Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2016 Jul 13;198(15):2020–2028. doi: 10.1128/JB.01035-15

F420H2 Is Required for Phthiocerol Dimycocerosate Synthesis in Mycobacteria

Endang Purwantini a,, Lacy Daniels c, Biswarup Mukhopadhyay a,b
Editor: T M Henkind
PMCID: PMC4944228  PMID: 27185825

ABSTRACT

Phthiocerol dimycocerosates (PDIM) are a group of cell surface-associated apolar lipids of Mycobacterium tuberculosis and closely related mycobacteria, such as Mycobacterium bovis and Mycobacterium leprae. A characteristic methoxy group of these lipids is generated from the methylation of a hydroxyl group of the direct precursors, the phthiotriols. The precursors arise from the reduction of phthiodiolones, the keto intermediates, by a ketoreductase. The putative phthiodiolone ketoreductase (PKR) is encoded by Rv2951c in M. tuberculosis and BCG_2972c in M. bovis BCG, and these open reading frames (ORFs) encode identical amino acid sequences. We investigated the cofactor requirement of the BCG_2972c protein. A comparative analysis based on the crystallographic structures of similar enzymes identified structural elements for binding of coenzyme F420 and hydrophobic phthiodiolones in PKR. Coenzyme F420 is a deazaflavin coenzyme that serves several key functions in pathogenic and nonpathogenic mycobacteria. We found that an M. bovis BCG mutant lacking F420-dependent glucose-6-phosphate dehydrogenase (Fgd), which generates F420H2 (glucose-6-phosphate + F420 → 6-phosphogluconate + F420H2), was devoid of phthiocerols and accumulated phthiodiolones. When the mutant was provided with F420H2, a broken-cell slurry of the mutant converted accumulated phthiodiolones to phthiocerols; F420H2 was generated in situ from F420 and glucose-6-phosphate by the action of Fgd. Thus, the reaction mixture was competent in reducing phthiodiolones to phthiotriols (phthiodiolones + F420H2 → phthiotriols + F420), which were then methylated to phthiocerols. These results established the mycobacterial phthiodiolone ketoreductase as an F420H2-dependent enzyme (fPKR). A phylogenetic analysis of close homologs of fPKR revealed potential F420-dependent lipid-modifying enzymes in a broad range of mycobacteria.

IMPORTANCE Mycobacterium tuberculosis is the causative agent of tuberculosis, and phthiocerol dimycocerosates (PDIM) protect this pathogen from the early innate immune response of an infected host. Thus, the PDIM synthesis system is a potential target for the development of effective treatments for tuberculosis. The current study shows that a PDIM synthesis enzyme is dependent on the coenzyme F420. F420 is universally present in mycobacteria and absent in humans. This finding expands the number of experimentally validated F420-dependent enzymes in M. tuberculosis to six, each of which helps the pathogen to evade killing by the host immune system, and one of which activates an antituberculosis drug, PA-824. This work also has relevance to leprosy, since similar waxy lipids are found in Mycobacterium leprae.

INTRODUCTION

Diacylated polyketides (DPs), a family of waxy compounds, are found in the cell walls of a group of mostly pathogenic and slow-growing mycobacteria (Fig. 1) (1, 2). The pathways for the biosynthesis of DPs are of great interest because these compounds are virulence factors for Mycobacterium tuberculosis and Mycobacterium leprae, which cause tuberculosis (TB) and leprosy, respectively (311). It was recently shown that these polyketide derivatives protect M. tuberculosis from the early innate immune response of an infected host (12). The DPs are generated by esterifying β-glycol-containing long-chain polyketides (PK) with long-chain multimethyl-branched fatty acids (Fig. 1) (1, 2). In M. tuberculosis, these compounds have two structural types: phthiocerol dimycocerosates (PDIM or DIM A) and glycosylated phenolphthiocerol dimycocerosates or phenolic glycolipids (PGL-tb) (13) (Fig. 1); if the PK units carry a keto group in place of a methoxy group, the respective variations are called phthiodiolone dimycocerosates (DIM B) and glycosylated phenolphthiodiolone dimycocerosates (Fig. 1) (1315). The above-mentioned methoxy group is generated in two steps, i.e., reduction of the corresponding keto group to a hydroxy group by a phthiodiolone reductase, generating phthiotriol intermediates, followed by methylation of the hydroxy group by a methyltransferase (14, 15).

FIG 1.

FIG 1

Conversion of phthiodiolone dimycocerosates (DIM B) to phthiocerol dimycocerosates (DIM A) in mycobacteria. The conversion proceeds via intermediate formation of phthiotriol dimycocerosates by an F420H2-dependent phthiodiolone ketoreductase (fPKR) that is encoded by Rv2951c in Mycobacterium tuberculosis (Mtb) and by BCG_2972c in Mycobacterium bovis BCG. The structures of the three classes of dimycocerosates are shown.

In Mycobacterium tuberculosis, the open reading frames (ORFs) Rv2951c and Rv2952 encode the phthiodiolone ketoreductase (PKR) and phthiotriol methyltransferase, respectively (1315). Disruption of Rv2951c eliminates the production of DIM A and PGL-tb and causes the accumulation of DIM B and glycosylated phenolphthiodiolone dimycocerosates (13). It has been indicated that Rv2951c encodes a domain characteristic of coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase (Mer), but its specific cofactor requirement has not been determined (14). Mer is a key enzyme in methane biosynthesis in methanogenic archaea (16), and a well-characterized mycobacterial Mer homolog is F420-dependent glucose-6-phosphate (G6P) dehydrogenase (Fgd) (1719); all mycobacteria carry the fgd gene (19, 20).

Coenzyme F420, a deazaflavin derivative, is a major coenzyme of the methanogenic archaea and of methanogens (16). In the bacterial domain, it is mostly found in some of the actinobacterial species, including all mycobacteria and streptomyces, and genome analysis suggests that F420 is sporadically present in proteobacteria as well (2023). At the ground state, the most commonly encountered form of this coenzyme in biological systems, the midpoint redox potential value (E0′) of F420 is −360 mV, and it performs hydride transfer (16, 24). The E0′ value of NAD(P)+, a major biological hydride transfer coenzyme, is −320 mV (16, 24). Whether the actinobacteria benefit from the higher reducing power (lower E0′ value) of F420 remains to be determined.

In this report, we describe results from our genetic and chemical analyses and an in vitro enzymatic conversion experiment which show that PKR is indeed an F420-dependent enzyme, and accordingly, we have termed it fPKR.

MATERIALS AND METHODS

Growth medium and culture conditions for Mycobacterium bovis BCG.

M. bovis BCG strain Pasteur 1173P2 (wild type) and a respective mutant strain lacking functional fgd (ORF BCG_0446) (25, 26) were used in this study. The mutant strain was obtained during a previous Tn5367 mutagenesis-based study, and it is known to lack the respective enzymatic activity (26). To clearly map the Tn5367 insertion site in the M. bovis BCG fgd::Tn5367 strain, a region of the mutant chromosome containing the interrupted fgd gene, respective upstream and downstream regions, and the inserted transposon was amplified by use of primers BCGFgd/1F (5′GGATCCGTCGCCGGGATAGCCGGCGTC3′) and BCGFgd/2R (5′CTGCAGGTCCCGCTCCGCAGAGAGCCG3′), and the amplicon was sequenced. The data showed that the transposon was inserted at the 421-bp position of the fgd coding sequence.

Both the wild-type and fgd::Tn5367 strains were grown in Middlebrook 7H9 liquid medium supplemented with 5% Middlebrook ADC, 0.2% glycerol, and 0.05% Tween 80 (27); the fgd::Tn5367 strain was cultivated in the presence of kanamycin (20 μg/ml). The cultures were incubated at 37°C with occasional manual shaking for 2 to 3 weeks. The cells were recovered by centrifugation at 18,000 × g for 15 min at 4°C, washed with 20 mM potassium phosphate buffer, pH 7.0, and stored at −20°C until further use.

Heterologous expression and purification of F420-dependent glucose-6-phosphate dehydrogenase.

The coding sequence of Mycobacterium smegmatis fgd (msmeg_0777) (19) was PCR amplified and cloned into the NdeI and BamHI sites of pTEV5, a T7 promoter-based protein expression vector (28), providing pTEV5-msmeg_0777. The plasmid was designed to generate recombinant Fgd with an NH2-terminal His6 tag (MSYYHHHHHHDYDIPTSENLYFQGASH). Escherichia coli BL21(DE3)(pTEV5-msmeg_0777) was cultivated at 37°C in LB medium containing 100 μg/ml ampicillin. Fgd expression was induced by supplementing the culture with isopropyl-β-d-thiogalactopyranoside (IPTG) to a final concentration of 0.4 mM. Fgd carrying the His6 tag was purified as a soluble protein via Ni2+-nitrilotriacetic acid chromatography (29, 30); the enzyme was eluted with 150 mM imidazole, and based on the results of SDS-PAGE analysis, the preparation was judged to be apparently homogeneous. Freshly prepared enzyme was used in the in vitro conversion experiment.

In vitro conversion of phthiodiolones to phthiotriols.

A broken-cell slurry of M. bovis BCG fgd::Tn5367 was prepared as described previously (26). In brief, about 0.2 g of wet cells was resuspended in 0.2 ml 20 mM potassium phosphate buffer, pH 7, and the cells in this suspension were lysed by use of a mini-bead beater (BioSpec Products, Inc., Bartlesville, OK) operating at 4,800 rpm; three 1-min bead beatings with intermediate 2-min incubations on ice were used. The cell slurry (0.25 ml) was mixed with the following at the indicated final concentrations in a total volume of 0.5 ml: purified recombinant Fgd (20 μg), F420 (50 μM), and glucose-6-phosphate (5 mM). The mixture was incubated overnight at 37°C with gentle shaking. The apolar lipids were isolated from the mixture and analyzed via thin-layer chromatography (TLC) as described below.

Lipid analysis.

A cell pellet (about 1 g) of M. bovis BCG or its fgd::Tn5367 derivative was mixed with 20 ml of a mixture of chloroform-methanol (2:1 [vol/vol]) and shaken at room temperature (∼25°C) overnight. The mixture was filtered using a Whatman grade 1 filter paper (GE Healthcare Bio-Sciences, Pittsburgh, PA), and then a 0.3% aqueous NaCl solution (1/5 of the filtrate volume) was added to the resulting filtrate to generate a chloroform layer that contained the apolar lipids, including DIM A and DIM B. The chloroform layer was collected and dried under an N2 stream, and the residue was dissolved in a minimal volume of a chloroform-methanol mixture (2:1 [vol/vol]). This product was analyzed via TLC on an aluminum-backed silica gel plate (Merck 5735, silica gel 60F254; Merck KGaA, Darmstadt, Germany), using a mixture of petroleum ether and diethyl ether (9:1) as the development solvent (15). The lipid spots of resolved lipids were visualized by spraying with a 5% molybdophosphoric acid solution in ethanol followed by charring at 110°C for 15 min (15); this procedure detects DIM A and DIM B but not the respective phenolic glycolipids (Fig. 1).

Mass spectrometric analysis of DIM A and DIM B.

The lipids to be analyzed were purified via TLC as follows. To generate an adequate amount of material, the TLC analysis as shown in each lane of Fig. 3 was scaled to a multilane format, and a terminal lane was cut off and processed for the detection of DIM A and/or DIM B bands as described above. Using a relevant band in the terminal lane as a guide, the silica layers of the desired dimycocerosate spots were scraped from the rest of the lanes. From the recovered silica particles, dimycocerosates were extracted with chloroform-methanol (2:1) and analyzed via matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry at the School of Chemical Sciences Mass Spectrometry Laboratory at the University of Illinois at Urbana-Champaign. Bruker peptide calibration mixture II (angiotensin II, angiotensin I, substance P, bombesin, ACTH clip 1–17, ACTH clip 18–39, somatostatin 28, bradykinin fragment 1–7, and porcine renin substrate tetradecapeptide; covered mass range, ∼700 to 3,200 Da) was used for calibration, and the matrix was 2,5-dihydroxybenzoic acid. A Bruker UltrafleXtreme mass spectrometer (Bruker, Bremen, Germany) equipped with a Smart Beam II laser was used in the positive mode to acquire MALDI-TOF mass spectra. Samples were analyzed in the reflectron mode.

FIG 3.

FIG 3

Analysis of dimycocerosates extracted from Mycobacterium bovis BCG strains and an in vitro conversion system via thin-layer chromatography (TLC). Lanes: wt, M. bovis BCG strain Pasteur 1173P2; Δfgd, M. bovis BCG fgd::Tn5367; Δfgd + F420H2, an in vitro reaction mixture containing a broken-cell suspension of M. bovis BCG fgd::Tn5367 (source of DIM B and fPKR) and F420H2 generated in situ from F420 and glucose-6-phosphate by the action of a purified recombinant form of Fgd of Mycobacterium smegmatis. The details of the in vitro reaction, extraction of apolar lipids from mycobacterial cells and the in vitro reaction mixture, and TLC analysis of apolar lipids appear in Materials and Methods. The TLC analysis detected DIM A and DIM B but not the respective phenolic glycolipids. DIM A and DIM B bands are marked; the identities of U1 and U2 are unknown.

Bioinformatic analysis.

Homologs of the Rv2951c protein were identified via a BLASTP search (31) of the NCBI's nonredundant protein database, using the amino acid sequence of this protein as the query and with a specific focus on Mycobacterium species (taxid 1763). Proteins showing >50% identity to the Rv2951c protein were selected for a phylogenetic analysis, which was performed as described previously (32). In brief, the amino acid sequences were aligned and trimmed by use of the Muscle (33) and Gblocks (34) programs, respectively. A phylogenetic tree was then constructed using a maximum likelihood-based phylogenetic reconstruction program, proml, in the Phylip 3.67 package (32), with 100 replicates, and the tree was viewed with FigTree v1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/).

For identification of the conserved Mer-type secondary structure features and F420-binding residues and for prediction of the DIM B-interacting elements in the Rv2951c protein, the amino acid sequences of this protein and selected Mer homologs for which X-ray crystallographic three-dimensional structures of the F420-bound forms are available (17, 3537) were aligned by PROMALS3D at http://prodata.swmed.edu/promals3d/promals3d.php and by manual adjustments (38).

RESULTS AND DISCUSSION

Analysis of the structural characteristics of the Rv2951c protein.

The goal of this analysis was to determine whether the Rv2951c protein has the potential to interact with coenzyme F420 and hydrophobic substrates, such as phthiodiolones. For this purpose, we performed a structure-based sequence alignment (Fig. 2) by utilizing the X-ray crystallographic structures of Mer from two methanogenic archaea, Methanopyrus kandleri and Methanosarcina barkeri (MkMer and MbMer, respectively) (36, 37), and two Mer homologs, an F420-dependent secondary alcohol dehydrogenase (Adf) from another methanogen (35) and Fgd of M. tuberculosis (17) (Fig. 2). For Fgd, Adf, and MbMer, structures of F420-bound forms were used. The primary structure of the recently described F420-dependent hydroxymycolic acid dehydrogenase of M. tuberculosis (fHMAD or Rv0132c) (39) was also included in the analysis (Fig. 2). The alignment showed that the predicted secondary structural features of the Rv2951c protein are highly similar to those found in Fgd, Adf, and MbMer and that the protein carries the features that allow a Mer homolog to bind F420 (Fig. 2). Mer, Adf, and Fgd induce a butterfly conformation at the si face of bound F420 by holding the coenzyme with conserved structural elements (marked with asterisks in Fig. 2) (17, 3537). In Adf, His39 and Glu108 hold the pyrimidine ring of F420, and the hydroxybenzyl wing of the coenzyme is fixed by Val193 and Ile227 (35). These interactions are conserved in Fgd and Mer, the equivalent residues in fHMAD are His78 and Glu147, and those in the Rv2951c protein are His43 and Glu129 (Fig. 2). In Adf, Fgd, and Mer, the central pyridine ring of F420 is placed outside the plane of the two flanking rings via an unusual structural element, a bulge, that contains a nonprolyl cis-peptide bond (17, 3537). Among Mer homologs, this element was first identified in MkMer, where Gly64 and Ile65 form the unusual cis-peptide bond (37) (Fig. 2). In Fgd, this bond occurs between Ser73 and Val74, and the carbonyl oxygen of Ser73 and the side chain of Val74 interact with the re face of the central pyridine ring (17). The respective residues in other enzymes are as follows (Fig. 2): Cys72 and Ile73 in Adf, Gly61 and Val62 in MbMer, Gly64 and Ile65 in MkMer, Gly121 and Val122 in fHMAD, and Cys94 and Val95 in the Rv2951c protein. The replacement of Ser73 as in Fgd with Cys or Gly in other Mer homologs is considered conservative, as these three amino acids are highly compatible in terms of their hydrophobicities, isoelectric points, and volumes (3943). In Adf, the formation of the unfavorable nonprolyl cis-peptide bond is dictated by a highly conserved Asp residue (Asp38) (Fig. 2), and the position of the carboxylate of this residue is fixed by a salt bridge with an Arg residue (Arg79) (35). Both Asp38 and Arg79 of Adf are conserved in Fgd, MkMer, MbMer, fHMAD, and the Rv2951c protein (Fig. 2), and the previously reported consensus sequence for the bulge [D/E-H-X(20–30)-I/L-S/G-X-I/V/A-X5-R/H] (35) fits the Rv2951c protein. Thus, the Rv2951c protein carries all sequence features for binding coenzyme F420.

FIG 2.

FIG 2

Putative F420-binding residues in F420-dependent phthiodiolone ketoreductase (fPKR). The figure presents a structure-guided multiple-sequence alignment generated at the PROMALS3D Web server (38). The ORFs encoding fPKR in Mycobacterium tuberculosis H37Rv (Rv2951c; http://www.ncbi.nlm.nih.gov/protein/CCP45755.1) and Mycobacterium bovis BCG strain Pasteur 1173P2 (BCG_2972c; http://www.ncbi.nlm.nih.gov/protein/CAL72961.1) have identical sequences. The sequences aligned (full name, abbreviation, PDB ID wherever applicable) are as follows: F420-dependent secondary alcohol dehydrogenase from Methanoculleus thermophilicus, Adf, 1rhc (35); F420-dependent glucose-6-phosphate dehydrogenase of M. tuberculosis, Fgd, 3b4y (17); F420-dependent methylenetetrahydromethanopterin reductase of Methanosarcina barkeri, MbMer, 1z69 (36, 37); F420-dependent methylenetetrahydromethanopterin reductase of Methanopyrus kandleri, MkMer, 1ezw (36, 37); F420-dependent hydroxymycolic acid dehydrogenase of M. tuberculosis, fHMAD (http://www.ncbi.nlm.nih.gov/protein/P96809.1) (39); and F420-dependent phthiodiolone ketoreductase, Rv2951c/BCG_2972c (this report). Yellow-shaded, underlined residues, experimentally determined F420-binding residues (17, 35, 36); yellow-shaded residues, predicted F420-binding residues; amino acid residues in red and blue letters, known (Adf, Fgd, MbMer, and MkMer) and predicted (fHMAD and fPKR) locations of alpha helices and beta sheets, respectively; CSS, consensus secondary structure (red h's and blue e's represent alpha helices and beta sheets, respectively); *, residues responsible for inducing a butterfly conformation at the si face of bound F420 (17, 3537).

In Adf, the hydroxybenzyl unit of F420 interacts with Val193 and Leu227, which are hydrophobic, and this selection is justified by the localization of the hydrocarbon chain of the secondary alcohol in this region (35). Similarly, for MkMer, the equivalent region carries Ala197 and Tyr229, which are proposed to interact with the pterin ring of tetrahydromethanopterin (37). A partial conservation is seen in fHMAD (Ala232 and Glu263), which also oxidizes hydrophobic substrates, i.e., hydroxymycolic acids (39). In contrast, the homologous residues in Fgd are Ser196 and Glu230, the latter of which is followed by Lys232, and these elements not only accommodate the hydroxybenzyl ring but also will be near the charged glucose-6-phosphate (17). Based on these observations, the presence of Val215 and Val248 at the equivalent positions and an absence of the conservation of Lys232 of Fgd in the Rv2951c protein are consistent with the possibility that the Rv2951c protein acts on DIM B, a rather hydrophobic substrate. Hence, the Rv2951c protein has the structural elements for binding both F420 and the hydrophobic phthiodiolone moiety of DIM B and glycosylated phenolphthiodiolone dimycocerosates. These observations support the hypothesis that the Rv2951c protein utilizes F420H2 as the electron source for the reduction of phthiodiolone.

Genetic analysis of the requirement for F420H2 in phthiodiolone reduction.

Our strategy for testing the above-mentioned hypothesis was based on the following observations. Several studies have shown that, at least under laboratory growth conditions where glycerol or glucose is used as the carbon and energy source, Fgd is the major F420H2-generating enzyme in the mycobacteria, and elimination or disruption of the fgd gene blocks F420H2-dependent reactions. For example, the M. smegmatis Δfgd strain cannot carry out reduction of NO2, which requires F420H2 (44). Similarly, in M. tuberculosis and M. bovis BCG, inactivation of the fgd gene makes these organisms resistant to PA-824 (45); PA-824 as such is not an antimycobacterial agent, but its reaction with F420H2 as catalyzed by a deazaflavin-dependent nitroreductase (Ddn) releases NO that helps to kill mycobacteria (46, 47). Also, inactivation of the fgd gene eliminates aflatoxin degradation capability in M. smegmatis, as this process requires the actions of two families of F420H2-dependent reductases (48). A study with a mutant lacking Fgd activity helped to establish the role of F420H2 in the defense against oxidative stress in mycobacteria (49). Accordingly, we rationalized that if the Rv2951c protein uses F420H2 as the electron source for reducing phthiodiolone, an M. tuberculosis strain lacking functional fgd will produce DIM B and glycosylated phenolphthiodiolone dimycocerosates but not the respective phthiotriol forms, and therefore will lack DIM A and PGL-tb (Fig. 1).

We tested the above-mentioned hypothesis in the Mycobacterium bovis BCG model by using genetic analysis. The DIM A and DIM B profiles of this organism and M. tuberculosis are the same (14, 15, 50, 51). The homolog of the Rv2951c protein of M. tuberculosis in M. bovis BCG is the BCG_2972c protein, and these proteins have identical amino acid sequences (25). M. bovis BCG produces DIM A and DIM B (Fig. 3, wt lane) and therefore is capable of reducing DIM B to phthiotriol dimycocerosates. Since a focus on either DIM B or glycosylated phenolphthiodiolone dimycocerosates is sufficient to identify the electron source utilized in the reduction of the keto group of the phthiodiolone moiety, we limited the scope of our work to only the conversion of DIM B to DIM A (the nonglycosylated forms) in M. bovis BCG (52). We examined the DIM A and DIM B contents of wild-type M. bovis BCG strain Pasteur 1173P2 and a respective mutant strain (fgd::Tn5367) lacking functional fgd (BCG_0446 ORF) (25) via TLC analysis. The resulting profile for M. bovis BCG fgd::Tn5367 (Fig. 3, Δfgd lane), which lacked F420H2 (the reductant), was similar to that observed previously with an M. tuberculosis H37Rv derivative lacking the Rv2951c protein (the reductase enzyme) (13). To validate the TLC data, we performed MALDI mass spectrometric analysis with the materials recovered from the specific bands. The DIM A and DIM B preparations obtained from the wild-type strain (Fig. 3, wt lane) yielded characteristic spectra (Fig. 4) (13, 53). The observed [DIM A + Na]+ ion, with an m/z value of 1,348.738 (Fig. 4, left panel), represents a molecule with 89 carbon atoms (C89 species; theoretical mass, 1,348.3409) that has been reported for the highest-intensity peak in the mass spectrum for a DIM A preparation from M. bovis BCG strain Tokyo 172 (13, 54). The m/z values for other ions were higher or lower than that for the C89 species, by n × 14 units (Fig. 4, left panel), and this result is consistent with n representing larger or smaller numbers of methylene (CH2) groups present in the respective molecules. Similarly, the DIM B preparation produced an ion with an m/z value of 1,332.541 (Fig. 4, right panel), which is 16 mass units lower than that of the above-mentioned [DIM A + Na]+ ion, with 89 carbon atoms (Fig. 4, left panel). This difference represents the conversion of a carbonyl group (C=O, as in DIM B) to a methoxy group (CH-OCH3, as in DIM A). Several other peaks in the DIM B spectrum had cognate peaks in the DIM A spectrum (Fig. 4). A mass spectrometric analysis of DIM B isolated from the fgd::Tn5367 strain (Fig. 3, Δfgd lane) produced the same results (data not shown). These findings clearly establish that M. bovis BCG fgd::Tn5367 lacks DIM A and accumulates DIM B. Since M. bovis BCG fgd::Tn5367 carries a homolog of the Rv2951c protein or phthiodiolone ketoreductase (the BCG_2972c protein), the inability to convert DIM B to DIM A was due to the unavailability of F420H2, which prevented the generation of the phthiotriol intermediate, the methylation substrate (Fig. 1) (14, 15). An obvious explanation for this observation is that the BCG_2972c protein (a homolog of the Rv2951c protein of M. tuberculosis) is an F420H2-dependent phthiodiolone ketoreductase (fPKR).

FIG 4.

FIG 4

MALDI-TOF mass spectra of phthiodiolone dimycocerosates (DIM B) and phthiocerol dimycocerosates (DIM A) recovered from wild-type Mycobacterium bovis BCG (strain Pasteur 1173P2). The products analyzed correspond to the wt lane in Fig. 3. The peaks for [M + Na]+ species with exclusively the 12C isotope that are characteristic of DIM A and DIM B of M. bovis BCG (13) are labeled with their respective numbers of carbon atoms and observed m/z values. For each ion, the respective theoretical mass value (72) is shown within parentheses. The observed m/z values deviated from the theoretical mass values by 0.34 to 0.64 unit for [DIM A + Na]+ ions and by 0.19 to 0.24 unit for [DIM B + Na]+ ions. Such deviations have been observed by mass spectrometry analysis of DIM A and DIM B of Mycobacterium bovis BCG (54).

Phthiodiolone ketoreductase reaction.

The phthiodiolone ketoreductase reaction is as follows: phthiodiolone + F420H2 → phthiotriol + F420. Alternatively, F420H2 may serve as an indirect source of reductant for phthiodiolone reduction. Resolution of these possibilities would require demonstration of enzymatic and/or F420-binding activity of the homogeneous enzyme.

Demonstration of F420H2-dependent phthiodiolone ketoreductase activity in cell extracts.

We validated the conclusion derived from genetic analysis at the enzymatic activity level. In this experiment, a broken-cell slurry of M. bovis BCG fgd::Tn5367 was used as the source of phthiodiolone dimycocerosate (DIM B) and phthiodiolone reductase (the BCG_2972c protein), and the needed F420H2 was generated in situ from added F420, glucose-6-phosphate, and purified Fgd via the following reaction: glucose-6-phosphate + F420 → F420H2 + 6-phosphogluconate. A TLC analysis showed that upon incubation at 37°C, the system converted DIM B present in M. bovis BCG fgd::Tn5367 to a DIM A-like product and two other compounds that were assigned the trivial names U1 and U2 (Fig. 3, Δfgd + F420H2 lane). The putative DIM A product isolated from the in vitro reaction mixture was analyzed via MALDI mass spectrometry, and in the resulting spectrum the following peaks had m/z values (numbers of carbon atoms) characteristic of DIM A: 1,348.354 (C89), 1,362.179 (C90), 1,376.245 (C91), 1,390.249 (C92), 1,404.360 (C93), 1,418.424 (C94), 1,432.277 (C95), and 1,446.239 (C96). The other reaction products, U1 and U2 (Fig. 3, Δfgd + F420H2 lane), remain to be identified, but the former seemed to exist in wild-type M. bovis BCG (Fig. 3, wt lane). These results showed that the in vitro reaction that was catalyzed by the enzyme systems from the mutant strain (fgd::Tn5367) and utilized F420H2 generated by purified Fgd as a reductant converted DIM B to DIM A. This conversion must have occurred in two steps: F420H2-dependent reduction of DIM B to the respective phthiotriol derivatives, catalyzed by the BCG_2972c protein; and methylation of phthiotriols to phthiocerols (DIM A) by a methyltransferase, the BCG_2973 protein. It remains to be investigated whether the production of U1 or U2 was caused by Fgd, F420H2, glucose-6-phosphate, 6-phosphogluconate, fPKR, or other enzymes of M. bovis BCG.

Phylogenetic analysis of mycobacterial homologs of the Rv2951c protein (fPKR), revealing potentially new F420-dependent lipid-modifying enzymes in mycobacteria.

The homologs of the full-length Rv2951c protein identified in the BLASTP search fell into two distinct groups in terms of amino acid sequence identity with the Rv2951c protein: those with ≥50% and those with ≤40% identity. This selection was justified by the absence of homologs in the intermediate range and therefore provided a sharp boundary. The ≤40% group included F420-dependent glucose-6-phosphate dehydrogenase (Fgd) (18, 19), F420-dependent hydroxymycolic acid dehydrogenase (fHMAD) (39), and putative flavin-containing enzymes. On the other hand, the ≥50% group was comprised of phthiodiolone ketoreductases and proteins of unknown function, and due to this closer relationship with the Rv2951c protein, we performed a maximum likelihood-based phylogenetic analysis with select representatives of this group (Fig. 5); the full-length sequence of every homolog, with appropriate trimming as described in Materials and Methods, was used in the analysis. The analysis revealed major clades, each of which had two or more subgroups (Fig. 5). Clade Ia represented the closest homologs of fPKR (with >83% amino acid sequence identities with the Rv2951c protein). These proteins belonged to a group of slow-growing mycobacteria which are known to contain PDIM (55) and to carry PapA5, which catalyzes a committed step of PDIM synthesis in M. tuberculosis (56). PapA5, a polyketide-associated protein, is an acyltransferase, and the respective gene is part of a PDIM synthesis gene cluster (79, 14, 50, 5759). Accordingly, clade Ia homologs of the Rv2951c protein are likely to be bona fide fPKRs. Also, with the exception of Mycobacterium gastri, all species carrying clade Ia homologs are human or animal pathogens (55) (Fig. 5). This pattern is consistent with the observation that PDIM is one of the pathogenicity determinants of mycobacteria (311). Clade Ib homologs and most members of clade II were from fast-growing mycobacterial species (Fig. 5), and the available data suggest that these organisms are devoid of PDIM (55). A BLASTP analysis showed that these species harbored weaker homologs of PapA5 that exhibited 40% amino acid sequence identity to M. tuberculosis PapA5; for the organisms with PDIM, the respective sequence identity values were >80%. However, every protein shown in Fig. 5 carried the conserved F420-binding residues shown in Fig. 2 (data not shown). Accordingly, we hypothesize that clade Ib and II homologs reduce keto groups or oxidize hydroxyl groups on lipids or lipid domains of more complex compounds by using F420 as an electron carrier.

FIG 5.

FIG 5

Maximum likelihood phylogenetic analysis of F420H2-dependent phthiodiolone ketoreductase (fPKR) homologs in mycobacteria. Homologs with amino acid sequence identities to Mycobacterium tuberculosis fPKR (the Rv2915c protein) of >50% were analyzed, and the method was performed as described previously (32). The coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase (Mer) from Methanopyrus kandleri (37) was used as the outgroup. The names of the slow-growing mycobacterial species (52) and the respective Rv2951c protein homologs are shown in red; the rest are fast growers (52). +, the fPKRs of M. tuberculosis H37Rv (the Rv2951c protein) and M. bovis BCG strain Pasteur 1173P2 (the BCG_2972c protein) have identical amino acid sequences. The dots near the branches indicate bootstrap values of >70 (calculated for 100 replicates). The homologs in clade Ia are >80% identical to the Rv2951c protein at the amino acid sequence level and belong to slow-growing mycobacterial species that contain PDIM (52, 55) and carry the gene for an acyltransferase (PapA5) that catalyzes the committed step of PDIM biosynthesis (56). With the exception of Mycobacterium gastri, the species harboring clade Ia homologs are human or animal pathogens (55).

fPKR expands the list of experimentally validated F420-dependent enzymes in M. tuberculosis to six (18, 39, 60), among which Fgd, fHMAD, and fPKR are Mer homologs (Fig. 2) (18, 19, 39) and the others are F420H2-dependent quinone reductases (Fqr) or Ddn family proteins (the Rv3547, Rv1261c, and Rv1558 proteins) (60). These enzymes represent a part of the full potential, as M. tuberculosis has been predicted to carry at least 28 F420-dependent enzymes (20), and one of the identified Ddn homologs (the Rv3178 protein) has yet to be studied for enzymatic activity (60). This is an important gap, as all F420-dependent systems of M. tuberculosis investigated thus far have been linked to TB pathogenesis and/or found to be relevant to the development of TB therapeutics (26, 39, 60, 61). Fgd is the principal enzyme for the generation of reduced F420H2 (18, 44, 49), which is likely used by M. tuberculosis in combating oxidative or nitrosative stress (44, 49, 60). For example, F420H2 allows this pathogen to covert highly toxic nitrogen dioxide (NO2) to nitric oxide (NO) via chemical reduction (44); the organism is very sensitive to NO2 and almost resistant to NO (44, 62). Similarly, a mutant strain of M. tuberculosis that is devoid of F420 is hypersensitive to oxidative stress, as it cannot provide F420H2 for the three F420H2-dependent quinone reductases discussed above, which protect mycobacteria against oxidative stress (60). One of these reductases (Ddn, encoded by the Rv3547 ORF) acts as a nitroreductase to activate a prodrug called PA-824, a promising anti-TB drug that acts in concert with F420H2 (45, 60, 63, 64). The hydroxymycolic acid dehydrogenase (fHMAD), which generates ketomycolic acids (K-MA) from hydroxymycolic acids (H-MA), and fPKR studied here exemplify the critical role of F420 in the functionalization of the formidable cell wall lipids that protect M. tuberculosis from the host immune attack and from anti-TB drugs (12, 39, 61, 6570). Also, fHMAD is one of the targets of PA-824 (39). Some of the mycobacterial F420-dependent enzymes catalyze decolorization of triphenylmethane dyes and degradation of aflatoxins (22, 46, 48, 71), and it is likely that these enzymes catalyze more physiologically relevant cellular functions in vivo, some of which may have roles in TB pathogenesis. The information presented in Fig. 5 brings several potentially novel F420-dependent lipid-modifying enzymes into focus. Thus, this report, in addition to defining the electron donor requirement of an important enzyme of pathogenic mycobacteria, further emphasizes a broad influence of F420 in the physiology of the mycobacteria in general.

ACKNOWLEDGMENTS

We thank Su Jung Kang for assistance with the purification of recombinant F420-dependent glucose-6-phosphate dehydrogenase, Dwi Susanti for consultation on phylogenetic analysis, and Furong Sun and Kevin R. Tucker, Mass Spectrometry Lab, School of Chemical Sciences, University of Illinois at Urbana-Champaign, for their help with mass spectrometry.

This research was supported by grant 1R21AI100039 from the National Institutes of Health. B.M. was supported in part by the Virginia Tech and Agricultural Experiment Station Hatch Program (CRIS project VA-160021).

REFERENCES

  • 1.Daffe M, Lacave C, Laneelle MA, Laneelle G. 1987. Structure of the major triglycosyl phenol-phthiocerol of Mycobacterium tuberculosis (strain Canetti). Eur J Biochem 167:155–160. doi: 10.1111/j.1432-1033.1987.tb13317.x. [DOI] [PubMed] [Google Scholar]
  • 2.Daffe M, Laneelle MA. 1989. Diglycosyl phenol phthiocerol diester of Mycobacterium leprae. Biochim Biophys Acta 1002:333–337. doi: 10.1016/0005-2760(89)90347-0. [DOI] [PubMed] [Google Scholar]
  • 3.Jain M, Petzold CJ, Schelle MW, Leavell MD, Mougous JD, Bertozzi CR, Leary JA, Cox JS. 2007. Lipidomics reveals control of Mycobacterium tuberculosis virulence lipids via metabolic coupling. Proc Natl Acad Sci U S A 104:5133–5138. doi: 10.1073/pnas.0610634104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Guenin-Mace L, Simeone R, Demangel C. 2009. Lipids of pathogenic mycobacteria: contributions to virulence and host immune suppression. Transbound Emerg Dis 56:255–268. doi: 10.1111/j.1865-1682.2009.01072.x. [DOI] [PubMed] [Google Scholar]
  • 5.Minnikin DE, Dobson G, Draper P. 1985. The free lipids of Mycobacterium leprae harvested from experimentally infected nine-banded armadillos. J Gen Microbiol 131:2007–2011. [DOI] [PubMed] [Google Scholar]
  • 6.Ng V, Zanazzi G, Timpl R, Talts JF, Salzer JL, Brennan PJ, Rambukkana A. 2000. Role of the cell wall phenolic glycolipid-1 in the peripheral nerve predilection of Mycobacterium leprae. Cell 103:511–524. doi: 10.1016/S0092-8674(00)00142-2. [DOI] [PubMed] [Google Scholar]
  • 7.Reed MB, Domenech P, Manca C, Su H, Barczak AK, Kreiswirth BN, Kaplan G, Barry CE III. 2004. A glycolipid of hypervirulent tuberculosis strains that inhibits the innate immune response. Nature 431:84–87. doi: 10.1038/nature02837. [DOI] [PubMed] [Google Scholar]
  • 8.Camacho LR, Ensergueix D, Perez E, Gicquel B, Guilhot C. 1999. Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Mol Microbiol 34:257–267. doi: 10.1046/j.1365-2958.1999.01593.x. [DOI] [PubMed] [Google Scholar]
  • 9.Cox JS, Chen B, McNeil M, Jacobs WR Jr. 1999. Complex lipid determines tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402:79–83. doi: 10.1038/47042. [DOI] [PubMed] [Google Scholar]
  • 10.Rousseau C, Winter N, Pivert E, Bordat Y, Neyrolles O, Ave P, Huerre M, Gicquel B, Jackson M. 2004. Production of phthiocerol dimycocerosates protects Mycobacterium tuberculosis from the cidal activity of reactive nitrogen intermediates produced by macrophages and modulates the early immune response to infection. Cell Microbiol 6:277–287. doi: 10.1046/j.1462-5822.2004.00368.x. [DOI] [PubMed] [Google Scholar]
  • 11.Sirakova TD, Dubey VS, Kim HJ, Cynamon MH, Kolattukudy PE. 2003. The largest open reading frame (pks12) in the Mycobacterium tuberculosis genome is involved in pathogenesis and dimycocerosyl phthiocerol synthesis. Infect Immun 71:3794–3801. doi: 10.1128/IAI.71.7.3794-3801.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Day TA, Mittler JE, Nixon MR, Thompson C, Miner MD, Hickey MJ, Liao RP, Pang JM, Shayakhmetov DM, Sherman DR. 2014. Mycobacterium tuberculosis strains lacking surface lipid phthiocerol dimycocerosate are susceptible to killing by an early innate host response. Infect Immun 82:5214–5222. doi: 10.1128/IAI.01340-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Simeone R, Constant P, Malaga W, Guilhot C, Daffe M, Chalut C. 2007. Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis. FEBS J 274:1957–1969. doi: 10.1111/j.1742-4658.2007.05740.x. [DOI] [PubMed] [Google Scholar]
  • 14.Onwueme KC, Vos CJ, Zurita J, Soll CE, Quadri LE. 2005. Identification of phthiodiolone ketoreductase, an enzyme required for production of mycobacterial diacyl phthiocerol virulence factors. J Bacteriol 187:4760–4766. doi: 10.1128/JB.187.14.4760-4766.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Perez E, Constant P, Laval F, Lemassu A, Laneelle MA, Daffe M, Guilhot C. 2004. Molecular dissection of the role of two methyltransferases in the biosynthesis of phenolglycolipids and phthiocerol dimycoserosate in the Mycobacterium tuberculosis complex. J Biol Chem 279:42584–42592. doi: 10.1074/jbc.M406134200. [DOI] [PubMed] [Google Scholar]
  • 16.DiMarco AA, Bobik TA, Wolfe RS. 1990. Unusual coenzymes of methanogenesis. Annu Rev Biochem 59:355–394. doi: 10.1146/annurev.bi.59.070190.002035. [DOI] [PubMed] [Google Scholar]
  • 17.Bashiri G, Squire CJ, Moreland NJ, Baker EN. 2008. Crystal structures of F420-dependent glucose-6-phosphate dehydrogenase FGD1 involved in the activation of the anti-tuberculosis drug candidate PA-824 reveal the basis of coenzyme and substrate binding. J Biol Chem 283:17531–17541. doi: 10.1074/jbc.M801854200. [DOI] [PubMed] [Google Scholar]
  • 18.Purwantini E, Daniels L. 1996. Purification of a novel coenzyme F420-dependent glucose-6-phosphate dehydrogenase from Mycobacterium smegmatis. J Bacteriol 178:2861–2866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Purwantini E, Daniels L. 1998. Molecular analysis of the gene encoding F420-dependent glucose-6-phosphate dehydrogenase from Mycobacterium smegmatis. J Bacteriol 180:2212–2219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Selengut JD, Haft DH. 2010. Unexpected abundance of coenzyme F420-dependent enzymes in Mycobacterium tuberculosis and other actinobacteria. J Bacteriol 192:5788–5798. doi: 10.1128/JB.00425-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Daniels L, Bakhiet N, Harmon K. 1985. Widespread distribution of a 5-deazaflavin cofactor in Actinomyces and related bacteria. Syst Appl Microbiol 6:12–17. doi: 10.1016/S0723-2020(85)80004-7. [DOI] [Google Scholar]
  • 22.Graham DE. 2010. A new role for coenzyme F420 in aflatoxin reduction by soil mycobacteria. Mol Microbiol 78:533–536. doi: 10.1111/j.1365-2958.2010.07358.x. [DOI] [PubMed] [Google Scholar]
  • 23.Purwantini E, Gillis TP, Daniels L. 1997. Presence of F420-dependent glucose-6-phosphate dehydrogenase in Mycobacterium and Nocardia species, but absence from Streptomyces and Corynebacterium species and methanogenic archaea. FEMS Microbiol Lett 146:129–134. doi: 10.1111/j.1574-6968.1997.tb10182.x. [DOI] [PubMed] [Google Scholar]
  • 24.Walsh CT. 1986. Naturally occurring 5-deazaflavin coenzymes: biological redox roles. Acc Chem Res 19:216–221. doi: 10.1021/ar00127a004. [DOI] [Google Scholar]
  • 25.Brosch R, Gordon SV, Garnier T, Eiglmeier K, Frigui W, Valenti P, Dos Santos S, Duthoy S, Lacroix C, Garcia-Pelayo C, Inwald JK, Golby P, Garcia JN, Hewinson RG, Behr MA, Quail MA, Churcher C, Barrell BG, Parkhill J, Cole ST. 2007. Genome plasticity of BCG and impact on vaccine efficacy. Proc Natl Acad Sci U S A 104:5596–5601. doi: 10.1073/pnas.0700869104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Choi KP, Bair TB, Bae YM, Daniels L. 2001. Use of transposon Tn5367 mutagenesis and a nitroimidazopyran-based selection system to demonstrate a requirement for fbiA and fbiB in coenzyme F(420) biosynthesis by Mycobacterium bovis BCG. J Bacteriol 183:7058–7066. doi: 10.1128/JB.183.24.7058-7066.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Parish T, Stoker NG (ed). 2001. Mycobacterium tuberculosis protocols. Humana Press, Totowa, NJ. [Google Scholar]
  • 28.Rocco CJ, Dennison KL, Klenchin VA, Rayment I, Escalante-Semerena JC. 2008. Construction and use of new cloning vectors for the rapid isolation of recombinant proteins from Escherichia coli. Plasmid 59:231–237. doi: 10.1016/j.plasmid.2008.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Case CL, Concar EM, Boswell KL, Mukhopadhyay B. 2006. Roles of Asp75, Asp78, and Glu83 of GTP-dependent phosphoenolpyruvate carboxykinase from Mycobacterium smegmatis. J Biol Chem 281:39262–39272. doi: 10.1074/jbc.M602591200. [DOI] [PubMed] [Google Scholar]
  • 30.Lai H, Kraszewski JL, Purwantini E, Mukhopadhyay B. 2006. Identification of pyruvate carboxylase genes in Pseudomonas aeruginosa PAO1 and development of a P. aeruginosa-based overexpression system for alpha4- and alpha4beta4-type pyruvate carboxylases. Appl Environ Microbiol 72:7785–7792. doi: 10.1128/AEM.01564-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W, Lipman D. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Susanti D, Mukhopadhyay B. 2012. An intertwined evolutionary history of methanogenic archaea and sulfate reduction. PLoS One 7:e45313. doi: 10.1371/journal.pone.0045313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17:540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [DOI] [PubMed] [Google Scholar]
  • 35.Aufhammer SW, Warkentin E, Berk H, Shima S, Thauer RK, Ermler U. 2004. Coenzyme binding in F420-dependent secondary alcohol dehydrogenase, a member of the bacterial luciferase family. Structure 12:361–370. doi: 10.1016/j.str.2004.02.010. [DOI] [PubMed] [Google Scholar]
  • 36.Aufhammer SW, Warkentin E, Ermler U, Hagemeier CH, Thauer RK, Shima S. 2005. Crystal structure of methylenetetrahydromethanopterin reductase (Mer) in complex with coenzyme F420: architecture of the F420/FMN binding site of enzymes within the nonprolyl cis-peptide containing bacterial luciferase family. Protein Sci 14:1840–1849. doi: 10.1110/ps.041289805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shima S, Warkentin E, Grabarse W, Sordel M, Wicke M, Thauer RK, Ermler U. 2000. Structure of coenzyme F420-dependent methylenetetrahydromethanopterin reductase from two methanogenic archaea. J Mol Biol 300:935–950. doi: 10.1006/jmbi.2000.3909. [DOI] [PubMed] [Google Scholar]
  • 38.Pei J, Kim BH, Grishin NV. 2008. PROMALS3D: a tool for multiple protein sequence and structure alignments. Nucleic Acids Res 36:2295–2300. doi: 10.1093/nar/gkn072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Purwantini E, Mukhopadhyay B. 2013. Rv0132c of Mycobacterium tuberculosis encodes a coenzyme F420-dependent hydroxymycolic acid dehydrogenase. PLoS One 8:e81985. doi: 10.1371/journal.pone.0081985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Biro JC. 2006. Amino acid size, charge, hydropathy indices and matrices for protein structure analysis. Theor Biol Med Model 3:15. doi: 10.1186/1742-4682-3-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chothia C. 1976. The nature of the accessible and buried surfaces in proteins. J Mol Biol 105:1–12. doi: 10.1016/0022-2836(76)90191-1. [DOI] [PubMed] [Google Scholar]
  • 42.Creighton TE. 1993. Proteins: structures and molecular properties. W H Freeman & Co, New York, NY. [Google Scholar]
  • 43.Zamyatnin AA. 1972. Protein volume in solution. Prog Biophys Mol Biol 24:107–123. doi: 10.1016/0079-6107(72)90005-3. [DOI] [PubMed] [Google Scholar]
  • 44.Purwantini E, Mukhopadhyay B. 2009. Conversion of NO2 to NO by reduced coenzyme F420 protects mycobacteria from nitrosative damage. Proc Natl Acad Sci U S A 106:6333–6338. doi: 10.1073/pnas.0812883106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Stover CK, Warrener P, VanDevanter DR, Sherman DR, Arain TM, Langhorne MH, Anderson SW, Towell JA, Yuan Y, McMurray DN, Kreiswirth BN, Barry CE, Baker WR. 2000. A small-molecule nitroimidazopyran drug candidate for the treatment of tuberculosis. Nature 405:962–966. doi: 10.1038/35016103. [DOI] [PubMed] [Google Scholar]
  • 46.Manjunatha U, Boshoff HI, Barry CE. 2009. The mechanism of action of PA-824: novel insights from transcriptional profiling. Commun Integr Biol 2:215–218. doi: 10.4161/cib.2.3.7926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Manjunatha UH, Boshoff H, Dowd CS, Zhang L, Albert TJ, Norton JE, Daniels L, Dick T, Pang SS, Barry CE III. 2006. Identification of a nitroimidazo-oxazine-specific protein involved in PA-824 resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 103:431–436. doi: 10.1073/pnas.0508392103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Taylor MC, Jackson CJ, Tattersall DB, French N, Peat TS, Newman J, Briggs LJ, Lapalikar GV, Campbell PM, Scott C, Russell RJ, Oakeshott JG. 2010. Identification and characterization of two families of F420H2-dependent reductases from mycobacteria that catalyse aflatoxin degradation. Mol Microbiol 78:561–575. doi: 10.1111/j.1365-2958.2010.07356.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hasan MR, Rahman M, Jaques S, Purwantini E, Daniels L. 2010. Glucose 6-phosphate accumulation in mycobacteria: implications for a novel F420-dependent anti-oxidant defense system. J Biol Chem 285:19135–19144. doi: 10.1074/jbc.M109.074310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Azad AK, Sirakova TD, Rogers LM, Kolattukudy PE. 1996. Targeted replacement of the mycocerosic acid synthase gene in Mycobacterium bovis BCG produces a mutant that lacks mycosides. Proc Natl Acad Sci U S A 93:4787–4792. doi: 10.1073/pnas.93.10.4787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Ferreras JA, Stirrett KL, Lu X, Ryu JS, Soll CE, Tan DS, Quadri LE. 2008. Mycobacterial phenolic glycolipid virulence factor biosynthesis: mechanism and small-molecule inhibition of polyketide chain initiation. Chem Biol 15:51–61. doi: 10.1016/j.chembiol.2007.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Rastogi N, Legrand E, Sola C. 2001. The mycobacteria: an introduction to nomenclature and pathogenesis. Rev Sci Tech 20:21–54. [DOI] [PubMed] [Google Scholar]
  • 53.Daffe M, Laneelle MA. 1988. Distribution of phthiocerol diester, phenolic mycosides and related compounds in mycobacteria. J Gen Microbiol 134:2049–2055. [DOI] [PubMed] [Google Scholar]
  • 54.Naka T, Maeda S, Niki M, Ohara N, Yamamoto S, Yano I, Maeyama J, Ogura H, Kobayashi K, Fujiwara N. 2011. Lipid phenotype of two distinct subpopulations of Mycobacterium bovis bacillus Calmette-Guerin Tokyo 172 substrain. J Biol Chem 286:44153–44161. doi: 10.1074/jbc.M111.310037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Onwueme KC, Vos CJ, Zurita J, Ferreras JA, Quadri LE. 2005. The dimycocerosate ester polyketide virulence factors of mycobacteria. Prog Lipid Res 44:259–302. doi: 10.1016/j.plipres.2005.07.001. [DOI] [PubMed] [Google Scholar]
  • 56.Chavadi SS, Onwueme KC, Edupuganti UR, Jerome J, Chatterjee D, Soll CE, Quadri LE. 2012. The mycobacterial acyltransferase PapA5 is required for biosynthesis of cell wall-associated phenolic glycolipids. Microbiology 158:1379–1387. doi: 10.1099/mic.0.057869-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Azad AK, Sirakova TD, Fernandes ND, Kolattukudy PE. 1997. Gene knockout reveals a novel gene cluster for the synthesis of a class of cell wall lipids unique to pathogenic mycobacteria. J Biol Chem 272:16741–16745. doi: 10.1074/jbc.272.27.16741. [DOI] [PubMed] [Google Scholar]
  • 58.Quadri LE, Sello J, Keating TA, Weinreb PH, Walsh CT. 1998. Identification of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for assembly of the virulence-conferring siderophore mycobactin. Chem Biol 5:631–645. doi: 10.1016/S1074-5521(98)90291-5. [DOI] [PubMed] [Google Scholar]
  • 59.Yu J, Tran V, Li M, Huang X, Niu C, Wang D, Zhu J, Wang J, Gao Q, Liu J. 2012. Both phthiocerol dimycocerosates and phenolic glycolipids are required for virulence of Mycobacterium marinum. Infect Immun 80:1381–1389. doi: 10.1128/IAI.06370-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Gurumurthy M, Rao M, Mukherjee T, Rao SP, Boshoff HI, Dick T, Barry CE III, Manjunatha UH. 2013. A novel F(420)-dependent anti-oxidant mechanism protects Mycobacterium tuberculosis against oxidative stress and bactericidal agents. Mol Microbiol 87:744–755. doi: 10.1111/mmi.12127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Dao DN, Sweeney K, Hsu T, Gurcha SS, Nascimento IP, Roshevsky D, Besra GS, Chan J, Porcelli SA, Jacobs WR. 2008. Mycolic acid modification by the mmaA4 gene of M. tuberculosis modulates IL-12 production. PLoS Pathog 4:e1000081. doi: 10.1371/journal.ppat.1000081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yu K, Mitchell C, Xing Y, Magliozzo RS, Bloom BR, Chan J. 1999. Toxicity of nitrogen oxides and related oxidants on mycobacteria: M. tuberculosis is resistant to peroxynitrite anion. Tuber Lung Dis 79:191–198. doi: 10.1054/tuld.1998.0203. [DOI] [PubMed] [Google Scholar]
  • 63.Matsumoto M, Hashizume H, Tomishige T, Kawasaki M, Tsubouchi H, Sasaki H, Shimokawa Y, Komatsu M. 2006. OPC-67683, a nitro-dihydro-imidazooxazole derivative with promising action against tuberculosis in vitro and in mice. PLoS Med 3:e466. doi: 10.1371/journal.pmed.0030466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Singh R, Manjunatha U, Boshoff HI, Ha YH, Niyomrattanakit P, Ledwidge R, Dowd CS, Lee IY, Kim P, Zhang L, Kang S, Keller TH, Jiricek J, Barry CE III. 2008. PA-824 kills nonreplicating Mycobacterium tuberculosis by intracellular NO release. Science 322:1392–1395. doi: 10.1126/science.1164571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Sambandan D, Dao DN, Weinrick BC, Vilcheze C, Gurcha SS, Ojha A, Kremer L, Besra GS, Hatfull GF, Jacobs WR Jr. 2013. Keto-mycolic acid-dependent pellicle formation confers tolerance to drug-sensitive Mycobacterium tuberculosis. mBio 4:e00222-13. doi: 10.1128/mBio.00222-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Dubnau E, Chan J, Raynaud C, Mohan VP, Laneelle MA, Yu K, Quemard A, Smith I, Daffe M. 2000. Oxygenated mycolic acids are necessary for virulence of Mycobacterium tuberculosis in mice. Mol Microbiol 36:630–637. [DOI] [PubMed] [Google Scholar]
  • 67.Yuan Y, Zhu Y, Crane DD, Barry CE III. 1998. The effect of oxygenated mycolic acid composition on cell wall function and macrophage growth in Mycobacterium tuberculosis. Mol Microbiol 29:1449–1458. doi: 10.1046/j.1365-2958.1998.01026.x. [DOI] [PubMed] [Google Scholar]
  • 68.Vander Beken S, Al Dulayymi JR, Naessens T, Koza G, Maza-Iglesias M, Rowles R, Theunissen C, De Medts J, Lanckacker E, Baird MS, Grooten J. 2011. Molecular structure of the Mycobacterium tuberculosis virulence factor, mycolic acid, determines the elicited inflammatory pattern. Eur J Immunol 41:450–460. doi: 10.1002/eji.201040719. [DOI] [PubMed] [Google Scholar]
  • 69.Beukes M, Lemmer Y, Deysel M, Al Dulayymi JR, Baird MS, Koza G, Iglesias MM, Rowles RR, Theunissen C, Grooten J, Toschi G, Roberts VV, Pilcher L, Van Wyngaardt S, Mathebula N, Balogun M, Stoltz AC, Verschoor JA. 2010. Structure-function relationships of the antigenicity of mycolic acids in tuberculosis patients. Chem Phys Lipids 163:800–808. doi: 10.1016/j.chemphyslip.2010.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rao V, Gao F, Chen B, Jacobs WR, Glickman MS. 2006. Trans-cyclopropanation of mycolic acids on trehalose dimycolate suppresses Mycobacterium tuberculosis-induced inflammation and virulence. J Clin Invest 116:1660–1667. doi: 10.1172/JCI27335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Guerra-Lopez D, Daniels L, Rawat M. 2007. Mycobacterium smegmatis mc2 155 fbiC and MSMEG_2392 are involved in triphenylmethane dye decolorization and coenzyme F420 biosynthesis. Microbiology 153:2724–2732. doi: 10.1099/mic.0.2006/009241-0. [DOI] [PubMed] [Google Scholar]
  • 72.Layre E, Sweet L, Hong S, Madigan CA, Desjardins D, Young DC, Cheng TY, Annand JW, Kim K, Shamputa IC, McConnell MJ, Debono CA, Behar SM, Minnaard AJ, Murray M, Barry CE III, Matsunaga I, Moody DB. 2011. A comparative lipidomics platform for chemotaxonomic analysis of Mycobacterium tuberculosis. Chem Biol 18:1537–1549. doi: 10.1016/j.chembiol.2011.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES