Abstract
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway.
Introduction
Upland cotton (Gossypium hirsutum L.) is an important economic crop worldwide and occupies a vital position in the global economy as its fibers are the most important plant materials for the textile industry [1]. Cotton fiber develops from the seed coat as a single epidermal cell, and the process of fiber development can be divided into four overlapping stages: initiation, elongation, secondary wall deposition and maturation [2]. The plant hormone auxin performs a decisive function in fiber development by regulating extracellular oxidative signals that affect cell wall configuration [3–5].
As a member of a small multigene family of multicopper oxidases, ascorbate oxidase (AO; EC 1.10.3.3) catalyzes the oxidation of ascorbic acid (AA) to dehydroascorbate (DHA), thereby generating oxidative signals in apoplasts [6–8]. DHA is an important oxidative molecule in apoplasts, and many studies have suggested that the oxidative signal catalyzed by AO plays a crucial role in cell elongation and enlargement [9]. AO is strongly expressed in the stretch expanded fruit of cucurbitaceous plants, including cucumber, pumpkin and melon. In pumpkin, AO expression is promptly increased during callus growth, fruit development and seedling elongation [9,10]. AO is also abundantly expressed in the young and growing tissues of tobacco [6,11].
Auxin signal transduction is closely associated with the apoplast redox state, which is modulated by AO. An auxin-binding protein (ABP1) present on the apoplast crosses the plasmalemma and is crucial for auxin-induced responses, and auxin responsiveness can be suppressed when there is an excess of oxidized ascorbate in apoplasts [12,13]. Auxin generates an abundance of oxidative signals through a comprehensive network in which AO might serve indispensable functions [9]. In plants, a flexible redox equilibrium in the apoplast is a key signal for determining plant cell sensing, transducing external environmental changes and activating hormone signal pathways [13]. Oxidative signals include oxygen-containing molecules, such as ROS, and non-oxygen-containing molecules, such as DHA, and both auxin and ROS signals play important roles in the fast elongation development of cotton fibers [3,13,14]; however, the precise mechanism underlying this process remains obscure.
Previously, we reported that cotton ascorbate peroxidase is closely associated with fiber elongation development in response to ROS and ethylene [14]. In the present study, the promoter of an ascorbate oxidase gene, GhAO1, was obtained. The promoter effectively drove the expression of GUS and GFP in tobacco trichomes. Functional sequences within the GhAO1 promoter were uncovered using serial 5’-end deletion. The GhAO1 promoter contains an auxin-responsive cis-acting element (TGA-element) and shows induced activity under IAA treatment. We concluded that the GhAO1 promoter is a functional sequence potentially involved in fiber development via the auxin-signaling pathway.
Materials and Methods
Growth of plants and material harvest
Upland cotton (Gossypium hirsutum L. cv. Xuzhou 142) seeds, tobacco (Nicotiana benthamiana) seeds, Escherichia coli strain DH5α, pCAMBIA1304 plasmid and Agrobacterium tumefaciens strain GV3101 were used in the present study and were maintained at the Key laboratory of Agrobiotechnology of Shihezi University. Cotton and tobacco plants were grown in a greenhouse at 28°C with a natural photoperiod.
Cloning of GhAO1 promoter
The cotton genomic DNA used for genome walking was isolated as described method [15]. Genome walking was performed to isolate the GhAO1 promoter region using a TAIL-PCR method and the Genome Walking kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The random primers were improved according to a previous study [16], and the three specific primers (SP1, SP2 and SP3) listed in Table 1 were designed using the GhAO1 cDNA sequence (GenBank Accession number: KT794559).
Table 1. Primers used in the present study.
| Primer name | Primer sequence |
|---|---|
| Isolation of GhAO1 promoter | |
| LAD | ACGATGGACTCCAGAGCGGCCGCNNNCGGT |
| AC1 | ACGATGGACTCCAGAG |
| SP1 | GTATTCGAAAGCCTCTCCTGGGT |
| SP2 | CAGTGAATGACAACTCCCTCGGT |
| SP3 | CTCCGTACGTGTATTCCACTTCC |
| Vector construction* | |
| P-1920-Foward | CGGGATCCTGTGCTTTATCAACTCATTGA |
| P-1600-Foward | CGGGATCCCAACTCATGAA GTTAAAAAAA |
| P-1320-Foward | CGGGATCCGCACCTCCATTACTAATTATT |
| P-1040-Foward | CGGGATCCTAAAATTAATTGATCTGATTT |
| P-720-Foward | CGGGATCCATCTATTACCACAATTTTACA |
| P-360-Foward | CGGGATCCATCTAATCCCAGTTCATTTGT |
| FP-Reverse | GAAGATCTGTTTCAGTACGTAAAACCAGG |
| RT-PCR | |
| GaAO-Foward | GAGTCAGTGAGCGAGGAAGCG |
| GaAO-Reverse | CCCTGGAACCCCAAGATTTA |
| GrAO-Foward | ATGGGGATGGGGGTTATTTT |
| GrAO-Reverse | CAGTCTCTCAGTTCTGCTTGTTTC |
| UBQ7-Foward | GAAGGCATTCCACCTGACCAAC |
| UBQ7-Reverse | CTTGACCTTCTTCTTCTTGTGCTTG |
* Restriction sites of BamH I in forward primers and Bgl II in reverse primers were underlined.
The extracted genomic DNA was subjected to pre-amplification using the primers LAD and SP1, and the product was subsequently diluted and used as a template in primary TAIL-PCR using the primer pairs AC1 and SP2. After secondary TAIL-PCR using the diluted primary TAIL-PCR product as a template and the primers AC1 and SP3, the amplified products were analyzed on 1.0% agarose gels, and single fragments were isolated from the gels and purified using a DNA purification kit. A ~2000-bp fragment was ligated to pMD19-T vector and transformed into E. coli for sequencing. The PLANTCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) was used to identify potential cis-regulatory elements within the promoter.
Construction of the expression vector
A 1,920 bp fragment (pGhAO1) upstream of the translational start codon of the GhAO1 gene and 5'-truncated promoter sequences were obtained by PCR using a single reverse primer and different forward primers (listed in Table 1) carrying BamH I and a Bgl II restriction sites. The amplified fragments were inserted upstream of the GUS gene coding region of the plasmid pCAMBIA 1304 (Clontech) as BamH I-Bgl II fragments at the corresponding restriction sites, replacing the cauliflower mosaic virus (CaMV) 35S promoter, producing a series of pGhAO1::GFP-GUS vectors, namely P-1920 (-1920/-1, 1920 bp), P-1760 (–1760/-1, 1760 bp), P-1600 (-1600/-1, 1600 bp), P-1320 (-1320/-1, 1320 bp), P-1040 (-1040/-1, 1040 bp), P-720(-720/-1, 720 bp), and P-360(-360/-1, 360 bp). After verification by sequence analysis, the confirmed constructs were used to determine the promoter activity in transgenic tobacco plants.
Transformation of tobacco plants
The eukaryotic expression vector pGhAO1::GFP-GUS (P1920) was introduced into A. tumefaciens GV3101 using a freeze-thaw method. Transgenic tobacco plants were generated using an agrobacterium-mediated leaf disk transformation regeneration method [17]. The transformed tobacco plants were selected on MS medium supplemented with 250 mg/L of carbenicillin disodium and 30 mg/L of hygromycin, and hormone-free MS medium containing 250 mg/L of carbenicillin disodium was used for plant regeneration. The identified transgenic plants were transferred to soil for blossom growth and seed bearing. All plants were grown in the greenhouse at 26°C with a 16 h light/8 h dark cycle. The constructed vectors were transformed into tobacco leaves using the transient transformation method [18], and the generated transgenic leaves were utilized for GUS activity analyses.
Histochemical GUS staining and GUS activity quantification
Histochemical localization and GUS enzyme activity were determined as previously described [19]. Plant tissues, including the leaves and roots of 6–7 week-old transgenic tobacco seedlings, were immersed in GUS staining buffer with successive incubation overnight at 37°C and de-staining in ethanol. X-gluc was dissolved in dimethyl sulfoxide (DMSO) and diluted 20-fold in substrate solution. The images were obtained using a microscope (Olympus,Japan). Fluorometric analysis of GUS activity was performed using 4-methylumbelliferyl-b-glucuronide (4-MUG) as a substrate. The extracted proteins from transgenic leaf samples were mixed with GUS assay buffer (2 mM 4-MUG, 50 mM sodium phosphate buffer pH 7.0, 10 mM β-mercaptoethanol, 10 mM Na2EDTA, 0.1% sodium lauroyl sarcosine, and 0.1% Triton X-100). The protein concentration was determined using the Bradford protein assay. The reaction was held at 37°C and terminated upon the addition of stop buffer (0.2 M Na2CO3). GUS activity was determined in triplicate based on the detection of 4-methylumbelliferone fluorochrome (4-MU) generated by the GUS-mediated catalysis of 4-MUG hydrolysis using a fluorescence spectrophotometer with an excitation wavelength of 365 nm and an emission wavelength of 455 nm. The GUS activity was defined as pmol of 4-methylumbelliferone per mg protein per min.
GFP localization
The leaves of 6–7 week-old transgenic tobacco plants were selected for the analysis of GFP localization. A confocal laser-scanning microscope (Zeiss LSM510, Germany) was used to monitor GFP localization. A laser at the wavelength of 488 nm was used to activate GFP fluorescence.
IAA treatment
The transgenic tobacco leaves transformed using a transient expression method were grown in an artificial climate incubator for 6–7 weeks on MS medium, and subsequently placed under a white fluorescent lamp for 1 h with successive inoculation at 25°C in MS medium with or without 1 mg/L IAA treatment for 2 days; the resultant materials were used for further GUS activity analysis.
Results
Sequence analysis of the GhAO1 promoter
We obtained an ascorbate oxidase gene GhAO1 (GenBank accession number: KT794559) from fast elongating fiber tissues previously. GhAO1 was specifically accumulated during fiber fast elongation development stages (5–20 dpa) in widetype (WT) cotton ovules associated with fibers compared with 10-dpa fuzzless-lintless (fl) mutant ovules, both at mRNA level and enzyme activity (S1 Fig). With reference to the cDNA sequence of GhAO1, a 1,920-bp sequence upstream of the coding region was isolated using the genome walking method. Sequence analysis using the online program PLACE (http://dna.affrc.go.jp/PLACE) revealed that a number of putative plant cis-elements were present. As shown in Fig 1, two TATA-boxes were identified, at the -74 and -181 bp sites, and seven CAAT-boxes were identified, at the -282, -315, -486, -548, -1,192, -1,739 and -1,747 bp positions. Some hormone-related elements were also recognized, including the auxin-responsive element (TGA-element: AACGAC) and abscisic acid responsive regulatory motif (ABRE: CGTACGTGCA). Light-responsive elements, such as the I-box (ATGATATGA), MRE (MYB binding site: AACCTAA) and G-box (CACGTT), were also observed. For tissue- or developmental stage-specific motifs, two Skn-1 motifs (endosperm expression: GTCAT), one CAT-box motif (meristem expression: GCCACT) and three root motifs (root expression: ATATT) were explored. Heat responsive elements (HSEs) (TTTTAAA), MYB recognition sites containing an MBS (MYB binding sites) (TAACTG) and MYBCORE elements (AACGG) were also identified in the present study.
Fig 1. Analysis of the GhAO1 promoter sequence.
The translation start codon is indicated by a box. The putative TATA-box and CAAT-box are indicated by shading, and the CAT-box, Skn-1 motifs, root motifs, MYB recognition sites, G-box, ARE, TGA-element, ABRE and HSE are indicated by underlining.
GhAO1 promoter activity analysis
To evaluate the activity of the GhAO1 promoter, pGhAO1::GFP-GUS was constructed and transformed into tobacco by an agrobacterium-mediated leaf disk method, and materials of identified transgenic tobacco plants were used for activity analysis. The activity of the integrated GhAO1 promoter, detected by histochemical GUS staining, showed that leaf epidermal hairs (Fig 2A and 2B), leaves (Fig 2C and 2D) and roots (Fig 2E and 2F) turned blue in transformed tobacco plants, indicating that the GhAO1 promoter markedly drives GUS expression. The green fluorescence of transformed tobacco leaves was detected using a fluorescence microscope (Fig 3), revealing that the GhAO1 promoter effectively activates reporter gene GFP expression in tobacco. The results demonstrated that the GhAO1 promoter is an integral functional sequence.
Fig 2. Histochemical staining of GUS in transgenic tobacco plants expressing pGhAO1::GFP-GUS.

(A) Hair from the leaf epidermis of non-transgenic tobacco plants. (B) Hair from the leaf epidermis of transgenic tobacco plants. (C) Representative leaf from non-transgenic tobacco plants; (D) Representative leaf from transgenic tobacco plants. (E) Representative root from non-transgenic tobacco plants. (F) Representative root from transgenic tobacco plants. Bars = 10 μm (in A, B), 50 μm (in C, D) and 100 μm (in E, F).
Fig 3. Fluorescence detection of GFP expression by transgenic tobacco leaves.
The leaves of pGhAO1::GFP-GUS transgenic tobacco plants were used to determine GFP expression (bright field, fluorescence and merged images). The GFP signals were detected by fluorescence microscopy.
Functional analysis of the regulatory regions of the GhAO1 promoter
To determine the activity of the various regulatory regions of the GhAO1 promoter, a series of 5’-deletion constructs of the promoter region were fused with the GUS gene to obtain GhAO1 promoter-GUS chimeric genes, in accordance with the schematic shown in Fig 4A. The promoter activities of P-360, P-720, P-1040, P-1320, P-1600, P-1760, and P-1920 were significantly higher than that of the control (Fig 4B). The GUS activity of P-720 was approximately 2-fold higher than that of P-1040, indicating that the 320-bp region from nucleotides -720 to -1040 bp might include at least one cis-element that acts as a silencer.
Fig 4. Promoter activity analysis of the GhAO1 promoter and 5’-deletion constructs.
Different constructs were transformed into tobacco, and GUS activity was assayed. (A) Schematic presentation of the 5’-deletion constructs. The full-length and truncated fragments were fused to the GFP-GUS gene, generating the constructs P-1920, P-1760, P-1600, P-1320, P-1040, P-720, and P-360. (B) Quantitative analysis of the GUS activity of the constructs. The promoter activity was determined in transgenic tobacco leaves transformed with the different constructs. The specific GUS activity was determined as the rate of 4-methylumbelliferyl β-D-glucuronide conversion to 4-methylumbelliferone (pmol mg protein-1 min-1). The data are presented as the average of three independent experiments.
IAA response analysis of the GhAO1 promoter
Previous studies have demonstrated that transcription of the AO gene is induced by auxin. The GhAO1 promoter contains an auxin-responsive cis-acting element (TGA-element). To confirm the relationship between the regulatory region of the cotton GhAO1 promoter and auxin, a series of 5’-end deletion constructs designed to contain or not contain the auxin-responsive cis-acting element were transformed into tobacco leaf tissues, and the obtained transgenic tobacco leaves were incubated in Murashige-Skoog (MS) medium with or without 1 mg/L IAA at 25°C for 2 days. The GUS activity of these transformed leaf tissues was measured using non-DNA transformants as controls. In control leaf tissues, almost no GUS activity was detected, whereas higher GUS activity was measured in all transformed leaf tissues, regardless of IAA treatment. There were no obvious differences in the GUS activity in the P-360, P-720, P-1040, P-1320 and P-1600 transformants, which did not contain the auxin-responsive cis-acting element, under water or IAA treatment. Interestingly, in the P-1920 and P-1760 transformants, containing the auxin-responsive cis-acting element, the GUS activity in leaf tissue incubated in the presence of 1 mg/L IAA was approximately 3- to 4-fold higher than in the absence of 1 mg/L IAA. Furthermore, this GUS activity was approximately 6-fold higher than that in the non-DNA transformed control (Fig 5). However, the increased GUS activity induced by IAA disappeared in the P-1600 transformant and shorter construct transformants, indicating that the fragment from -1760 to -1600 bp, containing the cis-acting auxin responsive element, is functional.
Fig 5. Promoter activity analysis of serial 5’-deletion constructs of the GhAO1 promoter under IAA treatment.
Various 5’-deletion constructs were transformed into tobacco leaf discs (1.5 cm diameter) using the agrobacterium-mediated transient transformation method. Discs of tobacco leaf tissue were incubated in MS medium with or without 1 mg/L IAA and incubated at 25°C for 2 d. Then, the quantitative analysis of GUS activity was spectrophotometrically measured. The GUS activity of non-DNA transformants (control) was also investigated. The white columns show GUS activity under normal treatment, and the black columns show GUS activity under IAA treatment. Each value represents the mean of the results from three independent experiments, and the bars indicate standard deviations.
Sequence analysis of AO promoter and expression pattern of AO gene in Gossypium arboreum (Ga), Gossypium raimondii (Gr), and Gossypium hirsutum (Gh)
Sequence analysis and RT-PCR were performed to investigate the linear structure of the AO promoter and the expression pattern of the AO gene in Ga, Gr and Gh. The 1,920-bp GhAO1 promoter matched the 5485295–5487167 genome region of chromosome 8 in Gr (almost 100% identity, with a 30-bp gap at -1623 bp); the 89397689–89400248 genome region of chromosome 3 in Ga (with a 950-bp region, instead of the 285-bp region from -1502 to -1787); the 23773–25242 genome region of scaffold 4497.1 (missing -1503 to -1920, a potential component of the Dt sub-genome) in Gh; and the 76757247–76773171 genome region of At chromosome 10 (with a 15924-bp gap, instead of the 161-bp region from -801 to -962 bp of the GhAO1 promoter) in Gh (Fig 6A). Gaps were detected in both the A genome (Ga) and At sub-genome (Gh), while high identities were observed in the D genome (Gr) and Dt sub-genome (Gh), indicating that the GhAO1 gene from the D or Dt genome was activated. The 950 and 15924-bp gaps might dramatically reduce the expression of the AO gene from the A or At genome in both Ga and Gh, according to the functional analysis of the regulatory region of the GhAO1 promoter (Fig 4). Furthermore, the expression patterns of the AO gene from the D and A genomes were examined using RT-PCR. Primers specific for the AO sequences from genomes A and D were used to amplify both DNA and cDNA templates. The PCR products obtained using the GaAO-specific primers were detected only with the Ga and Gh DNA templates, while no bands were observed for any of the cDNA templates (Fig 6B). For the GrAO primers, the products were not only amplified from DNA templates but also from cDNA templates (both Gr and Gh), suggesting that the GhAO1 promoter from the D genome/sub-genome was activated (Fig 6B). Our results indicate that the sequence containing the auxin responsive element might be a key regulator of promoter-driven expression and transcriptional regulation of the GhAO1 gene.
Fig 6. Comparison of the GhAO1 promoter region and GhAO1 expression patterns in Ga, Gr and Gh cotton.
(A) Sequence structure of the GhAO1 promoter regions in the At, Dt, A and D genomes. A 30-bp gap was detected in Gr (D genome) at -1623 bp. A 950 bp fragment replaced the 284 bp (from -1502 to -1787 bp) region of the GhAO1 promoter in Ga (A genome). In the tetraploid cotton Gh, two copies of the GhAO1 promoter were detected in the At and Dt genomes. The 418-bp of the 5’ region of the GhAO1 promoter is missing in the Dt sub-genome, while a 15924 bp gap replaces the 160 bp (from -801 to 962 bp) region of the GhAO1 promoter. Yellow, homologous regions; red, substituted sequences; dashed line, gaps. The start codons are framed and labeled in red. (B) The expression patterns of GaAO and GrAO transcripts from the DNA and cDNA templates of Ga, Gr and Gh cotton plants. The primers were specifically designed for GaAO amplification from Ga and Gh DNA templates, while the primers specifically designed for GrAO were designed for PCR amplification from DNA and cDNA templates. GhUBQ7 was used as a reference gene. Template materials were extracted from 10-d post-anthesis fibers. The primers used in the present study are listed in Table 1.
Discussion
Ascorbate oxidase plays important roles in redox state maintenance and oxidative burst generation in apoplasts, thereby controlling cell division and expansion. AO is highly expressed in fast-growing organs, indicating a direct link between AO and cell development through regulating redox balance regulation of the apoplast [18]. However, the mechanisms for the regulation of apoplastic AO expression and the promotion of cell growth remain unclear. In the present study, we isolated the promoter of the cotton GhAO1 gene to investigate the regulation of GhAO1. Sequence analysis showed that the promoter region contains some typical plant cis-elements important for GhAO1 transcriptional regulation (Fig 1); these might affect cell growth by modulating GhAO1 gene expression.
AO cDNAs have been isolated from many plants, such as cucumber, pumpkin, tobacco, and melon [11,20–23]. Although the consequences of cell elongation in AO overexpressing tobacco plants (via increased AO enzyme activity and DHA concentration) have been thoroughly examined [6,24], there are few studies concerning the AO promoter sequence and the transcriptional regulation of this gene. Kisu et al. described a pumpkin AO promoter and analyzed the transient expression in pumpkin fruit tissues after fusing the promoter to the β-glucuronidase reporter gene [25].
The GhAO1 promoter contains classical eukaryotic elements, such as a TATA-box and CAAT-box, for transcription initiation. In addition, some plant transcription factor binding sites were observed, including MYB and HSE (Fig 1). The significant roles of the transcription factor MYB and heat shock proteins in cotton fiber development have been explored [26–29], suggesting that MYB and heat stress play roles in the regulation of GhAO1 expression. In addition, some light responsive elements, such as the G-box and I-box (Fig 1), were also identified, indicating that GhAO1 might be a light modulated gene. Similar studies have demonstrated that AO expression is light dependent in tobacco [6, 30]. Moreover, root- and meristem-specific expression elements have also been identified, including root motifs and CAT-box sequences, respectively (Fig 1), implying that GhAO1 might be involved in tissue and organ development. High AO activity has been detected in the root quiescent center (QC) and the stem cell niche [31].
GUS and GFP gene fusion is most commonly used as a reporter gene expression system to detect promoter activity, and 5’-deletion analysis is considered a useful method to determine the function of cis-elements of the promoter [32,33]. Promoter fusion constructs induce the effective and stable expression of the reporter gene GUS or GFP in transformed plants using transient expression methods [17–18]. In the present study, the pGhAO1::GFP-GUS fusion expression vector was constructed and transformed into tobacco leaves, demonstrating that the promoter of the GhAO1 gene could significantly drive the expression of GUS and GFP based on GUS staining (Fig 2) and fluorescence detection (Fig 3) analyses, respectively. High GUS activity was observed in transformed tobacco leaves, whereas, less GUS activity was observed in transformed P-1040 tobacco leaves (Fig 4), suggesting that a silencer might be present and suppress promoter activity.
The promoters of several cotton genes highly expressed in fiber cells have been isolated, and the promoters of these genes, GhLTP6, GhLTP3, GhRGP1, and GhGlcAT1, have been examined in transgenic tobacco plants. The GhAO1 promoter was cloned from cotton, and activity validation was realized using transformed tobacco plants. Auxin promotes cell elongation through the generation of ROS, affecting cell wall composition and microtubule assembly [6]. The GhAO1 promoter contains an auxin responsive element at the -1,609 bp position (Fig 1), and a similar result has been reported for the pumpkin AO promoter, which contains a cis-acting region responsible for auxin regulation [25]. GhAO1 expression was induced by IAA treatment (Fig 5), consistent with the result reported for pumpkin [9]. The oxidation in apoplasts that is catalyzed by AO might lead to an absence of auxin-dependent reactions, resulting in plants insensitivity to IAA. These results suggest a potential link between auxin and the transcriptional regulation of AO expression, which are associated via the auxin responsive element. The overexpression of the AO gene in tobacco induces the accumulation of H2O2, increases MAPK enzyme activity and decreases plasmalemma-localized two-pore Ca2+ channel-associated gene (NtTPC1B) expression [18]. The functions of H2O2 and calcium ion signals in fiber elongation have previously been described [34–37].
Promoter sequence analysis showed that a gap in the A genome/sub-genome might inhibit the expression of GaAO by deactivating the promoter regions of the GaAO gene. The 950-bp substitution in the promoter region in the A genome between -1502 to -1787 bp is adjacent to the auxin response element, as determined based on a GUS reporter assay (Fig 5), suggesting that this region is important for the activity of the AO promoter. Furthermore, a 16-kb insertion in the At sub-genome in Gh from -801 to -962 bp might block transcription factor binding, resulting in the loss-of-function of the GaAO promoter in upland cotton (Fig 6A). We observed slight differences in both CDS and promoter regions of AO gene between the At sub-genome sequence and that of other sequences. This may potentially reflect variations between the cotton varieties used for genome sequencing (TM-1) and promoter cloning (Xuzhou 142). However, the mechanisms by which these insertions abrogate the activity of AO promoter in the A genome/sub-genome were not determined in the present study. Our results suggest a potential mechanism in which the GhAO1 promoter might be involved in cotton fiber cell growth via an auxin-mediated signaling pathway.
Supporting Information
Total RNA isolated from tissues of cotton ovules and fibers of various development stages were used for QRT-PCR analysis. The cotton ubiquitin gene, UBQ7 (Genbank accession no. AY189972) was used as the template control. Total AO enzyme activity was determined using samples prepared from the different growth stages indicated. The QRT-PCR and enzyme activity results were obtained from three independent experiments.
(JPG)
Data Availability
The accession number KT794559 mentioned in the manuscript, that is cotton ascorbate oxidase cDNA with full-length open reading frame, has been submitted to Genbank formerly.
Funding Statement
This work was supported by National Natural Science Foundation of China (Grant number 31260339), Germplasm resource innovation project of Bingtuan (Grant number 2012BB050), and Distinguished Youth innovation foundation of Bingtuan (Grant number 2014CD003). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Zhu YX, Li FG. The Gossypium raimondii genome, a huge leap forward in cotton genomics. J Integr Plant Biol. 2013. July;55(7):570–1. 10.1111/jipb.12076 [DOI] [PubMed] [Google Scholar]
- 2.John ME, Keller G. Metabolic pathway engineering in cotton: biosynthesis of polyhydroxybutyrate in fiber cells. Proc Natl Acad Sci U S A. 1996. November 12;93(23):12768–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Zhang M, Zheng XL, Song SQ, Zeng Q, Hou L, Li D, Zhao J, et al. Spatiotemporal manipulation of auxin biosynthesis in cotton ovule epidermal cells enhances fiber yield and quality. Nat Biotechnol. 2011. May;29(5):453–8. 10.1038/nbt.1843 [DOI] [PubMed] [Google Scholar]
- 4.Joo JH, Bae YS, Lee JS. Role of auxin-induced reactive oxygen species in root gravitropism. Plant Physiol. 2001. July;126(3):1055–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schopfer P, Liszkai A, Bechtold M, Frahry G, Wagner A. Evidence that hydroxyl radicals mediate auxin-induced extension growth. Planta. 2002. April;214(6):821–8. [DOI] [PubMed] [Google Scholar]
- 6.Pignocchi C, Fletcher J M, Wilkinson J E, Barnes J D, Foyer C H. The function of ascorbate oxidase in tobacco. Plant Physiol. 2003. July;132(3):1631–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Green MA, Fry SC. Vitamin C degradation in plant cells via enzymatic hydrolysis of 4- O-oxalyl-L-threonate. Nature. 2005. January 6;433(7021):83–7. [DOI] [PubMed] [Google Scholar]
- 8.Fotopoulos V, Sanmartin M, Kanellis AK. Effect of ascorbate oxidase over-expression on ascorbate recycling gene expression in response to agents imposing oxidative stress. J Exp Bot. 2006;57(14):3933–43. [DOI] [PubMed] [Google Scholar]
- 9.Esaka M, Fujisawa K, Goto M, Kisu Y. Regulation of ascorbate oxidase expression in pumpkin by auxin and copper. Plant Physiol. 1992. September;100(1):231–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Esaka M, Uchida M, Fukui H, Kubota K, Suzuki K. Marked increase in ascorbate oxidase protein in pumpkin callus by adding copper. Plant Physiol. 1988. November;88(3):656–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kato N, Esaka M. cDNA cloning and gene expression of ascorbate oxidase in tobacco. Plant Mol Biol. 1996. February;30(4):833–7. [DOI] [PubMed] [Google Scholar]
- 12.Barbier-Brygoo H, Ephritikhine G, Klämbt D, Ghislain M, Guern J. Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophyll protoplasts. Proc Natl Acad Sci U S A. 1989. February;86(3):891–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pignocchi C, Foyer CH. Apoplastic ascorbate metabolism and its role in the regulation of cell signaling. Curr Opin Plant Biol. 2003. August;6(4):379–89. [DOI] [PubMed] [Google Scholar]
- 14.Li HB, Qin YM, Pang Y, Song WQ, Mei WQ, Zhu YX. A cotton ascorbate peroxidase is involved in hydrogen peroxide homeostasis during fibre cell development. New Phytol. 2007;175(3):462–71. [DOI] [PubMed] [Google Scholar]
- 15.Li XB, Cai L, Cheng NH, Liu JW. Molecular Characterization of the Cotton GhTUB1 Gene That Is Preferentially Expressed in Fiber. Plant Physiol. 2002. October;130(2):666–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Liu Y-G, Chen Y. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. Biotechniques. 2007. November;43(5):649–50, 652, 654 passim. [DOI] [PubMed] [Google Scholar]
- 17.Sparkes IA, Runions J, Kearns A, Hawes C. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc. 2006;1(4):2019–25. [DOI] [PubMed] [Google Scholar]
- 18.Pignocchi C, Kiddle G, Hernandez I, Foster SJ, Asensi A, Taybi T, et al. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco. Plant Physiol. 2006. June;141(2):423–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Stomp AM. Histochemical localization of β-glucuronidase. GUS Protocols: Using the GUS gene as a Reporter of Gene Expression. Methods Mol Biol. 1992;103–113. 10.1385/0-89603-191-8:103 [DOI] [PubMed] [Google Scholar]
- 20.Ohkawa J, Okada N, Shinmyo A, Takano M. Primary structure of cucumber (Cucumis sativus) ascorbate oxidase deduced from cDNA sequence: homology with blue copper proteins and tissue-specific expression. Proc Natl Acad Sci U S A. 1989. February;86(4):1239–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ohkawa J, Ohya T, Ito T, Nozawa H, Nishi Y, Okada N, et al. Structure of the genomic DNA encoding cucumber ascorbate oxidase and its expression in transgenic plants. Plant Cell Rep. 1994. June;13(9):481–8. 10.1007/BF00232941 [DOI] [PubMed] [Google Scholar]
- 22.Esaka M, Hattori T, Fujisawa K, Sakajo S, Asahi T. Molecular cloning and nucleotide sequence of full-length cDNA for ascorbate oxidase from cultured pumpkin cells. ur J Biochem. 1990. August 17;191(3):537–41. [DOI] [PubMed] [Google Scholar]
- 23.Diallinas G, Pateraki I, Sanmartin M, Scossa A, Stilianou E, Panopoulos NJ, et al. Melon ascorbate oxidase: cloning of a multigene family, induction during fruit development and repression by wounding. Plant Mol Biol. 1997. July;34(5):759–70. [DOI] [PubMed] [Google Scholar]
- 24.Ioannidi E, Kalamaki MS. Expression profiling of ascorbic acid-related genes during tomato fruit development and ripening and in response to stress conditions. J Exp Bot. 2009;60(2):663–78. 10.1093/jxb/ern322 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kisu Y, Harada Y, Goto M, Esaka M. Cloning of the pumpkin ascorbate oxidase gene and analysis of a cis-acting region involved in induction by auxin. Plant Cell Physiol. 1997. May;38(5):631–7. [DOI] [PubMed] [Google Scholar]
- 26.Lee JJ, Woodward AW, Chen ZJ. Gene Expression Changes and Early Events in Cotton Fibre Development. Ann Bot. 2007. December;100(7):1391–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim HJ, Hinchliffe DJ, Triplett BA, Chen ZJ, Stelly DM, Yeater KM, et al. Phytohormonal networks promote differentiation of fiber initials on pre-anthesis cotton ovules grown in vitro and in planta. PLoS One. 2015. April 30;10(4):e0125046 10.1371/journal.pone.0125046 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang J, Sun N, Deng T, Zhang L, Zuo K. Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum). BMC Genomics. 2014. November 6;15:961 10.1186/1471-2164-15-961 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ding M, Jiang Y, Cao Y, Lin L, He S, Zhou W, Rong J. Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development. Gene. 2014. February 10;535(2):273–85. 10.1016/j.gene.2013.11.017 [DOI] [PubMed] [Google Scholar]
- 30.Fotopoulos V, Kanellis AK. Altered apoplastic ascorbate redox state in tobacco plants via ascorbate oxidase overexpression results in delayed dark-induced senescence in detached leaves. Plant Physiol Biochem. 2013. December;73:154–60. 10.1016/j.plaphy.2013.09.002 [DOI] [PubMed] [Google Scholar]
- 31.De Tullio MC, Guether M, Balestrini R. Ascorbate oxidase is the potential conductor of a symphony of signaling pathways. Plant Signal Behav. 2013. March;8(3):e23213 10.4161/psb.23213 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Cervera M. Histochemical and fluorometric assays for uidA (GUS) gene detection. Methods Mol Biol. 2005;286:203–14. [DOI] [PubMed] [Google Scholar]
- 33.Chen J, Burke JJ. Developing fiber specific promoter-reporter transgenic lines to study the effect of abiotic stresses on fiber development in cotton. PLoS One. 2015. June 1;10(6):e0129870 10.1371/journal.pone.0129870 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Qin YM, Hu CY, Zhu YX. The ascorbate peroxidase regulated by H(2)O(2) and ethylene is involved in cotton fiber cell elongation by modulating ROS homeostasis. Plant Signal Behav. 2008. March;3(3):194–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Qin YM, Zhu YX. How cotton fibers elongate: a tale of linear cell-growth mode. Curr Opin Plant Biol. 2011. February;14(1):106–11. 10.1016/j.pbi.2010.09.010 [DOI] [PubMed] [Google Scholar]
- 36.Tang W, He Y, Tu L, Wang M, Li Y, Ruan Y, L, Zhang X. Down-regulating annexin gene GhAnn2 inhibits cotton fiber elongation and decreases Ca2+ influx at the cell apex. Plant Mol Biol. 2014. August;85(6):613–25. 10.1007/s11103-014-0208-7 [DOI] [PubMed] [Google Scholar]
- 37.Gong W, He S, Tian J, Sun J, Pan Z, Jia Y, et al. Comparison of the transcriptome between two cotton lines of different fiber color and quality. PLoS One. 2014. November 17;9(11):e112966 10.1371/journal.pone.0112966 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Total RNA isolated from tissues of cotton ovules and fibers of various development stages were used for QRT-PCR analysis. The cotton ubiquitin gene, UBQ7 (Genbank accession no. AY189972) was used as the template control. Total AO enzyme activity was determined using samples prepared from the different growth stages indicated. The QRT-PCR and enzyme activity results were obtained from three independent experiments.
(JPG)
Data Availability Statement
The accession number KT794559 mentioned in the manuscript, that is cotton ascorbate oxidase cDNA with full-length open reading frame, has been submitted to Genbank formerly.





