Skip to main content
Genetics and Molecular Biology logoLink to Genetics and Molecular Biology
. 2016 Jan-Mar;39(1):49–53. doi: 10.1590/1678-4685-GMB-2015-0037

Genetic analysis reveals candidate species in the Scinax catharinae clade (Amphibia: Anura) from Central Brazil

Lídia Nogueira 1, Mirco Solé 2, Sérgio Siqueira 3, Paulo Roberto Antunes de Mello Affonso 3, Christine Strüssmann 4, Iracilda Sampaio 5
PMCID: PMC4807394  PMID: 27007898

Abstract

Scinax (Anura: Hylidae) is a species-rich genus of amphibians (113 spp.), divided into five species groups by morphological features. Cladistic analyses however revealed only two monophyletic clades in these groups: Scinax catharinae and Scinax ruber. Most species from the S. catharinae clade are found in Atlantic rainforest, except for Scinax canastrensis,S. centralis, S. luizotavioi, S. machadoi,S. pombali and S. skaios. In the present work, specimens of Scinax collected in Chapada dos Guimarães, central Brazil, were morphologically compatible with species from theS. catharinae group. On the other hand, genetic analysis based on mitochondrial (16S and 12S) and nuclear (rhodopsin) sequences revealed a nucleotide divergence of 6 to 20% between Scinax sp. and other congeners from the Brazilian savannah (Cerrado). Accordingly, Bayesian inference placed Scinax sp. in the S. catharinae clade with high support values. Hence, these findings strongly indicate the presence of a new species in the S. catharinae clade from the southwestern portion of the Brazilian savannah. To be properly validated as a novel species, detailed comparative morphological and bioacustic studies with other taxa from Brazil such asS. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios are required.

Keywords: Amphibians, DNA barcode, Cerrado, rDNA


The genus Scinax encompasses 113 species with a widespread distribution from southern Mexico to Argentina, Uruguay, St. Lucia and Trinidad and Tobago islands (Frost, 2015). Duellman and Wiens (1992) recognized seven species groups in this genus by means of morphological analyses (S. catharinae, S. perpusillus, S. rizibilis, S. rostratus, S. ruber, S. staufferi and S. x-signatus). Later, the groups S. rizibilis and S. x-signatus were regarded as synonyms of S. catharinae and S. ruber, respectively (Pombal et al., 1995a). Cladistic inferences however recovered only two monophyletic clades: S. catharinae (including the groups S. catharinae, S. staufferi and S. perpusillus) and S. ruber (encompassing the groups S. rostratus, S. ruber and some species within S. staufferi) (Faivovich, 2002; Faivovich et al., 2005).

The S. catharinae group (Frost, 2015) is characterized by the lack of an anterior process in the suprascapula, m. depressor mandibulae without an origin at the dorsal fascia of the m. dorsalis scapulae, distal division of the middle branch of the m. extensor digitorum comunis longus, and insertion of this muscle at the medial side on the tendon of the m. extensor brevis medius digiti IV (Faivovich, 2002). The vocalization of frogs from this group is usually composed of short notes and, sometimes, displays harmonic structure (Pombal et al., 1995a, b).

Most species in this group are distributed throughout the Atlantic rainforest (Faivovich et al., 2005). The only exceptions reported so far include S. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios, which were observed in gallery forests within the Brazilian savannah (Cerrado) and in central and southeastern Brazil (Pombal and Bastos, 1996;Pombal et al., 2010; Lourenço et al., 2013).

During inventories of herpetofauna carried out for the Management Plan of Chapada dos Guimarães National Park in the southwestern Cerrado, some samples ofScinax morphologically compatible with species of S. catharinae group were collected, but these specimens were differentiated from all other species described so far. Therefore, the goal of the present study was to perform a molecular analysis of these samples as an additional tool to their taxonomic identification, besides verifying the presence of a putative new representative in theS. catharinae clade in areas distant from their center of origin.

Eight individuals of Scinax sp. were collected on April 04, 2006 in deep gallery forests alongside headwaters of the Coxipó River, in Chapada dos Guimarães, state of Mato Grosso, Brazil (Figure 1, Table 1). The specimens were deposited in the Vertebrate Collection of the Universidade Federal de Mato Grosso (UFMT). Approximately 25 mg of muscle were removed from the inner thigh of each specimen and preserved in ethanol 95% at – 20 °C for molecular analyses.

Figure 1. Map of Brazil showing the collection sites of Scinax sp. in Chapada dos Guimarães, Mato Grosso, Brazil (red triangle).

Figure 1

Table 1. Description of anuran samples used in the present study.

Voucher Species Clade Country/Locality/State Coordinates GenBank Accession Number
16S 12S Rhodopsin
MACN 36999 Hypsiboas faber Argentina: San Vicente, Misiones 26°37'S54°08'W AY549333 AY549333 AY844607
MZUESC9759 Scinax agilis S. catharinae Brazil: Conceição da Barra, Espirito Santo 18°25'S, 39°42'W KT438894 KT438883 KT438902
Scinax berthae S. catharinae Argentina: Buenos Aires 34°36'S 58°22'W AY843754 AY843754 AY844740
MCP3734 Scinax catharinae S. catharinae Brazil: São Francisco de Paula, Rio Grande Do Sul 29°26'S 50°35'W AY843756 AY843756 AY844742
MVZFC 14457 Scinax elaeochroa S. ruber Costa Rica: Heredia 10°07'N83°33'W AY843757 AY843757 AY844743
WED 54071 Scinax garbei S. ruber Ecuador: Riobamba, Chimborazo 01°40'S78°38'W AY326033 AY326033 DQ283759
MACN 38650 Scinax nasicus S. ruber Argentina: Buenos Aires 34°36'S 58°22'W AY843759 AY843759 AY844745
LH401 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438886 KT438875 KT43889
LH905 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438887 KT438876 KT438898
LH900 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438888 KT438877 KT438899
LH902 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438889 KT438878 KT438900
LH908 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438890 KT438879 KT438901
LH909 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438891 KT438880
LH904 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438892 KT438881
LH903 Scinax sp. S. catharinae Brazil Chapada dos Guimarães, Mato Grosso 15°28' S, 55°48'W KT438893 KT438882
MZUESC11079 Scinax strigilatus S. catharinae Brazil Camacan, Bahia 15°24'S, 39°30'W KT438895 KT438884
MZUESC11080 Scinax strigilatus S. catharinae Brazil Camacan, Bahia 15°24'S, 39°30'W KT438896 KT438885
CFBH 5788 Scinax uruguayas S. ruber Brazil Cambará do Sul, Rio Grande do Sul 29°02'S, 50°08'W AY843681 AY843681 AY844674

Total DNA was extracted by using the Wizard® Genomic Purification kit (Promega), following manufacturer's instructions. The primer pairs used to amplify 16S, 12S, and rhodopsin, respectively, were: L1- 5'GCCTCGC TTGTTTACCAAAAAC −3 (Palumbi, 1996) and H1 – 5'CCGGTCTGAACTCAGATCACGT 3' (Varela et al., 2007); L1- 5'AAAAAGCTTCAAACTGGGATTAGAT ACCCCACTAT3' and H1- 5'TGACTGCAGAGGGTGA CGGGCGGTGTGT3' (Kocher et al., 1989), and Rhod-L1 5'ACCATGAACGGAACAGAAGGYCC 3' and Rhod-H1 5'GTAGCGAAGAARCTTCAAMGTA 3' (Bossuyt and Milinkovitch, 2000).

The PCR conditions consisted of an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C (12S and 16S) or 49 °C (rhodopsin) for 40 s and extension at 72 °C for 30 s, plus a final extension step at 72 °C for 7 min. Subsequently, the reaction products were purified and sequenced in an ABI 3500XL Genetic Analyzer automatic sequencer (Applied Biosystems). Sequencing reactions were carried out by using terminal dideoxynucleotides (Sanger et al., 1977). The sequences were then aligned with Clustal W available in the software BioEdit v. 5.09 (Hall, 1999). The software GBlocks 0.91 (Castresana, 2000) was used to eliminate poorly aligned positions and divergent region portions of 16S, according to the following parameters: minimum number of sequences for a flank position to 10, maximum number of contiguous nonconserved positions to 08, minimum length of a block to 2, and allowed gap positions to within half.

To estimate the divergence matrix and phylogeny we added sequences of seven other anuran species from GenBank to our data set: S. catharinae, Scinax berthae, Scinax uruguayus, Scinax garbei, Scinax elaechroa, Scinax nasicus andHypsiboas faber (outgroup). Two other species from the S. catharinae clade collected in Bahia, northeastern Brazil and Espirito Santo, southeastern Brazil, were also included in our analysis: Scinax strigilatus and Scinax agilis (Table 1).

Genetic divergence was estimated using the Kimura-2-parameter (K2P) substitution model (Kimura, 1980) in the software MEGA v. 5.0 (Tamura et al., 2011). The 16S, 12S and rhodopsin sequences were concatenated in the software DnaSP, v. 4.0 (Librado and Rozas, 2009).

A Bayesian phylogeny was inferred using the software MrBayes 3.1 (Ronquist and Huelsenbeck, 2003). The best mutation model was estimated according to Akaike Information Criteria – AIC in the software jModel Test 0.1 (Posada, 2008). Two runs (four chains each) with 20 million generations were performed with trees being sampled at every 1000 generations. Adequate burn-in was determined by examining likelihood scores of the heated chains for convergence on stationarity, as well as the effective sample size of values in Tracer 1.5 (Rambaut and Drummond, 2007). We discarded 10% of the generations/trees. We considered relationships strongly supported when posterior probabilities were equal to or higher than 0.95.

Eighteen sequences of 16S and 12S were obtained from each of the nineScinax species, comprising 423 bp (164 variable sites) and 386 bp (131 variable sites) for each fragment respectively. For rhodopsin, 13 sequences of 316 bp with 51 variable sites were obtained from eight Scinaxrepresentatives.

The intraspecific nucleotide divergence in Scinax sp. was 0.2% for 16S, 0.3% for 12S, 0.2% for combined 12S+16S, and 0% for the rhodopsin. The nucleotide divergence of Scinax sp. in relation to the other species ranged from 6 to 13%, 7 to 20%, 6 to 18% and 0.6 to 6% for 16S, 12S, 16S+12S and rhodopsin, respectively (Table 2).

Table 2. Interspecific nucleotide divergence within Scinax (Anura: Hylidae) based on K2P model of 16S (above diagonal), combined 12S+16S (above diagonal in parentheses), 12S (below diagonal) and Rhodopsin (below diagonal in parentheses) genes. The species 1 to 5 belong to the S. catharinae clade, while the species 6 to 9 belong to the S. ruber clade; H. faber (10) was used as outgroup.

Species 1 2 3 4 5 6 7 8 9 10
S. catharinae clade 1. S. agilis 0.10 0.11 0.10 0.10 0.12 0.13 0.19 0.18 0.16
(0.05) (0.06) (0.06) (0.06) (0.03) (0.05) (0.04) (0.05)
2. S. berthae 0.10 0.05 0.06 0.05 0.10 0.12 0.17 0.15 0.15
(0.10) (0.03) (0.03) (0.06) (0.04) (0.04) (0.06) (0.06)
3. S. catharinae 0.10 0.04 0.05 0.06 0.10 0.12 0.18 0.14 0.15
(0.10) (0.04) (0.01) (0.06) (0.05) (0.06) (0.07) (0.05)
4. Scinax sp. 0.10 0.06 0.06 0.07 0.12 0.15 0.21 0.16 0.15
(0.10) (0.06) (0.05) (0.05) (0.04) (0.05) (0.06) (0.04)
5. S. strigilatus 0.10 0.06 0.06 0.07 0.10 0.13 0.17 0.15 0.16
(0.10) (0.06) (0.06) (0.07)
S. ruber clade 6. S. uruguayus 0.15 0.13 0.12 0.11 0.12 0.10 0.17 0.13 0.15
(0.13) (0.12) (0.11) (0.11) (0.11) (0.02) (0.03) (0.04) (0.05)
7. S. elaeochrous 0.13 0.13 0.13 0.13 0.12 0.11 0.16 0.12 0.15
(0.13) (0.12) (0.12) (0.13) (0.12) (0.10) (0.01) (0.02) (0.04)
8. S. nasicus 0.12 0.13 0.13 0.13 0.12 0.14 0.07 0.16 0.21
(0.15) (0.14) (0.15) (0.16) (0.14) (0.15) (0.11) (0.03) (0.06)
9. S. garbei 0.14 0.13 0.14 0.12 0.13 0.11 0.10 0.13 0.20
(0.15) (0.14) (0.14) (0.13) (0.14) (0.11) (0.10) (0.14) (0.05)
10. Outgroup 0.16 0.15 0.15 0.15 0.16 0.17 0.14 0.16 0.15
(0.16) (0.15) (0.15) (0.15) (0.16) (0.16) (0.15) (0.18) (0.17)

The Bayesian consensus phylogeny (16S + 12S + rhodopsin) placed Scinaxsp. as a distinct clade with strong support, being closely related to S. berthae, S. catharinae, S. strigilatus and S. agilis, all belonging to the S. catharinae clade (Figure 2 and Table 2). The four species from the S. ruber clade also formed a monophyletic group with strong support.

Figure 2. Bayesian consensus phylogeny based on combined analysis of 12S, 16S and rhodopsin (1,123 bp) of Scinax species, using H. faber as outgroup. Posterior probabilities higher than 0.95 are shown. The S. catharinae clade is highlighted in red while theS. ruber clade is highlighted in black. Scinax sp. (Chapada dos Guimarães, Mato Grosso, Brazil) corresponds to the specimens collected in this study.

Figure 2

Even though the cytochrome C oxidase I (COI) gene has been elected as a universal DNA barcode in animals (Hebert et al., 2003), the 16S gene seems to be more effective to discriminate amphibian species (Vences et al., 2005), thus being used in the present study. Indeed, the genetic distances of 7 to 10% in 16S rDNA observed between Scinax sp. and the other known species in theS. catharinae clade (S. berthae, S. catharinae, S. strigilatus and S. agilis) (Table 2) are higher than the minimum value of 3% in nucleotide divergence proposed by Fouquet et al.(2007) to discriminate anuran species. Moreover, sequences of 12S and rhodopsin (nuclear) were also included to provide additional support to our hypothesis of a new species in the S. catharinae clade occuring in the Chapada dos Guimarães.

Many researchers advocate the integration of multiple approaches (molecular, cytogenetic, morphological and ecological studies) for identifying species (Dayrat, 2005; Padial et al., 2010). According to the nomenclature rules established byVieites et al. (2009),Scinax sp. could be classified as an "unconfirmed candidate species" (UCS), depending on additional morphological, ecological and vocalization studies to confirm its taxonomic status.

In conclusion, our molecular data provide evidence of a new species in the S. catharinae clade occurring in the Chapada dos Guimarães region, central Brazil. However, further morphological and bioacoustical analyses should be performed and focused on comparative data with other species from the S. catharine clade from Brazilian savannah, such as S. canastrensis, S. centralis, S. luizotavioi, S. machadoi, S. pombali and S. skaios.

Acknowledgments

The authors are grateful to CAPES and CNPq for the financial support and the Brazilian Environmental Agency ICMBio for the logistic support during field trips. The biological material was collected with permission of IBAMA (license 223/2005 from Sept. 14, 2005). CS, IS and MS thank CNPq for research fellowships (Bolsa de Produtividade em Pesquisa; processes # 309541/2012–3, # 306416/2013-1 and # 307165/2012-4).

Footnotes

Associate Editor: Antonio Mateo Solé

References

  1. Bossuyt F, Milinkovitch MC. Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proc Natl Acad Sci USA. 2000:976585–976590. doi: 10.1073/pnas.97.12.6585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000;17:540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [DOI] [PubMed] [Google Scholar]
  3. Dayrat B. Integrative taxonomy. Biol J Linn Soc. 2005;85:407–415. [Google Scholar]
  4. Duellman WE, Wiens JJ. The status of the hylid frog genus Ololygon and the recognition of Scinax Wagler, 1830. Occas. Pap Mus Nat Hist Univ Kansas. 1992;151:1–23. [Google Scholar]
  5. Faivovich J. A cladistic analysis of Scinax (Anura: Hylidae) Cladistics. 2002;18:367–393. doi: 10.1111/j.1096-0031.2002.tb00157.x. [DOI] [PubMed] [Google Scholar]
  6. Faivovich J, Haddad CFB, Garcia PC, Frost DR, Campbell JA, Wheeler WC. Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. Bull Am Mus Nat Hist. 2005;294:6–229. [Google Scholar]
  7. Fouquet A, Gilles A, Vences M, Marty C. Underestimation of species richness in Neotropical frogs revealed by mtDNA analyses. PLoS One. 2007;10: doi: 10.1371/journal.pone.0001109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids. Symp Ser. 1999;41:95–98. [Google Scholar]
  9. Hebert PDN, Cywinska A, Ball SL, Waard JR. Biological identifications through DNA barcodes. Proc R Soc Lond. 2003;270:313–321. doi: 10.1098/rspb.2002.2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  11. Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, Wilson AC. Dymamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci USA. 1989;86:6196–6200. doi: 10.1073/pnas.86.16.6196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Librado P, Rozas J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:1451–1452. doi: 10.1093/bioinformatics/btp187. [DOI] [PubMed] [Google Scholar]
  13. Lourenço ACC, Carvalho ALG, Baêta D, Pezzuti TL, Leite FSF. A new species of the Scinax catharinae group (Anura, Hylidae) from Serra da Canastra, southwestern state of Minas Gerais, Brazil. Zootaxa. 2013;3613:573–588. doi: 10.11646/zootaxa.3613.6.4. [DOI] [PubMed] [Google Scholar]
  14. Padial JM, Miralles AD, De la, Riva I, Vences M. The integrative future of taxonomy. Front Zool. 2010;7:1–14. doi: 10.1186/1742-9994-7-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Palumbi SR. Nucleic acids II: The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK, editors. Molecular systematics. Sinauer Associates, Inc; Sunderland, MA: 1996. pp. 205–247. [Google Scholar]
  16. Pombal JJ, Bastos RP. Nova espécie de Scinax Wagler, 1830 do Brasil Central (Amphibia, Anura, Hylidae) Bol Mus Nac. 1996;371:1–11. [Google Scholar]
  17. Pombal JJ, Haddad CFB, Kasahara S. Anew species of Scinax (Anura: Hylidae) from southeastern Brazil, with comments on the genus. J Herpetol. 1995a;29:1–6. [Google Scholar]
  18. Pombal JJ, Bastos RP, Haddad CFB. Vocalizações de algumas espécies do gêneroScinax (Anura, Hylidae) do sudeste do Brasil e comentários taxonômicos. Naturalia. 1995b;20:213–225. [Google Scholar]
  19. Pombal JJ, Carvalho RRJ, Canelas MAS, Bastos RP. A new Scinax of the S. catharinae species group from Central Brazil (Amphibia: Anura: Hylidae) Zoologia. 2010;27:795–802. [Google Scholar]
  20. Posada D. jModelTest: Phylogenetic Model Averaging. Mol Biol Evol. 2008;25:1253–1256. doi: 10.1093/molbev/msn083. [DOI] [PubMed] [Google Scholar]
  21. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  22. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;12:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Varela ES, Beasley CR, Schneider H, Sampaio I, Marques-Silva NS, Tagliaro CH. Molecular phylogeny of mangrove oysters (Crassostrea) from Brazil. J Molluscan Stud. 2007;73:229–234. [Google Scholar]
  25. Vences M, Thomas M, Bonett RM, Vieites DR. Deciphering amphibian diversity through DNA barcoding: chances and challenges. Phil Trans R Soc B. 2005;360:1859–1868. doi: 10.1098/rstb.2005.1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Vieites DR, Wollenberg KC, Andreone F, Köhler J, Glaw F, Vences M. Vast underestimation of Madagascar's biodiversity evidenced by an integrative amphibian inventory. Proc Natl Acad Sci USA. 2009;106:8267–8272. doi: 10.1073/pnas.0810821106. [DOI] [PMC free article] [PubMed] [Google Scholar]

Internet Resources

  1. Frost DR. Version 6.0. American Museum of Natural History. New York, USA: 2015. [accessed July 27, 2015]. Amphibian Species of the World: An Online Reference. http://research.amnh.org/herpetol-ogy/amphibia/index.html. [Google Scholar]
  2. Rambaut A, Drummond A. TRACER. University of Oxford; 2007. MCMC Trace Analysis Tool, Version 1.4. http://tree.bio.ed.ac.uk/software/tracer. [Google Scholar]

Articles from Genetics and Molecular Biology are provided here courtesy of Sociedade Brasileira de Genética

RESOURCES