N6-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression

Nagaraja Tirumuru; Boxuan Simen Zhao; Wuxun Lu; Zhike Lu; Chuan He; Li Wu

doi:10.7554/eLife.15528

. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528

N⁶-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression

Nagaraja Tirumuru ^1,^2,^†, Boxuan Simen Zhao ^3,^4,^5,^6,^†, Wuxun Lu ^1,², Zhike Lu ^3,^5,^6,⁴, Chuan He ^3,^5,^6,^4,^*, Li Wu ^1,^2,^7,^8,^*

Editor: Stephen P Goff⁹

PMCID: PMC4961459 PMID: 27371828

Abstract

The internal N⁶-methyladenosine (m⁶A) methylation of eukaryotic nuclear RNA controls post-transcriptional gene expression, which is regulated by methyltransferases (writers), demethylases (erasers), and m⁶A-binding proteins (readers) in cells. The YTH domain family proteins (YTHDF1–3) bind to m⁶A-modified cellular RNAs and affect RNA metabolism and processing. Here, we show that YTHDF1–3 proteins recognize m⁶A-modified HIV-1 RNA and inhibit HIV-1 infection in cell lines and primary CD4⁺ T-cells. We further mapped the YTHDF1–3 binding sites in HIV-1 RNA from infected cells. We found that the overexpression of YTHDF proteins in cells inhibited HIV-1 infection mainly by decreasing HIV-1 reverse transcription, while knockdown of YTHDF1–3 in cells had the opposite effects. Moreover, silencing the m⁶A writers decreased HIV-1 Gag protein expression in virus-producing cells, while silencing the m⁶A erasers increased Gag expression. Our findings suggest an important role of m⁶A modification of HIV-1 RNA in viral infection and HIV-1 protein synthesis.

DOI: http://dx.doi.org/10.7554/eLife.15528.001

Research Organism: Human, Virus

eLife digest

HIV infection is a global health challenge. The antiviral drugs that are currently available limit the ability of the virus to multiply in infected individuals, but they rarely eliminate the virus entirely. A better understanding of how HIV behaves in the cell would help researchers to find a cure for persistent HIV infection. When HIV enters an immune cell, its genetic material – in the form of molecules of ribonucleic acid (RNA) – is used as a template to make molecules of DNA. This viral DNA can integrate into the host cell’s DNA, where it is used as a template to make more viral RNA molecules, which are then used to make viral proteins. Some of the viral RNAs are also packaged into new virus particles.

In cells, RNA molecules are often subject to a chemical modification called adenosine methylation, which regulates how that RNA is translated into proteins. Specific enzymes add molecules called methyl tags to particular locations on the RNA, while other enzymes remove them. A family of proteins called YTHDF1–3 recognize and bind to these methyl tags on the RNA and influence how much protein is produced from the target RNA. There is evidence to suggest that the cell can add methyl tags to HIV RNA. However, the extent to which this happens, and what effects this modification has on HIV replication and viral protein production, are not clear.

Tirumuru et al. addressed these questions by analyzing how changing the levels of YTHDF1–3 proteins and the enzymes that add or remove methyl tags in human cells affected HIV infection. The experiments show that YTHDF1–3 proteins inhibited HIV infection in immune cells called T-lymphocytes by recognizing HIV RNA that had been methylated, mainly by targeting the step where the viral RNA is copied into DNA.

Altering the levels of the enzymes that add or remove methyl tags in the cells can change the amount of methyl tags attached to RNA molecules, which alters the amount of HIV protein produced. For example, when more RNA molecules had methyl tags, the cells produced more HIV proteins. These findings suggest that adenosine methylation plays an important role in regulating the ability of HIV to thrive and multiply in T-lymphocytes, which are an important target for HIV. Since the RNAs of other human viruses, such as influenza virus, can also be modified by adenosine methylation, drugs that target this pathway could have the potential to be used to fight a variety of viral illnesses.

DOI: http://dx.doi.org/10.7554/eLife.15528.002

Introduction

Interactions of host proteins with HIV-1 substantially modulate viral replication and pathogenesis (Goff, 2007; Moir et al., 2011). Host proteins that interact with HIV-1 nucleic acids or viral proteins can either enhance or inhibit viral replication in cells. The secondary structure model of HIV-1 RNA and its interactions with viral proteins have been recently analyzed (Kutluay et al., 2014; Lavender et al., 2015; Watts et al., 2009; Wilkinson et al., 2008); however, it is less clear whether host proteins can post-transcriptionally modify HIV-1 RNA, which may affect interactions between RNA and host or viral proteins, thereby affecting HIV-1 infection.

N⁶-methyladenosine (m⁶A) is the most prevalent internal messenger RNA (mRNA) modification in eukaryotic organisms and plays pivotal roles in post-transcriptional regulation of gene expression (Fu et al., 2014; Jia et al., 2013; Yue et al., 2015). This methylation is reversible (Jia et al., 2011; Zheng et al., 2013) and is specifically recognized by a family of reader proteins (Liu et al., 2014; Wang et al., 2015). The m⁶A modification is widely distributed in mammalian mRNAs, enriched in the 3’ untranslated region (UTR) near the stop codon and also present in the 5’ UTR and long exons (Dominissini et al., 2012; Meyer et al., 2012; Zhou et al., 2015). It has been known for almost 40 years that RNAs of influenza virus, adenovirus, Rous sarcoma virus, and simian virus 40 are m⁶A-methylated (Beemon and Keith, 1977; Canaani et al., 1979; Hashimoto and Green, 1976; Krug et al., 1976), although the impact of the m⁶A modification on viral replication remains unclear. The recent studies revealed that the m⁶A modification of HIV-1 RNA significantly affects viral replication and gene expression (Kennedy et al., 2016; Lichinchi et al., 2016). Lichinchi et al. reported that HIV-1 mRNA contains multiple m⁶A modifications and viral infection in a CD4⁺ T-cell line increases the m⁶A levels in both host and viral mRNAs (Lichinchi et al., 2016), suggesting a dynamic regulation of m⁶A methylomes during HIV-1 infection. In contrast, Kennedy et al. only found four clusters of m⁶A modifications in the 3’ UTR region of the HIV-1 RNA genome that enhance viral gene expression (Kennedy et al., 2016).

The dynamic addition, removal, and recognition of m⁶A in cellular mRNAs and other types of nuclear RNAs are coordinately regulated by three groups of host proteins, including adenosine methyltransferases (writers), m⁶A demethylases (erasers), and m⁶A-selective-binding proteins (readers) (Fu et al., 2014). The methyltransferase complex is composed of METTL3, METTL14 and WTAP (Wilms’ tumor 1-associating protein), which add m⁶A modification to nuclear RNAs (Liu et al., 2014; Ping et al., 2014). The RNA demethylases FTO (fat mass and obesity-associated protein) and AlkBH5 (AlkB family member 5) remove the m⁶A modification of RNAs (Fu et al., 2014; Jia et al., 2011). Three host proteins, including YTHDF1, 2, and 3 (YTHDF1–3), have been identified as selective m⁶A-binding proteins (readers) in mammalian cells (Dominissini et al., 2012; Wang et al., 2014, 2015). These m⁶A-reader proteins preferentially bind methylated mRNAs and control the stability and translation of target mRNAs (Dominissini et al., 2012; Liu et al., 2014). Human YTHDF1–3 proteins contain a conserved YTH RNA-binding domain that preferentially binds the m⁶A-containing RNAs and a P/Q/N-rich region that is associated with different RNA-protein complexes (Fu et al., 2014). Lichinchi et al. recently reported that silencing of the m⁶A writers or the eraser AlkBH5 decreases or increases HIV-1 replication, respectively (Lichinchi et al., 2016). Kennedy et al. showed that m⁶A modifications in the 3’ UTR region of HIV-1 RNA enhance viral gene expression by recruiting cellular YTHDF proteins (Kennedy et al., 2016). However, neither study examined the m⁶A modification of HIV-1 RNA and its effect on HIV-1 replication in primary CD4⁺ T-cells, nor systemically analyzed the role of the m⁶A writers, erasers, and readers in HIV-1 replication.

Here we show that HIV-1 RNA contains multiple m⁶A modifications enriched in the 5' and 3' UTRs and within several coding genes. We mapped the specific sites in HIV-1 RNA bound by YTHDF proteins in HIV-1-infected cells. We found that overexpression of YTHDF proteins in target cells significantly inhibited HIV-1 infection, while knockdown of these proteins in primary CD4⁺ T-cells enhanced HIV-1 infection. Furthermore, knockdown of the m⁶A writers or the erasers decreased or increased HIV-1 Gag synthesis and virion release in virus-producing cells, respectively. Our findings suggest important functions of the m⁶A reader, writer, and eraser proteins in modulating HIV-1 gene expression and viral infection through the m⁶A modification of HIV-1 RNA.

Results

HIV-1 RNA genome contains m⁶A modifications

To investigate the presence of m⁶A in HIV-1 RNA and to map the m⁶A modification within HIV-1 RNA, we isolated RNA samples from CD4⁺ Jurkat T-cells or primary CD4⁺ T-cells infected with replication-competent HIV-1_NL4-3, and performed immunoprecipitation (IP) with poly(A)-enriched RNA using m⁶A-specific antibodies, followed by high-throughput RNA sequencing (m⁶A-seq) (Dominissini et al., 2012). We identified similar profiles of m⁶A peaks in HIV-1 RNA from these two cell types, which are mainly enriched in the 5' and 3' UTRs as well as the rev and gag genes of the HIV-1 genome (Figure 1A,B). To confirm the m⁶A modification of HIV-1 RNA from virus-producing cells, we transfected HEK293T cells with a plasmid containing full-length HIV-1 proviral DNA (pNL4-3) and extracted total RNA from the transfected cells. Using the same m⁶A-seq approach, we identified multiple m⁶A peaks in HIV-1 RNA, which are enriched in the 5' and 3' UTRs and within overlapped HIV-1 coding genes, such as tat, rev, env, and nef (Figure 1—figure supplement 1). These results confirm the m⁶A modification of HIV-1 RNA despite some differences in m⁶A distributions in HIV-1 infected CD4⁺ T-cells compared to transfected HEK293T cells.

Figure 1. — (**A–B**) The distribution of m⁶A reads from m⁶A-seq mapped to HIV-1 genome (red line) in HIV-1 infected Jurkat cells (A) or primary CD4⁺ T-cells (B). Baseline signal from the RNA-seq of input samples is shown as a black line. A schematic diagram of HIV-1_NL4-3 genome is shown above. TAR, transacting response element; RRE, Rev response element. Jurkat cells (A) or primary CD4⁺ T-cells (B) were infected with HIV-1_NL4-3 and total RNA was extracted for m⁶A-seq at 72 or 96 hr post-infection (hpi), respectively. (C) YTHDF1-3 proteins bind to the HIV-1 gRNA. HeLa/CD4 cells overexpressing FLAG-tagged YTHDF1-3 proteins were infected with HIV-1_NL4-3 (MOI= 5) for 72 hr and used in CLIP-seq assay to identify their binding sites on HIV-1 gRNA. The distribution of mapped reads (>16 nt) with corresponding nucleotide positions are shown, forming peaks as putative binding positions. Asterisks mark the peak clusters overlapping with identified m⁶A peaks, indicating high-confident YTHDFs binding sites. Read density was normalized to the total number of mapped reads in each sample (YTHDF1: 28438; YTHDF2: 232568; YHTDF3: 124915). The data presented are representative of results from two independent experiments (n=2).

**DOI:** http://dx.doi.org/10.7554/eLife.15528.003

Figure 1—figure supplement 1. — (**A–B**) The distribution of m⁶A reads from m⁶A-seq mapped to HIV-1 genome (red line) in HIV-1 infected Jurkat cells (A) or primary CD4⁺ T-cells (B). Baseline signal from the RNA-seq of input samples is shown as a black line. A schematic diagram of HIV-1_NL4-3 genome is shown above. TAR, transacting response element; RRE, Rev response element. Jurkat cells (A) or primary CD4⁺ T-cells (B) were infected with HIV-1_NL4-3 and total RNA was extracted for m⁶A-seq at 72 or 96 hr post-infection (hpi), respectively. (C) YTHDF1-3 proteins bind to the HIV-1 gRNA. HeLa/CD4 cells overexpressing FLAG-tagged YTHDF1-3 proteins were infected with HIV-1_NL4-3 (MOI= 5) for 72 hr and used in CLIP-seq assay to identify their binding sites on HIV-1 gRNA. The distribution of mapped reads (>16 nt) with corresponding nucleotide positions are shown, forming peaks as putative binding positions. Asterisks mark the peak clusters overlapping with identified m⁶A peaks, indicating high-confident YTHDFs binding sites. Read density was normalized to the total number of mapped reads in each sample (YTHDF1: 28438; YTHDF2: 232568; YHTDF3: 124915). The data presented are representative of results from two independent experiments (n=2).

**DOI:** http://dx.doi.org/10.7554/eLife.15528.003

To investigate whether HIV-1 virion RNA contains m⁶A, we isolated HIV-1 RNA from highly purified HIV-1 virions derived from infected CD4⁺ T-cells (Rossio et al., 1998; Wang et al., 2008), and then performed a quantitative analysis of m⁶A level using liquid chromatography-mass spectrometry (Jia et al., 2011). Our data showed that m⁶A in HIV-1 RNA was approximately 0.1% of total adenosines (Figure 1—figure supplement 2). Considering 35.8% of HIV-1 genomic RNA (gRNA) (9173 nucleotides) are adenosines (van Hemert et al., 2014), our data suggest approximately 3–4 sites of the m⁶A modification in each copy of HIV-1 gRNA, which match the numbers of m⁶A peaks identified by m⁶A-seq (Figure 1A,B and Figure 1—figure supplement 1). Together, these results confirm that HIV-1 RNA contains m⁶A modifications at multiple sites within the viral genome.

Distribution of m⁶A in the cellular RNAs and gene ontology (GO) analysis of m⁶A-modified cellular genes

To examine the effect of HIV-1 infection on m⁶A modifications of cellular RNAs, we compared the distribution of m⁶A peaks in cellular RNAs from HIV-1 infected and uninfected T-cells. In Jurkat and primary CD4⁺ T-cells, HIV-1 infection did not significantly affect the percentages of total m⁶A peaks mapped to the human genome in the 5′ UTR, coding DNA sequence (CDS), 3′ UTR and noncoding regions (Figure 1—figure supplement 3A,B). The biological effects of the slightly altered m⁶A topology (<1%) remain to be investigated. To determine whether the preferential m⁶A motif usage in the host cells was altered by HIV-1 infection, we performed consensus sequence analyses within the m⁶A peaks to determine the preferred motifs in cellular RNAs. HIV-1 infection of Jurkat cells or primary CD4⁺ T cells slightly increased the frequency of the RRACH motif within the m⁶A peaks by 0.2–0.8%, but slightly decreased the GGACU motif frequency by 0.2–0.4% (Figure 1—figure supplement 3C,D). These data suggest that the preferential usage of the RRACH motifs in m⁶A modification of cellular RNAs could be altered during HIV-1 infection.

We also performed the GO analysis of m⁶A-modified cellular genes in HIV-1 infected Jurkat cells and primary CD4⁺ T cells and found numerous genes with known functions in viral infection-related pathways. We defined these genes as viral-specific genes and performed a separate analysis of the distribution and motif of methylation peaks on these genes (Figure 1—figure supplement 4A,B). We have also performed an individual GO analysis of genes with unique methylation peaks in infected samples, the results showed that these genes enrich in functional clusters, such as metabolism, immune system process, multicellular organismal process, and development (Figure 1—figure supplement 4C,D), indicating widespread impacts on host biological systems induced by HIV-1 infection.

YTHDF1–3 proteins bind to HIV-1 gRNA in infected cells

YTHDF1–3 proteins are reader proteins that specifically bind to m⁶A-methylated cellular RNAs (Wang et al., 2014, 2015). We utilized the crosslinking and immunoprecipitation (CLIP) assay combined with RNA-seq (Hafner et al., 2010; Liu et al., 2015) to map the binding sites of YTHDF1–3 proteins in the HIV-1 genome in infected HeLa/CD4 cells that overexpressed individual FLAG-tagged YTHDF1–3 proteins. We identified multiple CLIP peaks of YTHDF1–3 protein-bound HIV-1 RNA, including the transactivation response element (TAR) in the 5’ UTR leader sequence, the env gene, the rev gene, and the 3’ UTR. Some YTHDF-binding sites (e.g. at the 3’ and 5’ UTR and the gag gene) in HIV-1_NL4-3 infected HeLa/CD4 cells partially overlap with the identified m⁶A-containing regions in the HIV-1 genome in HIV-1_NL4-3 infected CD4+ Jurkat T-cells or primary CD4+ T-cells (marked by asterisks), indicating high-confident YTHDF1-3 binding sites. Different cell types used in these experiments might contribute to the difference of the m⁶A sites and YTHDFs-bound sites in HIV-1 RNA genome. Overall, these data demonstrate that YTHDF1-3 proteins bind to m⁶A-modified HIV-1 genomic RNA during viral infection.

YTHDF1–3 proteins negatively regulate HIV-1 post-entry infection

Because HIV-1 RNAs are present in the cytoplasm and the nucleus of infected cells at different stages of viral lifecycle (Goff, 2007), we hypothesized that YTHDF1–3 proteins may directly interact with methylated HIV-1 RNAs, thereby affecting the metabolism and/or processing of the viral RNA. To examine the roles of YTHDF1–3 proteins in post-entry HIV-1 infection, we either overexpressed or knocked down the individual YTHDF proteins in human cell lines, and examined the effect on HIV-1 infection using a single-cycle, luciferase reporter HIV-1 pseudotyped with vesicular stomatitis virus G protein (VSV-G) to overcome the requirement of HIV-1 receptors during viral entry (Wang et al., 2007). Compared to vector control cells, at 24 hr post-infection (hpi), overexpression of individual FLAG-tagged YTHDF1–3 proteins in HeLa cells (Figure 2A) significantly inhibited HIV-1 infection by approximately 10-fold (Figure 2B, p<0.0005) and drastically reduced the synthesis of full-length viral Gag protein (Pr55) (Figure 2C). In contrast, stable knockdown of individual, endogenous YTHDF1–3 proteins in HeLa cells (Figure 2D) significantly increased HIV-1 infection by four- to 14-fold (p<0.05) relative to control cells (Figure 2E). Overexpression or knockdown of YTHDF1–3 proteins in HeLa cells did not affect cell proliferation (data not shown).

Figure 2. — (A–B) Overexpression of YTHDF1–3 proteins in HeLa cells significantly inhibits HIV-1 infection compared to vector control cells. (A) Overexpression of YTHDF1–3 proteins in HeLa cells was confirmed by immunoblotting. (B) HeLa cells overexpressing YTHDF1–3 proteins were infected with HIV-1 Luc/VSV-G at an MOI of 0.5 and viral infection was measured by luciferase activity at 24 hpi. (C) Overexpression of YTHDF1–3 proteins inhibits HIV-1 Gag protein synthesis in infected cells. HeLa cells overexpressing individual YTHDF1–3 proteins or the vector control cells were infected by HIV-1-Luc/VSV-G at an MOI of 0.5. At 24 hpi, the expression of HIV-1 Gag and YTHDF1–3 proteins (FLAG-tagged) was determined using immunoblotting. GAPDH was used as a loading control and mock-infected vector control cells were used as a negative control. (D and E) Individual knockdown of endogenous YTHDF1–3 proteins in HeLa cells significantly increases HIV-1 infection compared to vector control cells. HIV-1 infection assays were performed as described for panel B. *p<0.05, **p<0.005, and ***p<0.0005, compared to vector control without AZT treatment. All results are shown as mean ± SD (n=3) and data presented are representative of at least three independent experiments.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.008

To confirm these observations in CD4⁺ T-cells, we generated Jurkat cell lines with knockdown of individual, endogenous YTHDF1–3 proteins (Figure 3A) and did not observe a significant change in proliferation of the knockdown cells relative to parental or vector-control Jurkat cells (Figure 3B). The partial knockdown of YTHDF1 or YTHDF3 in Jurkat cells increased HIV-1 infection by three- to four-fold (p<0.005), while YTHDF2 knockdown slightly increased viral infection (Figure 3A and C) at 24 hpi. Furthermore, knockdown of individual, endogenous YTHDF1–3 proteins in activated primary CD4⁺ T-cells from healthy donors enhanced HIV-1 infection by approximately two-fold (p<0.005) (Figure 3D and E), confirming the effects observed in cell lines despite a lesser extent. The treatment of cells with the HIV-1 reverse transcriptase inhibitor azidothymidine (AZT) was used as a negative control to show the expected HIV-1 inhibition (Figures 2B,E, 3C and E). Overall, these data suggest that overexpression of YTHDF1–3 proteins significantly inhibits HIV-1 infection, while knockdown of these proteins efficiently promotes HIV-1 gene expression. Thus, endogenous YTHDF1–3 proteins in CD4⁺ T-cells act as negative regulators to inhibit post-entry HIV-1 infection.

YTHDF1–3 proteins inhibit HIV-1 infection by blocking viral reverse transcription

To investigate the mechanisms of HIV-1 inhibition by YTHDF1–3 proteins, we assessed the stage of HIV-1 life cycle affected by the YTHDF1–3 proteins. We first measured levels of HIV-1 late reverse transcription (RT) products in infected cells, which represent the levels of the full-length viral cDNA (St Gelais et al., 2015). Overexpression of each of the YTHDF1–3 proteins in HeLa cells significantly reduced the level of HIV-1 late RT products by four- to ten-fold (p<0.005) compared to the vector control cells at 24 hpi (Figure 4A), suggesting that the inhibition of viral reverse transcription contributes to the impairment of post-entry HIV-1 infection. In contrast, the knockdown of individual YTHDF1–3 proteins in HeLa cells elevated the levels of HIV-1 late RT products by two- to three-fold compared to vector control cells (Figure 4B). Furthermore, the level of HIV-1 2-LTR circles in infected HeLa cells, a surrogate marker of nuclear import of viral cDNA (Dong et al., 2007), was also significantly reduced over 10-fold (p<0.05) by overexpression of YTHDF1–3 proteins (Figure 4C), corresponding to the reduced late RT products observed in this experiment. Using our established Jurkat cell lines with stable knockdown of individual YTHDF1–3 proteins (Figure 3A), we found that the levels of HIV-1 late RT products were significantly increased in YTHDF1 down-regulated cells by 2.7-fold (p<0.05) compared to control cells, while the knockdown of YTHDF2 or YTHDF3 only increased late RT products by 20–30% (Figure 4D). As a negative control, AZT-treated cells showed inhibition of HIV-1 post-entry infection as expected (Figure 4A–D).

Figure 4. — HeLa cells over-expressing or knocking-down (shRNA) individual YTHDF1–3 proteins were infected with HIV-1-Luc/VSV-G at an MOI of 0.5. (A, B and D) Genomic DNA was isolated from the cells 24 hr post-infection and HIV-1 late reverse transcription (RT) products were quantified by qPCR. (C) YTHDF family proteins reduce the formation of HIV-1 2-LTR circles in infected HeLa cells. At 24 hr post-infection, DNA was isolated from the cells and the 2-LTR circles were analyzed by qPCR and normalized to GAPDH levels. AZT treated vector control cells were used as a negative control for HIV-1 inhibition. *p<0.05 compared to the vector control without AZT treatment. All results are shown as mean ± SD (n=3) and data presented are representative of at least three independent experiments.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.010

Figure 4—figure supplement 1. — HeLa cells over-expressing or knocking-down (shRNA) individual YTHDF1–3 proteins were infected with HIV-1-Luc/VSV-G at an MOI of 0.5. (A, B and D) Genomic DNA was isolated from the cells 24 hr post-infection and HIV-1 late reverse transcription (RT) products were quantified by qPCR. (C) YTHDF family proteins reduce the formation of HIV-1 2-LTR circles in infected HeLa cells. At 24 hr post-infection, DNA was isolated from the cells and the 2-LTR circles were analyzed by qPCR and normalized to GAPDH levels. AZT treated vector control cells were used as a negative control for HIV-1 inhibition. *p<0.05 compared to the vector control without AZT treatment. All results are shown as mean ± SD (n=3) and data presented are representative of at least three independent experiments.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.010

The effects on HIV-1 late reverse transcription mediated by YTHDF1–3 would lead to altered viral gene expression. To examine the impacts of the YTHDF proteins on viral gene expression, we quantified HIV-1 gag mRNA in infected cells at 24 hpi. The HIV-1 gag mRNA level in HeLa cells with overexpression of individual YTHDF1–3 showed a four-fold reduction (p<0.0005) compared to vector control cells (Figure 4—figure supplement 1A). In contrast, the knockdown of individual YTHDF1–3 in HeLa cells increased the level of gag mRNA by eight- to 12-fold (p<0.05) compared to vector control cells (Figure 4—figure supplement 1B). The knockdown of YTHDF3 in Jurkat cells significantly increased the level of HIV-1 gag mRNA by two-fold (p<0.05) compared to control cells, while the knockdown of YTHDF1 or YTHDF2 did not have a significant effect (Figure 4—figure supplement 1C). The different effects of YTHDF1–3 silencing on gag mRNA expression in HeLa and Jurkat cells might result from the difference in the knockdown efficiency in these cells (Figures 2D and 3A). These data suggest that YTHDF1–3 proteins could negatively regulate HIV-1 mRNA transcription, in addition to inhibiting viral reverse transcription in HIV-1 infected cells.

YTHDF1–3 proteins are associated with HIV-1 gRNA and lead to degradation of viral RNA

We hypothesize that YTHDF1–3 proteins could inhibit the reverse transcription of HIV-1 gRNA through directly binding to the gRNA. To test this hypothesis, we used a single-cycle, VSV-G-pseudotyped HIV-1 to infect HeLa cells overexpressing individual YTHDF1–3 proteins or vector control cells, immunoprecipitated YTHDF proteins from the infected cells at 3 hpi, and then measured HIV-1 gRNA levels in the IP samples. The presence of YTHDF proteins was confirmed in the input and IP samples (Figure 5A). The quantification of the HIV-1 gRNA by qRT-PCR revealed a strong and specific association (p<0.005) of HIV-1 gRNA with YTHDF proteins in HIV-1-infected YTHDF1–3-expressing cells compared to control cells (Figure 5B). To examine the impact of YTHDF1–3 on HIV-1 gag RNA kinetics, we quantified HIV-1 gag RNA levels in YTHDF1–3-expressing HeLa cells and vector control cells over a time course of 6–24 hpi. The relative levels of gag RNA in HIV-1 infected cells were normalized to that of the vector control cells at 6 hpi. In the control cells, compared to 6 hpi (set as 100%), the level of gag RNA was reduced to 40% at 12 hpi and then increased to 80% at 24 hpi (Figure 5C), suggesting degradation of HIV-1 gRNA at 12 hpi during the reverse transcription and then increased gag mRNA at 24 hpi during viral gene transcription. In contrast, the levels of gag RNA in YTHDF1–3-expressing cells were reduced to 40% at 12 hpi and to 13–25% at 24 hpi (p<0.0005) compared to that of the vector control cells at 6 hpi (Figure 5C). These data suggest that YTHDF1–3 proteins can degrade HIV-1 gag RNA in infected cells, thereby leading to inhibition of HIV-1 reverse transcription.

Figure 5. — (A) Immunoblotting of YTHDF1–3 proteins in the input and immunoprecipitation (IP) samples from HIV-1-Luc/VSV-G infected HeLa cells. FLAG antibodies were used to immunoprecipitate FLAG-tagged YTHDF1–3 proteins overexpressed in HeLa cells after HIV-1 infection. A short and long exposure of the immunoblot is shown. (B) HIV-1 gRNA is bound by YTHDF1–3 proteins expressed in HeLa cells. HeLa cells stably overexpressing FLAG-tagged YTHDF1–3 proteins or empty vector control cells (Ctrl) were infected with HIV-1-Luc/VSV-G at an MOI of 5 for 3 hr. Cell lysates were immunoprecipitated with anti-FLAG, RNA was extracted and HIV-1 *gag* RNA levels were measured. **p<0.005 compared to the vector control cells. (C) YTHDF1–3 affect HIV-1 *gag* RNA kinetics. HIV-1 *gag* RNA levels in YTHDF1–3-expressing HeLa cells were quantified by qRT-PCR. The relative levels of *gag* RNA in infected cells were normalized to that of the vector control cells at 6 hr post-infection (hpi). ***p<0.0005, compared to the control cells at 6 hpi (set as 100%). All results are shown as mean ± SD (n=3) and data presented are representative of at least three independent experiments.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.012

The m⁶A writers and erasers affect HIV-1 Gag expression in virus- producing cells

We examined the role of the m⁶A writers in HIV-1 protein expression and viral release in virus-producing cells. We knocked down endogenous METTL3, METTL14, or both, in HEK293T cells using siRNA, and then transfected the cells with an HIV-1 proviral DNA plasmid (pNL4-3). We determined the levels of HIV-1 Gag protein expression in the cells and the capsid p24 protein released in the supernatants. Interestingly, we found that partial knockdown of METTL3, METTL14, or both, inhibited HIV-1 Gag expression in the cells by 60–70% (Figure 6A), and reduced the levels of HIV-1 p24 release by 30–50% compared to control cells (Figure 6B). These results suggest that the m⁶A writers are required for efficient HIV-1 protein synthesis, and that m⁶A modification of HIV-1 RNA could facilitate translation of viral proteins.

Figure 6. — (A and B) Individual or combined knockdown of endogenous METTL3 and METTL14 inhibits HIV-1 Gag protein expression. HEK293T cells were transfected with indicated siRNA, and then with an HIV-1 proviral DNA plasmid (pNL4-3). Cells and supernatants were collected for analyses at 36 hr post-transfection. (A) Expression of METTL3, METTL14 and HIV-1 Gag proteins in the transfected HEK293T cells was detected by immunoblotting. (C and D) Knockdown of endogenous AlkBH5, FTO, or both promotes HIV-1 Gag protein expression. HEK293T cells were transfected with indicated siRNA, and then with pNL4-3. Cells and supernatants were collected at 36 hr post-transfection. (C) Expression of AlkBH5, FTO and HIV-1 Gag proteins in the cells was detected by immunoblotting. (A and C) GAPDH was used as a loading control. Relative levels of Gag expression were normalized to GAPDH levels. (B and D) HIV-1 capsid p24 levels in supernatants were measured by ELISA. The relative levels (%) are also shown. *p<0.05 compared to the siRNA control. The results are shown as mean ± SD (n=3) and data presented are representative of three independent experiments.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.013

We next examined the role of the m⁶A erasers in HIV-1 protein expression and viral release in virus-producing cells. We knocked down endogenous AlkBH5, FTO, or both, in HEK293T cells using siRNA, and then transfected the cells with the pNL4-3 plasmid. We determined the levels of HIV-1 Gag protein expression in the cells and the capsid p24 protein released in the supernatants. Interestingly, we found that partial knockdown of FTO significantly promoted HIV-1 Gag synthesis in the cells by 2.5- to 6.5-fold (Figure 6C), and increased the levels of HIV-1 p24 release by two- to three-fold compared to control cells (Figure 6D). Thus, the m⁶A modification of HIV-1 RNA can enhance HIV-1 protein synthesis. Our results are in agreement with a recent report (Lichinchi et al., 2016) showing that silencing of the m⁶A writers (METTL3 and METTL14) or the eraser AlkBH5 decreases or increases HIV-1 p24 expression in the infected MT4 cells, respectively.

Discussion

The m⁶A modification of cellular mRNAs is coordinately regulated by the writers, erasers, and readers to control the metabolism and processing of methylated RNA (Fu et al., 2014). We found that HIV-1 RNA is m⁶A-methylated in infected cells, and that binding of YTHDF1–3 proteins to m⁶A-methylated HIV-1 RNA inhibits viral reverse transcription and gene expression. In contrast, partial knockdown of the m⁶A writers decreased HIV-1 Gag synthesis and viral release, while partial knockdown of FTO had the opposite effects, suggesting that m⁶A modification of HIV-1 RNA could enhance HIV-1 protein synthesis and viral release. Based on our results, we propose a working model suggesting that YTHDF proteins inhibit post-entry HIV-1 infection by blocking viral reverse transcription and mRNA expression, while the m⁶A modification of HIV-1 RNA can promote viral protein translation (Figure 7).

Figure 7. — In the nucleus, the m⁶A writers (METTL3 and METTL14) add the m⁶A marker to HIV-1 genomic RNA (gRNA) or mRNA, and the m⁶A erasers (FTO and AlkBH5) remove the m⁶A modifications of HIV-1 RNA. The m⁶A modification of HIV-1 RNA can promote viral protein translation in cells. In contrast, cytoplasmic m⁶A readers (YTHDF1–3) bind to m⁶A-modified HIV-1 gRNA, which can result in inhibition of HIV-1 reverse transcription (RT), viral mRNA expression, and thereby HIV-1 infection in cells.

**DOI:** http://dx.doi.org/10.7554/eLife.15528.014

It is possible that YTHDF protein-mediated inhibition of HIV-1 infection can result from indirect effects on cellular RNA stability or gene expression, rather than direct inhibition of HIV-1 replication. We noticed a differential level of the effect on HIV-1 infection in different cell types by manipulating the individual YTHDF1–3 proteins. It is possible that the different effects are due to distinct cellular functions and mechanisms of YTHDF proteins (Fu et al., 2014). Recent studies indicated that YTHDF1 is responsible for translation promotion, and that YTHDF2 is responsible for mRNA decay, while the function YTHDF3 is unclear, but likely to aid in the temporal-spatial transport and delivery of mRNA (Wang and He, 2014; Wang et al., 2014, 2015). Indeed, we observed a unique high peak within the rev gene of HIV-1 RNA bound by YTHDF1 (Figure 1C), while YTHDF1 and YTHDF2 appear to have similar inhibitory effects on HIV-1 infection. It is possible that YTHDF1 and YTHDF2 may interact with different host proteins that directly or indirectly affect HIV-1 replication and lead to similar effects on viral inhibition. Furthermore, these three YTHDF proteins may have functional redundancy, and individual knockdown of one YTHDF protein may result in a modest effect because the other two could compensate the function. A recent study suggests that the dynamic m⁶A modification of cellular mRNA is a result of stress-induced nuclear localization and upregulation of YTHDF2 (Zhou et al., 2015). It is conceivable that HIV-1 infection of cells may induce the changes of cellular localization and expression levels of YTHDF proteins, thereby affecting HIV-1 RNA replication and viral infection.

The mechanisms by which m⁶A modification of HIV-1 RNA regulates viral infection remain to be elucidated. Lichinchi et al. recently showed that m⁶A modification of a conserved adenosine (A7883) in the stem loop II region of HIV-1 Rev response element (RRE) RNA increased binding of HIV-1 Rev protein to the RRE and facilitated nuclear export of RNA, thereby enhancing HIV-1 replication (Lichinchi et al., 2016). However, other m⁶A sites in the HIV-1 genome (such as in the gag, pol, tat, and rev genes) might also be critical for viral replication. Future studies using targeted mutations of the identified m⁶A sites in HIV-1 genome may lead to a loss of the effects on HIV-1 infection by YTHDF1–3 knockdown or overexpression.

During the revision of this manuscript, Kennedy et al. reported that m⁶A modification of HIV-1 mRNAs enhances viral replication and gene expression (Kennedy et al., 2016). Our data of the inhibitory effects on HIV-1 infection by YTHDF1–3 proteins are different from the results recently reported by Kennedy et al. (Kennedy et al., 2016). They showed that overexpression of YTHDF1–3 proteins in HEK293T cells enhanced HIV-1 mRNA and protein expression in a single-cycle infection, and that overexpression or knockout of YTHDF2 in CEM-SS T-cells increased or decreased HIV-1 replication and protein expression, respectively (Kennedy et al., 2016). The mapping of m⁶A sites in HIV-1 RNA between the previous data (Kennedy et al., 2016; Lichinchi et al., 2016) and the results presented in this manuscript are also different. Different approaches, cell lines and other reagents used in these studies may contribute to distinct results obtained, which remain to be clarified in the future. However, we report here consistent m⁶A mapping results using Jurkat T-cells and primary CD4⁺ T-cells and systematic evaluation of the roles of the m⁶A writers, readers, and erasers in HIV-1 infection.

Chemical modifications of viral RNAs such as m⁶A may protect viral genomes or mRNA from recognition by cellular innate immunity proteins (Fu et al., 2014). The m⁶A modification of HIV-1 RNA could serve as an immune evasion strategy, wherein the virus may escape detection by innate immunity against infection. In response to HIV-1 infection, the host may evolve and utilize the YTHDF1–3 proteins to bind the m⁶A-modified viral RNA and inhibit its reverse transcription and subsequent viral mRNA expression. Our findings can stimulate further studies on the precise role of m⁶A in HIV-1 RNA replication and the mechanisms of m⁶A regulation pathways that impact HIV-1 infection in cells. Because m⁶A-modified RNA has also been found in other viruses (Beemon and Keith, 1977; Canaani et al., 1979; Hashimoto and Green, 1976; Krug et al., 1976), this modification pathway may represent a novel and conserved target for antiviral development.

Materials and methods

Cell culture

Human healthy primary CD4⁺ T-cells were isolated from healthy blood donors’ buffy coats (purchased from American Red Cross Blood Service, Columbus, OH) using anti-human CD4-coated magnetic particles according to the manufacturer’s instructions (BD Biosciences, San Jose, CA) as described (St Gelais et al., 2014, 2015). Isolated CD4⁺ T cells were maintained in complete RPMI media containing interleukin-2 (20 U/ml, PeproTech, Rocky Hill, NJ) and activated with phytohemagglutinin A (PHA, Sigma-Aldrich, St. Louis, MO) as described (St Gelais et al., 2014). HEK293T cells, Jurkat cells, and the HIV-1 indicator cell line GHOST/X4/R5 were cultured as described (St Gelais et al., 2014, 2015). HeLa cells overexpressing the empty vector (pPB-CAG), YTHDF1, YTHDF2, or YTHDF3 were maintained in complete DMEM containing 2 µg/ml of puromycin. All parental cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the identity of the cell lines has been authenticated using short tandem repeat profiling or genotyping methods as described (Wu et al., 2004). All the cell lines were tested negative for mycoplasma contamination using a PCR-based universal mycoplasma detection kit (ATCC).

Cell proliferation assay

Cell proliferation of HeLa cells or Jurkat cells with YTHDF1–3 overexpression or knockdown respectively were determined by the MTS assay (Promega, Madison, WI) as described (St Gelais et al., 2015). Cells (2 × 10⁴) were plated in triplicate in a 96-well plate and cultured for 3 days and the absorbance was read at 490 nm at the indicated times.

Plasmids and shRNA- and siRNA-mediated gene silencing

HIV-1 proviral DNA vector pNL4-3, pNL-Luc-E⁻R⁺ containing a firefly luciferase reporter gene and the empty vector control were described (de Silva et al., 2012). The pPB-CAG plasmid vector was used to overexpress the YTHDF1–3 proteins in HeLa cells. pLenti vectors carrying specific YTHDF1–3 shRNAs (Table 1) were used to knockdown of YTHDF1–3 proteins in different cell types as described (St Gelais et al., 2015). Jurkat cells transduced with lentivirus containing shRNAs specific for YTHDF1, YTHDF2, and YTHDF3 were maintained in puromycin (3 µg/ml) containing complete RPMI media. AlkBH5, FTO, METTL3 and METTL14 gene expression in HEK293T cells was silenced by two rounds of siRNA transfection using specific siRNA (Qiagen, Valencia, CA, sequences listed in Table 2) transfected with the Lipofectamin RNAiMax reagent (Invitrogen, Waltham, MA) according to the manufacturer protocol (reversible siRNA transfection method). Briefly, HEK293T cells (1.5 × 10⁵) were transfected with specific siRNA or a non-specific control (80 nM). At 24 hr post-transfection, media were replaced and the second round of siRNA transfection was performed using the same siRNA concentration (80 nM). The pNL4-3 construct (0.5 μg) was transfected into the cells (1.5 × 10⁵) 6 hr after of the second round transfection and cells were harvested for immunoblotting 36 hr after the proviral DNA transfection.

Table 1.

The shRNA sequences used in this study.

DOI: http://dx.doi.org/10.7554/eLife.15528.015

shRNA	Sequences (5’-3’)
Non-specific (vector) control	CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT
YTHDF1	CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG
YTHDF2	CCGGCGGTCCATTAATAACTATAACCTCGAGGTTATAGTTATTAATGGACCGTTTTTG
YTHDF3	CCGGGATAAGTGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCACTTATCTTTTTG

Open in a new tab

Table 2.

The siRNA sequences used in this study.

DOI: http://dx.doi.org/10.7554/eLife.15528.016

siRNA	Sequences (5’-3’)
METTL3	5’-CTGCAAGTATGTTCACTATGA-3’ 5’-AGGAGCCAGCCAAGAAATCAA-3’
METTL14	5’-TGGTGCCGTGTTAAATAGCAA-3’ 5’-AAGGATGAGTTAATAGCTAAA-3’
FTO	5’-AAATAGCCGCTGCTTGTGAGA-3’
AlkBH5	5’-AAACAAGTACTTCTTCGGCGA-3’

Open in a new tab

HIV-1 infection assays

Single-cycle, luciferase reporter HIV-1 stock (HIV-Luc/VSV-G) was generated by calcium phosphate co-transfection of HEK 293T cells with the pNL-Luc-E^–R⁺ and pVSV-G as described (St Gelais et al., 2014). The infectious units of virus stocks were evaluated by limiting dilution on GHOST/X4/R5 cells as described (Wang et al., 2007). HIV-1 infection assays using luciferase reporter viruses were performed using a multiplicity of infection (MOI) of 0.5 as described (de Silva et al., 2012). Cell lysates were obtained 24 hpi and analyzed for luciferase activity using a commercially available kit (Promega) according to the manufacturer’s instructions. Total cell protein was quantified using a bicinchoninic acid assay (BCA; Pierce, Waltham, MA) and all luciferase results were normalized to total protein amounts. HIV-1 capsid p24 levels in supernatants were measured by an enzyme-linked immunosorbent assay (ELISA) using anti-p24-coated plates (AIDS and Cancer Virus Program, NCI-Frederick, MD) as described (Wang et al., 2007). Jurkat cells were infected with replication-competent HIV-1_NL4-3 at an MOI of 0.5 as described (Wang et al., 2007). At 72 hpi, cells were washed 3 times and harvested for total RNA extraction using RNAeasy kit (Qiagen). PHA-activated primary CD4⁺ T cells were infected with HIV-1_NL4-3 (40 ng p24 equivalent HIV-1 per 10⁶ cells) and cells were harvested at 96 hpi for total RNA extraction using RNAeasy kit (Qiagen).

m⁶A-seq

High-throughput sequencing of HIV-1 methylome was carried out using m⁶A-seq (Dominissini et al., 2012) and followed the protocol published previously (Dominissini et al., 2012). In brief, total RNA containing HIV-1 RNA was extracted from the cells and purified by poly (dT) beads. Purified polyadenylated RNA was mixed with 2.5 μg of affinity purified anti-m⁶A polyclonal antibody (202003; Synaptic Systems, Goettingen, Germany) in IPP buffer (150 mM NaCl, 0.1% NP-40, 10 mM Tris-HCl, pH 7.4) and incubated for 2 hr at 4°C. RNA was used for library generation with the small RNA sequencing kit (NEB, Ipswich, MA). Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions.

Quantification of HIV-1 RNA m⁶A level using liquid chromatography-mass spectrometry (LC-MS/MS)

HIV-1 gRNA (250 μg) was isolated from highly purified HIV-1_MN virions (total p24 capsid 600 μg) (Rossio et al., 1998; Wang et al., 2008) using an RNeasy Mini kit (Invitrogen), and subjected to quantitative analysis of m⁶A level using LC-MS/MS as described (Jia et al., 2011).

Quantitative PCR and RT-PCR

Quantitative PCR (qPCR) was performed to assess the relative levels of HIV-1 late reverse transcription (RT) products and 2-LTR circles as described (de Silva et al., 2012; Dong et al., 2007). Reverse transcription PCR (RT-PCR) was used to measure HIV-1 gag mRNA as described (Dong et al., 2007). To amplify HIV-1 late RT products in cells transduced with pLenti vectors, a different set of primers (LW59 and LW60) were used as described (St Gelais et al., 2015). Sequences of PCR primers and probes are listed in Table 3. All HIV-1 stocks used for PCR assays were treated with DNaseI (40 U/ml; Ambion, Waltham, MA) prior to infections to avoid plasmid DNA contamination.

Table 3.

Sequences of PCR primers and probes used in this study.

DOI: http://dx.doi.org/10.7554/eLife.15528.017

Primers	Sequences (5’-3’)
HIV-1 gag forward	CTAGAACGATTCGCAGTTAATCCT
HIV-1 gag reverse	CTATCCTTTGATGCACACAATAGAG
Unspliced GAPDH forward	GGGAAGCTCAAGGGAGATAAAATTC
Unspliced GAPDH reverse	GTAGTTGAGGTCAATGAAGGGGTC
Spliced GAPDH forward	GGAAGGTGAAGGTCGGAGTCAACGG
Spliced GAPDH reverse	CTGTTGTCATACTTCTCATGGTTCAC
MH531 forward (for HIV-1 late reverse transcription (RT) products)	TGTGTGCCCGTCTGTTGTGT
BB reverse (for late RT products)	GGATTAACTGCGAATCGTTC
HIV-1 late RT product probe	TCGACGCAGGACTCGGCTTGCT
2-LTR probe	AAGTAGTGTGTGCCCGTCTGTTGTGTGACTC
2-LTR forward	GCCTGGGAGCTCTCTGGCTAA
2-LTR reverse	GCCTTGTGTGTGGTAGATCCA
LW59 (forward, alternative for late RT detection in shRNA vector-transduced cells)	GACATAGCAGGAACTACTAGTACCC
LW60 (reverse, alternative for late RT detection in shRNA vector-transduced cells)	GGTCCTTGTCTTATGTCCAGAATGC

Open in a new tab

Antibodies and immunoblotting

The antibodies used in this study were: anti-GAPDH (clone 4G5, AbD serotec, Atlanta, GA), anti-FLAG (F-3165, Sigma-Aldrich), anti-FTO (ab124892, Abcam, Cambridge, MA), anti- AlkBH5 (HPA007196, Sigma-Aldrich), anti-METTL3 (15073-1-AP, Proteintech Group, Rosemont, IL), anti-METTL14 (HPA038002, Sigma-Aldrich), anti-YTHDF1 (ab99080; Abcam), anti-YTHDF2 (ABE542, EMD Millipore, Billerica, MA), anti-YTHDF3 (ab103328; Abcam), and anti-HIV-1 Gag (clone #24–2, the NIH AIDS Reagent Program). Cells were harvested and lysed in cell lysis buffer (Cell Signalling, Beverly, MA) supplemented with protease inhibitor cocktails (Sigma-Aldrich). Immunoblotting was performed as described (St Gelais et al., 2015). Detection of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression was used as a loading control.

Immunoprecipitation and RNA isolation

HeLa cells expressing pPB-CAG vector or YTHDF1–3 (2.5 × 10⁶ cells) were seeded in a 60 mm-diameter culture plate. Cells were infected with HIV-Luc/VSV-G at an MOI of 5 for 3 hr. Cells were UV-cross-linked, lysed in cell lysis buffer (Sigma-Aldrich). The cells were incubated in lysis buffer for 10 min on ice with frequent mixing and were sonicated to ensure maximum lysis. The lysed cell suspension was centrifuged for 5 min at 9,300 ×g at 4°C. The supernatant was transferred to fresh tubes and equal amount of cell lysates were mixed with anti-FLAG-conjugated protein G beads and rotated for 2 hr at 4°C. After the incubation, beads were washed 3 times with cell lysis buffer. Co-immunoprecipitated RNA was isolated from the immunoprecipitates using Trizol (Invitrogen), and RNeasy columns (Qiagen) with an on-column DNase I treatment (Qiagen) and eluted with RNase-free water. Equal volumes of RNA were used as a template for first-strand cDNA synthesis, according to the manufacturer’s instructions.

CLIP-seq

We followed a previously reported protocol of the PAR (photoactivatable ribonucleoside-enhanced)-CLIP assay (Hafner et al., 2010) with the following modifications. As HIV-1 infection was inhibited by the addition of 4-thiouridine (data not shown), we omitted that step and performed crosslinking directly. Briefly, HeLa/CD4 cells stably expressing individual YTHDF1-3 proteins were seeded in thirty 15-cm diameter plates one day before HIV-1_NL4-3 infection. At day 2, the cells were infected with HIV-1_NL4-3 at a multiplicity of infection (MOI) of 5 and cells were washed to remove cell-free viruses. At 72 hr post-infection, the cells were washed once with 10 mL ice-cold PBS. Uncovered cell plates were placed on a tray with ice and irradiated with 0.15 J/cm² of 254 nm UV light three times in a Stratalinker 2400 (Stratagene, Santa Clara, CA). Cells were scraped off in PBS and transferred to centrifugation tubes and collected by centrifugation at 500 × g for 5 min at 4°C. The cell pellets were lysed in 3 volumes of 1% NP40 lysis buffer and incubated on ice for 10 min. The cell lysates were cleared by centrifugation at 13,000 × g for 15 min at 4°C. Cleared cell lysates were incubated with RNase T1 to a final concentration of 0.2 U/μl, at 22°C for 15 min, and immediately put on ice for 5 min to quench. Samples were then centrifuged at 13,000 × g for 10 min at 4°C and the supernatant was taken. Anti-FLAG M2 magnetic beads (Sigma M8823, 20 μl slurry/15-cm diameter plate) were washed in IP buffer (50 mM HEPES (pH 7.5), 0.3 M KCl, 0.05% NP40) for 5 times and resuspended in cleared cell lysates and incubated at 4°C overhead rotator for 2 hr. After 2 hr, beads were washed with 1 mL IP buffer for 3 times and beads were changed into a new tube for the final wash and resuspended into 100 μl IP buffer. RNAse T1 was added to the beads at a final concentration of 10 U/μl, incubated at 22°C for 6 min, immediately put on ice for 5 min to quench. Beads were washed with 1 mL high salt buffer (50 mM Tris (pH 7.5), 500 mM KCl, 0.05% NP40) five times, then with 1 mL T4 polynucleotide kinase (PNK) buffer containing 50 mM Tris (pH 7.5), 10 mM MgCl₂, 50 mM NaCl (without DTT) two times, finally resuspended into 100 μl PNK reaction mix (95 μl commercial PNK buffer and 5 μl T4 PNK (Promega) and incubated at 37°C for 15 min. Then 10 μl PNK and 1.1 μl 10 mM ATP (to a final concentration of 100 μM) were added to the mixture and kept at 37°C for another 20 min, followed by washing with 1 mL PNK buffer (without DTT) five times and with 1 mL high salt buffer five times. The bound RNA fragments were eluted from the beads by proteinase K digestion twice at 55 °C for 20 and 10 min, respectively. The eluate was further purified using RNA Clean and Concentrator kit (Zymo Research). RNA was used for library generation with NEBNext Small RNA Library Prep kit (NEB). Sequencing was carried out on Illumina HiSeq 4000 according to the manufacturer’s instructions.

For bioinformatics analysis, after removing the adapter sequence, only reads that are longer than 16 bp were kept. The reads were mapped to the reference genomes (both human hg38 and HIV-1_NL4-3 (GenBank: M19921.2) using Bowtie2. Reads uniquely mapped to HIV-1 genome (not to human genome) were used in the subsequent analysis.

Measurement of the kinetics of HIV-1 RNA in infected cells

HeLa cells over-expressing individual YTHDF1–3 proteins or the pPB-CAG vector were infected with HIV-1-Luc/VSV-G (MOI of 0.5). Cells were collected at 6, 12 and 24 hpi. Total RNA was isolated from the cells using RNeasy columns (Qiagen) with on-column DNase I treatment (Qiagen) and eluted with RNase-free water. Quantitative RT-PCR was used to measure HIV-1 gag RNA levels as described (Dong et al., 2007). Sequences of PCR primers are listed in Table 3. All HIV-1 stocks used for infection were treated with DNaseI (40 U/ml; Ambion) prior to infections to avoid plasmid DNA contamination.

GO analysis

GO analysis was performed using the GO Enrichment Analysis tool from the Gene Ontology Consortium (Gene Ontology, 2015). GO graphs were plotted using the Web server REVIGO (Supek et al., 2011).

Statistical analysis

Data were analyzed using Mann-Whitney’s U test or one-way ANOVA test with Prism software and statistical significance was defined as p<0.05.

Data deposition and access

Data accession: all the raw data and processed files have been deposited in the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) and accessible under GSE85724.

Acknowledgements

The authors thank Dr. Jeffrey D Lifson (NCI-Fredrick) for providing purified HIV-1 virions, Suresh de Silva for technical assistance, and Corine St. Gelais for critical reading the manuscript. The antibody to HIV-1 Gag (clone #24-2) and the HIV-1 RT inhibitor AZT were obtained from the NIH AIDS Reagent Program. This work was supported by NIH grants AI104483 to LW and AI074658 to CH and a seed grant to LW from the Center for RNA Biology at The Ohio State University (OSU). LW is also supported in part by NIH grants (CA181997 and AI120209) and the Public Health Preparedness for Infectious Diseases Program of OSU. CH is an investigator of the Howard Hughes Medical Institute (HHMI). BSZ is an HHMI International Student Research Fellow.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Funding Information

This paper was supported by the following grants:

National Institutes of Health AI074658 to Chuan He.
Howard Hughes Medical Institute to Chuan He.
National Institutes of Health AI104483 to Li Wu.
National Institutes of Health CA181997 to Li Wu.
National Institutes of Health AI120209 to Li Wu.
Center for RNA Biology at The Ohio State University Seed Grant to Li Wu.

Additional information

Competing interests

The authors declare that no competing interests exist.

Author contributions

NT, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.

BSZ, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.

WL, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.

ZL, Acquisition of data, Analysis and interpretation of data.

CH, Conception and design, Analysis and interpretation of data, Drafting or revising the article.

LW, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.

Additional files

Major datasets

The following dataset was generated:

Nagaraja Tirumuru,Boxuan Simen Zhao,Wuxun Lu,Zhike Lu,Chuan He,Li Wu,2017,RNA sequencing dataset of m6A sites and YTHDF protein binding sites in HIV-1 RNA,http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE85724,Publicly available at the NCBI Gene Expression Omnibus (accession no. GSE85724)

References

Beemon K, Keith J. Localization of N6-methyladenosine in the Rous sarcoma virus genome. Journal of Molecular Biology. 1977;113:165–179. doi: 10.1016/0022-2836(77)90047-X. [DOI] [PubMed] [Google Scholar]
Canaani D, Kahana C, Lavi S, Groner Y. Identification and mapping of N6-methyladenosine containing sequences in simian virus 40 RNA. Nucleic Acids Research. 1979;6:2879–2899. doi: 10.1093/nar/6.8.2879. [DOI] [PMC free article] [PubMed] [Google Scholar]
de Silva S, Planelles V, Wu L. Differential effects of Vpr on single-cycle and spreading HIV-1 infections in CD4+ T-cells and dendritic cells. PLoS One. 2012;7:e35385. doi: 10.1371/journal.pone.0035385. [DOI] [PMC free article] [PubMed] [Google Scholar]
Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012;485:201–206. doi: 10.1038/nature11112. [DOI] [PubMed] [Google Scholar]
Dong C, Janas AM, Wang JH, Olson WJ, Wu L. Characterization of human immunodeficiency virus type 1 replication in immature and mature dendritic cells reveals dissociable cis- and trans-infection. Journal of Virology. 2007;81:11352–11362. doi: 10.1128/JVI.01081-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
Fu Y, Dominissini D, Rechavi G, He C. Gene expression regulation mediated through reversible m⁶A RNA methylation. Nature Reviews Genetics. 2014;15:293–306. doi: 10.1038/nrg3724. [DOI] [PubMed] [Google Scholar]
Gene Ontology C Gene Ontology Consortium: going forward. Nucleic Acids Research. 2015;43:D1049–1056. doi: 10.1093/nar/gku1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
Goff SP. Host factors exploited by retroviruses. Nature Reviews Microbiology. 2007;5:253–263. doi: 10.1038/nrmicro1541. [DOI] [PubMed] [Google Scholar]
Hafner M, Landthaler M, Burger L, Khorshid M, Hausser J, Berninger P, Rothballer A, Ascano M, Jungkamp AC, Munschauer M, Ulrich A, Wardle GS, Dewell S, Zavolan M, Tuschl T. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010;141:129–141. doi: 10.1016/j.cell.2010.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hashimoto SI, Green M. Multiple methylated cap sequences in adenovirus type 2 early mRNA. Journal of Virology. 1976;20:425–435. doi: 10.1128/jvi.20.2.425-435.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
Jia G, Fu Y, He C. Reversible RNA adenosine methylation in biological regulation. Trends in Genetics. 2013;29:108–115. doi: 10.1016/j.tig.2012.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, Yi C, Lindahl T, Pan T, Yang YG, He C. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nature Chemical Biology. 2011;7:885–887. doi: 10.1038/nchembio.687. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kennedy EM, Bogerd HP, Kornepati AV, Kang D, Ghoshal D, Marshall JB, Poling BC, Tsai K, Gokhale NS, Horner SM, Cullen BR. Posttranscriptional m(6)A editing of HIV-1 mRNAs enhances viral gene expression. Cell Host & Microbe. 2016;19:675–685. doi: 10.1016/j.chom.2016.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
Krug RM, Morgan MA, Shatkin AJ. Influenza viral mRNA contains internal N6-methyladenosine and 5'-terminal 7-methylguanosine in cap structures. Journal of Virology. 1976;20:45–53. doi: 10.1128/jvi.20.1.45-53.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kutluay SB, Zang T, Blanco-Melo D, Powell C, Jannain D, Errando M, Bieniasz PD. Global changes in the RNA binding specificity of HIV-1 gag regulate virion genesis. Cell. 2014;159:1096–1109. doi: 10.1016/j.cell.2014.09.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lavender CA, Gorelick RJ, Weeks KM. Structure-based alignment and consensus secondary structures for three HIV-related RNA genomes. PLoS Computational Biology. 2015;11:e1004230. doi: 10.1371/journal.pcbi.1004230. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lichinchi G, Gao S, Saletore Y, Gonzalez GM, Bansal V, Wang Y, Mason CE, Rana TM. Dynamics of the human and viral m6A RNA methylomes during HIV-1 infection of T cells. Nature Microbiology. 2016;1:16011. doi: 10.1038/nmicrobiol.2016.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nature Chemical Biology. 2014;10:93–95. doi: 10.1038/nchembio.1432. [DOI] [PMC free article] [PubMed] [Google Scholar]
Liu N, Dai Q, Zheng G, He C, Parisien M, Pan T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature. 2015;518:560–564. doi: 10.1038/nature14234. [DOI] [PMC free article] [PubMed] [Google Scholar]
Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012;149:1635–1646. doi: 10.1016/j.cell.2012.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
Moir S, Chun TW, Fauci AS. Pathogenic mechanisms of HIV disease. Annual Review of Pathology. 2011;6:223–248. doi: 10.1146/annurev-pathol-011110-130254. [DOI] [PubMed] [Google Scholar]
Ping XL, Sun BF, Wang L, Xiao W, Yang X, Wang WJ, Adhikari S, Shi Y, Lv Y, Chen YS, Zhao X, Li A, Yang Y, Dahal U, Lou XM, Liu X, Huang J, Yuan WP, Zhu XF, Cheng T, Zhao YL, Wang X, Rendtlew Danielsen JM, Liu F, Yang YG. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Research. 2014;24:177–189. doi: 10.1038/cr.2014.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rossio JL, Esser MT, Suryanarayana K, Schneider DK, Bess JW, Vasquez GM, Wiltrout TA, Chertova E, Grimes MK, Sattentau Q, Arthur LO, Henderson LE, Lifson JD. Inactivation of human immunodeficiency virus type 1 infectivity with preservation of conformational and functional integrity of virion surface proteins. Journal of Virology. 1998;72:7992–8001. doi: 10.1128/jvi.72.10.7992-8001.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
St Gelais C, de Silva S, Hach JC, White TE, Diaz-Griffero F, Yount JS, Wu L. Identification of cellular proteins interacting with the retroviral restriction factor SAMHD1. Journal of Virology. 2014;88:5834–5844. doi: 10.1128/JVI.00155-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
St Gelais C, Roger J, Wu L. Non-POU domain-containing octamer-binding protein negatively regulates HIV-1 infection in CD4(+) T cells. AIDS Research and Human Retroviruses. 2015;31:806–816. doi: 10.1089/aid.2014.0313. [DOI] [PMC free article] [PubMed] [Google Scholar]
Supek F, Bošnjak M, Škunca N, Šmuc T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS One. 2011;6:e21800. doi: 10.1371/journal.pone.0021800. [DOI] [PMC free article] [PubMed] [Google Scholar]
van Hemert F, van der Kuyl AC, Berkhout B. On the nucleotide composition and structure of retroviral RNA genomes. Virus Research. 2014;193:16–23. doi: 10.1016/j.virusres.2014.03.019. [DOI] [PubMed] [Google Scholar]
Wang JH, Janas AM, Olson WJ, KewalRamani VN, Wu L. CD4 coexpression regulates DC-SIGN-mediated transmission of human immunodeficiency virus type 1. Journal of Virology. 2007;81:2497–2507. doi: 10.1128/JVI.01970-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang JH, Wells C, Wu L. Macropinocytosis and cytoskeleton contribute to dendritic cell-mediated HIV-1 transmission to CD4+ T cells. Virology. 2008;381:143–154. doi: 10.1016/j.virol.2008.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang X, He C. Reading RNA methylation codes through methyl-specific binding proteins. RNA Biology. 2014;11:669–672. doi: 10.4161/rna.28829. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T, He C. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014;505:117–120. doi: 10.1038/nature12730. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, He C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell. 2015;161:1388–1399. doi: 10.1016/j.cell.2015.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
Watts JM, Dang KK, Gorelick RJ, Leonard CW, Bess JW, Swanstrom R, Burch CL, Weeks KM. Architecture and secondary structure of an entire HIV-1 RNA genome. Nature. 2009;460:711–716. doi: 10.1038/nature08237. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wilkinson KA, Gorelick RJ, Vasa SM, Guex N, Rein A, Mathews DH, Giddings MC, Weeks KM. High-throughput SHAPE analysis reveals structures in HIV-1 genomic RNA strongly conserved across distinct biological states. PLoS Biology. 2008;6:e96. doi: 10.1371/journal.pbio.0060096. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wu L, Martin TD, Carrington M, KewalRamani VN. Raji B cells, misidentified as THP-1 cells, stimulate DC-SIGN-mediated HIV transmission. Virology. 2004;318:17–23. doi: 10.1016/j.virol.2003.09.028. [DOI] [PubMed] [Google Scholar]
Yue Y, Liu J, He C. RNA N6-methyladenosine methylation in post-transcriptional gene expression regulation. Genes & Development. 2015;29:1343–1355. doi: 10.1101/gad.262766.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zheng G, Dahl JA, Niu Y, Fedorcsak P, Huang CM, Li CJ, Vågbø CB, Shi Y, Wang WL, Song SH, Lu Z, Bosmans RP, Dai Q, Hao YJ, Yang X, Zhao WM, Tong WM, Wang XJ, Bogdan F, Furu K, Fu Y, Jia G, Zhao X, Liu J, Krokan HE, Klungland A, Yang YG, He C. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Molecular Cell. 2013;49:18–29. doi: 10.1016/j.molcel.2012.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature. 2015;526:591–594. doi: 10.1038/nature15377. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.020

Decision letter

Editor: Stephen P Goff¹

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "N6-methyladenosine of HIV-1 RNA Regulates Viral Infection and HIV-1 Gag Protein Expression" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Wenhui Li as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Kathleen Collins (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

The reviewers were collectively in agreement that the topic of RNA m⁶A modification is of much current interest, and that there are interesting observations on its role in HIV-1 replication in the paper. But there were significant weaknesses in the data and the presentation, as should be apparent from the reviews. Some of the findings are confusing or hard to understand. Major revisions are required to answer the criticisms.

Of the comments, it will be essential to address these points:

1) From Reviewer #2: Silencing YTHDF1, but not 2 or 3, enhanced RT in T cells. In contrast, silencing YTHDF 3, but not 1 or 2, enhanced gag mRNA expression. Silencing each in HeLa cells strongly enhanced both RT and gag mRNA expression. This needs to be laid out more clearly, and an explanation needs to be presented. The explanation given "One possibility is that different levels of YTHDF proteins in overexpression or knockdown experiments using different cell types." is confusing.

2) We need better explanation of the exact sites and population states of the modifications. What exactly do the data allow us to know? This is laid out in Reviewer #3 comment 1.

3) The cell-type specificity of the results is not adequately spelled out. If the authors feel this is a major conclusion, we need to know what is happening in relevant cells (T cells).

4) The differential effects of the various YTHDF proteins reported here are not in agreement with effects seen by others. This and other discrepancies need to be addressed or explained.

5) We need to know if the mechanism of action is thought to be RNA degradation or just inhibition of RT.

We suppose that it will not be simple to address these issues without considerable new effort, and so we want to make it clear that there is no certain path that will assure satisfaction of the reviewers. The key issues raised by Reviewer #3 will need to be addressed.

Reviewer #1:

This paper reports the effects of KD or overexpression of the three YTHDF proteins on HIV-1 replication. These are "readers" of m⁶A modification of RNAs.

This is a very active area of investigation right now. The existence of the modification on HIV-1 and many other viral RNAs has been known for some time. Recently a paper has appeared that shows that the "writers" of the modification (METTL3 and METTL14 and WTAP) and the "erasers" (the FTO proteins) have effects on HIV-1 consistent with the idea that the modifications are mostly negative. There is, however, an m⁶A on the RRE that seems to be stimulatory.

This present work maps the modifications on the viral genome and shows that a family of m⁶A binding proteins play some role in HIV-1 replication. They bind to the RNA in a characteristic pattern. They seem to be inhibitory, both during RT and during expression.

One weakness here is what they do – i.e., whether they are really "readers". Do they just interfere with RT or the ribosome? Do they do something active?

Another is that the KD effects are in general modest – often 2-5 fold (Figure 3C,E). The KD did give 5-12x effects in one assay (Figure 2E). The overexpression has bigger effects but it's not clear how to interpret these results given the abnormal levels.

The major new finding is the involvement of the YTHDF proteins, rounding out the earlier work implicating the writers and erasers. I wish we knew more about what they do. I wish we understood more about the times when m⁶A is stimulatory and inhibitory. But there is new information here, even if we cannot say that this paper presents a breakthrough in our understanding.

Reviewer #2:

The article entitled, "N6-methyladenosine of HIV-1 RNA Regulates Viral infection and HIV-1 Gag Protein Expression" by Tirumuru and colleagues is a well written and very interesting investigation into the role of N6-methyladenosine in the viral life cycle. The authors find that this modification of viral RNA has both positive and negative effects; it is inhibitory to reverse transcription due to binding by YTHDF1-3 proteins. The authors also confirm prior studies indicating that N6-methyladenosine incorporation is necessary for maximal HIV protein expression. Thus, N6-methyladenosine has both positive and negative effects depending on the stage of the viral life cycle. Overall, the experiments were well-controlled and interpreted accurately. In particular, the inhibitory effects of YTHDF1-3 on reverse transcription and viral gene expression in HeLa cells in Figures 4 and 5 are quite striking. The authors also elegantly determine the binding sites of YTHDF1-3 proteins on the HIV genome and demonstrate that these sites partially correspond with sites containing N6-methyladenosine. Interestingly, YTHDF1 had a unique binding site within the rev gene, suggesting it plays a unique role. The data are significant and important to our understanding of this poorly understood RNA modification and its role in HIV replication.

Reviewer #3:

Overall this is an interesting story about m⁶A and HIV. A recent paper in Nature Microbiology by Rana et al. showed m⁶A promotes viral replication and via promoting REV/RRE interactions and mapped m⁶A in HIV and in the host cellular RNA. The present manuscript does not significantly advance the field in light of the prior study, and the relevance of the mechanisms seem somewhat unclear. Lastly, some of the experiments seem poorly executed.

1) Concerns with mapping m⁶A: Mapping of m⁶A sites on the HIV-1 RNA was performed in HEK293T cells using m⁶A-seq and in Jurkat cells using m⁶A -CLIP-seq. However, m⁶A mapping was never performed in the natural target cell (primary CD4⁺ T cells) of HIV-1 virus. Moreover, the resolution of these methods seems limited-it doesn't appear that the m⁶A -CLIP-Seq identifies the specific adenosine that is methylated, but regions that might contain an m⁶A. (Or perhaps the authors could show the residues that are methylated in an inset?) This is especially important for Figures 1B and C which look like jagged noise-how do we know these are caused by m⁶A?

The authors claim that there are 4 m⁶A's based on MS. This assumes that each site is methylated in every viral RNA. This may not be the case. The number of sites should be predicted from the mapping data, not the MS data.

2) In Figure 1A (bottom panel), the m⁶A peak profile in HEK293T and m⁶A-CLIP-seq in Jurkat cells appear strikingly different. This difference clearly suggests cell-to-cell variation in m⁶A distribution on the HIV-1 RNA. Therefore, an m⁶A map from primary CD4⁺ T cells which are the natural targets of HIV-1 virus is necessary.

3) The authors fail to identify any robust m⁶A peak/site over the input RNA in the gag gene (Figure 1A, bottom panel), but they see an effect of overexpression of YTHDF proteins on the expression of HIV-1 Gag protein (Figure 2C). At the same time, in Figure 6C, several YTHDF binding sites were identified in the gag gene. This discrepancy is not addressed.

4) YTHDF1 and YTHDF2 have different effects on cellular mRNA. YTHDF2 (Wang et al., Nature, 2014, doi:10.1038/nature12730) mediates m⁶A-dependent mRNA degradation and YTHDF1 (Wang et al., Cell, 2015, DOI: http://dx.doi.org/10.1016/j.cell.2015.05.014) promotes mRNA translation. However, in the present manuscript, the authors demonstrate that YTHDF 1-3 show a similar effect on Gag protein expression. Overexpression of YTHDF proteins leads to a decreased expression of Gag protein (Figure 2C). In Figure 5, the authors demonstrate the effects of YTHDF protein overexpression and knockdown on gag mRNA expression. Similar to the decrease in Gag protein expression, gag mRNA expression decreases upon the overexpression of YTHDF proteins. Furthermore, a shRNA-mediated knockdown leads to an increase in gag mRNA levels. From their previous findings, YTHDF1 and YTHDF2 should exhibit opposing effects on gag mRNA and protein levels. This contradictory data is not addressed. It is also possible that the changes in gag expression is due to some secondary effects of YTHDF knockdown and overexpression.

5) According to the Rana paper, HIV-1 infection modulates host gene expression and m⁶A levels in the encoded mRNAs. Protein encoded by these mRNAs (19 out of 56) were previously identified as regulators of HIV replication. Some of these proteins also directly interact with HIV proteins. These m⁶A-containing host RNAs could also be targets of YTHDF proteins. Therefore, the role of YTHDF interaction with the viral genome and inhibition of viral reverse transcription is not convincing. In cells, HIV-1 RNA can be covered with hundreds of proteins before and during reverse transcription. Why would the presence of YTHDF protein on HIV-1 genomic RNA hinder reverse transcription? It is highly likely that recruitment of YTHDF proteins induce HIV-1 RNA degradation or function in an indirect manner to affect HIV. Little mechanistic insight is provided.

6) It seems arbitrary that the authors only look at FTO and not the other m⁶A demethylase ALKBH5, yet incorporate ALKBH5 in their model.

7) The PAR-CLIP data should be aligned with the m⁶A site data so that we can see if these YTH proteins are bound at m⁶A sites. It seems like all m⁶A-Seq and PAR-CLIP experiments were done without replicates. This is a problem.

eLife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.021

Author response

We thank reviewers for their careful reviews and helpful suggestions to improve our work. We also appreciate the editors’ clear summary of the essential points that we need to address. We have performed new experiments to address these questions and carefully revised the manuscript accordingly.

Of the comments, it will be essential to address these points:

We appreciate the suggestion from the reviewer. We have performed additional experiments to further confirm our results of the late RT and gag mRNA expression. The inhibition of RT products by YTHDF1 occurred before gag mRNA expression and is the main mechanism. Thus, to avoid confusion, we moved the gag mRNA results to Figure 4—figure supplement 1 and provided further explanations in subsection “YTHDF1–3 proteins inhibit HIV-1 infection by blocking viral reverse transcription”. We have also deleted the confusing sentence as the reviewer indicated.

2) We need better explanation of the exact sites and population states of the modifications. What exactly do the data allow us to know? This is laid out in Reviewer #3 comment 1.

We agree. As Reviewer #3 suggested, we have performed additional experiments to map the m⁶A sites on the HIV-1 RNAs from Jurkat T-cells and primary CD4⁺ T-cells infected with HIV-1. The new m⁶A mapping results are consistent in both cell types (Figure 1A-B). Please refer to the details in response Reviewer #3 comment 1.

3) The cell-type specificity of the results is not adequately spelled out. If the authors feel this is a major conclusion, we need to know what is happening in relevant cells (T cells).

We agree. We performed additional experiments using Jurkat T-cells and primary CD4⁺ T-cells infected with replication-competent HIV-1 and obtained consistent results (Figure 1A-B, Figure 1—figure supplement 3 and 4). We also provided explanations to address cell-type specificity when we compared the results obtained from different cell types.

4) The differential effects of the various YTHDF proteins reported here are not in agreement with effects seen by others. This and other discrepancies need to be addressed or explained.

We have provided careful explanations regarding the discrepancies between previously published results and our data (see Discussion section). Please also refer to details in the following specific responses. Of note, neither recent studies (Lichinchi et al., Nature Microbiology 2016; Kennedy et al., Cell Host Microbe 2016) examined m⁶A modification of HIV-1 RNA and its effect on HIV-1 replication in primary CD4⁺ T-cells, nor systemically analyzed the role of the m⁶A writers, erasers, and readers in HIV-1 replication.

5) We need to know if the mechanism of action is thought to be RNA degradation or just inhibition of RT.

We agree and appreciate the constructive suggestions. To better understand the mechanism of action, we performed a new experiment to examine the impact of YTHDF1–3 on HIV-1 gag RNA kinetics (Figure 5C). Our data suggest that YTHDF1–3 proteins can degrade HIV-1 gag RNA in infected cells, thereby leading to inhibition of HIV-1 reverse transcription (Figure 5C).

In summary, we have made our best effort to address the key issues raised by three reviewers. We performed new experiments suggested by the reviewers and revised the manuscript accordingly. We also provide detailed responses to the specific points from three reviewers.

Reviewer #1:

This paper reports the effects of KD or overexpression of the three YTHDF proteins on HIV-1 replication. These are "readers" of m⁶A modification of RNAs. This is a very active area of investigation right now. The existence of the modification on HIV-1 and many other viral RNAs has been known for some time. Recently a paper has appeared that shows that the "writers" of the modification (METTL3 and METTL14 and WTAP) and the "erasers" (the FTO proteins) have effects on HIV-1 consistent with the idea that the modifications are mostly negative. There is, however, an m⁶A on the RRE that seems to be stimulatory.

One weakness here is what they do – i.e., whether they are really "readers". Do they just interfere with RT or the ribosome? Do they do something active?

We understand this important question. To better understand the mechanism of action, we performed a new experiment to examine the impact of YTHDF1–3 on HIV-1 gag RNA kinetics. Our data suggest that YTHDF1–3 proteins can degrade HIV-1 gag RNA in infected cells, thereby leading to inhibition of HIV-1 reverse transcription (Figure 5C).

We understand the concerns. To address the concern, we have performed additional knockdown experiments or quantified the knockdown efficiencies (new Figures 2D, 3A and D) and presented the average results of HIV-1 infection assays from at least three independent experiments (new Figures 2E, 3C and E). We agree that the overexpression generally has bigger effects than the knockdown experiments. We have explained our overexpression results cautiously and corroborated the knockdown results by demonstrating opposite effects of overexpression.

We thank this reviewer for the supportive comments. We have performed additional experiments to better understand the role and mechanisms of the m⁶A reader proteins in HIV-1 infection. We believe that the new information in our manuscript is important to the new area studying the m⁶A modification of HIV-1 RNA or other viruses.

Reviewer #2:

The article entitled, "N6-methyladenosine of HIV-1 RNA Regulates Viral infection and HIV-1 Gag Protein Expression" by Tirumuru and colleagues is a well written and very interesting investigation into the role of N6-methyladenosine in the viral life cycle. The authors find that this modification of viral RNA has both positive and negative effects; it is inhibitory to reverse transcription due to binding by YTHDF1-3 proteins. The authors also confirm prior studies indicating that N6-methyladenosine incorporation is necessary for maximal HIV protein expression. Thus, N6-methyladenosine has both positive and negative effects depending on the stage of the viral life cycle. Overall, the experiments were well-controlled and interpreted accurately. In particular, the inhibitory effects of YTHDF1-3 on reverse transcription and viral gene expression in HeLa cells in Figures 4 and 5 are quite striking. The authors also elegantly determine the binding sites of YTHDF1-3 proteins on the HIV genome and demonstrate that these sites partially correspond with sites containing N6-methyladenosine. Interestingly, YTHDF1 had a unique binding site within the rev gene, suggesting it plays a unique role. The data are significant and important to our understanding of this poorly understood RNA modification and its role in HIV replication.

We thank this reviewer for the positive comments and constructive suggestions. We have performed additional experiments and carefully revised the manuscript based on the reviewer’s suggestions.

Reviewer #3:

We thank this reviewer for the careful review and constructive suggestions to improve our work and manuscript. We have performed additional experiments as the reviewer suggested and carefully revised our manuscript accordingly. We are confident that our revised manuscript can provide new information to advance this new field studying HIV-1 RNA methylation.

1) Concerns with mapping m⁶A: Mapping of m⁶A sites on the HIV-1 RNA was performed in HEK293T cells using m⁶A-seq and in Jurkat cells using m⁶A-CLIP-seq. However, m⁶A mapping was never performed in the natural target cell (primary CD4⁺ T cells) of HIV-1 virus. Moreover, the resolution of these methods seems limited-it doesn't appear that the m⁶A-CLIP-Seq identifies the specific adenosine that is methylated, but regions that might contain a m⁶A. (Or perhaps the authors could show the residues that are methylated in an inset?) This is especially important for Figures 1B and C which look like jagged noise-how do we know these are caused by m⁶A?

We understand the reviewer’s concerns and appreciate the helpful suggestions. As the reviewer suggested, we have performed additional experiments to map the m⁶A sites on the HIV-1 RNAs from Jurkat T-cells and primary CD4⁺ T-cells infected with a replication-competent HIV-1. The new m⁶A mapping results are consistent in both cell types (Figure 1A-B). To avoid potential confusion, we have moved the previous m⁶A mapping results of HIV-1 RNA from HEK293T cells to Figure 1—figure supplement 1.

To identify the specific adenosine on the HIV-1 RNA that is m⁶A-methylated, we have planned to employ a photo-crosslinking-assisted m⁶A sequencing strategy that more accurately defines sites of modification (Chen, K et al. Angew Chem Int Ed Engl 2015), and validate the result with a base-resolution method termed SCARLET (site-specific cleavage and radioactive labeling followed by ligation-assisted extraction and thin-layer chromatography) (Liu N. et al. RNA, 2013). However, we need to optimize the protocols of both methods to define the specific m⁶A residues on the HIV-1 RNA, which would require additional controls and time to complete. We feel that this experiment is beyond the current scope and focus of our study, which we will complete in the future.

To investigate whether purified HIV-1 virion RNA contains m⁶A, we quantified HIV-1 RNA m⁶A level using liquid chromatography-mass spectrometry (Figure 1—figure supplement 2). This is a novel approach because none of two recent studies (Lichinchi et al., Nature Microbiology 2016; Kennedy et al., Cell Host Microbe 2016) directly measured m⁶A level of HIV-1 RNA from purified HIV-1 particles. Considering 35.8% of HIV-1 genomic RNA (9,173 nucleotides) sequence are adenosines (van Hemert et al., Virus Res. 2014), based on our data, we estimated 3-4 sites of the m⁶A modification in each copy of HIV-1 gRNA, which match the numbers of m⁶A peaks identified by m⁶A-seq (Figure 1A-B and Figure 1—figure supplement 1). We believe that this new information is helpful to further define the specific m⁶A residues on the HIV-1 RNA and study their functions and mechanisms.

2) In Figure 1A (bottom panel), the m⁶A peak profile in HEK293T and m⁶A-CLIP-seq in Jurkat cells appear strikingly different. This difference clearly suggests cell-to-cell variation in m⁶A distribution on the HIV-1 RNA. Therefore, a m⁶A map from primary CD4⁺ T cells which are the natural targets of HIV-1 virus is necessary.

We agree. As the reviewer suggested, we have performed additional experiments to map the m⁶A sites on the HIV-1 RNAs from Jurkat T-cells and primary CD4⁺ T-cells infected with a replication-competent HIV-1. The new m⁶A mapping results are consistent in both cell types (Figure 1A-B).

3) The authors fail to identify any robust m⁶A peak/site over the input RNA in the gag gene (Figure 1A, bottom panel), but they see an effect of overexpression of YTHDF proteins on the expression of HIV-1 Gag protein (Figure 2C). At the same time, in Figure 6C, several YTHDF binding sites were identified in the gag gene. This discrepancy is not addressed.

Thanks for the comments and we agree. We now provided new results of HIV-1 RNA m⁶A mapping in both Jurkat T-cells and primary CD4⁺ T-cells (Figure 1A-B), which show two m⁶A peaks in the gag gene. Together, these results confirm the m⁶A modification of HIV-1 RNA despite some differences in m⁶A distributions in HIV-1 infected CD4⁺ T-cells compared to transfected HEK293T cells.

We agree and appreciate the comments. We have added discussions on different effects of YTHDF1 and YTHDF2 on cellular mRNA and translation (Discussion section, second paragraph). Indeed, we observed a unique high peak within the rev gene of HIV-1 RNA bound by YTHDF1 (Figure 1C), while YTHDF1 and YTHDF2 appear to have similar inhibitory effects on HIV-1 infection. It is possible that YTHDF1 and YTHDF2 may interact with different host proteins that directly or indirectly affect HIV-1 replication and lead to similar effects on viral inhibition.

We agree and appreciate the constructive suggestions. To better understand the mechanism of action of YTHDF proteins, we have performed a new experiment to examine the impact of YTHDF1–3 on HIV-1 gag RNA kinetics (Figure 5C). Our data indicate that YTHDF1–3 proteins can degrade HIV-1 gag RNA in infected cells, thereby leading to inhibition of HIV-1 reverse transcription (Figure 5C).

6) It seems arbitrary that the authors only look at FTO and not the other m⁶A demethylase ALKBH5, yet incorporate ALKBH5 in their model.

We agree. We have added the result of knockdown ALKBH5 alone and double knockdown of FTO and ALKBH5 in new Figure 6C and 6D.

We agree. We have aligned the CLIP-seq data (Figure 1C) with the m⁶A site mapping data (Figure 1A-B) in new Figure 1. We have also repeated the m⁶A-Seq experiments using both Jurkat cells and primary CD4⁺ T-cells. We identified similar profiles of m⁶A peaks in HIV-1 RNA from these two cell types, which are mainly enriched in the 5' and 3' UTRs, the rev and gag genes of the HIV-1 genome (Figure 1A and 1B).

[bib1] Beemon K, Keith J. Localization of N6-methyladenosine in the Rous sarcoma virus genome. Journal of Molecular Biology. 1977;113:165–179. doi: 10.1016/0022-2836(77)90047-X. [DOI] [PubMed] [Google Scholar]

[bib2] Canaani D, Kahana C, Lavi S, Groner Y. Identification and mapping of N6-methyladenosine containing sequences in simian virus 40 RNA. Nucleic Acids Research. 1979;6:2879–2899. doi: 10.1093/nar/6.8.2879. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib3] de Silva S, Planelles V, Wu L. Differential effects of Vpr on single-cycle and spreading HIV-1 infections in CD4+ T-cells and dendritic cells. PLoS One. 2012;7:e35385. doi: 10.1371/journal.pone.0035385. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib4] Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012;485:201–206. doi: 10.1038/nature11112. [DOI] [PubMed] [Google Scholar]

[bib5] Dong C, Janas AM, Wang JH, Olson WJ, Wu L. Characterization of human immunodeficiency virus type 1 replication in immature and mature dendritic cells reveals dissociable cis- and trans-infection. Journal of Virology. 2007;81:11352–11362. doi: 10.1128/JVI.01081-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] Fu Y, Dominissini D, Rechavi G, He C. Gene expression regulation mediated through reversible m⁶A RNA methylation. Nature Reviews Genetics. 2014;15:293–306. doi: 10.1038/nrg3724. [DOI] [PubMed] [Google Scholar]

[bib7] Gene Ontology C Gene Ontology Consortium: going forward. Nucleic Acids Research. 2015;43:D1049–1056. doi: 10.1093/nar/gku1179. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] Goff SP. Host factors exploited by retroviruses. Nature Reviews Microbiology. 2007;5:253–263. doi: 10.1038/nrmicro1541. [DOI] [PubMed] [Google Scholar]

[bib9] Hafner M, Landthaler M, Burger L, Khorshid M, Hausser J, Berninger P, Rothballer A, Ascano M, Jungkamp AC, Munschauer M, Ulrich A, Wardle GS, Dewell S, Zavolan M, Tuschl T. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010;141:129–141. doi: 10.1016/j.cell.2010.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] Hashimoto SI, Green M. Multiple methylated cap sequences in adenovirus type 2 early mRNA. Journal of Virology. 1976;20:425–435. doi: 10.1128/jvi.20.2.425-435.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] Jia G, Fu Y, He C. Reversible RNA adenosine methylation in biological regulation. Trends in Genetics. 2013;29:108–115. doi: 10.1016/j.tig.2012.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib12] Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, Yi C, Lindahl T, Pan T, Yang YG, He C. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nature Chemical Biology. 2011;7:885–887. doi: 10.1038/nchembio.687. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] Kennedy EM, Bogerd HP, Kornepati AV, Kang D, Ghoshal D, Marshall JB, Poling BC, Tsai K, Gokhale NS, Horner SM, Cullen BR. Posttranscriptional m(6)A editing of HIV-1 mRNAs enhances viral gene expression. Cell Host & Microbe. 2016;19:675–685. doi: 10.1016/j.chom.2016.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] Krug RM, Morgan MA, Shatkin AJ. Influenza viral mRNA contains internal N6-methyladenosine and 5'-terminal 7-methylguanosine in cap structures. Journal of Virology. 1976;20:45–53. doi: 10.1128/jvi.20.1.45-53.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] Kutluay SB, Zang T, Blanco-Melo D, Powell C, Jannain D, Errando M, Bieniasz PD. Global changes in the RNA binding specificity of HIV-1 gag regulate virion genesis. Cell. 2014;159:1096–1109. doi: 10.1016/j.cell.2014.09.057. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] Lavender CA, Gorelick RJ, Weeks KM. Structure-based alignment and consensus secondary structures for three HIV-related RNA genomes. PLoS Computational Biology. 2015;11:e1004230. doi: 10.1371/journal.pcbi.1004230. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] Lichinchi G, Gao S, Saletore Y, Gonzalez GM, Bansal V, Wang Y, Mason CE, Rana TM. Dynamics of the human and viral m6A RNA methylomes during HIV-1 infection of T cells. Nature Microbiology. 2016;1:16011. doi: 10.1038/nmicrobiol.2016.11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nature Chemical Biology. 2014;10:93–95. doi: 10.1038/nchembio.1432. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] Liu N, Dai Q, Zheng G, He C, Parisien M, Pan T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature. 2015;518:560–564. doi: 10.1038/nature14234. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib20] Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012;149:1635–1646. doi: 10.1016/j.cell.2012.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] Moir S, Chun TW, Fauci AS. Pathogenic mechanisms of HIV disease. Annual Review of Pathology. 2011;6:223–248. doi: 10.1146/annurev-pathol-011110-130254. [DOI] [PubMed] [Google Scholar]

[bib22] Ping XL, Sun BF, Wang L, Xiao W, Yang X, Wang WJ, Adhikari S, Shi Y, Lv Y, Chen YS, Zhao X, Li A, Yang Y, Dahal U, Lou XM, Liu X, Huang J, Yuan WP, Zhu XF, Cheng T, Zhao YL, Wang X, Rendtlew Danielsen JM, Liu F, Yang YG. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Research. 2014;24:177–189. doi: 10.1038/cr.2014.3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] Rossio JL, Esser MT, Suryanarayana K, Schneider DK, Bess JW, Vasquez GM, Wiltrout TA, Chertova E, Grimes MK, Sattentau Q, Arthur LO, Henderson LE, Lifson JD. Inactivation of human immunodeficiency virus type 1 infectivity with preservation of conformational and functional integrity of virion surface proteins. Journal of Virology. 1998;72:7992–8001. doi: 10.1128/jvi.72.10.7992-8001.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] St Gelais C, de Silva S, Hach JC, White TE, Diaz-Griffero F, Yount JS, Wu L. Identification of cellular proteins interacting with the retroviral restriction factor SAMHD1. Journal of Virology. 2014;88:5834–5844. doi: 10.1128/JVI.00155-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] St Gelais C, Roger J, Wu L. Non-POU domain-containing octamer-binding protein negatively regulates HIV-1 infection in CD4(+) T cells. AIDS Research and Human Retroviruses. 2015;31:806–816. doi: 10.1089/aid.2014.0313. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] Supek F, Bošnjak M, Škunca N, Šmuc T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS One. 2011;6:e21800. doi: 10.1371/journal.pone.0021800. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib27] van Hemert F, van der Kuyl AC, Berkhout B. On the nucleotide composition and structure of retroviral RNA genomes. Virus Research. 2014;193:16–23. doi: 10.1016/j.virusres.2014.03.019. [DOI] [PubMed] [Google Scholar]

[bib28] Wang JH, Janas AM, Olson WJ, KewalRamani VN, Wu L. CD4 coexpression regulates DC-SIGN-mediated transmission of human immunodeficiency virus type 1. Journal of Virology. 2007;81:2497–2507. doi: 10.1128/JVI.01970-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib29] Wang JH, Wells C, Wu L. Macropinocytosis and cytoskeleton contribute to dendritic cell-mediated HIV-1 transmission to CD4+ T cells. Virology. 2008;381:143–154. doi: 10.1016/j.virol.2008.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] Wang X, He C. Reading RNA methylation codes through methyl-specific binding proteins. RNA Biology. 2014;11:669–672. doi: 10.4161/rna.28829. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T, He C. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014;505:117–120. doi: 10.1038/nature12730. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H, He C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell. 2015;161:1388–1399. doi: 10.1016/j.cell.2015.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] Watts JM, Dang KK, Gorelick RJ, Leonard CW, Bess JW, Swanstrom R, Burch CL, Weeks KM. Architecture and secondary structure of an entire HIV-1 RNA genome. Nature. 2009;460:711–716. doi: 10.1038/nature08237. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] Wilkinson KA, Gorelick RJ, Vasa SM, Guex N, Rein A, Mathews DH, Giddings MC, Weeks KM. High-throughput SHAPE analysis reveals structures in HIV-1 genomic RNA strongly conserved across distinct biological states. PLoS Biology. 2008;6:e96. doi: 10.1371/journal.pbio.0060096. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] Wu L, Martin TD, Carrington M, KewalRamani VN. Raji B cells, misidentified as THP-1 cells, stimulate DC-SIGN-mediated HIV transmission. Virology. 2004;318:17–23. doi: 10.1016/j.virol.2003.09.028. [DOI] [PubMed] [Google Scholar]

[bib36] Yue Y, Liu J, He C. RNA N6-methyladenosine methylation in post-transcriptional gene expression regulation. Genes & Development. 2015;29:1343–1355. doi: 10.1101/gad.262766.115. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] Zheng G, Dahl JA, Niu Y, Fedorcsak P, Huang CM, Li CJ, Vågbø CB, Shi Y, Wang WL, Song SH, Lu Z, Bosmans RP, Dai Q, Hao YJ, Yang X, Zhao WM, Tong WM, Wang XJ, Bogdan F, Furu K, Fu Y, Jia G, Zhao X, Liu J, Krokan HE, Klungland A, Yang YG, He C. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Molecular Cell. 2013;49:18–29. doi: 10.1016/j.molcel.2012.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature. 2015;526:591–594. doi: 10.1038/nature15377. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

N6-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression

Nagaraja Tirumuru

Boxuan Simen Zhao

Wuxun Lu

Zhike Lu

Chuan He

Li Wu

Roles

Abstract

eLife digest

Introduction

Results

HIV-1 RNA genome contains m6A modifications

Figure 1. HIV-1 RNA contains m6A modifications and YTHDF1–3 proteins bind to m6A-modified HIV-1 RNA.

Figure 1—figure supplement 1. HIV-1 RNA contains m6A modifications.

Figure 1—figure supplement 2. Quantification of HIV-1 RNA m6A level using liquid chromatography-mass spectrometry.

Figure 1—figure supplement 3. Distribution of m6A in cellular RNAs and the frequency of m6A motifs in HIV-1-infected cells.

Figure 1—figure supplement 4. Gene ontology (GO) analysis of m6A-modified cellular genes in HIV-1 infected cells.

Distribution of m6A in the cellular RNAs and gene ontology (GO) analysis of m6A-modified cellular genes

YTHDF1–3 proteins bind to HIV-1 gRNA in infected cells

YTHDF1–3 proteins negatively regulate HIV-1 post-entry infection

Figure 2. YTHDF1–3 proteins negatively regulate post-entry HIV-1 infection in HeLa cells.

Figure 3. YTHDF1–3 proteins negatively regulate post-entry HIV-1 infection in CD4+ T-cells.

YTHDF1–3 proteins inhibit HIV-1 infection by blocking viral reverse transcription

Figure 4. YTHDF1–3 proteins inhibit post-entry HIV-1 infection by blocking viral reverse transcription.

Figure 4—figure supplement 1. YTHDF1–3 proteins negatively regulate HIV-1 gag mRNA expression.

YTHDF1–3 proteins are associated with HIV-1 gRNA and lead to degradation of viral RNA

Figure 5. YTHDF1–3 proteins bind to HIV-1 gRNA in infected cells.

The m6A writers and erasers affect HIV-1 Gag expression in virus- producing cells

Figure 6. The m6A writers and erasers affect HIV-1 Gag expression in virus-producing cells.

Discussion

Figure 7. Proposed mechanisms and dynamics of m6A modification of HIV-1 RNA in regulating viral infection in cells.

Materials and methods

Cell culture

Cell proliferation assay

Plasmids and shRNA- and siRNA-mediated gene silencing

Table 1.

Table 2.

HIV-1 infection assays

m6A-seq

Quantification of HIV-1 RNA m6A level using liquid chromatography-mass spectrometry (LC-MS/MS)

Quantitative PCR and RT-PCR

Table 3.

Antibodies and immunoblotting

Immunoprecipitation and RNA isolation

CLIP-seq

Measurement of the kinetics of HIV-1 RNA in infected cells

GO analysis

Statistical analysis

Data deposition and access

Acknowledgements

Funding Statement

Funding Information

Additional information

Competing interests

Author contributions

Additional files

Major datasets

References

Decision letter

Roles

Author response

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

N⁶-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression

HIV-1 RNA genome contains m⁶A modifications

Figure 1. HIV-1 RNA contains m⁶A modifications and YTHDF1–3 proteins bind to m⁶A-modified HIV-1 RNA.

Figure 1—figure supplement 1. HIV-1 RNA contains m⁶A modifications.

Figure 1—figure supplement 2. Quantification of HIV-1 RNA m⁶A level using liquid chromatography-mass spectrometry.

Figure 1—figure supplement 3. Distribution of m⁶A in cellular RNAs and the frequency of m⁶A motifs in HIV-1-infected cells.

Figure 1—figure supplement 4. Gene ontology (GO) analysis of m⁶A-modified cellular genes in HIV-1 infected cells.

Distribution of m⁶A in the cellular RNAs and gene ontology (GO) analysis of m⁶A-modified cellular genes

Figure 3. YTHDF1–3 proteins negatively regulate post-entry HIV-1 infection in CD4⁺ T-cells.

The m⁶A writers and erasers affect HIV-1 Gag expression in virus- producing cells

Figure 6. The m⁶A writers and erasers affect HIV-1 Gag expression in virus-producing cells.

Figure 7. Proposed mechanisms and dynamics of m⁶A modification of HIV-1 RNA in regulating viral infection in cells.

m⁶A-seq

Quantification of HIV-1 RNA m⁶A level using liquid chromatography-mass spectrometry (LC-MS/MS)