Abstract
There is concern that susceptibility of Staphylococcus aureus to tetracyclines may decrease due to use of antimalarial prophylaxis (doxycycline). We examined characteristics related to tetracycline resistance, including doxycycline exposure, in S. aureus isolates collected via admission surveillance swabs and inpatient clinical cultures from United States military personnel injured during deployment (June 2009-January 2012). Tetracycline class resistance was determined using antimicrobial susceptibility testing. The first S. aureus isolate from 168 patients were analyzed, of which 38 (23%) isolates were resistant to tetracyclines (class). Tetracycline-resistant isolates had a higher proportion of resistance to clindamycin (p=0.019) compared to susceptible isolates. There was no significant difference in tetracycline resistance between isolates collected from patients with and without antimalarial prophylaxis; however, significantly more isolates had tet(M) resistance genes in the doxycycline exposure group (p=0.031). Despite 55% of the patients receiving doxycycline as antimalarial prophylaxis, there was no association with resistance to tetracyclines.
Keywords: Staphylococcus aureus, tetracyclines, antibiotic resistance
1.0 INTRODUCTION
Staphylococcus aureus is a widely prevalent pathogen associated with infections in hospitalized patients, in addition to generally healthy individuals (Boucher et al., 2009; Creech et al., 2010; Ellis et al., 2004; Klevens et al., 2007; Sievert et al., 2013; Tenover et al., 2006). One population that is frequently affected by both healthcare-associated (e.g., strain USA100) and community-associated (CA; e.g., strain USA300) S. aureus infections is the military. Specifically, skin and soft-tissue infections (SSTI) related to methicillin-resistant (MRSA) and methicillin-susceptible S. aureus (MSSA) are commonly reported among military trainees, non-deployed active-duty personnel, and deployed service members (Ellis et al., 2004, 2009; Landrum et al., 2012; Murray et al., 2009, 2010). An analysis of Army personnel undergoing training in the United States found that 3% and 28% of the soldiers were colonized with CAMRSA and CA-MSSA, respectively (Ellis et al., 2004). In addition, the rate of CA-MRSA and CA-MSSA SSTIs among TRICARE beneficiaries (2005-2010) was estimated at 82.7 and 59.2 per 100,000 person-years, respectively. Regarding hospital-associated SSTIs and bacteremia, the rate of MRSA and MSSA infections was 0.5 and 0.4 per 100,000 person-years, respectively (Landrum et al., 2012).
Along with being resistant to β-lactams, MRSA isolates may develop resistance to other broad-spectrum antimicrobial agents, such as tetracyclines (i.e., tetracycline, minocycline, and doxycycline) (Ardic et al., 2005; Han et al., 2007; Trzcinski et al., 2000). Two main mechanisms of tetracycline resistance through the acquisition of resistance genes (tet genes) have been described: active efflux due to energy-dependent efflux pumps associated with acquisition of plasmid-mediated tet(K) and tet(L) genes; and ribosomal protection involving elongation factor-like proteins, which are encoded by chromosomal or transposonal tet(M) and tet(O) genes (Leamer et al., 2013). Resistance to tetracycline in S. aureus is usually conferred by tet(K), while tetracycline class resistance is associated with tet(M) (Schwartz et al., 2009; Trzcinski et al., 2000). Among non-deployed military personnel, tetracycline resistance has been reported in up to 6% of CA-MRSA colonizing or pathogenic (i.e., linked to a SSTI) isolates (Ellis et al., 2009; Leamer et al., 2013). Furthermore, 5-18% of MRSA isolates collected from U.S. military personnel at combat support hospitals in Iraq have been tetracycline-resistant (Co et al., 2011; Huang et al., 2011; Murray et al., 2010).
Although tetracycline resistance among S. aureus isolates is presently low, there is the possibility that susceptibility may decrease due to use of doxycycline and minocycline to treat MRSA infections (Han et al., 2007; McDougal et al., 2010; Nurjadi et al., 2015; Ruhe and Menon, 2007; Schwartz et al., 2009). In particular, doxycycline has been shown to induce its own resistance in MRSA isolates carrying tet(K) (Schwartz et al., 2009). Furthermore, use of doxycycline as antimalarial prophylaxis is also a concern (Lesens et al., 2007; Vento et al., 2013). In accordance with U.S. Department of Defense (DoD) guidelines (Department of the Army 2013; Department of Defense, 2010, 2013), military personnel serving in Afghanistan are prescribed doxycycline or atovaquone/proquanil (Malarone®) (mefloquine is used if there are contraindications to primary antimalarials), which is initiated prior to entering the country and continued throughout deployment. Studies have indicated that compliance with primary antimalarial prophylaxis among deployed soldiers ranges from 38 to 61% (Brisson et al., 2012; Kotwal et al., 2005; Newton et al., 1994; Whitman et al., 2010). Moreover, 74% of military personnel wounded in Afghanistan and evacuated to Landstuhl Regional Medical Center (LRMC; Germany) were prescribed doxycycline by clinicians in order to comply with antimalarial prophylaxis guidelines (Rini et al., 2014). While prophylaxis is warranted when serving in malaria-endemic regions, there are unavoidable consequences of extensive use of doxycycline, including potential for increased tetracycline resistance among S. aureus.
A recent analysis compared data related to S. aureus colonization between active-duty military personnel who were stationed in the United States (non-deployed) and Afghanistan (deployed). The deployed personnel received doxycycline antimalarial prophylaxis, while non-deployed personnel were not administered any antibiotics within 30 days of S. aureus isolate collection. Although there was no significant difference in doxycycline susceptibility between the populations, a significantly higher proportion of S. aureus isolates collected from deployed personnel were resistant to tetracycline (Vento et al., 2013).
Among clinicians caring for combat wounded personnel, the occurrence of multidrug-resistant organisms presents challenges. Thus, the possibility of MRSA isolates acquiring resistance to tetracyclines is a concern. We examined characteristics related to tetracycline resistance in S. aureus isolates collected from military personnel wounded during the recent conflicts, including doxycycline antimalarial prophylaxis.
2.0 MATERIALS AND METHODS
2.1 Study Population and Demographics
The overarching project for this analysis is the Trauma Infectious Disease Outcomes Study (TIDOS), which is an ongoing observational cohort study of short- and long-term infectious complications among military personnel injured during deployment in Iraq and Afghanistan (Tribble et al., 2011). Trauma patients were eligible for inclusion in TIDOS if they were active-duty personnel or DoD beneficiaries, at least 18 years of age, and sustained deployment-related injuries requiring medical evacuation through LRMC before being transferred to a participating clinical facility in the United States, including National Naval Medical Center and Walter Reed Army Medical Center in the National Capital Region (merged to become Walter Reed National Military Medical Center after September 2011) and Brooke Army Medical Center (renamed San Antonio Military Medical Center after September 2011) in San Antonio, TX. A bacterial repository was also established to store isolates collected at LRMC and U.S. clinical facilities as a result of standardized admission screening and from clinical cultures.
Information related to trauma history and inpatient care was obtained through the DoD Trauma Registry (Eastridge et al., 2006) and supplemented by the TIDOS infectious disease module. S. aureus isolates were collected from surveillance swabs at admission (i.e., groin swabs and anterior nares cultures) and inpatient clinical cultures of wounded military personnel admitted between June 2009 and January 2012. Isolates were classified as surveillance, colonizing, or infecting. Surveillance isolates were collected from admission surveillance swabs. Colonizing isolates were collected from cultures that were not associated with an infection. Infecting isolates were collected as part of infection work-ups. While groin swabs and inpatient cultures were performed at all clinical facilities, nares cultures were only collected at the U.S. sites, and not LRMC. If patients had serially positive cultures that grew S. aureus, the first S. aureus isolate collected was utilized in the analysis. Doxycycline exposure was defined by receipt of the antibiotic after medical evacuation and prior to isolate collection.
2.2 Clinical Microbiology and Antimicrobial Susceptibility Testing
Isolates were defined as MRSA by demonstrating resistance to oxacillin or cefoxitin, along with detection of the mecA gene (Division of Healthcare Quality Promotion, 2016). Tetracycline class resistance was defined as resistance to tetracycline, doxycycline, and minocycline. Antimicrobial susceptibility was assessed using the BD Phoenix Automated Microbiology System (Becton, Dickinson and Company, Sparks, MD) per manufacturer guidelines utilizing PMIC/ID-106 and PMIC/ID-107 panels, and interpreted according to the Clinical Laboratory and Standards Institute criteria (Clinical Laboratory and Standards Institute, 2013).
Isolates were screened by PCR for the presence of tetracycline resistance genes [tet(K), tet(L), tet(M), and tet(O)]. Genomic DNA was extracted from overnight cultures utilizing the QIAamp DNA Mini Kit (Qiagen, Valencia, CA) following the manufacturers protocol. All PCRs were conducted using 5 PRIME MasterMix (5 PRIME Inc., Gaithersburg, MD) and 400 nM of each primer (Table 1). Amplifications of tet(K) and tet(M) genes were performed with the following parameters: 2 minutes at 94°C, 30 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 50 seconds, followed by a final extension at 72°C for 3 minutes. The tet(L) and tet(O) genes were amplified using the following conditions: 2 minutes at 94°C; 30 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 100 seconds, followed by a final extension at 72°C for 3 minutes.
Table 1.
PCR Oligonucleotide Primers for the Amplification of Tetracycline Resistance (tet) Genes
| Gene | Primer Sequence (5’-3’) | Product Size (bp) |
|---|---|---|
| tet(K) | F: TAGGGGGAATAATAGCACATT R: AATCCGCCCATAACAAATA |
613 |
| tet(L) | F: ATAAATTGTTTCGGGTCGGTAAT R: AACCAGCCAACTAATGACAATGAT |
1077 |
| tet(M) | F: GAACTCGAACAAGAGGAAAGC R: ATGGAAGCCCAGAAAGGAT |
740 |
| tet(O) | F: AGCGTCAAAGGGGAATCACTATCC R: CGGCGGGGTTGGCAAATA |
1723 |
F – phenylalanine; R – arginine
Using methods previously published (McDougal et al., 2003), pulsed-field gel electrophoresis was used to evaluate genotypic patterns amongst the S. aureus isolates. The resulting pulsed-field types (PFTs) were assessed using the commercial software BioNumerics (Applied Maths, Inc., Austin, TX) and clonality was evaluated per established criteria (McDougal et al., 2003; Tenover et al., 1995).
2.3 Statistical Analysis
Statistical analysis was performed using SPSS software (IBM SPSS Statistics version 22, Chicago, IL) and Cytel Studio Software (version 1.0, Chesterbrook, PA). Univariate analysis included chi-square, Fisher's exact test (Fisher-Freeman-Halton test with Monte Carlo as appropriate), and Mann-Whitney U test. Statistically significant variables related to doxycycline exposure were assessed for inclusion in a logistic regression multivariate analysis using stepwise selection (significance level of p=0.2). A p-value of <0.05 was considered significant.
3.0 RESULTS
3.1 Study Population
Between June 2009 and January 2012, 4051 U.S. wounded personnel were admitted to LRMC, of which half transferred to one of the participating clinical facilities in the United States. S. aureus isolates were collected from 168 patients who were utilized as the study population. In general, patients in the study population were young (median age: 24.5 years) men (99%) serving in the U.S. Army and Marines (66% and 27%, respectively) and wounded in military operations in Afghanistan (83%). The patients predominantly sustained a blast injury (69%) and were admitted to the intensive care unit (ICU) in the U.S. hospitals (46%). The median injury severity score, which is an overall measure of injury severity based on anatomical regional values (Linn, 1995), was 14 (moderate injuries).
3.2 Staphylococcus aureus Isolates
A total of 168 isolates were utilized in the analysis, of which 45 (27%), 47 (28%), and 76 (45%) were surveillance, colonizing, and infecting, respectively. Isolates were collected a median of 6 days post-injury (interquartile range [IQR]: 3-80 days). Among the isolates, 45 (27%) were MRSA and 38 (23%) were resistant to the tetracycline antimicrobial class.
3.2.1 Methicillin Resistance
Between the patients with MRSA and MSSA isolates (45 and 123, respectively), there was no significant difference in injury mechanism, injury severity score, ICU admission status, or facility where the isolate was collected, but there was a significant difference in the PFT profile (p<0.001; Table 2). A significantly higher proportion of MRSA isolates were surveillance and infecting (p=0.037). Moreover, while there was a significant difference in the distribution of enlisted versus warrant/officers between patients with MRSA and MSSA isolates (p=0.026), the majority of isolates in both groups were collected from enlisted personnel. A greater number of MRSA isolates were also resistant to other antimicrobials (i.e., clindamycin, levofloxacin, moxifloxacin, rifampin, and trimethoprim-sulfamethoxazole; p<0.001). There was no significant difference between the groups with regards to tetracycline resistance and doxycycline exposure.
Table 2.
Characteristics of United States Military Personnel Subjects with Methicillin-Resistant or Methicillin-Susceptible Staphylococcus aureus Isolates
| Characteristics, No (%)a | Total (N=168) | Patients with MRSA Isolates (N=45) | Patients with MSSA Isolates (N=123) | p-value |
|---|---|---|---|---|
| Male | 167 (99.4) | 44 (97.8) | 123 (100) | |
| Age, median year (IQR) | 24.5 (22.2-29.0) | 25.1 (22.1-30.4) | 24.0 (22.2-28.3) | 0.397 |
| Branch of Service | 0.929 | |||
| Army | 111 (66.1) | 29 (64.4) | 82 (66.7) | |
| Marine | 46 (27.4) | 13 (28.9) | 33 (26.8) | |
| Navy | 5 (3.0) | 1 (2.2) | 4 (3.3) | |
| Air Force | 4 (2.4) | 1 (2.2) | 3 (2.4) | |
| Other | 2 (1.2) | 1 (2.2) | 1 (0.8) | |
| Rank | 0.026 | |||
| Enlisted | 147 (87.5) | 37 (82.2) | 110 (89.4) | |
| Officer | 16 (9.5) | 3 (6.7) | 13 (10.6) | |
| Warrant | 3 (1.8) | 3 (6.7) | 0 | |
| Theater of Operation | 0.473 | |||
| Iraq | 24 (14.3) | 5 (11.1) | 19 (15.4) | |
| Afghanistan | 140 (83.3) | 39 (86.7) | 101 (82.1) | |
| Mechanism of Injury | 0.535 | |||
| Blast | 115 (68.5) | 33 (73.3) | 82 (66.7) | |
| Gunshot wound | 23 (13.7) | 4 (8.9) | 19 (15.4) | |
| Otherb | 30 (17.9) | 8 (17.8) | 22 (17.9) | |
| Initial Medical Facility | 0.834 | |||
| Mobile medical unit within combat zone | 51 (30.4) | 15 (33.3) | 36 (29.3) | |
| Hospital within combat zone | 107 (63.7) | 27 (60.0) | 80 (65.0) | |
| LRMC | 10 (5.9) | 3 (6.7) | 7 (5.7) | |
| Injury Severity Scorec, median (IQR) | 14 (9-24) | 18 (10-26) | 14 (9-24) | 0.158 |
| Intensive Care Unit admissiond | 0.470 | |||
| LRMC only | 24 (14.3) | 8 (17.8) | 16 (13.0) | |
| U.S. hospital ± LRMC | 77 (45.8) | 23 (51.1) | 54 (43.9) | |
| Non-ICU | 59 (35.1) | 13 (28.9) | 46 (37.4) | |
| Facility of Isolate Collection | 0.103 | |||
| LRMC | 54 (32.1) | 9 (20.0) | 45 (36.6) | |
| BAMC | 43 (25.6) | 15 (33.3) | 28 (22.8) | |
| National Capital Regione | 71 (42.3) | 21 (46.7) | 50 (40.7) | |
| Isolate Typef | 0.037 | |||
| Surveillance | 45 (26.8) | 14 (31.1) | 31 (25.2) | |
| Colonizing | 47 (28.0) | 6 (13.3) | 41 (33.3) | |
| Infecting | 76 (45.2) | 25 (55.6) | 51 (41.5) | |
| PFTs | <0.001 | |||
| USA100 | 9 (5.4) | 9 (20.0) | 0 | |
| USA200 | 17 (10.1) | 0 | 17 (13.8) | |
| USA300 | 28 (16.7) | 15 (33.3) | 13 (10.6) | |
| USA400 | 22 (13.1) | 4 (8.9) | 18 (14.6) | |
| USA500 | 8 (4.8) | 2 (4.4) | 6 (4.9) | |
| USA600 | 10 (6.0) | 0 | 10 (8.1) | |
| USA800 | 20 (11.9) | 6 (13.3) | 14 (11.4) | |
| USA900 | 9 (5.4) | 0 | 9 (7.3) | |
| USA1000 | 9 (5.4) | 3 (6.7) | 6 (4.9) | |
| MRSA other types | 6 (3.6) | 6 (13.3) | 0 | |
| MSSA other types | 30 (17.9) | 0 | 30 (16.3) | |
| Specimen Site | 0.077 | |||
| Nares | 30 (17.9) | 10 (22.2) | 30 (16.3) | |
| Groin | 15 (8.9) | 4 (8.9) | 11 (8.9) | |
| Respiratory | 56 (33.3) | 7 (15.6) | 49 (39.8) | |
| Blood | 5 (3.0) | 2 (4.4) | 3 (2.4) | |
| Urine | 3 (1.8) | 1 (2.2) | 2 (1.6) | |
| Wound | 57 (33.9) | 19 (42.2) | 36 (29.3) | |
| Other | 4 (2.4) | 2 (4.4) | 2 (1.6) | |
| Tetracycline Resistance Genes | 1.00 | |||
| tet(K) | 15 (8.9) | 4 (8.9) | 11 (8.9) | |
| tet(L) | 2 (1.2) | 0 | 2 (1.6) | |
| tet(M) | 24 (14.3) | 6 (13.3) | 18 (14.6) | |
| tet(O) | 0 | 0 | 0 | |
| None | 130 (77.4) | 36 (80.0) | 94 (76.4) | |
| Tetracycline Resistance | 0.941 | |||
| Doxycycline | 25 (14.9) | 5 (11.1) | 20 (16.3) | |
| Minocycline | 23 (13.7) | 5 (11.1) | 18 (14.6) | |
| Tetracycline | 38 (22.6) | 9 (20.0) | 29 (23.6) | |
| Other Antimicrobial Resistance | <0.001 | |||
| Clindamycin | 45 (26.8) | 21 (46.7) | 24 (19.5) | |
| Levofloxacin | 31 (18.5) | 27 (60.0) | 4 (3.3) | |
| Moxifloxacin | 31 (18.5) | 27 (60.0) | 4 (3.3) | |
| Rifampin | 2 (1.2) | 2 (4.4) | 0 | |
| Trimethoprim-Sulfamethoxazole | 9 (5.4) | 4 (8.9) | 5 (4.1) | |
| Doxycycline Exposure | 91 (54.2) | 28 (62.0) | 64 (52.0) | 0.240 |
BAMC – Brooke Army Medical Center; IQR – interquartile range; LRMC – Landstuhl Regional Medical Center; MRSA – methicillin-resistant Staphylococcus aureus; MSSA – methicillin-susceptible Staphylococcus aureus
Data are missing for some variables: rank is missing from two patients, intensive care unit admission from eight patients, and theater of operation is missing from four patients
Other mechanisms include motor vehicle crashes, burns, and falls
Calculated at LRMC admission
Admission is recorded within the first week of care at each facility
National Capital Region includes National Naval Medical Center and Walter Reed Army Medical Center (June 2009 through August 2011) and Walter Reed National Military Medical Center following the merging of the two facilities in September 2011.
Isolates classified as surveillance were collected through admission surveillance cultures; colonizing isolates were defined as those collected from cultures but not associated with a specific infection; infecting isolates were collected as part of infection workups
3.2.2 Tetracycline Class Resistance
Thirty-eight (23%) isolates were resistant to the tetracycline antimicrobial class (Table 3), of which, 100% were resistant to tetracycline, 66% to doxycycline, and 61% to minocycline. Regarding tet genes, tet(M) and tet(K) contributed the highest proportion among the tetracycline-resistant isolates. Compared to susceptible isolates, a significantly higher proportion of tetracycline-resistant isolates were collected from personnel wounded in Afghanistan (p=0.032) when compared directly against all non-Afghanistan theater data. Tetracycline-resistant isolates were collected a median of 5.5 days post-injury (IQR: 4-22 days), while it was a median of 9.5 days (IQR: 3-109 days) for tetracycline susceptible isolates. When methicillin resistance was considered, there was no significant difference between the tetracycline-resistant and susceptible groups regarding the overall PFT profile. Nonetheless, a higher proportion of tetracycline-resistant isolates were also resistant to clindamycin and trimethoprim-sulfamethoxazole (p=0.019). Among the 25 isolates resistant to doxycycline, 17 (68%) were from patients with antimalarial prophylaxis. There was no significant difference in doxycycline exposure between the groups. The limited number of isolates with tetracycline resistance did not allow for a multivariate risk factor analysis.
Table 3.
Characteristics of Tetracycline Resistance among Staphylococcus aureus Isolates Collected from Wounded United States Military Personnel
| Characteristics, No (%)a | Patients with Tetracycline-Resistant Isolates (N=38) | Patients with Tetracycline Susceptible Isolates (N=130) | p-value |
|---|---|---|---|
| Male | 38 (100) | 129 (99.2) | ~1.0 |
| Age, median year (IQR) | 25.1 (22.4-28.3) | 24.5 (22.2-29.7) | 0.759 |
| Branch of Service | 0.047 | ||
| Army | 25 (65.8) | 86 (66.2) | |
| Marine | 9 (23.7) | 37 (28.5) | |
| Navy | 4 (10.5) | 1 (0.8) | |
| Air Force | 0 | 4 (3.1) | |
| Other | 0 | 2 (1.5) | |
| Rank | 0.695 | ||
| Enlisted | 33 (86.8) | 114 (87.7) | |
| Officer | 4 (10.5) | 12 (9.2) | |
| Warrant | 1 (2.6) | 2 (1.5) | |
| Theater of Operation | 0.094 | ||
| Iraq | 2 (5.3) | 22 (16.9) | |
| Afghanistan | 36 (94.7) | 104 (80.0) | 0.032b |
| Mechanism of Injury | 0.666 | ||
| Blast | 28 (73.7) | 87 (66.9) | |
| Gunshot wound | 5 (13.2) | 18 (13.8) | |
| Otherc | 5 (13.2) | 25 (19.2) | |
| Initial Medical Facility | 0.190 | ||
| Mobile medical unit within combat zone | 16 (42.1) | 35 (26.9) | |
| Hospital within combat zone | 21 (55.3) | 86 (66.2) | |
| LRMC | 1 (2.6) | 9 (6.9) | |
| Injury Severity Scored, median (IQR) | 10 (6-24) | 15 (10-25) | 0.090 |
| Intensive Care Unit admissione | 0.445 | ||
| LRMC only | 4 (10.5) | 20 (15.4) | |
| U.S. hospital ± LRMC | 17 (44.7) | 60 (46.2) | |
| Non-ICU | 17 (44.7) | 42 (32.3) | |
| Facility of Isolate Collection | 0.766 | ||
| LRMC | 13 (34.2) | 41 (31.5) | |
| BAMC | 8 (21.1) | 35 (26.9) | |
| National Capital Regionf | 17 (44.7) | 54 (41.5) | |
| Isolate Typeg | 0.125 | ||
| Surveillance | 15 (39.5) | 30 (23.1) | 0.045b |
| Colonizing | 8 (21.1) | 39 (30.0) | |
| Infecting | 15 (39.5) | 61 (46.9) | |
| Methicillin Resistance | 0.624 | ||
| MRSA | 9 (23.7) | 36 (27.7) | |
| MSSA | 29 (76.3) | 94 (72.3) | |
| PFTs | 0.050 | ||
| USA100 | 0 | 9 (6.9) | |
| USA200 | 2 (5.3) | 15 (11.5) | |
| USA300 | 6 (15.8) | 22 (16.9) | |
| USA400 | 4 (10.5) | 18 (13.8) | |
| USA500 | 1 (2.6) | 7 (5.4) | |
| USA600 | 2 (5.3) | 8 (6.2) | |
| USA800 | 7 (18.4) | 13 (10.0) | |
| USA900 | 1 (2.6) | 8 (6.2) | |
| USA1000 | 0 | 9 (6.9) | |
| MRSA other types | 4 (10.5) | 2 (1.5) | |
| MSSA other types | 11 (28.9) | 19 (14.6) | |
| Tetracycline Resistance Genes | 0.229 | ||
| tet(K) | 13 (34.2) | 2 (1.5) | |
| tet(L) | 2 (5.3) | 0 | |
| tet(M) | 24 (63.2) | 0 | |
| tet(O) | 0 | 0 | |
| Other Antimicrobial Resistance | 0.019 | ||
| Clindamycin | 15 (39.5) | 30 (23.1) | |
| Levofloxacin | 7 (18.4) | 24 (18.5) | |
| Moxifloxacin | 7 (18.4) | 24 (18.5) | |
| Rifampin | 2 (5.3) | 0 | |
| Trimethoprim-Sulfamethoxazole | 6 (15.8) | 3 (2.3) | |
| Doxycycline Exposure | 24 (63.2) | 68 (52.0) | 0.237 |
BAMC – Brooke Army Medical Center; CA – community-associated; IQR – interquartile range; LRMC – Landstuhl Regional Medical Center; HA – healthcare-associated; MRSA – methicillin-resistant Staphylococcus aureus; MSSA – methicillin-susceptible Staphylococcus aureus
Data are missing for some variables: rank is missing from two patients, intensive care unit admission from eight patients, and theater of operation is missing from four patients
Chi-square p-value for comparison of Afghanistan theater against all non-Afghanistan theater data (sum of Iraq theater and missing [4 patients])
Other mechanisms include motor vehicle crashes, burns, and falls
Calculated at LRMC admission
Admission is recorded within the first week of care at each facility
National Capital Region includes National Naval Medical Center and Walter Reed Army Medical Center (June 2009 through August 2011) and Walter Reed National Military Medical Center following the merging of the two facilities in September 2011.
Isolates classified as surveillance were collected through admission surveillance cultures; colonizing isolates were defined as those collected from cultures but not associated with a specific infection; infecting isolates were collected as part of infection workups
3.2.3 Doxycycline Exposure
Ninety-two isolates were from patients exposed to doxycycline prior to isolate collection (Table 4), of which 98% were injured in Afghanistan compared to 66% among patients who did not receive doxycycline (p<0.001). Among the 92 patients, doxycycline exposure was initiated a median of 2 days post-injury (IQR: 2-3 days). Isolates were collected a median of 50 (IQR: 6-138.5 days) and 3 days post-injury (IQR: 2-5 days) from patients with and without doxycycline exposure, respectively. A greater proportion of patients who received doxycycline also sustained blast injuries (79% versus 55%; p<0.001); however, less were admitted to a U.S. hospital ICU (41% versus 51%; p=0.171). In addition, significantly more isolates from patients with doxycycline exposure were collected at hospitals in the National Capital Region (56% versus 25%; p<0.001) and as the result of infection work-ups (61% versus 26%; p<0.001). There was no significant difference regarding methicillin and tetracycline resistance and PFT profiles between the groups of isolates from doxycycline-exposed and unexposed patients. Although the profile of tet genes was not significantly different between the groups, a statistically higher proportion of tet(M) genes were found in doxycycline-exposed patients (p=0.031). Although there was no statistically significant difference related to the overall profile of resistance to other antimicrobials between the two groups, there was a significantly greater proportion of isolates from patients exposed to doxycycline that were resistant to levofloxacin (25% versus 10%; p=0.016), and moxifloxacin (25% versus 10%; p=0.016). In a logistic regression multivariate model, sustaining an injury in Afghanistan was significantly associated with doxycycline exposure (odds ratio: 29.9; 95% Wald confidence interval: 6.3-141.2). Isolate type (e.g., infecting) and occurrence of tet(M) gene were not significantly associated with doxycycline antimalarial prophylaxis.
Table 4.
Characteristics of Doxycycline Exposure Related to Staphylococcus aureus Isolates Collected from Wounded United States Military Personnel
| Characteristics, No (%)a | Patients with Doxycycline Exposureb (N=92) | Patients without Doxycycline Exposure (N=76) | p-value |
|---|---|---|---|
| Male | 92 (100) | 75 (98.7) | 0.452 |
| Age, median year (IQR) | 24.3 (24.3-29.5) | 24.5 (22.1-28.8) | 0.971 |
| Branch of Service | 0.046 | ||
| Army | 68 (73.9) | 43 (56.6) | |
| Marine | 19 (20.7) | 27 (35.5) | |
| Navy | 2 (2.2) | 3 (3.9) | |
| Air Force | 3 (3.3) | 1 (13) | |
| Other | 0 | 2 (2.6) | |
| Rank | 0.766 | ||
| Enlisted | 79 (85.9) | 68 (89.5) | |
| Officer | 10 (10.9) | 6 (7.9) | |
| Warrant | 2 (2.2) | 1 (1.3) | |
| Theater of Operation | <0.001 | ||
| Iraq | 2 (2.2) | 22 (28.9) | |
| Afghanistan | 90 (97.8) | 50 (65.8) | |
| Mechanism of Injury | <0.001 | ||
| Blast | 73 (79.3) | 42 (55.3) | |
| Gunshot wound | 13 (14.1) | 10 (13.2) | |
| Otherc | 6 (6.5) | 24 (31.6) | |
| Initial Medical Facility | 0.001 | ||
| Mobile medical unit within combat zone | 36 (39.1) | 15 (19.7) | |
| Hospital within combat zone | 55 (59.8) | 52 (68.4) | |
| LRMC | 1 (11) | 9 (11.8) | |
| Injury Severity Scored, median (IQR) | 14 (10-23) | 14 (6-25) | 0.661 |
| Intensive Care Unit admissione | 0.171 | ||
| LRMC only | 16 (17.4) | 8 (10.5) | |
| U.S. hospital ± LRMC | 38 (41.3) | 39 (51.3) | |
| Non-ICU | 37 (40.2) | 22 (28.9) | |
| Facility of Isolate Collection | <0.001 | ||
| LRMC | 8 (8.7) | 46 (60.5) | |
| BAMC | 32 (34.8) | 11 (14.5) | |
| National Capital Regionf | 52 (56.5) | 19 (25.0) | |
| Isolate Typeg | <0.001 | ||
| Surveillance | 24 (26.1) | 21 (27.6) | |
| Colonizing | 12 (13.0) | 35 (46.1) | |
| Infecting | 56 (60.9) | 20 (26.3) | |
| Methicillin Resistance | 0.240 | ||
| MRSA | 28 (30.4) | 17 (22.4) | |
| MSSA | 64 (69.6) | 59 (77.6) | |
| PFTs | 0.079 | ||
| USA100 | 7 (7.6) | 2 (2.6) | |
| USA200 | 12 (13.0) | 5 (6.6) | |
| USA300 | 18 (19.6) | 10 (13.2) | |
| USA400 | 9 (9.8) | 13 (18.2) | |
| USA500 | 5 (5.4) | 3 (3.9) | |
| USA600 | 7 (7.6) | 3 (3.9) | |
| USA800 | 10 (10.9) | 10 (13.2) | |
| USA900 | 7 (7.6) | 2 (2.6) | |
| USA1000 | 3 (3.3) | 6 (7.9) | |
| MRSA other types | 4 (4.3) | 2 (2.6) | |
| MSSA other types | 10 (10.9) | 20 (26.3) | |
| Tetracycline Resistance Genes | 0.252 | ||
| tet(K) | 8 (8.7) | 7 (9.2) | |
| tet(L) | 2 (2.2) | 0 | |
| tet(M)h | 18 (19.6) | 6 (7.9) | |
| tet(O) | 0 | 0 | |
| Tetracycline Resistance | 0.237 | ||
| Doxycycline | 17 (18.5) | 8 (10.5) | |
| Minocycline | 15 (16.3) | 8 (10.5) | |
| Tetracycline | 24 (26.1) | 14 (18.4) | |
| Other Antimicrobial Resistance | 0.658 | ||
| Clindamycin | 30 (32.6) | 15 (19.7) | |
| Levofloxacini | 23 (25.0) | 8 (10.5) | |
| Moxifloxacini | 23 (25.0) | 8 (10.5) | |
| Rifampin | 1 (11) | 1 (13) | |
| Trimethoprim-Sulfamethoxazole | 5 (5.4) | 4 (5.3) |
BAMC – Brooke Army Medical Center; CA – community-associated; IQR – interquartile range; LRMC – Landstuhl Regional Medical Center; HA – healthcare-associated; MRSA – methicillin-resistant Staphylococcus aureus; MSSA – methicillin-susceptible Staphylococcus aureus
Data are missing for some variables: rank is missing from two patients, intensive care unit admission from eight patients, and theater of operation is missing from four patients
Doxycycline exposure occurred prior to isolate collection
Other mechanisms include motor vehicle crashes, burns, and falls
Calculated at LRMC admission
Admission is recorded within the first week of care at each facility
National Capital Region includes National Naval Medical Center and Walter Reed Army Medical Center (June 2009 through August 2011) and Walter Reed National Military Medical Center following the merging of the two facilities in September 2011.
Isolates classified as surveillance were collected through admission surveillance cultures; colonizing isolates were defined as those collected from cultures but not associated with a specific infection; infecting isolates were collected as part of infection workups
Groups are statistically significantly different; p=0.031.
Groups are statistically significantly different; p=0.016.
3.2.4 Isolates Associated with Infection
Seventy-six patients had isolates classified as infecting (Table 5), of which a greater proportion were collected at hospitals in the National Capital Region (54%) compared to non-infecting isolates (33%; p=0.012). Infecting isolates were collected a median of 69.5 days post-injury (IQR: 7-154 days). In addition, infecting isolates were predominantly collected from wound specimens (61% versus 10% of non-infecting isolates; p<0.001), while non-infecting isolates were primarily from respiratory specimens (37% versus 29% of infecting isolates). Among the infecting isolates, 15 (20%) were tetracycline-resistant. Nonetheless, there was no significant difference regarding methicillin and tetracycline resistance, profile of PFTs, and tet genes between the patients with infecting and non-infecting isolates. There was a significantly greater (p<0.001) proportion of infecting isolates from patients with doxycycline exposure (74%) compared to the group that had non-infecting isolates (39%). Infecting isolates from patients with doxycycline exposure were collected a median of 97.5 days post-injury (IQR: 16.5-187.5 days).
Table 5.
Characteristics of Infection Status among Staphylococcus aureus Isolates Collected from Wounded United States Military Personnel
| Characteristics, No (%)a | Patients with Infecting Isolatesb (N=76) | Patients with non-Infecting Isolatesb (N=92) | p-value |
|---|---|---|---|
| Theater of Operation | 0.062 | ||
| Iraq | 6 (7.9) | 18 (19.6) | |
| Afghanistan | 69 (90.8) | 71 (77.2) | |
| Mechanism of Injury | 0.094 | ||
| Blast | 50 (65.8) | 65 (70.7) | |
| Gunshot wound | 15 (19.7) | 8 (8.7) | |
| Otherc | 11 (14.5) | 19 (20.7) | |
| Initial Medical Facility | 0.192 | ||
| Mobile medical unit within combat zone | 28 (36.8) | 23 (25.0) | |
| Hospital within combat zone | 45 (59.2) | 62 (67.4) | |
| LRMC | 3 (3.9) | 7 (7.6) | |
| Injury Severity Scored, median (IQR) | 17 (10-24) | 14 (6-24) | 0.179 |
| Intensive Care Unit admissione | 0.350 | ||
| LRMC only | 9 (11.8) | 15 (16.3) | |
| U.S. hospital ± LRMC | 40 (52.6) | 37 (40.2) | |
| Non-ICU | 25 (32.9) | 34 (37.0) | |
| Facility of Isolate Collection | 0.012 | ||
| LRMC | 17 (22.4) | 37 (40.2) | |
| BAMC | 18 (23.7) | 25 (27.2) | |
| National Capital Regionf | 41 (53.9) | 30 (32.6) | |
| Specimen Site | <0.001 | ||
| Nares | 0 | 30 (32.6) | |
| Groin | 0 | 15 (16.3) | |
| Respiratory | 22 (28.9) | 34 (37.0) | |
| Blood | 5 (6.6) | 0 | |
| Urine | 0 | 3 (3.3) | |
| Wound | 46 (60.5) | 9 (9.8) | |
| Other | 3 (3.9) | 1 (11) | |
| Methicillin Resistance | 0.104 | ||
| MRSA | 25 (32.9) | 20 (21.7) | |
| MSSA | 51 (67.1) | 72 (78.3) | |
| PFTs | 0.740 | ||
| USA100 | 5 (6.6) | 4 (4.3) | |
| USA200 | 7 (9.2) | 10 (10.9) | |
| USA300 | 14 (18.4) | 14 (15.2) | |
| USA400 | 10 (13.2) | 12 (13.0) | |
| USA500 | 2 (2.6) | 6 (6.5) | |
| USA600 | 6 (7.9) | 4 (4.3) | |
| USA800 | 8 (10.5) | 12 (13.0) | |
| USA900 | 5 (6.6) | 4 (4.3) | |
| USA1000 | 6 (7.9) | 3 (3.3) | |
| MRSA other types | 3 (3.9) | 3 (3.3) | |
| MSSA other types | 10 (13.2) | 20 (21.7) | |
| Tetracycline Resistance Genes | 0.755 | ||
| tet(K) | 5 (6.6) | 10 (10.9) | |
| tet(L) | 1 (13) | 1 (1.1) | |
| tet(M) | 10 (13.2) | 14 (15.2) | |
| tet(O) | 0 | 0 | |
| None | 60 (78.9) | 67 (72.8) | |
| Tetracycline Resistance | 0.417 | ||
| Doxycycline | 11 (14.5) | 14 (15.2) | |
| Minocycline | 10 (13.2) | 13 (14.1) | |
| Tetracycline | 15 (19.7) | 23 (25.0) | |
| Other Antimicrobial Resistance | 0.269 | ||
| Clindamycin | 20 (26.3) | 25 (27.2) | |
| Levofloxacin | 20 (26.3) | 11 (12.0) | |
| Moxifloxacin | 20 (26.3) | 11 (12.0) | |
| Rifampin | 1 (13) | 1 (11) | |
| Trimethoprim-Sulfamethoxazole | 4 (5.3) | 5 (5.4) | |
| Doxycycline Exposure | 56 (73.7) | 36 (39.1) | <0.001 |
BAMC – Brooke Army Medical Center; IQR – interquartile range; LRMC – Landstuhl Regional Medical Center; MRSA – methicillin-resistant Staphylococcus aureus; MSSA – methicillin-susceptible Staphylococcus aureus
Data are missing for some variables: rank is missing from two patients, intensive care unit admission from eight patients, and theater of operation is missing from four patients
Isolates classified as infecting were collected as part of infection workups while non-infecting isolates were collected through admission surveillance cultures and from cultures not associated with a specific infection and so determined to be colonizing
Other mechanisms include motor vehicle crashes, burns, and falls
Calculated at LRMC admission
Admission is recorded within the first week of care at each facility
National Capital Region includes National Naval Medical Center and Walter Reed Army Medical Center (June 2009 through August 2011) and Walter Reed National Military Medical Center following the merging of the two facilities in September 2011.
Thirty-three patients had serially positive infection work-ups with S. aureus growth. When characteristics of first isolates were compared to the last isolates collected from the same patients, there were no significant differences related to methicillin resistance (36% and 39% of first and last isolates, respectively; p=0.80), tetracycline resistance (24% and 21%, respectively; p=0.77), PFT profiles (21% USA300 in both first and last isolates; p=0.999), tet genes (21% and 18% with tet(M), respectively; p=0.77), and other antimicrobial resistance (30% and 33%, respectively, resistant to clindamycin, levofloxacin, and moxifloxacin; p=0.81).
4.0 DISCUSSION
Increasing multidrug resistance among bacterial pathogens presents a continuing challenge for clinicians. During the recent wars, there was concern that use of doxycycline antimalarial prophylaxis among military personnel deployed to Afghanistan would have the unintended consequence of increased S. aureus tetracycline resistance (Lesens et al., 2007; Vento et al., 2013). We examined 168 S. aureus isolates collected from wounded military personnel with regards to tetracycline resistance, MRSA, and doxycycline exposure. Overall, we found no statistically significant association between doxycycline exposure and resistance to the tetracycline antimicrobial class nor to the profile of tet resistance genes; however, when tet(M) was assessed separately, there was a significantly higher proportion among patients exposed to doxycycline.
Among the S. aureus isolates in our analysis 27% and 73% were MRSA and MSSA, respectively, with USA300, USA400 and USA800 contributing the majority of the PFTs. In addition, isolates were predominantly obtained through infection work-ups (45%), of which 33% were MRSA and 20% were resistant to tetracyclines. It is noteworthy that there was no significant difference regarding tetracycline resistance and occurrence of tet genes between the MRSA and MSSA groups; however, MRSA isolates had a significantly higher proportion of resistance to other antimicrobials, including clindamycin and fluoroquinolones.
Overall, 23% of the S. aureus isolates were resistant to tetracyclines. The majority of isolates with tet genes were resistant to tetracycline with only two isolates (1%) carrying the tet(K) gene classified as susceptible. Tetracycline-resistant isolates were also significantly more resistant to other antimicrobials. Furthermore, a significantly higher proportion of tetracycline-resistant isolates were collected from military personnel wounded in Afghanistan; however, there was no significant association with doxycycline antimalarial prophylaxis. A possible explanation could be that the larger proportion of wounded in our study were from the Afghanistan theater (83%). Nevertheless, our findings are comparable with a prior analysis that showed that 26% of S. aureus isolates (MRSA and MSSA) collected from personnel deployed to Afghanistan were resistant to tetracycline, while 5% were resistant to doxycycline or minocycline. Isolates from non-deployed personnel (no doxycycline exposure) were also considered in the analysis and they showed 98-100% susceptibility to tetracyclines (Vento et al., 2013). In another analysis, nasal cultures were collected from 273 French soldiers and 98 with S. aureus colonization were identified, of which 43% were carriers of doxycycline-resistant MSSA/MRSA. Approximately 90% of the soldiers had previously been prescribed doxycycline for malarial prophylaxis (Lesens et al., 2007).
Tetracycline resistance has been reported among S. aureus isolates collected from military personnel wounded in Iraq as well as Afghanistan. In one analysis, isolates obtained from U.S. and non-U.S. patients in a combat support hospital (50% and 34% MRSA, respectively) were found to be 82% and 63% susceptible to tetracycline, respectively (Co et al., 2011). Additional studies have reported tetracycline susceptibility ranging from 90 to 95% among MRSA isolates (79-80% PFT USA300) collected from combat support hospitals in Iraq (Huang et al., 2011; Murray et al., 2010). High tetracycline resistance has also been observed in isolates from civilian populations. In particular, 72% tetracycline resistance was reported in one MRSA strain (USA300 variant) collected from a Boston health center over a 19-month period (Han et al., 2007). Following the Wenchuan earthquake in China, pathogenic S. aureus was isolated from 12% of the trauma patients, of which approximately 25% and 65% was resistant to minocycline and tetracycline, respectively (Zhang et al., 2012). Resistance to tetracycline was also reported among 63% of S. aureus isolates from volunteers in Haiti. Prior usage of doxycycline was examined, but no association was identified (Rosenthal et al., 2014).
As expected, 98% of patients with doxycycline antimalarial prophylaxis sustained injuries in Afghanistan. The association between the Afghanistan theater and doxycycline use was confirmed in the multivariate model. A significantly higher proportion of blast-related injuries was also observed among patients with doxycycline exposure. Although there was no correlation between blast injuries with combat theater in the multivariate model, it has been well-documented that the rate of traumatic amputations substantially increased after transition of personnel to Afghanistan due to dismounted patrols encountering improvised explosive devices, which may explain the higher proportion of blast-injured patients with doxycycline exposure (Krueger et al., 2012). An increase in isolates classified as infecting was also observed in the doxycycline exposure group, but the association was not significant in the multivariate model and may be due to restricting the analysis to the first isolate collected from each patient. Although doxycycline usage was not associated with tetracycline resistance, there were significantly more isolates with the tet(M) gene (p=0.031). One prior analysis reported the potential for doxycycline to induce its own resistance in MRSA PFT USA300 that carried the tet(K) gene and not tet(M) (Schwartz et al., 2009). Our findings did not find any evidence of doxycycline use as antimalarial prophylaxis inducing doxycycline resistance; however, only 9% of isolates within the doxycycline-exposed group carried the tet(K) gene and 20% had tet(M).
Our retrospective analysis has limitations which should be considered. In particular, the patients that comprise our study population generally sustained more severe injuries than those who transferred to non-TIDOS-participating U.S. clinical sites (Tribble et al., 2011). Therefore, data reported herein may not be applicable to all wounded military personnel who were medically evacuated to LRMC before returning to the United States. In addition, the limited number of isolates with tetracycline resistance did not allow for a multivariate risk factor analysis. Furthermore, the limited number of isolates with tetracycline class resistance may have reduced the statistical power of the analysis of doxycycline exposure in relation to resistance. Lastly, DoD guidance recommends use of doxycycline throughout duration of service in support of operations in Afghanistan; however, information on antimalarial prophylaxis self-compliance by military personnel while in theater was not collected by our study. Nonetheless, these data may have broader applicability due to the occurrence of infections involving S. aureus following natural disasters, such as the Wenchuan earthquake (Zhang et al., 2012).
5.0 CONCLUSION
Overall, our findings highlight a low proportion of MRSA collected from wounded military personnel during the recent wars; however, over half of the MRSA isolates were classified as infecting. There was also a low level of resistance to tetracycline among S. aureus isolates (MSSA and MRSA). Although there was no association between the utilization of doxycycline and resistance to tetracyclines, including doxycycline, further analysis is needed before a definite conclusion can be reached.
Highlights.
Twenty-three percent of isolates were resistant to tetracycline antibiotic class
Clindamycin resistance was higher among tetracycline-resistant isolates
Tetracycline class resistance was not associated with antimalarial prophylaxis
Acknowledgments
We are indebted to the Infectious Disease Clinical Research Program Trauma Infectious Disease Outcomes Study team of clinical coordinators, microbiology technicians, data managers, clinical site managers, and administrative support personnel for their tireless hours to ensure the success of this project. We also wish to thank M. Leigh Carson for her assistance in writing and preparing the manuscript.
Financial Support: Support for this work (IDCRP-024) was provided by the Infectious Disease Clinical Research Program (IDCRP), a Department of Defense program executed through the Uniformed Services University of the Health Sciences, Department of Preventive Medicine and Biostatistics. This project has been funded by the Department of Defense Global Emerging Infections Surveillance and Response System (GEIS) [HT9404-12-1-0011], a division of the Armed Forces Health Surveillance Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health, under Inter-Agency Agreement Y1-AI-5072, and the Department of the Navy under the Wounded, Ill, and Injured Program [HU001-10-1-0014].
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of Interest: None
Ethical standards: The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional committees on human experimentation and with the Helsinki Declaration of 1975, as revised in 2008.
Disclaimer: The views expressed are those of the authors and do not necessarily reflect the official views of the Uniformed Services University of the Health Sciences, the Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc., the National Institutes of Health or the Department of Health and Human Services, Brooke Army Medical Center, the U.S. Army Medical Department, the U.S. Army Office of the Surgeon General, the Department of Defense or the Departments of the Army, Navy, or Air Force. Mention of trade names, commercial products, or organizations does not imply endorsement by the U.S. Government.
References
- Ardic N, Ozyurt M, Sareyyupoglu B, Haznedaroglu T. Investigation of erythromycin and tetracycline resistance genes in methicillin-resistant staphylococci. Int J Antimicrob Agents. 2005;26:213–8. doi: 10.1016/j.ijantimicag.2005.06.013. doi: 10.1016/j.ijantimicag.2005.06.013. [DOI] [PubMed] [Google Scholar]
- Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB, et al. Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin Infect Dis. 2009;48:1–12. doi: 10.1086/595011. doi: 10.1086/595011. [DOI] [PubMed] [Google Scholar]
- Brisson M, Brisson P. Compliance with antimalaria chemoprophylaxis in a combat zone. Am J Trop Med Hyg. 2012;86:587–90. doi: 10.4269/ajtmh.2012.11-0511. doi: 10.4269/ajtmh.2012.11-0511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clinical and Laboratory Standards Institute . Analysis and presentation of cumulative antimicrobial susceptibility test data; approved guideline – Third Edition. CLSI document M39-A3; Wayne, PA.: 2009. [Google Scholar]
- Co EM, Keen EF, 3rd, Aldous WK. Prevalence of methicillin-resistant Staphylococcus aureus in a combat support hospital in Iraq. Mil Med. 2011;176:89–93. doi: 10.7205/milmed-d-09-00126. [DOI] [PubMed] [Google Scholar]
- Creech CB, Saye E, McKenna BD, Johnson BG, Jimenez N, Talbot TR, et al. One-year surveillance of methicillin-resistant Staphylococcus aureus nasal colonization and skin and soft tissue infections in collegiate athletes. Arch Pediatr Adolesc Med. 2010;164:615–20. doi: 10.1001/archpediatrics.2010.93. doi: 10.1001/archpediatrics.2010.93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Department of the Army [2 January 2016];Department of the Army Personnel Policy Guidance for Overseas Contingency Operations. 2013 Available at http://www.armyg1.army.mil/MilitaryPersonnel/PPG/PPG_17-May-2013.pdf.
- Department of Defense [12 February 2016];USCENTCOM 021922Z Dec 11 MOD Eleven to USCENTCOM Individual Protection and Individual-Unit Deployment Policy. 2010 Available at http://www.cpms.osd.mil/expeditionary/pdf/MOD11-USCENTCOM-Indiv-Protection-Indiv-Unit-Deployment-Policy-Incl-Tab-A-and-B.pdf.
- Department of Defense [12 February 2016];USCENTCOM 021502Z Dec 13 MOD Twelve to USCENTCOM Individual Protection and Individual-Unit Deployment Policy. 2013 Available at http://cpol.army.mil/library/mobil/MOD12-Dec13.pdf.
- Division of Healthcare Quality Promotion. The National Healthcare Safety Network (NHSN) Manual . Patient safety component. Protocol multidrug-resistant organism and Clostridium difficile Infection (MDRO/CDI) module. Centers for Disease Control and Prevention; Atlanta, GA.: 2016. [Google Scholar]
- Eastridge BJ, Jenkins D, Flaherty S, Schiller H, Holcomb JB. Trauma system development in a theater of war: Experiences from Operation Iraqi Freedom and Operation Enduring Freedom. J Trauma. 2006;61:1366–72. doi: 10.1097/01.ta.0000245894.78941.90. discussion 1372-73. [DOI] [PubMed] [Google Scholar]
- Ellis MW, Hospenthal DR, Dooley DP, Gray PJ, Murray CK. Natural history of community-acquired methicillin-resistant Staphylococcus aureus colonization and infection in soldiers. Clin Infect Dis. 2004;39:971–9. doi: 10.1086/423965. doi: 10.1086/423965. [DOI] [PubMed] [Google Scholar]
- Ellis MW, Griffith ME, Jorgensen JH, Hospenthal DR, Mende K, Patterson JE. Presence and molecular epidemiology of virulence factors in methicillin-resistant Staphylococcus aureus strains colonizing and infecting soldiers. J Clin Microbiol. 2009;47:940–5. doi: 10.1128/JCM.02352-08. 10.1128/JCM.02352-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han LL, McDougal LK, Gorwitz RJ, Mayer KH, Patel JB, Sennott JM, et al. High frequencies of clindamycin and tetracycline resistance in methicillin-resistant Staphylococcus aureus pulsed-field type USA300 isolates collected at a Boston ambulatory health center. J Clin Microbiol. 2007;45:1350–2. doi: 10.1128/JCM.02274-06. doi: 10.1128/JCM.02274-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang XZ, Cash DM, Chahine MA, van Horn GT, Erwin DP, McKay JT, et al. Methicillin-resistant Staphylococcus aureus infection in combat support hospitals in three regions of Iraq. Epidemiol Infect. 2011;139:994–7. doi: 10.1017/S0950268810001950. doi: 10.1017/S0950268810001950. [DOI] [PubMed] [Google Scholar]
- Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA. 2007;298:1763–71. doi: 10.1001/jama.298.15.1763. doi: 10.1001/jama.298.15.1763. [DOI] [PubMed] [Google Scholar]
- Kotwal RS, Wenzel RB, Sterling RA, Porter WD, Jordan NN, Pertruccelli BP. An outbreak of malaria in US Army Rangers returning from Afghanistan. JAMA. 2005;293:212–6. doi: 10.1001/jama.293.2.212. doi: 10.1001/jama.293.2.212. [DOI] [PubMed] [Google Scholar]
- Krueger CA, Wenke JC, Ficke JR. Ten years at war: comprehensive analysis of amputation trends. J Trauma Acute Care Surg. 2012;73:S438–44. doi: 10.1097/TA.0b013e318275469c. 10.1097/TA.0b013e318275469c. [DOI] [PubMed] [Google Scholar]
- Landrum ML, Neumann C, Cook C, Chukwuma U, Ellis MW, Hospenthal DR, et al. Epidemiology of Staphylococcus aureus blood and skin and soft tissue infections in the US military health system, 2005-2010. JAMA. 2012;308:50–9. doi: 10.1001/jama.2012.7139. doi: 10.1001/jama.2012.7139. [DOI] [PubMed] [Google Scholar]
- Leamer NK, Clemmons NS, Jordan NN, Pacha LA. Update: Community-acquired methicillin-resistant Staphylococcus aureus skin and soft tissue infection surveillance among active duty military personnel at Fort Benning GA, 2008-2010. Mil Med. 2013;178:914–20. doi: 10.7205/MILMED-D-13-00082. doi: 10.7205/MILMED-D-13-00082. [DOI] [PubMed] [Google Scholar]
- Lesens O, Haus-Cheymol R, Dubrous P, Verret C, Spiegel A, Bonnet R, et al. Methicillin-susceptible, doxycycline-resistant Staphylococcus aureus, Cote d'Ivoire. Emerg Infect Dis. 2007;13:488–90. doi: 10.3201/eid1303.060729. doi: 10.3201/eid1303.060729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Linn S. The injury severity score--Importance and uses. Ann Epidemiol. 1995;5:440–6. doi: 10.1016/1047-2797(95)00059-3. [DOI] [PubMed] [Google Scholar]
- McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol. 2003;41:5113–20. doi: 10.1128/JCM.41.11.5113-5120.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McDougal LK, Fosheim GE, Nicholson A, Bulens SN, Limbago BM, Shearer JE, et al. Emergence of resistance among USA300 methicillin-resistant Staphylococcus aureus isolates causing invasive disease in the United States. Antimicrob Agents Chemother. 2010;54:3804–11. doi: 10.1128/AAC.00351-10. doi: 10.1128/AAC.00351-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Murray CK, Holmes RL, Ellis MW, Mende K, Wolf SE, McDougal LK, et al. Twenty-five year epidemiology of invasive methicillin-resistant Staphylococcus aureus (MRSA) isolates recovered at a burn center. Burns. 2009;35:1112–7. doi: 10.1016/j.burns.2009.02.013. doi: 10.1016/j.burns.2009.02.013. [DOI] [PubMed] [Google Scholar]
- Murray CK, Griffith ME, Mende K, Guymon CH, Ellis MW, Beckius M, et al. Methicillin-resistant Staphylococcus aureus in wound cultures recovered from a combat support hospital in Iraq. J Trauma. 2010;69(Suppl 1):S102–8. doi: 10.1097/TA.0b013e3181e44b57. doi: 10.1097/TA.0b013e3181e44b57. [DOI] [PubMed] [Google Scholar]
- Newton JA, Jr., Schnepf GA, Wallace MR, Lobel HO, Kennedy CA, Oldfield EC., 3rd Malaria in US Marines returning from Somalia. JAMA. 1994;272:397–9. [PubMed] [Google Scholar]
- Nurjadi D, Friedrich-Janicke B, Schafer J, van Genderen PI, Goorhuis A, Perignon A, et al. Skin and soft tissue infections in intercontinental travellers and the import of multi-resistant Staphylococcus aureus to Europe. Clin Microbiol Infect. 2015;21:567, e1–10. doi: 10.1016/j.cmi.2015.01.016. doi: 10.1016/j.cmi.2015.01.016. [DOI] [PubMed] [Google Scholar]
- Rini EA, Weintrob AC, Tribble DR, Lloyd BA, Warkentien TE, Shaikh F, et al. Compliance with antimalarial chemoprophylaxis recommendations for wounded United States military personnel admitted to a military treatment facility. Am J Trop Med Hyg. 2014;90:1113–6. doi: 10.4269/ajtmh.13-0646. doi: 10.4269/ajtmh.13-0646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosenthal ME, Mediavilla J, Chen L, Sonnenfeld J, Pierce L, Shannon A, et al. Molecular epidemiology of Staphylococcus aureus in post-earthquake northern Haiti. Int J Infect Dis. 2014;29:146–51. doi: 10.1016/j.ijid.2014.08.007. doi: 10.1016/j.ijid.2014.08.007. [DOI] [PubMed] [Google Scholar]
- Ruhe JJ, Menon A. Tetracyclines as an oral treatment option for patients with community onset skin and soft tissue infections caused by methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2007;51:3298–303. doi: 10.1128/AAC.00262-07. doi: 10.1128/AAC.00262-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schwartz BS, Graber CJ, Diep BA, Basuino L, Perdreau-Remington F, Chambers HF. Doxycycline, not minocycline, induces its own resistance in multidrug-resistant, community-associated methicillin-resistant Staphylococcus aureus clone USA300. Clin Infect Dis. 2009;48:1483–4. doi: 10.1086/598510. doi: 10.1086/598510. [DOI] [PubMed] [Google Scholar]
- Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasan A, et al. Antimicrobial-resistant pathogens associated with healthcare-associated infections: summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009-2010. Infect Control Hosp Epidemiol. 2013;34:1–14. doi: 10.1086/668770. doi: 10.1086/668770. [DOI] [PubMed] [Google Scholar]
- Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233–9. doi: 10.1128/jcm.33.9.2233-2239.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tenover FC, McDougal LK, Goering RV, Killgore G, Projan SJ, Patel JB, et al. Characterization of a strain of community-associated methicillin-resistant Staphylococcus aureus widely disseminated in the United States. J Clin Microbiol. 2006;44:108–18. doi: 10.1128/JCM.44.1.108-118.2006. doi: 10.1128/JCM.44.1.108-118.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tribble DR, Conger NG, Fraser S, Gleeson TD, Wilkins K, Antonille T, et al. Infection-associated clinical outcomes in hospitalized medical evacuees following traumatic Injury: Trauma Infectious Disease Outcome Study. J Trauma. 2011;71:S33–42. doi: 10.1097/TA.0b013e318221162e. doi: 10.1097/TA.0b013e318221162e. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother. 2000;45:763–70. doi: 10.1093/jac/45.6.763. [DOI] [PubMed] [Google Scholar]
- Vento TJ, Cole DW, Mende K, Calvano TP, Rini EA, Tully CA, et al. Multidrug-resistant gram-negative bacteria colonization of healthy US military personnel in the US and Afghanistan. BMC Infect Dis. 2013;13:68. doi: 10.1186/1471-2334-13-68. doi: 10.1186/1471-2334-13-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Whitman TJ, Coyne PE, Magill AJ, Blazes DL, Green MD, Milhous WK, et al. An outbreak of Plasmodium falciparum malaria in U.S. Marines deployed to Liberia. Am J Trop Med Hyg. 2010;83:258–65. doi: 10.4269/ajtmh.2010.09-0774. doi: 10.4269/ajtmh.2010.09-0774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang B, Liu Z, Lin Z, Zhang X, Fu W. Microbiologic characteristics of pathogenic bacteria from hospitalized trauma patients who survived Wenchuan earthquake. Eur J Clin Microbiol Infect Dis. 2012;31:2529–35. doi: 10.1007/s10096-012-1591-0. [DOI] [PubMed] [Google Scholar]