Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2016 May 25;6:26387. doi: 10.1038/srep26387

Comparative Mitochondrial Genome Analysis of Eligma narcissus and other Lepidopteran Insects Reveals Conserved Mitochondrial Genome Organization and Phylogenetic Relationships

Li-Shang Dai 1,*, Bao-Jian Zhu 1,*, Yue Zhao 1, Cong-Fen Zhang 1, Chao-Liang Liu 1,a
PMCID: PMC4879558  PMID: 27222440

Abstract

In this study, we sequenced the complete mitochondrial genome of Eligma narcissus and compared it with 18 other lepidopteran species. The mitochondrial genome (mitogenome) was a circular molecule of 15,376 bp containing 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes and an adenine (A) + thymine (T) − rich region. The positive AT skew (0.007) indicated the occurrence of more As than Ts. The arrangement of 13 PCGs was similar to that of other sequenced lepidopterans. All PCGs were initiated by ATN codons, except for the cytochrome c oxidase subunit 1 (cox1) gene, which was initiated by the CGA sequence, as observed in other lepidopterans. The results of the codon usage analysis indicated that Asn, Ile, Leu, Tyr and Phe were the five most frequent amino acids. All tRNA genes were shown to be folded into the expected typical cloverleaf structure observed for mitochondrial tRNA genes. Phylogenetic relationships were analyzed based on the nucleotide sequences of 13 PCGs from other insect mitogenomes, which confirmed that E. narcissus is a member of the Noctuidae superfamily.


The Ailanthus defoliator Eligma narcissus is a member of the family Noctuidae (superfamily Noctuidae), which has spread all over China. This insect pest completes three or four generations every year. It is an important species that is harmful to many plants of economic importance, such as Ailanthus altissima, Amygdalus persica L., Toona sinensis, and others1. Many studies have been conducted on the biology and chemical pest control of E. narcissus1,2. However, no research has been conducted on its mitochondrial genome.

Insect mitochondrial DNA (mtDNA) has been widely used for species identification and for population genetics and molecular evolution studies due to the low or lack of sequence recombination and its maternal inheritance3. In most insects, mtDNA is composed of small, double strands: an L-strand, which is biased in favor of As and Cs, and an H-strand, which has an abundance of Ts and Gs4. Moreover, the mtDNA is a relatively conserved circular molecule of 14–19 kb in length5 and includes 13 protein-coding genes (PCGs: atp6, atp8, cox1, cox2, cox3, cob, nad1, nad2, nad3, nad4, nad5, nad6, and nad4L), large and small ribosomal RNA (rrnL and rrnS) genes, 22 transfer RNA (tRNA) genes and a large non-coding element called the A+T-rich region that contains sequences essential for the initiation of transcription and gene replication6.

Lepidoptera (moths and butterflies) is the second largest order in Insecta, accounting for more than 155,000 insect species7. Although the superfamily Noctuidae is the largest superfamily in Lepidoptera, only few mitogenomes of Noctuidae are available in GenBank (Table 1). In the present study, we determined the complete mitogenome sequence of E. narcissus and compared the nucleotide composition, codon usage, tRNA secondary structure and A+T rich region with those of other lepidopteran species. Furthermore, the concatenated nucleotide sequence of 13 PCGs of E. narcissus was used to provide insight into the phylogenetic relationships among lepidopteran superfamilies.

Table 1. Lepidopteran mitogenomes used in this study.

Superfamily Family Species Acc. number Refference
Noctuoidea Noctuidae Eligma narcissus   This study
    Agrotis ipsilon KF163965 32
    Helicoverpa armigera GU188273 12
    Helicoverpa assulta KR149448 unpublished
    Sesamia inferens NC_015835 unpublished
  Erebidae Hyphantria cunea GU592049 33
  Notodontidae Phalera flavescens JF440342 34
  Lymantriidae Lymantria dispar NC_012893 unpublished
Bombycoidea Bombycidae Bombyx mori NC_002355 unpublished
  Saturniidae Actias selene NC_018133 9
  Sphingidae Manduca sexta EU286785 35
Pyraloidea Crambidae Elophila interruptalis NC_021756 36
  Pyralidae Corcyra cephalonica NC_016866 unpublished
Tortricoidea Tortricidae Acleris fimbriana NC_018754 unpublished
    Adoxophyes orana NC_021396 37
Gelechioidea Oecophoridae Promalactis suzukiella KM875542 38
Papilionoidea Papilionidae Papilio syfanius NC_023978 39
    Teinopalpus aureus NC_014398 unpublished
  Nymphalidae Polyura nepenthes NC_026073 unpublished

Results and Discussion

Genome organization and base composition

The complete mitogenome of E. narcissus is a circular molecule of 15,376 bp in size (Fig. 1), which is bigger than the genomes of A. selene (15,236 bp) and H. armigera (15,347 bp) but smaller than the genomes of P. flavescens (15,659 bp) and M. sexta (15,516 bp). The mitogenome of E. narcissus contains a remarkably conserved set of 37 genes, including 13 protein-coding genes (PCGs: atp6, atp8, cox1, cox2, cox3, cob, nad1, nad2, nad3, nad4, nad5, nad6, and nad4L), large and small ribosomal RNA (rrnL and rrnS) genes, 22 transfer RNA (tRNA) genes and a large non-coding element called the A+T-rich region. The gene order is the same as in other sequenced Noctuidae mitogenomes8,9,10, with a trnM-trnI-trnQ order, which is different from the ancestral trnI-trnQ-trnM order11. The nucleotide composition (A: 40.78%, T: 40.21%, G: 7.68%, C: 11.33%) of the E. narcissus mitogenome is biased toward A+T nucleotides (80.99%), which is a higher percentage than that of six other lepidopterans but a lower percentage than that of M. sexta (81.79%) (Table 2). The positive AT skew (0.007) indicates the occurrence of more As than Ts, similar to some lepidopterans such as H. armigera (0.001)12, O. lunifer (0.030)13, and the Chinese B. mandarina (0.057)14.

Figure 1. Circular map of the mitogenome of E. narcissus. cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits.

Figure 1

cob refers to cytochrome b. nad1-nad6 refer to NADH dehydrogenase components. rrnL and rrnS refer to ribosomal RNAs. tRNAs are denoted as a one-letter symbol according to the IUPAC-IUB single-letter amino acid codes. Gene names with lines indicate that these genes are located on L strand, whereas the others are located on H strand.

Table 2. Composition and skewness in the lepidopteran mitogenomes.

Species Size (bp) A% G% T% C% A+T % ATskewness GCskewness
Whole genome
 E. narcissus 15,376 40.78 7.68 40.21 11.33 80.99 0.007 −0.192
 H. armigera 15,347 40.54 7.69 40.43 11.34 80.97 0.001 −0.192
 O. lunifer 15,593 40.09 7.56 37.75 14.60 77.84 0.030 −0.318
 P. flavescens 15,659 40.07 7.87 40.80 11.26 80.87 −0.009 −0.177
 B. mandarina 15,682 43.11 7.40 38.48 11.01 81.59 0.057 −0.196
 A. selene 15,236 38.54 8.05 40.37 13.03 78.91 −0.023 −0.236
 M. sexta 15,516 40.67 7.46 41.11 10.76 81.79 −0.005 −0.181
PCG
 E. narcissus 11,190 40.68 8.40 37.72 13.20 78.42 0.038 −0.222
 H. armigera 11,203 34.25 10.62 45.18 9.95 79.43 −0.138 0.033
 O. lunifer 11,266 32.47 12.08 43.26 12.19 75.73 −0.142 −0.004
 P. flavescens 11,206 39.40 8.90 39.56 12.15 78.96 −0.002 −0.154
 B. mandarina 11,196 42.83 8.26 37.04 11.87 79.87 0.072 −0.179
 A. selene 11,231 37.93 8.74 39.44 13.89 77.37 −0.020 −0.228
 M. sexta 11,178 40.40 8.22 39.89 11.49 80.29 0.006 −0.166
tRNA
 E. narcissus 1450 41.52 8.00 40.48 10.00 82.00 0.013 −0.111
 H. armigera 1473 41.41 8.15 40.39 10.05 81.81 0.012 −0.104
 O. lunifer 1666 41.78 7.32 39.86 11.04 81.63 0.023 −0.202
 P. flavescens 1474 41.66 7.80 40.64 9.91 82.29 0.012 −0.119
 B. mandarina 1472 41.78 7.81 39.95 10.46 81.73 0.022 −0.145
 A. selene 1459 40.37 8.16 40.23 11.24 80.60 0.002 −0.159
 M. sexta 1470 41.09 8.16 40.68 10.07 81.77 0.005 −0.145
rRNAs
 E. narcissus 2122 41.89 5.00 42.60 10.51 84.50 −0.008 −0.355
 H. armigera 2189 41.75 4.89 43.40 9.96 85.15 −0.019 −0.341
 O. lunifer 2157 41.96 4.82 40.19 13.03 82.15 0.022 −0.460
 P. flavescens 2198 41.31 4.73 44.04 9.92 85.35 −0.032 −0.354
 B. mandarina 2134 43.86 4.78 41.05 10.31 84.91 0.028 −0.366
 A. selene 2126 39.93 4.99 43.79 11.29 83.73 −0.046 −0.387
 M. sexta 2168 41.37 4.84 44.05 9.73 85.42 −0.031 −0.335
A+T-rich region
 E. narcissus 434 47.47 1.15 49.08 2.30 96.54 −0.017 −0.332
 H. armigera 328 44.51 1.22 50.61 3.66 95.12 −0.064 −0.500
 O. lunifer 319 44.5 1.6 48.9 5.0 93.4 −0.047 −0.524
 P. flavescens 541 42.14 2.22 49.72 5.91 91.87 −0.083 −0.454
 B. mandarina 484 46.49 2.69 47.93 2.89 94.42 −0.015 −0.036
 A. selene 339 43.07 5.90 44.84 6.19 87.91 −0.020 −0.024
 M. sexta 324 45.06 1.54 50.31 3.09 95.37 −0.055 −0.419

In the mitogenome of E. narcissus, there are a total of 34 bp that contain overlapping genes. The 34 bp gene overlap in 11 positions of the E. narcissus mitogenome ranges in size from 1 to 8 bp, and the longest overlapping region is present between trnW and trnC. A total of 192 bp of intergenic spacers are dispersed in 16 regions and range in size from 1 to 52 bp, with the longest spacer present between trnQ and nad2. The length of the intergenic spacers is considerably longer than that of A. selene (137 bp over 13 regions) but shorter than that of O. lunifer (371 bp over 20 regions)9,13.

Protein-coding genes and codon usage

The 13 PCGs of E. narcissus are 11,181 bp in length, accounting for 72.72% of the entire mitochondrial genome. Like other lepidopterans, all 13 PCGs in the E. narcissus mitogenome have ATN as their start codon, except for the cox1 gene, which uses CGA instead. The start codon of the cox1 is rare in insect mtDNA; the canonical codons TTG, ACG, TTA and TTAG are often reported as the cox1 start codons15,16,17,18. Ten of the 13 PCGs harbor the complete stop codon TAA, whereas the other three possess the incomplete termination codon T for cox1 and cox2, and TA for nad4 (Table 3). Incomplete stop codons are commonly observed in lepidopteran species9,19.

Table 3. Annotation and gene organization of the Eligma narcissus mitogenome.

Gene Direction Location Size Anticodon Start codon Stop codon Intergenic nucleotides*
trnM F 1–67 67 CAT – – 0
trnI F 68–132 65 GAT – – −3
trnQ R 130–198 69 TTG – – 52
nad2 F 251–1264 1014 – ATT TAA 1
trnW F 1266–1334 69 TCA – – −8
trnC R 1327–1394 68 GCA – – 2
trnY R 1397–1461 65 GTA – – 2
cox1 F 1464–2997 1534 – CGA T −1
trnL2(UUR) F 2995–3061 67 TAA – – 0
cox2 F 3062–3743 682 – ATG T 0
trnK F 3744–3814 71 CTT – – 7
trnD F 3822–3887 66 GTC – – 0
atp8 F 3888–4052 165 – ATC TAA −7
atp6 F 4046–4723 678 – ATG TAA −1
cox3 F 4723–5511 789 – ATG TAA 2
trnG F 5514–5578 65 TCC – – 0
nad3 F 5579–5932 354 – ATT TAA 42
trnA F 5975–6039 65 TGC – – 2
trnR F 6042–6104 63 TCG – – 6
trnN F 6111–6175 65 GTT – – 5
trnS1(AGN) F 6181–6251 71 GCT – – −1
trnE F 6251–6315 65 TTC – – 4
trnF R 6320–6386 67 GAA – – −2
nad5 R 6391–8132 1742 – ATT TAA −2
trnH R 8131–8197 67 GTG – – −2
nad4 R 8196–9531 1336 – ATA TA −6
nad4L R 9526–9812 287 – ATT TAA 23
trnT F 9836–9899 64 TGT – – 0
trnP R 9900–9963 64 TGG – – 7
nad6 F 9971–10,507 537 – ATA TAA −1
cob F 10,507–11,654 1148 – ATG TAA 3
trnS2(UCN) F 11,658–11,723 66 TGA – – 30
nad1 R 11,754–12,683 930 – ATT TAA 4
trnL1(CUN) R 12,688–12,754 67 TAG – – 0
rrnL R 12,755–14,089 1335 – – – 0
trnV R 14,090–14,155 66 TAC – – 0
rrnS R 14,156–14,942 787 – – – 0
CR   14,943–15,376 434 – – – –

The 13 PCGs of the E. narcissus mitogenome contain 3727 codons in total, which is within the range of 3687 in H. armigera and 3742 in Agrotis ipsilon. The complete nucleotide sequences of seven lepidopteran insects were downloaded from GenBank to investigate the codon usage among lepidopterans. These mitogenomes are divided into five superfamilies: four species belong to Noctuidae, and the others belong to Bombycoidea, Pyraloidea, Gelechioidea, and Papilionoidea (Fig. 2). We looked at the behavior of codon families in the PCGs and found that Asn, Ile, Leu, Phe, and Tyr are the most abundant amino acids in the E. narcissus mitogenome (Fig. 3). RSCU for Lepidoptera is shown in Fig. 4. All possible codons are present in the PCGs of the E. narcissus mitogenome, whereas some codons, such as GCG, GGC, GTG and CGC, are not found in four other species. Previous research indicates that codons with high G and C content are likely not to be favored, a phenomenon that is found in some lepidopteran insects7,20.

Figure 2. Comparison of codon usage in mitochondrial genomes in Lepidoptera.

Figure 2

Lowercase letters (a–e) above the species name represent the superfamily that the species belong to ((a) Noctuidae, (b) Bombycoidea, (c) Pyraloidea, (d) Gelechioidea, (e) Papilionoidea).

Figure 3. Codon distribution in Lepidoptera.

Figure 3

CDspT, codons per thousand codons.

Figure 4. The mitochondrial genome relative synonymous codon usage (RSCU) across five superfamilies in Lepidoptera.

Figure 4

Codon families are provided on the X axis. Codons indicated above the bar are not present in the mitogenome.

Ribosomal RNA genes and transfer RNA genes

As with all other insect mitogenome sequences, there were two rRNAs in E. narcissus with a total length of 2122 bp. The large ribosomal gene (rrnL), located between trnL1(CUN) and trnV, had a length of 1335 bp, whereas the small one (rrnS), located between trnV and the A+T- rich region, had a length of 786 bp. The negative AT skew (−0.335) indicated the occurrence of more Ts than As. The A+T content of the two rRNA genes was 84.50%, which was within the range of 82.15% in O. lunifer and 85.42% in M. sexta (Table 2).

The E. narcissus mitogenome contained 22 tRNAs interspersed throughout the entire genome and ranging in size from 63 to 71 bp, which comprised 1450 bp of the total mitogenome overall. Of these genes, 14 were encoded by the H-strand, and eight were encoded by the L-strand. The predicted structures of the tRNAs are shown in Fig. 5. The A+T content of the 22 tRNAs was 82.00%, with a positive AT skew (0.013). A total of 11 mismatched base pairs were identified in the tRNAs of E. narcissus, three of them being mismatched base pairs (1 A–A and 2 U-U) and eight being G-U wobble pairs. In many insect mitogenomes, the trnS1 (AGN) gene has an unusual secondary structure lacking a stable stem-loop structure in the DHU arm9,19; however, we found that all the tRNA genes in E. narcissus could be folded into the expected typical cloverleaf secondary structure observed in mitochondrial tRNA genes. All of the secondary structures were drawn using the RNA structure program.

Figure 5. Predicted secondary cloverleaf structures of E. narcissus tRNA genes.

Figure 5

The A+T-rich region

The A+T-rich region, known for the initiation of replication in vertebrates and invertebrates, is located between the rrnS and trnM genes in E. narcissus. This region is 434 bp in length, which is longer than the regions in A. selene (339 bp) and M. sexta (324 bp) but shorter than the regions in Chinese B. mandarina (484 bp) and P. flavescens (541 bp) (Table 2). The region contains the highest A+T content (96.54%) in the mitogenome. There are some conserved structures observed in the E. narcissus A+T-rich region, including the motif ‘ATAGA’ followed by an 19 bp poly-T stretch, the motif ‘ATTTA’ followed by a microsatellite-like (AT) motif 6 and a poly-A element upstream of the trnM gene (Fig. 6). The poly-T is located upstream of the rrnS 5′-end and is preceded by the ‘ATAGA’ motif, a structural feature that is found in the majority of lepidopteran insects (Fig. 7). Previous research indicates that the poly-T element may be involved in controlling transcription and replication initiation21. Two repeat elements are found in the A+T-rich region of the E. narcissus mitogenome. Some lepidopteran insects also have repeat elements in the A+T-rich region. The A+T-rich region of S. longistyla harbors two repeat elements22, whereas the C. medinalis and C. suppressalis mitogenomes contain a duplicated 25 bp repeat element and a duplicated 36 bp repeat element, respectively20.

Figure 6. Features present in the A+T-rich region of E. narcissus.

Figure 6

The motif, poly-T stretch, microsatellite T/A repeat sequences and poly-A stretch are colored in red, green, blue and purple, respectively.

Figure 7. Sequence alignment of the partial D-loop region of 10 moth species.

Figure 7

The boxed nucleotides indicate the ‘ATAGA’ conserved motif.

Phylogenetic analyses

In this study, the mitogenomes of 18 lepidopteran species representing six lepidopteran superfamilies (Noctuoidea, Bombycoidea, Pyraloidea, Tortricoidea, Geometroidea, Papilionoidea) were downloaded from GenBank. The phylogenetic relationships among the superfamilies of Lepidoptera were reconstructed based on concatenated nucleotide sequences of 13 PCGs by using the maximum likelihood (ML) method (Fig. 8). The phylogenetic analyses show that E. narcissus was within Noctuidae. Noctuidae is closely related to Bombycoidea. Although these results do not conflict with other published trees7,23, more studies of a variety of species are needed to provide further insights into the relationships among Noctuidae species.

Figure 8. Phylogenetic analysis of lepidopteran insects.

Figure 8

The phylogenetic tree was constructed using the maximum likelihood (ML) method, and bootstrap values (1000 repetitions) of the branches were indicated. D. incompta (NC_025936) and A. gambiae (NC_002084) were used as outgroups.

Materials and Methods

Sample collection and DNA extraction

No specific permits were required for the insect collection necessary for this study. E. narcissus larvae were collected in Hefei city, China. Specimens identified as E. narcissus were preserved in 100% ethanol and stored at −80 °C. Total genomic DNA was extracted with the Aidlab Genomic DNA Extraction Kit (Aidlab Co., Beijing, China) according to the manufacturer’s instructions. The DNA was examined using 1% agarose gels and was then used for PCR amplification of the complete mitogenome.

PCR amplification, cloning and sequencing

To amplify the entire mitogenome of E. narcissus, nine pairs of primers were designed based on the known mitogenomes of lepidopteran species (Beijing Sunbiotech Co., Ltd., Beijing, China) (Table 4). PCR reactions were carried out in a 50 μl reaction volume, including 5 μl of 10× long Taq buffer (Mg2+ plus), 5 μl of dNTP (20 mM), 1.5 μl of DNA template from a single specimen, 2 μl of each primer (10 μM), 35 μl of sterilized distilled water and 0.5 μl (1 unit) of long Taq (Aidlab Co., Beijing, China). The conditions for PCR amplification were as follows: an initial denaturation for 4 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 40 s at 46–57 °C (depending on primer combination) and 1–3 min (depending on putative length of the fragments) at 72 °C, as well as a final extension step of 72 °C for 10 min. All PCR reactions were performed in a BIO-RAD thermal cycler.

Table 4. List of primers used to amplify the mitogenome of Eligma narcissus.

Primer Sequence (5′ → 3′)
F1 ATAGAATTAAACTATATCCTATA
R1 ATCTAAGAGATGTTCCTACTAT
F2 TACAATTTATCGCTTATAACTCA
R2 TATTAGGAGTTATATATGAGTC
F3 TGAAGTTATGAATATTCAGATT
R3 ATTATTTAGGTGTCGAATTAAA
F4 AGCTGCTAACTTAATTTTTAGT
R4 CTGTTTCAGCTTTAGTTCATTCA
F5 TTACCATTAAAATTATAACATCT
R5 AGATTAATTAATAGATTAATTAG
F6 TCAAATTATTCTAAAATCAATCT
R6 CAAATCAAAGAATAGTTTAATA
F7 CGAAACTAACTCTCTCTCACTC
R7 ATATGTACATATTGCCCGTCGCT
F8 TAGAAACACTTTCCAGTACCTC
R8 ATTTTAAATTATTAGGTGAAATT
F9 ATGAACTAAAATACCGCCAAAT
R9 ATTAATATTGATGAGTTGATTAT

The above PCR products were resolved by agarose gel electrophoresis (1% w/v) and purified using a DNA gel extraction kit (TaKaRa Co., Dalian, China). The purified PCR fragments were ligated into the T-vector (TaKaRa Co., Dalian, China) and then transformed into competent Escherichia coli DH5α. The positive recombinant clone with an insert was sequenced at least three times (Invitrogen Co., Ltd., Shanghai, China).

Genome assembly and gene annotation

The E. narcissus final consensus mtDNA sequence was performed using the Lasergene software package (DNASTAR Inc. Madison, USA). Sequence annotation was performed using the Online Blast Tool of the NCBI web site (http://blast.ncbi.nlm.nih.gov/Blast). The overlapping regions and intergenic spacers between genes were counted manually. The base composition of nucleotide sequences was described by skewness and was measured according to the following formulas: AT skew = [A − T]/[A+T]), GC skew = [G − C]/[G+C]. The A+T content and relative synonymous codon usage (RSCU) values were calculated using MEGA 5.024. Transfer RNA genes were identified using the tRNAscan-SE program software available online at http://lowelab.ucsc.edu/tRNAscan-SE/25. The secondary structures of tRNA genes were analyzed by comparison with the nucleotide sequences of other insect tRNA sequences. The nucleotide sequences of the PCGs were translated on the basis of the invertebrate mtDNA genetic code. Alignments of PCGs from other lepidopteran mitogenome sequences were performed using ClustalX software26. The entire A+T-rich region was subjected to a search for tandem repeats using the Tandem Repeats Finder program (http://tandem.bu.edu/trf/trf.html)27.

Phylogenetic analysis

Along with the E. narcissus mitochondrial genome, 21 available insect mitogenomes were downloaded from GenBank to illustrate the phylogenetic relationships among lepidopteran insects. The mitogenomes of Drosophila incompta (NC_025936)28 and Anopheles gambiae (NC_002084)29 were downloaded and used as outgroups. The nucleotide and putative amino acid regions for each of the 13 PCGs were aligned using ClustalW, as implemented in the program MEGA. To select the conserved regions of the putative amino acids, all alignments were analyzed with the program Gblock 0.91b using default settings30. Phylogenetic analysis was conducted using the maximum likelihood (ML) method, as implemented in the MEGA 5.0 program31. This method was used to infer phylogenetic trees with 1000 bootstrap replicates. Substitution model selection was also conducted based on the lowest BIC scores (Bayesian Information Criterion) using MEGA 5.0. The mtREV24 + G + F model was the appropriate models for the amino acid sequence dataset.

Additional Information

How to cite this article: Dai, L.-S. et al. Comparative Mitochondrial Genome Analysis of Eligma narcissus and other Lepidopteran Insects Reveals Conserved Mitochondrial Genome Organization and Phylogenetic Relationships. Sci. Rep. 6, 26387; doi: 10.1038/srep26387 (2016).

Acknowledgments

This work was supported by the earmarked fund for modern Argo-industry Technology Research System (CARS-22 SYZ10), the Anhui High Schools Natural Science Foundation (KJ2013B320), the National 863 plans projects of China (2011AA100306), the Sericulture Biotechnology Innovation Team (2013xkdt-05), and Ph.D. programs in Biochemistry and Molecular Biology (xk2013042).

Footnotes

Author Contributions C.-L.L., B.-J.Z. and L.-S.D. designed the research. L.-S.D. performed the research. L.-S.D., Y.Z. and C.-F.Z. analyzed the data. L.-S.D., B.-J.Z., C.-F.Z. and C.-L.L. contributed reagents/materials/analysis tools. L.-S.D., B.-J.Z. and C.-L.L. wrote the paper with other authors.

References

  1. Shao Y. L., Sun X. Q., Gu L. J. & Tan X. H. The study in Eligma narcissus about living habits and prevention. Anhui Agri. Sci. Bull. 18, 93–94 (2012). [Google Scholar]
  2. Li S. M., Li M. L. & Wang F. H. Comparative Analysis of Fatty Acids in Larva and Pupa of Eligma narcissus. Journal of Northwest Forestry University. 21, 105–106 (2006). [Google Scholar]
  3. Lin C. P. & Danforth B. N. How do insect nuclear and mitochondrial gene substitution patterns differ? Insights from Bayesian analyses of combined datasets. Mol. Phylogenet. Evol. 30, 686–702 (2004). [DOI] [PubMed] [Google Scholar]
  4. Hassanin A., Léger N. & Deutsch J. Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Syst. Biol. 54, 277–298 (2005). [DOI] [PubMed] [Google Scholar]
  5. Boore J. L. Animal mitochondrial genomes. Nucleic. Acids. Res. 27, 1767–1780 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Shadel G. S. & Clayton D. A. Mitochondrial DNA maintenance invertebrates. Annu. Rev. Biochem. 66, 409–435 (1997). [DOI] [PubMed] [Google Scholar]
  7. Lu H. F., Su T. J., Luo A. R., Zhu C. D. & Wu C. S. Characterization of the complete mitochondrion genome of diurnal Moth Amata emma (Butler) (Lepidoptera: Erebidae) and its phylogenetic implications. PLoS One 8, e72410 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dai L. S., Zhu B. J., Liu Q. N., Wei G. Q. & Liu C. L. Characterization of the complete mitochondrial genome of Bombyx mori strain H9 (Lepidoptera: Bombycidae). Gene 519, 326–334 (2013). [DOI] [PubMed] [Google Scholar]
  9. Liu Q. N., Zhu B. J., Dai L. S., Wei G. Q. & Liu C. L. The complete mitochondrial genome of the wild silkworm moth, Actias selene. Gene 505, 291–299 (2012). [DOI] [PubMed] [Google Scholar]
  10. Liu Q. N., Zhu B. J., Dai L. S. & Liu C. L. The complete mitogenome of Bombyx mori strain Dazao (Lepidoptera: Bombycidae) and comparison with other lepidopteran insects. Genomics 101, 64–73 (2013). [DOI] [PubMed] [Google Scholar]
  11. Dai L. S. et al. The complete mitochondrial genome of the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae). Mitochondrial DNA 27, 1512–1513 (2016). [DOI] [PubMed] [Google Scholar]
  12. Yin J., Hong G. Y., Wang A. M., Cao Y. Z. & Wei Z. J. Mitochondrial genome of the cotton bollworm Helicoverpa armigera (lepidoptera: Noctuidae) and comparison with other lepidopterans. Mitochondrial DNA 21, 160–169 (2010). [DOI] [PubMed] [Google Scholar]
  13. Salvato P., Simonato M., Battisti A. & Negrisolo E. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera: Notodontidae). BMC Genomics 9, 331 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Pan M. H. et al. Characterization of mitochondrial genome of Chinese wild mulberry silkworm, Bomyx mandarina (lepidoptera: Bombycidae). Sci. China C. Life Sci. 51, 693–701 (2008). [DOI] [PubMed] [Google Scholar]
  15. Ogoh K. & Ohmiya Y. Complete mitochondrial DNA sequence of the sea-firefly, Vargula hilgendorfii (Crustacea, Ostracoda) with duplicate control regions. Gene 327, 131–139 (2004). [DOI] [PubMed] [Google Scholar]
  16. Sabine L. B., Timo S. & Stefan P. Different methods to determine length heteroplasmy within the mitochondrial control region. Int. J. of Legal. Med. 118, 274–281 (2004). [DOI] [PubMed] [Google Scholar]
  17. Yamauchi M. M., Miya M. U. & Nishida M. Complete mitochondrial DNA sequence of the Japanese spiny lobster, Panulirus japonicus (Crustacea: Decapoda). Gene 295, 89–96 (2002). [DOI] [PubMed] [Google Scholar]
  18. Lee E. S. et al. The mitochondrial genome of the smaller tea tortix Adoxophyes honmai (lepidoptera: Tortricidae). Gene 373, 52–57 (2008). [DOI] [PubMed] [Google Scholar]
  19. Zhu B. J. et al. Characterization of the complete mitochondrial genome of Diaphania pyloalis (Lepidoptera: Pyralididae). Gene 527, 283–291 (2013). [DOI] [PubMed] [Google Scholar]
  20. Chai H. N., Du Y. Z. & Zhai B. P. Characterization of the Complete Mitochondrial Genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). Int. J. Biol. Sci. 8, 561–579 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jiang S. T. et al. Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (lepidoptera: Saturniidae). Int. J. Biol. Sci. 5, 351–365 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Chen Z. T. & Du Y. Z. Comparison of the complete mitochondrial genome of the stonefly Sweltsa longistyla (Plecoptera: Chloroperlidae) with mitogenomes of three other stoneflies. Gene 558, 82–87 (2015). [DOI] [PubMed] [Google Scholar]
  23. Chai H. N. & Du Y. Z. The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths. Int. J. Biol. Sci. 13, 10236–10256 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Tamura K. et al. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28, 2731–2739 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lowe T. M. & Eddy S. R. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic. Acids Res. 25, 955–964 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Thompson J. D., Gibson T. J., Plewniak F., Jeanmougin F. & Higgins D. G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic. Acids Res. 25, 4876–4882 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Benson G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic. Acids Res. 27, 573–580 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Re F. C. D., Wallau L. & Robe L. J. Characterization of the complete mitochondrial genome of flower-breeding Drosophila incompta (Diptera, Drosophilidae). Genetica 142, 525–535 (2014). [DOI] [PubMed] [Google Scholar]
  29. Beard C. B., Mills D. & Collins F. H. The mitochondrial genome of the mosquito Anopheles gambiae: DNA sequence, genome organization, and comparisons with mitochondrial sequences of other insects. Insect Mol. Biol. 2, 103–124 (1993). [DOI] [PubMed] [Google Scholar]
  30. Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17, 540–552 (2000). [DOI] [PubMed] [Google Scholar]
  31. Tamura K. et al. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wu Q. L., Cui W. X. & Wei S. J. Characterization of the complete mitochondrial genome of the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae). Mitochondrial DNA 26, 139–140 (2015). [DOI] [PubMed] [Google Scholar]
  33. Liao F. et al. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (lepidoptera: Arctiidae). Int. J. Biol. Sci. 6, 172–186 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sun Q. Q. et al. Complete sequence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens (Lepidoptera: Notodontidae). Genet. Mol. Res. 11, 4213–4225 (2012). [DOI] [PubMed] [Google Scholar]
  35. Cameron S. L. & Whiting M. F. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta (Insecta: lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408, 112–113 (2008). [DOI] [PubMed] [Google Scholar]
  36. Park J. S., Kim M. J., Kim S. S. & Kim I. Complete mitochondrial genome of an aquatic moth, Elophila interruptalis (Lepidoptera: Crambidae). Mitochondrial DNA 25, 275–277 (2014). [DOI] [PubMed] [Google Scholar]
  37. Wu Q. L., Liu W., Shi B. C., Gu Y. & Wei S. J. The complete mitochondrial genome of the summer fruit tortrix moth Adoxophyes orana (Lepidoptera: Tortricidae). Mitochondrial DNA 24, 214–216 (2013). [DOI] [PubMed] [Google Scholar]
  38. Park J. S., Kim S. S., Kim K. Y. & Kim I. Complete mitochondrial genome of Suzuki’s Promolactis moth Promalactis suzukiella (Lepidoptera: Oecophoridae). Mitochondrial DNA doi: 10.3109/19401736.2014.982572 (2013). [DOI] [PubMed] [Google Scholar]
  39. Dong Y. et al. Complete mitochondrial genome of Papilio syfanius (Lepidoptera: Papilionidae). Mitochondrial DNA 27, 403–404 (2016). [DOI] [PubMed] [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES