The lupus susceptibility gene Pbx1 regulates the balance between follicular helper T cell and regulatory T cell differentiation

Abstract

Pbx1 controls chromatin accessibility to a large number of genes and is entirely conserved between mice and humans. The Pbx1-d dominant negative isoform is more frequent in the CD4⁺ T cells from lupus patients than from healthy controls. Pbx1-d is associated with the production of autoreactive T cells in mice carrying the Sle1a1 lupus susceptibility locus. Transgenic expression of Pbx1-d in CD4⁺ T cells reproduced the phenotypes of Sle1a1 mice, with increased inflammatory functions of CD4⁺ T cells and impaired regulatory T cell homeostasis. Pbx1-d Tg also expanded the number of follicular helper T cells in a cell-intrinsic and antigen-specific manner that was enhanced in recall responses, and resulted in T_H1-biased antibodies. Moreover, Pbx1-d Tg CD4⁺ T cells upregulated the expression of miR-10a, miR-21 and miR-155, which have been implicated in Treg and T_FH cell homeostasis. Our results suggest that Pbx1-d impacts lupus development by regulating effector T cell differentiation and promoting T_FH cells at the expense of Treg cells. In addition, our results identify Pbx1 as a novel regulator of CD4⁺ T cell effector function.

Introduction

The NZM2410 murine strain was derived from the classical (NZB x NZW) F1 model of systemic lupus erythematosus (SLE), which is an autoimmune disease characterized by the production of autoantibodies (autoAbs) to nuclear antigens (Ag), immune activation, and immune-complex mediated inflammation in various tissues. We have mapped three major NZM2410 lupus susceptibility loci, and generated three congenic strains, B6.NZMSle1, -Sle2, and -Sle3, each carrying the corresponding NZM2410-derived genomic interval on the C57BL/6J (B6) genome (1, 2). Analysis of immunological properties of each congenic strain in comparison to B6 showed that Sle1 and Sle3 increase T cell activation and effector functions, and that Sle1 and Sle2 promote the development of autoreactive B cells and B cell hyperactivity (3).

Sle1 on telomeric chromosome 1 was the locus with the strongest linkage to lupus nephritis, and its expression is required for the development of systemic autoimmunity and pathogenesis in the NZM2410 model (4, 5). Sle1 expression results in the production of autoAbs specific for chromatin (6) through intrinsic defects in B and CD4⁺ T cells (7). Three Sle1 independent sub-loci, Sle1a, Sle1b, and Sle1c, contribute to autoimmune phenotypes (8). Sle1a and Sle1c induce the production of activated autoreactive T cells and decrease the number and function of Foxp3⁺ regulatory CD4⁺ (Treg) cells (9–11). Sle1b is associated with extensive polymorphisms between two divergent haplotypes of the SLAM family, and it regulates B cell (12) as well as T cell (13) tolerance. Sle1a has been mapped to two interacting loci, Sle1a1 and Sle1a2 (14). Sle1a1 contains only one functional known gene, pre-B cell leukemia homeobox 1 (Pbx1), and the lupus-associated allele corresponds to the increased expression of a novel splice isoform, Pbx1-d, in CD4⁺ T cells (15). Pbx1, a member of the three-amino-acid-loop-extension (TALE) class of homeodomain proteins, is a transcriptional factor that regulates chromatin access of multimeric complexes that include Hox factors, as well as myeloid ecotropic viral integration site (Meis) and Pbx-regulating protein-1 (Prep-1), two other TALE proteins that regulate chromatin remodeling and coactivator access (16). The interactions of Pbx-Meis/Prep-1 complexes with both Hox and non-Hox factors ultimately contribute to either gene activation or repression (17). Pbx1-d lacks exons 6 and 7 corresponding to the DNA binding domain and the Hox binding domain, respectively, which confers this splice isoform a dominant-negative function (18).

Sle1a1 expands the number of activated and autoreactive CD4⁺ T cells, and reduces the number of peripheral Treg (pTreg) cells in a CD4⁺ T cell intrinsic manner (15). These T cell phenotypes were not sufficient however to induce a robust production of autoAbs in B6.Sle1a1 mice, which requires the expression of Sle1 in B cells (14). In addition, Pbx1-d expression is associated with abnormal responses to TGF-β and retinoic acid (RA) in both murine and human T cells (19). Pbx1 expression is necessary for B cell development (20), but its function in T cells is unknown. The goal of this study was to directly address the role of Pbx1-d over-expression in CD4⁺ T cells. We showed that transgenic B6 mice that overexpress Pbx1-d in their CD4⁺ T cells (Pbx1-d Tg mice) reproduce the phenotypes of B6.Sle1a1 mice, with increased inflammatory functions of CD4⁺ T cells and impaired Treg cells homeostasis. In addition, Pbx1-d Tg mice showed a follicular helper T (T_FH) cell population that expanded in an Ag-specific and T-cell intrinsic manner, with an enhanced capacity to locate in B cell follicles and to promote affinity maturation of T_H1-associated Ab isotypes. These results suggest that Pbx1 regulates the balance between pTreg and T_FH cell maintenance or differentiation, and that Pbx1-d contributes to autoimmunity by tilting the balance in favor on T_FH over Treg cells.

Materials and Methods

Mice

B6.CD4-Pbx1-d Tg (Pbx1-d Tg) mice were generated at the University of Florida transgenic core using a bicistronic Pbx1-d/GFP cDNA controlled by the CD4 promoter (Sup. Fig. 1A) in a C57BL/6J background. Four Tg lines were obtained, with a Tg copy number of 8–13 in the A886, C855 and A872 lines, and 30 in the C861 line (Sup. Fig. 1B). GFP protein expression was not achieved in any of the lines. The following primers were used to detect Pbx1-d Tg are: Forward (spanning exons 5 and 8): ATCACAGTCTCCCAGGTGGA, and Reverse (in exon 9): ATCCTGCCAACCTCCATTAG. Pbx1-d expression was restricted to CD4⁺ T cells (Sup. Fig. 1B and C). Primer and Taqman probe sequences used to measure Pbx1-d message expression have been described (21). Mice from all four lines were healthy at least up to one year of age. Results reported in this study were obtained with mice from the first three lines, without any difference observed between lines. C861 mice were not included due to poor breeding performance. Initial characterization was performed with Tg-negative littermates, which presented phenotypes identical to that of B6 controls. No difference was observed between hemizygous and homozygous lines, indicating that within the observed range, the Tg copy number was not critical for the phenotypes. The results reported in this study were obtained with homozygous mice. B6, B6.SJL-Ptprc^aPep3^b/BoyJ (B6.Ly5^a), B6.Cg-Tg(TcraTcrb)425Cbn/J (B6.OT-II) and B6.129S7-Rag1^tm1Mom/J (B6.Rag-1^−/−) mice were originally obtained from the Jackson Laboratory. B6.Thy1^a.OT-II mice were graciously provided by Dr. Stephen Schoenberger. The B6.Sle1a.1^NZW/NZW (B6.Sle1a1) and B6.NZM-Sle1^NZM2410/AegSle2^NZM2410/AegSle3^NZM2410/Aeg/LmoJ (B6.TC) congenic mice have been previously described (5, 14). B6.Foxp3-enhanced GFP (B6.Foxp^egfp) mice (22) were kindly provided by Dr. V. J. Kuchroo. Pbx1-d Tg.Foxp3^egfp mice were bred from the A886 line and Pbx1-d Tg.OT-II were bred from the C855 line. All mice were bred and maintained at the University of Florida in specific pathogen-free conditions. Only female mice, except for the colitis experiment, were used in this study under a protocol approved by the Institutional Animal Care and Use Committee of the University of Florida.

T cell polarization

In vitro induced Treg (iT_reg) cells were differentiated as previously described (15). Briefly, CD4⁺CD25⁻ cells were negatively selected from B6 or Pbx1-d Tg splenocytes using the CD4⁺CD25⁺ Treg isolation kit (Miltenyi Biotech), and then 5 × 10⁵ cells were stimulated with mouse T-activator CD3/CD28 beads (Life Technologies) at the concentration of 1 × 10⁶ beads/mL in the presence of 100 U IL-2, 20 ng/ml TGF-β (Pepro Tech), and 0–5 nM all-trans retinoic acid (RA) for 5 d. T_H1 and T_H17 polarization was performed as previously described (23).

Flow cytometry

Single-cell suspensions were prepared using standard procedures from spleen, thymus, and mesenteric lymph node (mLN). After red blood cell lysis, cells were blocked with anti-CD16/32 Ab (2.4G2), and stained in FACS staining buffer (2.5% FBS, 0.05% sodium azide in PBS). Fluorochrome-conjugated Abs used were to B220 (RA3-6B2), BCL6 (K112-91), CD4 (RAM4-5), CD8 (53-6.7), CD25 (PC61.5), CD44 (IM7), CD45.1 (A20), CD45.2 (104), CD62L (MEL-14), CD69 (H1.2F3), CD95 (Jo2), CD90.1 (HIS51), CD90.2 (53-2.1), Foxp3 (FJK-16s), Ly-77 (GL7), Neuropilin-1 (761705), PD-1 (RMP1-30), IFN-γ (XMG1.2), IL-2 (JES6-5H4), IL-17a (eBio17B7), and IL-21 (FFA21) purchased from BD Biosciences, eBioscience, BioLegend, and R&D Systems. Follicular T cells were stained as previously described (55) in a three-step process using purified CXCR5 (2G8) followed by biotinylated anti-rat IgG (Jackson ImmunoResearch), then PerCP5.5-labeled streptavidin in FACS staining buffer on ice. Dead cells were excluded with fixable viability dye (eFluor780; eBioscience). Data were collected on LSRFortessa (BD Biosciences) and analyzed with FlowJo software (Tree Star).

Mixed bone marrow (BM) chimera and adoptive cell transfers

Chimeras were prepared as previously described (9) with the following modifications. 8–10 week-old (B6 x B6.Ly5^a)F1 recipient mice were lethally irradiated with two doses of 452 rad (4 h apart) using an X-RAD 320 irradiator (Precision X-Ray). Donor BM cells were depleted of mature T cells using CD5 MicroBeads (Miltenyi Biotech). Mixed 1:1 BM cells (1 × 10⁷ cells) were given to the recipient mice by tail-vein injection. Treg cells were analyzed in chimeric mice 8 weeks later. For T-dependent (TD) immune responses, chimeric mice were immunized with 100 μg of NP₂₃-KLH (Biosearch Tech.) in alum 8 weeks after BM cell transplantation, and T_FH cells were analyzed 1 week after immunization. CD4⁺ T cells from Pbx1-d Tg.OT-II, B6.Sle1a1.OT-II and B6.OT-II mice were purified by negative selection using MACS MicroBeads, then 0.5 × 10⁶ cells were tail-vein injected into B6.Ly5^a mice, followed by subcutaneous immunization with 50 μg NP₁₆-OVA in alum 4 h after cell transfer. For mixed adoptive transfer, CD4⁺ T cells from Pbx1-d Tg.OT-II or B6.Sle1a1.OT-II and B6.Thy1^a.OT-II mice were mixed at 1:1 ratio, and 1 × 10⁶ cells were injected into (B6 x B6.Thy1^a)F1 recipient mice prior to immunization with NP₁₆-OVA.

To assess the function of effector T (T_Eff) cells in vivo, 4 × 10⁵ purified CD4⁺CD25⁻T_Eff cells from 2 month-old Pbx1-d Tg and B6 mice were tail-vein injected into B6.Rag-1^−/−mice. The function of Treg cells was evaluated in co-injections of 1 × 10⁵ CD4⁺CD25⁺ Treg cells from either Pbx1-d Tg or B6 mice along with 4 × 10⁵ CD4⁺CD25⁻B6 T_Eff cells. Recipient mice were monitored for clinical signs of colitis for up to 8 weeks and body weight was monitored weekly. The recipient mice that lost more than 15% body weight or showed overt clinical signs of disease were sacrificed. Colon histology was ranked blindly in a semi-quantitative fashion as previously described (9).

Immunohistochemistry

To stain splenic germinal centers (GCs) in B6.Ly5^a mice that received Pbx1-d Tg.OT-II or B6.OT-II CD4⁺ T cells, 7 μm thick OCT-embedded cryosections were prepared on super-frost glass, washed with PBS, fixed with 4% paraformaldehyde for 15 min at 4°C, and subsequently permeabilized with 0.1% Triton X-100 for 5 min at 4°C. The sections were washed with cold PBS and incubated overnight in the dark at 4°C with anti-CD45.2 conjugated to PE, anti-GL7 conjugated to AF488, and anti-IgD conjugated to APC (all from eBioscience). Sections were washed three times with cold PBS, mounted with cytoseal, and covered with glass coverslip. The stained sections were analyzed using an EVOS FL digital inverted fluorescence microscope (Fisher Scientific, Waltham, MA), images were captured by ×10, ×20, and ×40 objectives, keeping all of the conditions of microscope and settings of software identical for all treatments and controls.

Immunization and Ab measurements

For TD responses, 8–10 wk-old mice were immunized intra-peritoneally with 100 μg NP₂₃KLH in alum, and boosted at week 2 and 6. Serum samples were collected 1, 3, 5, and 7 weeks after the first immunization. NP-specific Abs were measured by ELISA using NP₄-or NP₂₅-BSA (Biosearch Tech.) coated plates, followed by incubation with 1:1000 diluted serum samples and developed with alkaline phosphatase-conjugated goat anti-mouse IgG1, IgG2a, IgG2c, IgG3, or IgM (Southern Biotech). All samples were run in duplicate. Anti-dsDNA and anti-chromatin IgG were measured as previously described (6) in sera diluted 1:100, and relative units were standardized using serial dilutions of a positive serum from B6.TC mice, setting the 1:100 dilution reactivity to 100 U. Serum anti-nuclear Ab (ANA) were measured by applying 1:40 diluted sera to fixed Hep-2 cells (Inova) and revealed with anti-mouse IgG-FITC (Invitrogen).

miRNA analysis

Splenic CD4⁺ T cells from Pbx1-d Tg.Foxp3^egfp, B6.Sle1a1.Foxp3^egfp, and B6.Foxp3^egfp mice were first enriched by negative selection using MACS MicroBeads, then GFP⁺ and GFP⁻cells were sorted with a FACSAria cytometer with a purity ≥ 95%. miRNAs were isolated and reverse transcribed using Life Technologies reagents. Quantification of miRNAs expression was performed using TaqMan MicroRNA assays (Life Technologies) using the Applied Biosystems StepOne^™ real-time PCR machine. U6 snRNA was used as internal control. Comparisons were made using the 2^−ΔΔCt method and values were normalized to the B6 average values.

Luciferase assay

Putative human PBX1 binding sites in the ~ 2 Kb flanking miR-10a, miR-21 and miR-155 precursors were identified using Jaspar3 (set for 75% accuracy). We generated luciferase reporter constructs containing the 798-bp, 1071-bp and 850-bp region upstream of miR-10a, miR-21 and miR-155, respectively (Fig. 8A) cloned into the pGL4.25 Luciferase vector (Promega). PBX1-b or PBX1-d expression plasmids were generated by inserting cDNAs (15) into the pHAGE-CMV-MCS-IzsGreen plasmid. The luciferase reporter constructs and the pGL3-basic plasmid were then each co-transfected with either PBX1-b or PBX1-d expression plasmid into HEK293T cells. Cells were harvested after 48 h. After lysis with the Passive Lysis Buffer (Promega), luciferase activity was measured using a dual luciferase reporter assay system (Promega) according to the manufacturer’s instructions with a Lumat LB 9507 luminometer (Berthold Technologies).

Figure 8. Human PBX1 binds to the promoter of miR-10a, miR-21, and miR-155.

A. miRNA luciferase constructs containing predicted PBX1 binding sites were selected using Jaspar3. The regions used in the luciferase assays are indicated for each locus. B. Dual luciferase analyses of miR-10a, miR-21 and miR-155 expression in the presence of either PBX1-b or PBX1-d, showing fold change relative to the absence of PBX1 expression plasmid. All results are expressed as mean ± SD from at least three independent experiments.

Statistical analysis

Differences between groups were evaluated by two-tailed statistics: unpaired t tests or Mann-Whitney U tests depending on whether the data was normally distributed, paired t tests for mixed BM-chimeras, χ² tests to compare distributions, and two-way ANOVA tests for time-course experiments. Unless specified, graphs show means and standard deviations of the mean. *P < 0.05, **P < 0.01, and ***P < 0.001.

Results

Pbx1-d Tg mice replicated the phenotypes of B6.Sle1a1 mice

To address whether the overexpression of Pbx1-d in CD4⁺ T cells was sufficient to induce their activation and loss of tolerance, we generated Pbx1-d Tg mice that express Pbx1-d driven by the Cd4 promoter (Supl. Fig. 1). Pbx1-d Tg overexpression in CD4⁺ T cells resulted in the production of serum ANA with the characteristic homogenous nuclear staining pattern (Fig. 1A) as well as anti-dsDNA and anti-chromatin IgG in 7 to 12 month old mice (Fig. 1B and C). A similar nuclear staining pattern was observed in the serum of B6.Sle1a1 mice, although with a lower intensity, which is consistent with a low level of anti-dsDNA and anti-chromatin IgG (Fig. 1B and C), as we have previously reported for this strain (14, 15). This suggested that Pbx1-d overexpression results in the production of autoreactive CD4⁺ T cells that are sufficient to induce humoral autoimmunity against nuclear Ag. B6.Sle1a1 mice were characterized by the expansion of CD44⁺CD62L⁻effector memory T (T_EM) cells relative to CD44⁻CD62L⁺ naïve T (T_N) cells (15). Aged Pbx1-d Tg mice also presented a skewed T_N/T_EM ratio (Fig. 1D). We examined the consequence of Pbx1-d overexpression in CD4⁺CD25⁻T_Eff cells in vivo with the experimental colitis model that we have used with B6.Sle1a1 T cells (9). B6.Rag1^−/− mice that received Pbx1-d Tg T cells showed a greater body weight loss and a Eff more severe colitis than the mice that received B6 T_Eff cells (Fig. 1E–F). These results suggest that Pbx1-d expression is sufficient to induce an intrinsic activation in CD4⁺ T cells. However, we observed a similar ability of Pbx1-d Tg or B6 CD4⁺CD25⁺ T cells to suppress B6 T_Eff cells in the same colitis model (data not shown), suggesting that Pbx1-d Tg Treg in vivo functions were less affected than that of B6.Sle1a1 Treg cells (14).

Figure 1. Pbx1-d overexpression in CD4⁺ T cells reproduced the phenotypes of B6.Sle1a1 mice.

A. Representative serum ANA staining patterns in B6, Pbx1-d Tg⁻ (Tg⁻), B6.Sle1, B6.Sle1a1, Pbx1-d Tg (Tg⁺), and TC mice as positive control. The pattern distribution (nuclear, cytoplasmic or negative) was significantly different between Pbx1-d Tg⁺ or B6.Sle1a1 and (B6 + Tg⁻) combined mice (n = 10–18 per strain). Serum anti-dsDNA (B) and anti-chromatin (C) IgG (n = 10–15). D. T_N/T_EM ratio in the spleen and mLN from B6 and Pbx1-d Tg mice (n = 3–4). Mice were 7–12 month old for A–D. E. Maximum weekly percentage of body weight loss by B6.Rag1^{−/ −} mice up to 8 weeks after transfer of Pbx1-d Tg or B6 T_Eff cells. F. Colitis pathology score 8 weeks after transfer with representative images of colon histology taken with the same 40X magnification shown on the right. Each symbol represents a mouse. *P < 0.05, **P < 0.01.

Pbx1-d overexpression impaired Treg cell homeostasis

To assess the role of Pbx1-d in Treg cells as compared to conventional CD4⁺ T cells, we bred the EGFP-Foxp3 reporter construct to both B6.Sle1a1 and Pbx1-d Tg mice. Pbx1-d expression in Pbx1-d Tg CD4⁺ T cells was ~ 10,000 folds higher than in B6 T cells, and was similar in Foxp3⁺ and Foxp3⁻ cells (Fig. 2A–B). Pbx1-d expression in the Pbx1-d Tg T cells was also much higher (~100 folds) than in B6.Sle1a1 mice in either Foxp3⁺ or Foxp3⁻T cells (Fig 2A–B). As previously reported for B6.Sle1a1 mice (14, 15), the frequency of CD4⁺Foxp3⁺ Treg cells was reduced in Pbx1-d Tg mice with the largest difference in the mLN (Fig. 2C). In addition, in vitro iTreg cell polarization by TGF-β and RA was reduced in Pbx1-d Tg CD4⁺CD25⁻T cells as compared to B6 cells (Fig. 2D). These results indicate that, as Sle1a1, Pbx1-d overexpression in CD4⁺ T cells impairs iTreg differentiation by interfering with the response to RA in the presence of TGF-β.

Figure 2. Pbx1-d overexpression impaired pTreg cell induction.

bx1-d mRNA expression in Foxp3⁺ and Foxp3⁻CD4⁺ T cells purified from B6.Foxp3^egfp, Pbx1-d Tg.Foxp3^egfp, and B6.Sle1a1.Foxp3^egfp mice analyzed by conventional (A) and quantitative (B) RT-PCR with the data presented relative to B6 (RQ; n = 3). C. Frequency of Foxp3⁺ Treg cells in the mLN of 10–12 month-old B6, Pbx1-d Tg, and B6.Sle1a1 mice. Each symbol represents a mouse. D. Foxp3 induction in CD4⁺CD25⁻T cells in the presence of TGF-β, presented as the ratio of induction with over without RA. E–H. Mixed-BM chimera analysis of Treg cells. E. Experimental design. F. Gates for Foxp3⁺Nrp-1⁺ tTreg and Foxp3⁺Nrp-1⁻pTreg cells within the total CD4⁺CD8⁻CD45.1⁺ or CD45.2⁺ thymocytes. Percentage of pTreg (G) and tTreg cells (H) in the chimeras with each linked symbol representing a mouse. *P < 0.05, ** P < 0.01.

To further evaluate the impact of Pbx1-d on Treg differentiation, we reconstituted lethally irradiated (B6 x B6.Ly5^a)F1 mice with T cell-depleted BM cells mixed from Pbx1-d Tg and B6.Ly5^a mice (Fig. 2E). Pbx1-d Tg BM yielded to a decreased percentage of CD4⁺Foxp3⁺Nrp-1⁻pTreg cells as compared to the B6.Ly5^a BM in the thymus of the recipient mice, whereas the proportion of CD4⁺Foxp3⁺Nrp-1⁺ thymic Treg (tTreg) cells was similar between the two genotypes (Fig. 2F–H). In these conditions, however, the proportions of Treg cells in the peripheral organs of recipient mice were similar for BM-derived cells of either genotypes (data not shown), possibly due to the relatively short time between BM transfer and phenotype readout. Together these data indicate that Pbx1-d Tg overexpression in CD4⁺ T cells impairs the induction or maintenance of pTreg cells in a cell-intrinsic manner.

Pbx1-d Tg overexpression in CD4⁺ T cells expanded the number of T_FH cells

Since Pbx1-d overexpressing CD4⁺ T cells showed an activated phenotype (Fig. 1D), we next examined their cytokine production. Ex vivo Pbx1-d Tg CD4⁺ T cells showed a significantly increased IL-21 expression (Sup. Fig. 2A–B) as compared to B6, but there was no difference for the level of IL-2, IL-17A or IFN-γ production (Sup. Fig. 2A, C–E), or the frequency of IL-17A⁺ or IFN-γ⁺ CD4⁺ T cells (data not shown). Under in vitro T_H1 polarization conditions, a small but significant difference was observed with Pbx1-d Tg CD4⁺ T cells producing more IFN-γ than B6 cells, while there was no difference for IL-17A (Sup. Fig. 2F and G). These results prompted us to investigate T_FH cell differentiation in Pbx1-d Tg mice. T_FH cells secrete high levels of IL-21, and IL-21 signaling up-regulates Bcl6 expression, which is required for the development of T_FH cells and germinal center (GC) formation (24–27). At steady state, young (6–8 weeks) Pbx1-d Tg and B6.Sle1a1 mice showed an increased cellularity in the mLN, where the numbers and percentages of GC B cells were also increased as compared to B6 (Fig. 3A–C). The percentages and absolute numbers of CD4⁺PD1⁺CXCR5⁺Bcl6⁺Foxp3⁻T_FH cells were significantly higher in the mLN from Pbx1-d Tg mice, but not in their spleen (Fig. 3D–F). A similar trend was observed for B6.Sle1a1 T_FH cells. On the other hand, the number of CD4⁺PD1⁺CXCR5⁺Bcl6⁺Foxp3⁺ follicular regulatory T (T_FR) cells was significantly reduced in the spleen of Pbx1-d Tg mice (Fig. 3F). We next tested the differentiation of T_FH and T_FR cells 7 d after administrating a TD Ag into chimeric mice reconstituted with a 1:1 mix of Pbx1-d Tg and B6 BM (Fig. 3G). The number and percentage of both Pbx1-d Tg-derived T_FH and T_FR cells were significantly increased as compared to B6-derived cells (Fig. 3H and I). The discrepancy between the unchanged frequency or a decreased number of Pbx1-d Tg T_FR cells in unmanipulated mice (Fig. 3E and F) on one hand and the increased number and frequency of Pbx1-d Tg-derived T_FR cells in chimeric mice (Fig. 3H and I) on the other hand is likely due to homeostatic expansion that favors all Bcl6-expressing Pbx1-d Tg-derived T cells. The numbers of B6 and Pbx1-d Tg-derived total CD4⁺ T cells were similar before immunization, indicating an Ag-driven enhancement of T_FH cell differentiation by Pbx1-d overexpression. These steady-state and immunization results are consistent with Pbx1-d overexpression in CD4⁺ T cells increasing T_FH cell differentiation in a cell-intrinsic manner.

Figure 3. Pbx1-d Tg expression in CD4⁺ T cells expanded GC lymphocytes.

Absolute numbers of lymphocytes (A), percentages (B) and absolute numbers (C) of B220⁺GL-7⁺FAS⁺ GC B cells in the spleen and mLN from 2 month-old B6, Pbx1-d Tg, and B6.Sle1a1 mice. D. Representative FACS plots for CD4⁺CXCR5⁺PD-1⁺Bcl6⁺Foxp3⁺ T_FR and CD4⁺CXCR5⁺PD-1 ⁺Bcl6⁺Foxp3⁻T_FH cells. Percentages (E) and absolute numbers (F) of T_FH and T_FR cells. n = 5–10. G–I: Follicular T cell expansion in response to NP-KLH immunization in mixed BM chimeras. G: Experimental strategy. Absolute numbers (H) and percentages (I) of T_FH and T_FR cells 7 d after immunization gated according to their strain of origin: CD45.1: B6, CD45.2: Pbx1-d Tg. Each symbol (linked in I) represents a mouse. *P < 0.05, **P < 0.01.

Pbx1-d Tg overexpression enhanced Ag-specific T_FH cell differentiation and follicular localization

To track T_FH cells in an Ag-specific manner, Pbx1-d Tg mice were bred with B6.OT-II mice, which express an MHC class II-restricted T cell receptor specific for ovalbumin (OVA) (28). Pbx1-d Tg.OT-II or B6.OT-II CD4⁺ T cells were transferred into B6.Ly5^a mice, which were then immunized with NP-OVA. By d 5 after immunization, Pbx1-d Tg.OT-II and B6.OT-II total CD4⁺ T cells were expanded to a similar extent, and there was no difference for the recipient CD45.1⁺ T cells (Fig. 4A). However, the CD45.2⁺ Pbx1-d Tg.OT-II CD4⁺ T cells contained a higher frequency and number of T_FH cells (Fig. 4B and C) than the B6.OT-II CD4⁺ T cells. Either Pbx1-d Tg.OT-II or B6.OT-II transferred CD4⁺ T cells produced very low numbers of T_FR cells (Fig. 4A). Homing of primed T_FH cells to B cell follicles is a critical step to generate GCs. The number of transferred Pbx1-d Tg.OT-II CD4⁺ T cells within the B cell zone was significantly higher than the number of B6.OT-II CD4⁺ T cells, whereas there was no difference in the number of transferred T cells in the T cell zone (Fig. 4D and E). In addition, CXCR5 and Bcl6 expression was significantly higher in the transferred Pbx1-d Tg.OT-II than the transferred B6.OT-II CD4⁺ T cells (CXCR5: 483 ± 18.14 vs. 430.20 ± 10.14, P < 0.001; Bcl6: 507.20 ± 23.21 vs. 436.60 ± 13.86, P < 0.05). At d 7 after immunization, there was a similar frequency of Pbx1-d Tg.OT-II and B6.OT-II T_FH cells (Supplemental Fig. 3A), and a similar number of these cells in the spleen (Supplemental Fig. 3B), although the number ofPbx1-d Tg.OT-II T_FH cells was still higher in the mLN (Supplemental Fig. 3B). Interestingly, the number of total Pbx1-d Tg.OT-II T cells was increased in both spleen and mLN (Supplemental Fig. 3C). This expanded population was largely absent from the GC (Supplemental Fig. 3D), suggesting that they may correspond to extrafollicular helper T cells, a population that is expanded in lupus-prone mice (29).

Figure 4. Pbx1-d Tg expression in CD4⁺ T cells regulated Ag-specific T_FH cell differentiation.

T_FH cells were analyzed 5 d after NP-OVA immunization of CD45.1⁺ B6 mice transferred with CD45.2⁺ naïve B6.OT-II or Pbx1-d Tg.OT-II cells. A. Representative flow cytometric plots showing mLN CD4⁺ CD45.1⁺ (endogenous) and CD45.2⁺ (transferred) gated CXCR5⁺PD-1⁺ T_FH and T_FR cells. B. Percentages of donor and recipient T_FH cells. C. Absolute numbers of donor T_FH cells. Each symbol represents a recipient mouse. D. Localization of donor OT-II CD4⁺ T cells (CD45.2⁺, red) relative to B cell follicles (IgD⁺, F), GCs (GL7⁺, green), and periarteriolar lymphoid sheaths (PALS). The framed areas in the 10x magnification are shown below at 20x, with the bottom panels showing only the outline of the IgG⁺ B cell follicles for a better comparison of the number and location of CD45.2⁺ T cells. E. Numbers of B6.OT-II or Pbx1-d Tg.OT-II CD4⁺ T cells in B or T cell zones, showing mean ± SEM from 3–7 GC regions per mouse from 3 mice per strain. F. Percentages of donor and recipient T_FH cells 5 d after NP-OVA immunization of CD45.1⁺ B6 mice transferred with CD45.2⁺ naïve B6.OT-II or Sle1a1.OT-II cells. G. Representative 20x spleen sections of B6.OT-II or Sle1a1.OT-II cell recipients, as in D. H. Numbers of B6.OT-II or Sle1a1.OT-II CD4⁺ T cells in B or T cell zones, showing mean ± SEM from 3–7 GC regions per mouse from 5 mice per strain. *P < 0.05, **P < 0.01.

We performed the same experiment with B6.Sle1a1.OT-II CD4⁺ T cells, which generated a similar frequency and number of T_FH cells as well as a similar number of B6.Sle1a1.OT-II CD4⁺ T cells located in the B cell follicles than B6.OT-II CD4⁺ T cells 5 d after immunization (Fig. 4F–G). At d 7 after immunization, the number and frequency of T_FH cells were also similar between cells of Sle1a1 or B6 origin (Supplemental Fig. 3E and F). The number of total Sle1a1.OT-II CD4⁺ T cells was however higher in the spleen than B6.OT-II T cells and there was a trend in the mLN (Supplemental Fig. 3G). Therefore, these results suggest that a high level of Pbx1-d expression in CD4⁺ T cells increased Ag-specific T_FH cell differentiation as well as early entry in B cell follicles, while the more modest increased expression of Pbx1-d in Sle1a1 CD4⁺ T cells increased their Ag-specific expansion.

We then examined the effect of Pbx1-d overexpression on T_FH cell differentiation in a competitive setting by co-transferring B6.Thy1^a.OT-II and Pbx1-d Tg.OT-II (1:1) CD4⁺ T cells into (B6 x B6.Thy1^a)F1 recipient mice. Five days after primary NP-OVA immunization (Fig. 5A), the percentage of total B6.Thy1^a.OT-II CD4⁺ T cells was higher than that of Pbx1-d.OT-II Tg CD4⁺ T cells in the spleen and mLN, and the same trend was observed for Sle1a1.OT-II CD4⁺ T cells (Fig. 5B). A higher percentage of T_FH cells was only found with Pbx1-d Tg origin in the mLN (Fig. 5C). We next asked whether Pbx1-d overexpression influenced the recall Ag-response in the same model (Fig. 5A). In contrast to the primary response, the percentages of Pbx1-d.OT-II Tg and Sle1a1.OT-II total CD4⁺ T cells (Fig. 5D) and T_FH cells (Fig 5E) were higher than that of corresponding cells of B6 origin in the spleen and mLN at 3 d after secondary immunization. Moreover, the relative expansion of the T_FH subset was significantly greater in cells from Pbx1-d Tg or Sle1a1 origin as compared to cells from B6 origin in the recall as compared to the primary response (Fig. 5F). Finally, the percentage of Pbx1-d Tg activated (Fig. 5G–H) and CD44^hi memory CD4⁺ T cells (Fig 5I–J) was enhanced, which we did not observed during the primary response. Taken together, these results indicate that Pbx1-d overexpression conferred a cell-intrinsic competitive advantage during Ag-specific T_FH cell differentiation that was enhanced during recall responses.

Figure 5. Pbx1-d intrinsically regulated T_FH cell differentiation and amplified recall responses.

A. Experimental design for primary and recall response after mixed adoptive transfer of CD90.1⁺ B6.OT-II and CD90.2⁺ Pbx1-d Tg.OT-II or Sle1a1.OT-II CD4⁺ T cells into (B6 x B6.Thy1^a)F1 mice. Percentages of CD90.1⁺ B6.OT-II and CD90.2⁺ Pbx1-d Tg.OT-II or Sle1a1.OT-II CD4⁺ T cells (B and D) and T_FH cells (C and E) from each genotype in the primary (B and C) and recall (D and E) responses. F. Fold increase of T_FH cells in recall vs. primary response, calculated as the ratio of CD90.2⁺ /CD90.1⁺ T_FH cells. Representative flow cytometric plots and corresponding percentages of CD4⁺CD69⁺ activated T (G and H) and T_EM / T_N CD4⁺ T cells ratios (I and J) in CD90.1⁺ B6.OT-II and CD90.2⁺ Pbx1-d.OT-II Tg donor cells in the recall response. Each linked symbol represents a recipient mouse. n = 5–6, *P < 0.05, **P < 0.01, ***P < 0.001.

Pbx1-d Tg mice responded to TD Ags with an increased T_H1-related Ig isotypes

To assess the effect of Pbx1-d overexpression on affinity maturation and class-switching, B6 and Pbx1-d Tg mice were boosted 2 and 6 weeks after primary immunization with NP-KLH. Pbx1-d Tg mice produced significantly more high and low affinity anti-NP-IgG3 and high-affinity anti-NP IgG2a and IgG2c than B6 mice (Fig. 6A–B). Moreover, the affinity of anti-NP IgG2a and IgG2c as measured by the NP₄/NP₂₅ ratio was significantly increased in Pbx1-d Tg mice after boosting (Fig. 6C), suggesting that Pbx1-d overexpression increases affinity maturation of T_H1-associated antibodies.

Figure 6. Pbx1-d Tg expression in CD4⁺ T cells increased affinity maturation of T_H1-related isotypes.

B6 and Pbx1-d Tg mice were immunized with NP-KLH then boosted 2 and 6 weeks later (arrows on X axes). Serum levels of NP-specific Abs 1 wk before and after boosting measured in plates coated with NP₄ (A) or NP₂₅ (B) BSA. C. Affinity measured as the NP₄ / NP₂₅ ratio for each isotype, n = 5.

Pbx1-d overexpression increased the expression of miR-10, miR-21 and miR-155 in CD4⁺ T cells

Numerous studies have implicated microRNAs (miRNAs) in Treg and T_FH cell differentiation and functions (30). We have analyzed the effect of Pbx1-d overexpression on candidate miRNAs selected for their role in this process (miR-10a, -17, -19a, -19b, -20a, -21, -92, -155, -181a, and -181b) in Foxp3-GFP⁺ and Foxp3-GFP⁻CD4⁺ T cells from young Pbx1-d Tg.Foxp3^egfp, B6.Sle1a1.Foxp3^egfp, and B6.Foxp3^egfp mice. miR-10a, miR-21 and miR-155 expression was 2–3 fold higher in either Pbx1-d Tg or B6.Sle1a1 than in B6.Foxp3-GFP⁺ Treg cells (Fig. 7A). The same result was obtained for Pbx1-d Tg Foxp3-GFP⁻conventional CD4⁺ T cells, while expression of miR-21 and miR-155 was more variable in B6.Sle1a1 Foxp3-GFP⁻CD4⁺ T cells, although going in the same direction (Fig. 7B). The expression of miRNAs from the miR17~92 and miR181 families was significantly increased in Foxp3-GFP⁺ Treg cells from B6.Sle1a1 mice, but not in Treg cells from Pbx1-d Tg mice and there was no consistent difference between strains in Foxp3-GFP⁻conventional T cells (Supplemental Table 1). These findings indicate that Pbx1-d affects the expression of specific miRNAs that have been associated with CD4⁺ Treg and T_FH cell differentiation and function, either directly or indirectly.

Figure 7. Pbx1-d Tg in CD4⁺ T cells increased the expression of miR-10a, miR-21, and miR-155.

miRNA expression was analyzed by qPCR in FOXP3⁺-GFP⁺ (A) and FOXP3-GFP⁻ (B) CD4⁺ T cells from Pbx1-d Tg.Foxp3^egfp, B6.Sle1a1.Foxp3^egfp, and B6.Foxp3^egfp spleens. Representative FACS plots for follicular T cells in spleens from 4 month old B6 and TC mice (C) and corresponding percentages and absolute numbers of T_FH cells (D). E. miRNAs expression in CD4⁺ T cells from B6 and TC mice at 2, 4, and 10–12 month of age, n = 3–4.

To address whether the increased expression of miR-10a, miR-21 and miR-155 found in Pbx1-d Tg and B6.Sle1a1 CD4⁺ T cells was maintained in mice with clinical lupus phenotypes, we analyzed B6.Sle1.Sle2.Sle3 (TC) mice, which carry the Sle1a1 allele of Pbx1 (5). TC mice present spontaneously expanded subsets of T_FH cells (Fig. 7C and D). miR-10a, miR-21 and miR-155 were expressed at a higher level in TC CD4⁺ T cells starting at 2 months of age, before the mice produce autoAbs and show overt signs of autoimmune activation (Fig. 7E). These results suggest that the up-regulation of these three miRNAs driven by Pbx1-d overexpression in the Tg mice contributes to the autoimmune phenotype in lupus mice that express the Pbx1-d allele.

miR-21 expression is regulated by the PBX1/HOX9 complex in leukemia (31), suggesting that Pbx1 could directly regulate the transcription of miR-10a, miR-21 and miR-155. An in silico analysis identified several putative PBX1 binding sites for each of the three miRNAs that are overexpressed in Pbx1-d Tg T cells. We co-transfected HEK293T cells with one of three luciferase constructs containing the upstream regulatory region for miR-10a, miR-21 or miR-155 that contained the most proximal putative PBX1 binding sites (Fig. 8A) and plasmids expressing either the normal allele PBX1-b or the lupus allele PBX1-d cDNA. As shown in Fig. 8B, PBX1-b and PBX1-d increased the transcription of each of the three miRNA, with higher levels obtained for PBX1-d than PBX1-b for miR-10a and miR-155. These data strongly support transcriptional regulation of miR-10a, miR-21 and miR-155 by PBX1.

Discussion

This study examined the role of Pbx1-d expression in CD4⁺ T cells relative to the phenotypes induced by the Sle1a1 lupus susceptibility locus. Sle1a1 increases CD4⁺ T cell effector functions and reduces the number and function of Treg cells, resulting in the production of autoreactive CD4⁺ T cells (9, 11). Pbx1-d over expression in the CD4⁺ T cells of B6 mice resulted in autoAb production and T cell activation as well as a decreased number of pTreg cells and a reduced iTreg differentiation in vitro. These results are fully consistent with Pbx1-d overexpression being responsible for Sle1a1 CD4⁺ T cell activation and impaired iTreg cell differentiation or maintenance (9). The most striking phenotype of Pbx1-d Tg mice was however the expansion of T_FH cells and associated TD immune responses. BM chimera and adoptive transfer studies showed that Pbx1-d overexpression resulted in a cell-intrinsic Ag-specific expansion of T_FH cells. This phenotype was accentuated in recall responses, which represent the chronic stimulation by autoantigens better than primary responses. This suggests that Pbx1-d expression contributes to lupus by promoting T_FH cells at the expense of iTreg differentiation, resulting in the production of class-switched affinity matured autoantibodies that are the hallmark of the Sle1 susceptibility locus and lupus pathogenesis.

Lupus patients present high levels of circulating T_FH-like cells that correlate with disease activity (32, 33) and functional T_FH cells have been found in the kidneys of patients with lupus nephritis (34). T_FH cells are the limiting factor for GC size and function, and there is abundant evidence from several mouse models that unrestricted T_FH expansion leads to systemic autoimmunity (35, 36). Multiple studies have also found an association between decreased numbers or impaired function of Treg cells in lupus patients and mouse models (37). The differentiation of effector CD4⁺ T cell subsets is a dynamic and plastic process, and cross-talks between the T_FH and Treg pathways have been described (30, 38). Although rapid progress has been made in recent years in mapping out the molecular pathways leading to Treg (39) and T_FH cell differentiation (40), many questions still remain, including the mechanisms by which the balance between these two subsets is maintained. We propose that PBX1 is involved in this process through its ability to regulate gene expression in a cell specific manner through complex interactions with its co-factors. The over-expression of dominant-negative Pbx1-d leads to an imbalance in T cell homeostasis: a modest Pbx1-d over-expression limits the spontaneous expansion or maintenance of the Treg subset in B6.Sle1a1 mice, while a high over-expression of Pbx1-d expands T_FH cells Pbx1-d Tg mice. Homeostatic expansion in the context of BM chimera revealed a role for Pbx1-d Tg overexpression for Treg maintenance. Similarly, a recall response in a competitive setting revealed a much stronger response of T_FH cells expressing Pbx1-d either as a transgene or endogenously. This could be due to a better survival of memory T_FH cells after the primary response, or to a better ability to respond to the challenge, two possibilities that we will explore in future experiments.

Interestingly, we found that the imbalance between Treg and T_FH cells was enhanced in the mLN. We have previously associated Pbx1-d expression with an impaired response to RA ((15) and this report), and the major effect of RA in vivo occurs in gut-associated lymphoid tissue. It is therefore possible that the anatomy of T_FH cell expansion in Pbx1-d Tg mice reflects the relative response to RA and commensal microbiota, an issue that will be explored in future studies. Pbx1-d led to T_FH cell expansion in spite of a relatively expanded T_FR subset, which is reminiscent of a recent study of mice with a specific deletion of PTEN in Foxp3⁺ T cells, in which T_FH cell expansion occurred as a result of impaired Treg cell functions but in the presence of unchanged or expanded T_FR cell numbers (41). In addition to Pbx1-d expression level, other factors may contribute to the differences between B6.Sle1a1 and Pbx1-d Tg mice. B6.Sle1a1 mice express Pbx1-d in other cell types, such as mesenchymal stem cells, leading to an increased production of pro-inflammatory cytokines (21). Pbx1 also regulates the production of inflammatory cytokines in macrophages in response to apoptotic cells (42). Although we have shown that the Sle1a1 T cell phenotypes are cell-intrinsic (15), we cannot rule out that Pbx1-d expression in other cell types may have additional modulatory effects on CD4⁺ T cell differentiation

MicroRNAs are essential mediators of T_H cell plasticity, including the balance between Treg and T_FH cells (30). Numerous studies have documented different miRNA profiles in human and murine SLE (43–45), and causal relationships between overexpression of either miR-21 or miR-155 and lupus have been established (46, 47). We showed here that increased expression of miR-10a, miR-21 and miR-155 occurs in CD4⁺ T cells before TC mice show autoimmune manifestations. Importantly, increased Pbx1-d expression in both the B6.Sle1a1 congenic and Pbx1-d Tg CD4⁺ T cells showed the same pattern of miRNA expression, implicating Pbx1-d as a primary driver regulating the intrinsic expression of these three miRNAs in T cells, either directly or indirectly. The existence of PBX1 binding sites in the distal promoter of each of these three miRNAs that are sufficient to increase transcription in the presence of Pbx1 supports this hypothesis. If Pbx1-d functions as a dominant negative transcription factor, it suggests that Pbx1-b is a negative regulator of these three miRNAs, especially for miR-10a and miR-155. Pbx1 can however bind to DNA indirectly through numerous co-factors (48, 49). Detailed studies will be necessary to unravel the molecular mechanisms by which Pbx1 isoforms regulate the expression of miR-10a, miR-21 and miR-155.

The exact role of each of these miRNAs in T cells overexpressing Pbx1-d could provide important cues on the mechanisms by which Pbx1 regulates T cell differentiation. miR-10a is over-expressed in B cells from lupus patients (44) and miR-10a stabilizes Treg cells (50) and prevents the conversion of pTreg into T_FH cells by targeting Bcl6 and its co-repressor Ncor2 in a TGF-β and RA-dependent manner (51). It was therefore unexpected to find consistently high levels of miR-10a expression in the CD4⁺ T cells, including Foxp3⁺ T cells, of the lupus congenic mice characterized here. Moreover, the level of miR-10a was similar between Pbx1-d Tg and TC CD4⁺ T cells, arguing that Pbx1-d overexpression is the main determinant of this dysregulation. miR-21 is elevated in lupus (52) and it regulates aberrant T cell responses by blocking PDCD4 expression (45). miR-21 expression has not been directly linked to either Treg or T_FH cells, but it is activated by STAT3 in T cells (53), and it is possible that its increased expression in Pbx1-d Tg CD4⁺ T cells is secondary to their increased IL-21 expression. miR-155 is a central modulator of T cell functions (54). Receptor activation increases miR-155 expression in T cells, which regulates effector subset differentiation and maintenance. miR-155 deficiency has been associated with decreased T_H1 responses as well as low Treg cell numbers, which fits with Pbx1-d Tg expressing T cells showing high miR-155 expression, skewed T_H1 humoral responses and a reduced Treg population. Specific deletion of miR-155 in T cells showed an intrinsic requirement of miR-155 for T_FH cell differentiation (55). miR-155 deficiency normalized B cell functions and autoAb production in FAS-deficient mice (47). The role of miR-155 expression in T cells was however not addressed in this model. Our results demonstrate consistent high levels of miR-155 expression in the CD4⁺ T cells of the lupus congenic mice examined in this study, including both Foxp3⁺ and Foxp3⁻Pbx1-d Tg CD4⁺ T cells. This is consistent with a model in which miR-155 favors T_FH over Treg cell differentiation and demonstrates that Pbx1-d overexpression is sufficient to drive this process. Interestingly, we found an overexpression of the miR-17~92 cluster in Sle1a1 Treg cells but no difference in Pbx1-d Tg Treg cells, or in non-Treg cells in either strain. miR-17~92 prevents pTreg cell differentiation (56), which fits with our findings that Treg cells are more affected in Sle1a1 than Pbx1-d Tg T cells. Moreover, miR-17~92 over-expression in lymphocytes leads to autoimmune phenotypes in mice (57), suggesting that it may be a mechanism by which Pbx1-d overexpression contributes to autoimmunity.

In conclusion, the phenotypes and CD4⁺ T cell differentiation in Pbx1-d Tg mice are similar to that of B6.Sle1a1 mice, which establishes Pbx1 as the gene responsible for the Sle1a1 phenotype. It also highlights critical roles for the lupus development in regulating Treg and T_FH cell differentiation, and developing humoral autoimmunity. The Pbx1-d Tg mice provide a novel model to investigate T cell intrinsic mechanisms that regulate Treg/T_FH homeostasis. Further studies are required to identify the Pbx1/Pbx1-d-regulated genes in T cells and their contribution to CD4⁺ T cell differentiation and effector functions.

Abbreviations

Ab

antibody

Ag

antigen

ANA

anti-nuclear Ab

B6

C57BL/6J mice

B6.Ly5^a

B6.SJL-Ptprc^aPep3^b/BoyJ

BM

bone marrow

GC

germinal center

iTreg

induced Treg

mLN

mesenteric lymph node

OVA

ovalbumin

pTreg

peripheral Treg

SLE

systemic lupus erythematosus

TC

B6.NZM-Sle1^NZM2410/AegSle2^NZM2410/AegSle3^NZM2410/Aeg/LmoJ

TD

T-dependent

Teff

effector T cells

Tg

transgene

T_EM

CD44⁺CD62L^-CD4⁺ effector memory T cells

T_FH

CXCR5⁺PD-1⁺BCL6⁺FOXP3^-CD4⁺ follicular helper T cells

T_FR

CD4⁺PD1⁺CXCR5⁺Bcl6⁺Foxp3⁺ follicular regulatory T cells

T_N

CD44⁻CD62L⁺ naïve T cells

Treg

regulatory T cells

tTreg

thymic Treg