori virulence factors is the substantial geographic diversity in the prevalence of H. pylori virulence factors. Although presence of cagA is significantly associated with the disease status in Western countries, but in Asian countries (including Japan, China and India) this correlation was not observed as majority of the H. pylori strains in this region carry cagA gene [7, 9, 10].
Several studies reported the unusual genetic heterogeneity of H. pylori in terms of allelic diversity, which has established it as a species with a very high population recombination rate, and also enabled to identify the strains from various populations of different geographic regions [11]. Comparative analysis of the full genome sequences of two H. pylori strains (26695 and J99) indicated several regions whose G + C content was lower than that of the rest of H. pylori genome, indicating horizontal DNA transfer from other species. H. pylori contains an open pan-genome, in which each individual is found to possess distinct set of non-core, or strain-specific, genes [11]. On the basis of comparative analysis of the first sequenced H. pylori genomes, it can be said that these strain-specific genes are mostly found in genomic regions that had previously been coined as plasticity zones, a designation initially used to describe a particular genetic locus with high variation between the first two H. pylori genome sequences [11]. The availability of more sequencing data and more complete H. pylori genome sequences makes it clear that parts of the plasticity zones are generally organized as genomic islands that may be incorporated in one of quite a few different genetic loci. Approximately half of the strain-specific genes of H. pylori are positioned in the plasticity region [12]. For example, this plasticity region in strain J99 is continuous and 45 kb long whereas it is 68 kb discontinuous in strain 26695. Among the 38 open reading frames (ORFs) of the plasticity zone (jhp0914–jhp0951) in strain J99, only six are present in strain 26695 [13–17]. Although various representative genes of these plasticity regions have been recommended as disease markers, e.g. dupA for duodenal ulcer [18, 19], or jhp950 for marginal zone B cell MALT lymphoma [20], the functions of the plasticity zones are still not clear yet. The different combinations of genes within plasticity regions are directly related to the variability of the gene content of H. pylori [21].
It is not clearly understood whether strain-specific genes or combinations of strain specific genes force the severity of gastric mucosal inflammation and the risk of various H. pylori-mediated diseases. Additionally, the functional importance of the majority number of open reading frames (ORFs) in the plasticity region remain unrevealed. Recently it has been reported that jhp0940, jhp0945, jhp0947, and jhp0949 of Western H. pylori strains showed an association with an increased chance of gastroduodenal disease and an increase in inflammatory cytokines [15, 17, 22]. However, in other studies, the role of selected genes in the plasticity region in relation to the risk of H. pylori-related disease and the severity of gastric mucosal damage was debatable and uncertain. Furthermore, the reported associations need to be confirmed in other geographic regions, since geographic differences with regard to virulence genes of H. pylori have been demonstrated [16, 23, 24].
Indian H. pylori strains are genetically distinct than East Asian and Western strains [24]. Moreover, our recent study showed that presence of strains with intact cag-PAI was found more frequently in Kolkata than in Southern India indicating regional variation in the H. pylori gene pools [9]. In addition, India constitutes about 1/5th of the world’s population and there were no reports regarding the distribution of different plasticity genes and their correlation to disease from India except the dupA gene. These observations and our continuing interest in the dynamics of genetic traits associated with H. pylori infection and disease association motivated us to perform the present study for examining the prevalence of jhp0940, jhp0945, jhp0947and jhp0949 of H. pylori and their relation to H. pylori-related disease in Indian population along with their role in in vitro study.
Results
Among the enrolled 171 subjects suffering from gastroduodenal problems, a total of 113 H. pylori strains were isolated by culture method. Based on the visual examination of the stomach and duodenum during endoscopy, subjects were divided into two groups: non-ulcer dyspepsia (NUD) and duodenal ulcer (DU) patients. All the strains were isolated from these two groups: (1) 61 DU patients and (2) 52 NUD. Out of 61 DU cases, the mean age difference was 47.3 ± 9.8 and among 52 NUD subjects, the mean age difference was 31.6 ± 9.9. The genomic DNA from these 113 strains was used for further PCR based analysis.
Distribution of jhp0940, jhp0945, jhp0947 and jhp0949 and their disease association
Prevalence of these selected genes in the plasticity region of H. pylori among NUD and DU patients in Indian population was screened by PCR and dot blot hybridization (Fig. 1a, b). All the strains yielded 480-bp product similar to ureB gene, indicating the identity of H. pylori DNA. All samples considered negative by PCR were confirmed as negative by dot blot hybridization. The prevalence rates of jhp0940, jhp0945, jhp0947, and jhp0949 in patients with H. pylori were 13.3 % (15/113), 38.9 % (44/113), 39.8 % (45/113) and 31 % (35/113), respectively (Fig. 2). There was a low frequency of jhp0940 gene in Indian population and 17.3 and 9.8 % strains were positive in NUD and DU patients, respectively (Table 1). jhp0940 is almost 2 times higher in NUD than the DU even though difference was not significant.
Fig. 1.

a Genotyping of plasticity region genes in Indian H. pylori isolates. The images shown are from a representative gel electrophoresis of a PCR amplification product of plasticity region genes from Indian isolates and J99 control strain with (1) jhp0940F and jhp0940R primers [22], (2) jhp0945F and jhp0945R primers [22], (3) jhp0947F and jhp0947R primers [22], and (4) jhp0949F and jhp0949R primers [22]. Where lane 1: DNA ladder lane 2: positive control, lanes 3–13: clinical isolates and lane 14: negative control. b Genotyping of jhp0940 gene in Indian H. pylori isolates by dot blot hybridization assay. The images shown are from a representative dot blot hybridization of jhp0940 gene from Indian isolates and J99 control strain (A1 and H12 represent as positive controls)
Fig. 2.

Distribution of jhp0940, jhp0945, jhp0947, and jhp0949 genotypes among Indian H. pylori isolates
Table 1.
Prevalence of jhp0940, jhp0945, jhp0947 and jhp0949 genes in the plasticity region of Indian Helicobacter pylori isolates
| No. of strains screened | Jhp0940 | Jhp0945 | Jhp0947 | Jhp0949 |
|---|---|---|---|---|
| NUD (52) | 9 (17.3 %) | 15 (28.8 %) | 14 (26.9 %) | 10 (19.2 %) |
| DU (61) | 6 (9.8 %) | 29 (47.5 %) | 31 (50.8 %) | 25 (40.9 %) |
| OR (95 % CI) | 1.91 (0.63−5.80) |
2.23 (1.02−4.88) |
2.80 (1.27−6.19) |
2.92 (1.23−6.87) |
| P value | 0.130 | 0.042* | 0.009* | 0.013* |
OR odds ratio, CI confidence interval
* Statistically significant
jhp0945 gene was found in 28.8 and 47.5 % of the strains isolated from NUD and DU patients, respectively indicating that jhp0945 gene was significantly associated with DU than NUD (P = 0.042 and OR 2.23; 95 % CI 1.02–4.88) (Table 1). 14 (26.9 %) of the 52 patients with NUD and 31 (50.8 %) of the 61 patients with DU were colonized by a jhp0947-positive strain. In the univariate analysis, when patients with NUD and DU were compared, the presence of the jhp0947gene was positively associated with DU (P = 0.009; OR 2.80; 95 % CI 1.27–6.19). Similarly, jhp0949 gene was detected in 19.2 and 40.9 % of the strains isolated from NUD and DU patients, respectively. Results demonstrated the significant association of jhp0949 with DU than NUD (P = 0.013 and OR 2.92; 95 % CI 1.23–6.87). Among the 35 jhp0949 positive strains, 33 were positive for jhp0947 and 25 strains were also positive for all three elements (jhp0945, jhp0947 and jhp0949). So, the presence of jhp0949 was completely linked with that of jhp0947 in Indian population and was roughly associated with that of jhp0945 (Fig. 3). In our study, only one strain containing all four ORFs (jhp0940, jhp0945, jhp0947, and jhp0949) was detected.
Fig. 3.

Prevalence of jhp0940, jhp0945, jhp0947, and jhp0949 genotypes of Indian H. pylori strains isolated from DU patients and NUDs
The cagA and vacA status were determined using primers and protocols described earlier [23, 25]. cagA was present in 87.6 % (99/113) of the tested strains from this region. 68 % (77/113) of the strains had vacAs1m1 allele. Other two alleles s1m2 and s2m2 of vacA were present in 18.6 % (21/113) and 13.3 % (15/113), respectively (Fig. 4). Status of cagA and vacA genes did not have any correlation with the presence of plasticity region genes indicating the presence of these two virulence-associated genes independent of the plasticity region genes.
Fig. 4.

Distribution of cagA positive and different genotypes of vacA among Indian H. pylori isolates
jhp0945, jhp0947 and jhp0949 positive strains showed greater IL-8 induction in gastric epithelial (AGS) cells
According to the presence of these virulence genes, the strains were divided into three groups viz. (1) triple positive strains (cagA+/vacA+/three ORFs+(jhp0945, jhp0947, and jhp0949), (2) only three ORFs positive strains (cagA−/vacA−/three ORFs+), and (3) triple negative strains (cag−/vacA−/three ORFs−). AGS cell were co-cultured with H. pylori strains for 8 h. IL-8 secretion was significantly (P < 0.05) higher from those cells which were infected with cagA+/vacA+/three ORFs+ strains (813.1 ± 96.05 pg/ml, n = 5; Fig. 5) than the cells infected with cagA−/vacA−/three ORFs+ strains (492.4 ± 54.79 pg/ml, n = 5; Fig. 5), whereas the cells infected with triple negative strains (cagA-/vacA-/three ORFs) recorded the lowest IL-8 induction (94.28 ± 20.45 pg/ml, n = 5; Fig. 5). Here, vacA s1m1 and vacA s2m2 alleles are taken as vacA+ and vacA−, respectively because vacA s2m2 allele is nonfunctional.
Fig. 5.

Role of H. pylori plasticity region in in vitro induction of IL-8. In vitro IL-8 production from AGS cells co-cultured with randomly selected cagA(+)vacA(+)P(+), cagA(−)vacA(-)P(+), and cagA(−)vacA(−)P(−) H. pylori strains (MOI is 100) for 8 h. IL-8 from culture supernatant was measured using ELISA as described in "Methods" section. Data are expressed as mean ± standard error of mean (SEM) of 3 experiments in duplicates. vacA positive and negative denote the vacA s1m1 and vacA s2m2 alleles, respectively
Three ORFs positive strains trigger more apoptosis in AGS cells
The cell cycle analysis with propidium iodide reveals distribution of cells in three major phases of the cell cycle (G1, S and G2/M) and makes it possible to detect unhealthy cells with fractional DNA content. The cells in the sub-G0 phase represent apoptotic cells. After co-culturing the AGS cells with H. pylori for 24 h significantly (P < 0.05) higher amount of apoptotic cell death was found when the cells were infected with cagA+/vacA+/three ORFs+ strains (49.13 ± 3.002 %, Fig. 6) than the cells infected with cagA−/vacA−/three ORFs+ strains (24.78 ± 2.936 %, Fig. 6) and infection with the triple negative strains (cagA−/vacA−/three ORFs−) caused the least apoptotic cell damage (13.63 ± 1.52 %, Fig. 6).
Fig. 6.

Importance of H. pylori plasticity region in cell cycle analysis of AGS cells. a Cell cycle analysis of AGS cells i worked as control) co-cultured with different genotypic variant i.e. ii cagA(+)vacA(+)P(+); iii cagA(−)vacA(−)P(+) and iv cagA(−)vacA(−)P(−). H. pylori strains for 24 h (MOI is 100), stained with propidium iodide, processed and analysed by flow cytometry. These figures are representative profile of at least three experiments. b Graphical representation of % apoptotic cells (Sub G0 phase) infected with same group of strains were expressed as mean ± SEM. vacA positive and negative denote the vacA s1m1 and vacA s2m2 alleles, respectively
Strains harboring three ORFs cause more induction of caspase-3 in AGS cells
We also assessed the effects of combined effects of these three ORFs regarding apoptosis via the level of caspase-3 activity. Cleavage of caspase-3 is a regular concluding pathway in caspase-mediated cell death initiated by any agents. Activation of Caspase-3 by H. pylori was determined by measuring cleavage of the colorimetric substrate DEVD-pNa as described in methods. We measured the degree of caspase-3 activity in H. pylori infection by using biochemical assays of lysates from cells infected with the aforesaid group of strains having particular genotype (n = 3 in each group). As shown in Fig. 7, caspase-3 activity was significantly higher (P < 0.05) after 24 h of infection in cagA+/vacA+/three ORFs+ strains infected AGS cells compared to the cells infected with cagA−/vacA−/three ORFs+ strains, followed by triple negative strains (cagA−/vacA−/three ORFs−).
Fig. 7.

Spectrophotometric analysis of caspase 3. Caspase analysis of AGS cells (controls) co-cultured with different genotypic variant i.e. cagA(+)vacA(+)P(+);cagA(−)vacA(−)P(+) and cagA(−)vacA(−)P(−) H. pylori strains for 24 h (MOI is 100), cells were then lysed and supernatant was used for colorimetric assay of caspase-3 activity as described in "Methods". Data are expressed as mean ± standard error of mean (SEM) of 3 experiments in duplicates. vacA positive and negative denote the vacA s1m1 and vacA s2m2 alleles, respectively
Discussion
Identification of a disease-specific H. pylori virulence factors prognostic of the consequence of infection still remains elusive. Although a number of putative virulence factors of H. pylori has been reported (e.g., the cag-PAI, vacA, babA, and oipA) to be associated with the clinical outcomes of H. pylori infection, they fail to answer the entire process of disease manifestation in all geographical areas in the world, especially in the context of Asian countries. Prevalence of two most studied virulence determinants namely; cagA and vacA of H. pylori strains isolated from DU and NUD patients in Asian countries do not show any significant variations. So, studies searching on new putative virulence factors in H. pylori are still essential. Under this condition, there has been considerable recent curiosity in the plasticity region, whose gene content varies among different isolates and may play important roles in the pathogenesis of H. pylori-associated diseases. Using a comparative genome analysis, Fischer et al. recently concluded that major parts of the H. pylori plasticity zones reported earlier should in fact be considered as mobile genetic elements with conserved gene content, rather than regions of genome plasticity. They have also suggested that the high prevalence and wide distribution of these regions throughout all H. pylori populations might provide an as yet unknown fitness benefit to their hosts.
Studies indicated that Novel protein antigen (JHP0940) from plasticity region in H. pylori elicited strong and significant levels of tumor necrosis factor alpha and interleukin-8 in human macrophages [26]. Moreover, according to Kim et al. [27] JHP0940 is a catalytically active protein kinase that translocates into cultured human cells and with that kinase activity is capable of indirect upregulation of NF-κB p65 phosphorylation at Ser276. These observations might suggest the putative role of jhp0940 in chronic gastric inflammation and, possibly, the various other outcomes of H. pylori infection, including gastric cancer.
The prevalence of jhp0940 in Western and East Asian isolates has been reported as 17.2 and 23.5 %, respectively. Studies with Brazilian patients indicated that the jhp0940 gene was found in only three of 200 H. pylori strains tested [28]. Other studies demonstrated that 62 % (71 from 114 strains) and 53.1 % of the H. pylori strains isolated from Pakistan and Mexico were positive for jhp0940, respectively [15, 29]. But our study showed that only 13.3 % of the H. pylori isolates from India were positive for jhp0940. According to Occhialini et al. [17]., in a Costa Rican population about 41.2 % isolates from gastric cancer patients were jhp0940 positive, where all the isolates from gastritis patients were found negative (P < 0.0006). Study from Pakistan also demonstrated that gastric ulcer (GU) was more significantly associated with jhp0940 (17 patients, 77 %; P = 0.003) than with gastritis (14 patients, 39 %) [15]. In contrary, Sugimoto et al. [22] reported that jhp0940-positive Western isolates were significantly associated with absence of gastric ulcer or duodenal ulcer [0.21 (0.05–0.94) and 0.31 (0.12–0.78], respectively). Our study is partially in accord with this Western finding as jhp0940 is almost two times higher in NUD than the DU in Indian population although the difference was not significant. Our results might propose that jhp0940 has a protective effect on gastroduodenal diseases although findings from various research groups from different parts of the world produced contradictory reports regarding the prevalence as well as its effect. The absence of jhp0940 was supported by a probability of deletion because there are reports showing deletion of some genes from evolved H. pylori strains isolated from advanced stages of gastric diseases when chronic atrophic gastritis progressed to gastric cancer in the same patient over a time of four years [30]. Thus, it is possible that due to high rate of evolution of the bacteria, jhp0940 might get deleted from H. pylori strains during progression of gastritis to duodenal ulcer. However, there are no reports on how the bacteria modulate these types of deletions within a single host during disease progression and to justify such rapid evolution.
Studies from Turkey, Costa Rica, and Netherlands reported that the prevalence of jhp0945 status was parallel between H. pylori from patients with peptic ulcer and that from patients with gastritis but the sample size was small in those studies [17]. Another comprehensive study by Sugimoto et al. [22] among 300 H. pylori isolates from Western population presented a significant association between jhp0945-positive isolates and gastric ulcer, duodenal ulcer, and gastric cancer. Same study also reported that the jhp0945 status was associated with an increased risk of gastric ulcer (odds ratio (OR) 2.58, 95 % CI 1.06–6.27) in East Asia using univariant analysis. Our results are consistent with this finding and showed that jhp0945 status is significantly associated with DU, which supports the finding of Sugimoto et al. [22].
The prevalence of jhp0947 in East Asian isolates was only 5.5 % [22]. In 2000, Occhialini et al. [17] suggested about a more frequent distribution of jhp0947 in gastric cancer isolates (64.7 %) than in those from gastritis patients (34.6 %). Moreover, Santos et al, [28] described that the presence of the jhp0947 remained associated only with gastric cancer (OR 2.94, 95 % CI, 1.86–4.64) and with duodenal ulcer disease (4.84, 2.13–10.96) using multivariate analysis. Moreover, Yakoob et al. [15] found a significant association of jhp0947 with chronic active inflammation and multivariate analysis demonstrated that the ORF was associated with DU in Pakistan and our study also showed that the jhp0947 status was associated with a significantly increased risk of duodenal ulcer.
One study in a Dutch population established that the presence of jhp0949 was significantly associated with duodenal ulcer compared to gastritis [31]. Another study reported that 83.7 % of the H. pylori strains isolated from Mexican children was positive for jhp0949 [29]. Sugimoto et al. [22] reported that there were no significant association between the development of gastroduodenal disease and the status of jhp0949 in East Asian and Western population. But the present study in Indian population demonstrated significant association in the prevalence of jhp0949 between patients with NUD and those with H. pylori related duodenal ulcer. These differences may well reflect the geographic variation of the H. pylori isolates used in various studies. Further, this study also displayed that IL-8 production and apoptotic cell death were significantly higher in H. pylori strains containing jhp0945, jhp0947 and jhp0949 than the strains lacking those genes. Together, these results may emphasize that the presence of jhp0945, jhp0947 and jhp0949 were significantly associated with symptomatic expressions whereas jhp0940 seems to be negatively associated with the disease status.
Conclusions
In conclusion, this was the first study in India to assess the relationship between plasticity region genes and clinical manifestations. The findings of the study suggest that jhp0945, jhp0947 and jhp0949 could be useful prognostic markers for the development of peptic ulcer in Indian population whereas jhp0940 seems to be negatively associated with the disease.
Methods
Collection of Biopsy samples
A total of 171 adult patients of both sexes (aged between 23 and 71 years) with gastric complaints were subjected to endoscopy at the hospital of the Institute of Post Graduate Medical Education and Research, Kolkata, and St. John’s Medical College Hospital, Bangalore, India during the year 2007–2009. Complete patient’s history was noted, and a physical examination of each subject was performed before endoscopy. The NICED Ethical committee had approved the study. The record regarding the patient information was kept blind during the experimental procedures and the disease status was decoded during the data analysis. Two biopsies, one from antrum and the other from corpus of the stomach, were taken during endoscopy, from each individual. Biopsies obtained in 0.6 ml of Brucella broth (Difco Laboratories, Detroit, MI) with 15 % glycerol were transported to the laboratory in ice-cold condition and were stored at −70 °C until culture.
H. Pylori culture
In the laboratory, Brucella broth containing the specimen was vortexed for 2 min and 200 µl of the mixture was streaked on Petri plates containing brain heart infusion (BHI) agar (Difco Laboratories) supplemented with 7 % sheep blood, 0.4 % IsoVitaleX, amphotericin B (8 µg/ml) (Sigma Chemicals Co., St. Louis, MO), trimethoprim (5 µg/ml), vancomycin (6 µg/ml) (Sigma Chemicals) and Nalidixic acid (8 µg/ml) (all from Sigma). Plates were incubated for 3–6 days at 37 °C in a double gas incubator (Heraeus Instrument, Germany) which maintains an atmosphere of 85 % N2, 10 % CO2, and 5 % O2 [32]. The H. pylori colonies were identified by their typical colony morphology, appearance on Gram staining and positive reactions in urease, catalase and oxidase tests along with the urease PCR. Bacteria were sub-cultured at 37 °C on the above medium and under the same microaerophilic condition.
Extraction of genomic DNA
Cells were harvested from the culture plates and washed with phosphate-buffer saline (pH 8.0) followed by centrifugation at 3000 rpm for 1 min. The pelleted cells were resuspended in 540 µl of TE buffer (10 mM Tris–HCL, 1 mM EDTA), 60 µl of 10 % Sodium dodecyl sulfate (SDS) (Sigma) and 9 µl of Proteinase K (20 mg/ml) (Invitrogen, Carlsbad, CA), mixture was incubated at 50 °C for 1 h followed by addition of 100 µl of 5 M NaCl, 80 µl of 10 % CTAB solution and then again incubated at 65 °C for 10 min. The DNA was extracted according to the standard phenol–chloroform-method [33].
PCR amplification
PCR amplification was performed in a final volume of 20 µl containing template DNA (2–20 ng), 2 µl of 10× Buffer (Roche, Germany), 2.5 mM dNTPs (Roche) and 10 pmol of corresponding primers (Table 2) in the presence of 1U of Taq DNA Polymerase (Roche). The cycling program has the following condition: initial denaturation at 95 °C for 3 min followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 1 min, and final extension at 72 °C for 7 min. Genomic DNA from the strain J99 and 26695 were included as positive and negative control respectively. The PCR products were analyzed by 1.5 % agarose gels (containing 0.5 µg of ethidium bromide per ml) in 1X TAE buffer. Gels were scanned under UV light and analyzed with Quantity One software (Bio-Rad, Hercules, CA). The size of product was confirmed by using molecular weight marker.
Table 2.
Primers used in this study
| Primer | Sequence (5′-3′) | Amplicon (bp) | Reference |
|---|---|---|---|
| jhp0940F | GAAATGTCCTATACCAATGG | 600 | [22] [22] |
| jhp0940R | CCTAAGTAGTGCATCAAGG | ||
| jhp0945F | ACTCCAGCCAGTATTGTAAA | 246 | [22] [22] |
| jhp0945R | TTCTTGCGAGTTAGGATTGG | ||
| jhp0947F | GATAATCCTACGCAGAAC | 650 | [22] [22] |
| jhp0947R | GCTAAAGTCATTTGGCTGTC | ||
| jhp0949F | ATAGGAGTGGGTGCTTACTT | 788 | [22] [22] |
| jhp0949R | AGCAACAACAAAGGCATGTA | ||
| ureBF | CGTCCGGCAATAGCTGCCATAGT | 480 | [34] [34] |
| ureBR | GTAGGTCCTGCTACTGAAGCCTTA | ||
| CagA5CF | GTTGATAACGCTGTCGCTTCA | 350 | [25] [25] |
| CagA3CR | GGGTTGTATGATATTTTCCATAA | ||
| Lunil1 | ACATTTTGGCTAAATAAACGCTG | 550 | [25] [25] |
| R5280 | CCAACGTGCGTAAAAGGGAATTAG | ||
| vacAsF | ATGGAAATACAACAAACACAC | s1-259/s2-286 | [35] [35] |
| vacAsR | CTGCTTGAATGCGCCAAAC | ||
| vacAmF | CAATCTGTCCAATCAAGCGAG | m1-567/m2-642 | [35] [35] |
| vacAmR | GCGTCAAAATAATTCCAAGG |
IL-8 assay
All the bacterial strains were cultured in 7 % serum containing BHIA plates for 24 h at 37 °C under microaerophilic conditions. In order to obtain in vitro IL-8 secretion from gastric epithelial cells, AGS (human gastric adenocarcinoma cell line) cells were plated (2.5 × 105cells/ml) into 24 well plates and cultured for 24 h. H. pylori (multiplicity of infection (MOI) of 100) were added to cultured cells. After 8 h. of infection, IL-8 levels in the supernatant were assayed in duplicate three times using a commercially available specific ELISA kit (Genetix, India) following the manufacturer’s protocols.
Cell cycle analysis
AGS cells (1 × 106cells/ml in each well) were infected with exponentially growing H. pylori culture. After 24 h of infection cells were fixed in 70 % chilled ethanol and were kept at 4°C for further analysis. Prior to analysis cells were washed in 2 % fetal bovine serum (FBS) containing PBS (pH 7.4) and the cell pellets were stained with propidium iodide (50 µg/ml) containing DNase-free RNase (0.1 mg/ml). Cells were then acquired on flow cytometer and the data was analyzed in FACS Diva (Becton–Dickinson, USA) software.
In vitro caspase-3 activity assay
The AGS cells were plated (2.5 × 106 cells/ml in each plate) into petriplate (60 mm dias) to perform this experiment and cultured for 24 h. The cells were then infected with one day old H. pylori culture (multiplicity of infection [MOI] of 100). After 24 h of infection the AGS cells were collected by centrifugation at 1000×g for 10 min at room temperature, which were then washed twice with PBS. A suspension of these cells were prepared then in lysis buffer at a density of 107 cells/ml and kept on ice for 10 min. The cell debris was discarded by centrifugation at 16,000×g for 5 min at 4 °C, and the cell supernatant was then used for the colorimetric assay of caspase-3 activity using commercially available kit (Abcam, Cambridge, UK). Protein concentrations were measured using the Bio-Rad protein assay according to the manufacturer’s protocols.
Statistical analysis
Each experiment was performed at least thrice in duplicates and results expressed as mean ± standard error of the mean (SEM). Statistical analysis was done by T test and ANOVA (wherever applicable). Univariate analysis was done to determine Odds ratio (OR) and Confidence interval (CI). Calculations were done using Graph Pad Prism software (version 5, Graph Pad Software Inc, USA) and P values <0.05 were considered to be significant.
Authors’ contributions
Conceived and design the experiments AKM and SS. Performed the experiments MG and DRS. Analyzed the data MG, PG, AS, JA, RD and AKM. Contributed reagents/materials/analysis tools AKM, SS and DRS. Wrote the paper AKM and MG. All authors read and approved the final manuscript.
Acknowledgements
This work was supported in part by the Council of Scientific and Industrial Research (CSIR) (Ref. No. 37(1640)/14/EMR-II); and Indian Council of Medical Research, New Delhi. Funders have no role in study design, data collection, analysis, interpretation and publication.
Competing interests
The authors declare that they have no competing interests.
Contributor Information
Mou Ganguly, Email: moumukhopadhyay6@gmail.com.
Sagartirtha Sarkar, Email: sagartirtha.sarkar@gmail.com.
Prachetash Ghosh, Email: prache.bio@gmail.com.
Avijit Sarkar, Email: vijit2me@gmail.com.
Jawed Alam, Email: jawedalam81@yahoo.com.
Bipul Chandra Karmakar, Email: bkniced03@gmail.com.
Ronita De, Email: dronita@gmail.com.
Dhira Rani Saha, Email: dhira.saha@gmail.com.
Asish K. Mukhopadhyay, Email: asish_mukhopadhyay@yahoo.com
References
- 1.Brown LM. Helicobacter pylori: epidemiology and routes of transmission. Epidemiol Rev. 2000;22:283–297. doi: 10.1093/oxfordjournals.epirev.a018040. [DOI] [PubMed] [Google Scholar]
- 2.Mégraud F, Lamouliatte H. Helicobacter pylori and duodenal ulcer evidence suggesting causation. Dig Dis Sci. 1992;37:769–772. doi: 10.1007/BF01296437. [DOI] [PubMed] [Google Scholar]
- 3.Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med. 1991;325:1127–1131. doi: 10.1056/NEJM199110173251603. [DOI] [PubMed] [Google Scholar]
- 4.Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet. 1991;338:1175–1176. doi: 10.1016/0140-6736(91)92035-Z. [DOI] [PubMed] [Google Scholar]
- 5.Graham DY, Adam E, Reddy GT, Agarwal JP, Agarwal R, Evans DJ, Malaty HM, Evans DG. Seroepidemiology of Helicobacter pylori infection in India. Comparison of developing and developed countries. Dig Dis Sci. 1991;36:1084–1088. doi: 10.1007/BF01297451. [DOI] [PubMed] [Google Scholar]
- 6.Singh V, Trikha B, Nain CK, Singh K, Vaiphei K. Epidemiology of Helicobacter pylori and peptic ulcer in India. J Gastroenterol Hepatol. 2002;17:659–665. doi: 10.1046/j.1440-1746.2002.02746.x. [DOI] [PubMed] [Google Scholar]
- 7.Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, Rappuoli R, Covacci A. Cag pathogenicity island of Helicobacter pylori, encodes type I-specific and diseases associated virulence factors. Proc Natl Acad Sci. 1996;93:14648–14653. doi: 10.1073/pnas.93.25.14648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Broutet N, Marais A, Lamouliatte H, de Mascarel A, Samoyeau R, Salamon R, Megraud F. cagA status and eradication treatment outcome of anti-Helicobacter pylori triple therapies in patients with non ulcer dyspepsia. J Clin Microbiol. 2001;39:1319–1322. doi: 10.1128/JCM.39.4.1319-1322.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Patra R, Chattopadhyay S, De R, Datta S, Chowdhury A, Ramamurthy T, Nair GB, Berg DE, Mukhopadhyay AK. Intact cag pathogenicity island of Helicobacter pylori without disease association in Kolkata, India. Int J Med Microbiol. 2011;301:293–302. doi: 10.1016/j.ijmm.2010.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F, Kato T, Kohli Y, Kuriyama M. Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan. J Clin Microbiol. 1997;35:1710–1714. doi: 10.1128/jcm.35.7.1710-1714.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fischer W, Breithaupt U, Kern B, Smith SI, Spicher C, Haas RA. Comprehensive analysis of Helicobacter pylori plasticity zones reveals that they are integrating conjugative elements with intermediate integration specificity. BMC Genom. 2014;15:310. doi: 10.1186/1471-2164-15-310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Alm RA, Trust TJ. Analysis of the genetic diversity of Helicobacter pylori: the tale of two genomes. J Mol Med. 1999;77:834–846. doi: 10.1007/s001099900067. [DOI] [PubMed] [Google Scholar]
- 13.Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J Med Microbiol. 2008;57:545–553. doi: 10.1099/jmm.0.2008/000570-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pacheco AR, Proença-Módena JL, Sales AI, Fukuhara Y, da Silveira WD, Pimenta-Módena JL, de Oliveira RB, Brocchi M. Involvement of the Helicobacter pylori plasticity region and cag pathogenicity island genes in the development of gastroduodenal diseases. Eur J Clin Microbiol Infect Dis. 2008;27:1053–1059. doi: 10.1007/s10096-008-0549-8. [DOI] [PubMed] [Google Scholar]
- 15.Yakoob J, Abbas Z, Naz S, Islam M, Abid S, Jafri W. Associations between the plasticity region genes of Helicobacter pylori and gastroduodenal diseases in a high-prevalence area. Gut Liver. 2010;4:345–350. doi: 10.5009/gnl.2010.4.3.345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kersulyte D, Mukhopadhyay AK, Velapatiño B, et al. Differences in genotypes of Helicobacter pylori from different human populations. J Bacteriol. 2000;182:3210–3218. doi: 10.1128/JB.182.11.3210-3218.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Occhialini A, Marais A, Alm R, Garcia F, Sierra R, Mégraud F. Distribution of open reading frames of plasticity region of strain J99 in Helicobacter pylori strains isolated from gastric carcinoma and gastritis patients in Costa Rica. Infect Immun. 2000;68:6240–6249. doi: 10.1128/IAI.68.11.6240-6249.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterol. 2005;128:833–848. doi: 10.1053/j.gastro.2005.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jung SW, Sugimoto M, Shiota S, Graham DY, Yamaoka Y. The intact dupA cluster is a more reliable Helicobacter pylori virulence marker than dupA alone. Infect Immun. 2012;80:381–387. doi: 10.1128/IAI.05472-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Lehours P, Dupouy S, Bergey B, Ruskoné-Foumestraux A, Delchier JC, Rad R, Richy F, Tankovic J, Zerbib F, Mégraud F, Ménard A. Identification of a genetic marker of Helicobacter pylori strains involved in gastric extranodal marginal zone B cell lymphoma of the MALT-type. Gut. 2004;53:931–937. doi: 10.1136/gut.2003.028811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, et al. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 1999;397:176–180. doi: 10.1038/16495. [DOI] [PubMed] [Google Scholar]
- 22.Sugimoto M, Watada M, Jung SW, Graham DY, Yamaoka Y. Role of Helicobacter pylori plasticity region genes in development of gastroduodenal diseases. J Clin Microbiol. 2012;50:441–448. doi: 10.1128/JCM.00906-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Atherton JC, Peek RM, Jr, Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterol. 1997;112:92–99. doi: 10.1016/S0016-5085(97)70223-3. [DOI] [PubMed] [Google Scholar]
- 24.Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y, Chowdhury A, et al. Distinctiveness of genotypes of Helicobacter pylori in Calcutta. India. J Bacteriol. 2000;182:3219–3227. doi: 10.1128/JB.182.11.3219-3227.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chattopadhyay S, Patra R, Ramamurthy T, Chowdhury A, Santra A, Dhali GK, Bhattacharya SK, Berg DE, Nair GB, Mukhopadhyay AK. Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens. J Clin Microbiol. 2004;42:2821–2824. doi: 10.1128/JCM.42.6.2821-2824.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rizwan M, Alvi A, Ahmed N. Novel protein antigen (JHP940) from the genomic plasticity region of Helicobacter pylori induces tumor necrosis factor alpha and interleukin-8 secretion by human macrophages. J Bacteriol. 2008;190:1146–1151. doi: 10.1128/JB.01309-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim do J, Park KS, Kim JH, Yang SH, Yoon JY, Han BG, et al. Helicobacter pylori pro-inflammatory protein up-regulates NF-kappaB as a cell-translocating Ser/Thr kinase. Proc Natl Acad Sci. 2010;107:21418–21423. doi: 10.1073/pnas.1010153107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Santos A, Queiroz DM, Ménard A, Marais A, Rocha GA, Oliveira CA, Nogueira AM, Uzeda M, Mégraud F. New pathogenicity marker found in the plasticity region of the Helicobacter pylori genome. J Clin Microbiol. 2003;41:1651–1655. doi: 10.1128/JCM.41.4.1651-1655.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Romo-González C, Consuelo-Sánchez A, Camorlinga-Ponce M, Velázquez-Guadarrama N, García-Zúñiga M, Burgueño-Ferreira J, Coria-Jiménez R. Plasticity region genes jhp0940, jhp0945, jhp0947, and jhp0949 of Helicobacter pylori in isolates from Mexican children. Helicobacter. 2015;20:231–237. doi: 10.1111/hel.12194. [DOI] [PubMed] [Google Scholar]
- 30.Oh JD, Kling-Bäckhed H, Giannakis M, Xu J, Fulton RS, Fulton LA. The complete genome sequence of a chronic atrophic gastritis Helicobacter pylori strain: evolution during disease progression. Proc Natl Acad Sci. 2006;103:9999–10004. doi: 10.1073/pnas.0603784103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.de Jonge R, Kuipers EJ, Langeveld SC, Loffeld RJ, Stoof J, van Vliet AH, Kusters JG. The Helicobacter pylori plasticity region locus jhp0947–jhp0949 is associated with duodenal ulcer disease and interleukin-12 production in monocyte cells. FEMS Immunol Med Microbiol. 2004;41:161–167. doi: 10.1016/j.femsim.2004.03.003. [DOI] [PubMed] [Google Scholar]
- 32.De R, Kundu P, Swarnakar S, Ramamurthy T, Chowdhury A, Nair GB, Mukhopadhyay AK. Antimicrobial activity of curcumin against Helicobacter pylori isolates from India and during infections in mice. Antimicrob Agents Chemother. 2009;53:1592–1597. doi: 10.1128/AAC.01242-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current Protocols in Molecular Biology. New York: Greene Publishing and Wiley-Interscience; 1993. [Google Scholar]
- 34.Alam J, Maiti S, Ghosh P, De R, Chowdhury A, Das S, Macaden R, Devarbhavi H, Ramamurthy T, Mukhopadhyay AK. Significant association of the dupA gene of Helicobacter pylori with duodenal ulcer development in a South-east Indian population. J Med Microbiol. 2012;61:1295–1302. doi: 10.1099/jmm.0.038398-0. [DOI] [PubMed] [Google Scholar]
- 35.Atherton JC, Cao P, Peek RM, Jr, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:17771–17777. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
