Selenoprotein H is an essential regulator of redox homeostasis that cooperates with p53 in development and tumorigenesis

Significance

Dietary selenium and selenoproteins play important roles in regulating redox processes that impact human health. The human genome includes 25 genes for selenoproteins, which have diverse roles in redox homeostasis, thyroid hormone metabolism, endoplasmic reticulum quality control, selenium transport, and other functions. Selenoprotein H (seph) is a recently identified nucleolar oxidoreductase with DNA-binding properties whose function is not well understood. In this work, we used a unique combination of unbiased metabolomic and transcriptomic approaches in zebrafish to discover that seph is an essential regulator of redox homeostasis that regulates p53. In addition, we demonstrate the seph-deficient adults are prone to chemically induced carcinogenesis. Our results suggest that seph suppresses oxidative stress and DNA damage in the nucleolus.

Abstract

Selenium, an essential micronutrient known for its cancer prevention properties, is incorporated into a class of selenocysteine-containing proteins (selenoproteins). Selenoprotein H (SepH) is a recently identified nucleolar oxidoreductase whose function is not well understood. Here we report that seph is an essential gene regulating organ development in zebrafish. Metabolite profiling by targeted LC-MS/MS demonstrated that SepH deficiency impairs redox balance by reducing the levels of ascorbate and methionine, while increasing methionine sulfoxide. Transcriptome analysis revealed that SepH deficiency induces an inflammatory response and activates the p53 pathway. Consequently, loss of seph renders larvae susceptible to oxidative stress and DNA damage. Finally, we demonstrate that seph interacts with p53 deficiency in adulthood to accelerate gastrointestinal tumor development. Overall, our findings establish that seph regulates redox homeostasis and suppresses DNA damage. We hypothesize that SepH deficiency may contribute to the increased cancer risk observed in cohorts with low selenium levels.

Selenium is an essential micronutrient that has been implicated in cancer chemoprevention and is thought to delay the severity of cardiovascular and neurologic disorders (1). The biological properties of selenium are mediated by a diverse group of selenocysteine (Sec)-containing selenoproteins (2). Sec is incorporated into protein in response to the UGA opal codon in a unique context in which the 3′ UTR of the gene contains a Sec insertion sequence (SECIS) element (3, 4). The human selenoproteome includes five glutathione peroxidases (GPX1-4, 6), three thioredoxin reductases (TXNRD1-3), and one methionine sulfoxide reductase (MSRB1) that act in concert to provide antioxidant defense (2). The selenoproteome also includes three iodothyronine deiodinases (DIO1-3) that control thyroid hormone metabolism and two selenoproteins that are involved in selenoprotein synthesis (SPS2) and transport (SELP). In contrast, little is known regarding the function of the other 11 human selenoproteins (SELW, SELT, SELH, SELV, SELI, SEP15, SELM, SELK, SELS, SELO, and SELN) (5).

Although selenium was originally considered a toxin, classic work by Schwartz and Foltz showed that selenium prevents liver necrosis in rats, suggesting that it is an essential micronutrient (6). This essential role as a micronutrient during development was subsequently recognized by the livestock industry and is now widely known for human health (7). Genetic disruption of three mammalian selenoproteins―GPX4, TXNRD1, and TXNRD2―causes embryonic lethality (8–12) in murine models. SelP-deficient mice exhibit impaired selenium transport from the liver to peripheral tissues and show growth retardation and impaired motor coordination (13, 14). In contrast, mice deficient in Gpx1 (15), Gpx2 (16), Gpx3 (17), MsrB1 (18), Sep15 (19), or SelM (20) are viable, with more subtle defects, some of which only manifest in the context of stress.

Epidemiologic surveys have shown that selenium deficiency may be associated with an increased risk of certain types of cancer (21, 22). For example, patients with cirrhosis (scarring) of the liver have a high risk of developing liver cancer, and are typically deficient in selenium (23–26). However, selenium supplementation chemoprevention trials have provided mixed results, possibly related to a combination of unknown baseline selenium status and genetic factors that modulate selenoprotein function (22). In vivo cancer studies using transgenic mice have revealed that the role of selenoproteins in tumorigenesis is context-dependent, both preventing and promoting cancer (27, 28). The importance of selenium and selenoproteins in embryonic development and tumorigenesis underscores the need for a better understanding of the biological function of the recently identified selenoproteins.

Here we show that seph (ortholog of human SELH) plays an essential role in vertebrate organ development. Using unbiased metabolomic and transcriptomic approaches, we found that SepH deficiency alters redox homeostasis, provokes an inflammatory response, and activates p53. SepH-deficient zebrafish larvae exhibit an increased susceptibility to oxidative stress and DNA damage. Loss of p53 partially mitigates the developmental defects observed in seph mutants; however, loss of p53 function combines with SepH haploinsufficiency in adulthood to accelerate gastrointestinal (GI) tumor development. Collectively, our results establish that SepH regulates redox homeostasis and suppresses DNA damage during development and tumorigenesis.

Results

seph Mutant Zebrafish Exhibit Defects in Organ Development.

This investigation was spurred by the isolation of a seph mutant from a large-scale insertional mutagenesis screen (29). This seph mutant was caused not by viral insertion into the coding region, but rather by insertion into the 3′ UTR. Sequence analysis indicated that the virus is inserted in the 3′ UTR upstream of the regulatory SECIS element (Fig. 1 and Fig. S1A); therefore, we infer that loss of function in seph mutants is caused by displacement of the SECIS element and a consequent inability to read the in-frame UGA codon as Sec. We found that seph expression, present in the head region of wild type (WT) embryos, was completely absent in the seph mutant larvae at 3 dpf (Fig. S1B). This is consistent with previous studies demonstrating that SELH (human ortholog of seph) is among the most sensitive selenoprotein mRNAs to changes in abundance in response to selenium status, owing to the differences in Sec incorporation efficiency and nonsense-mediated decay (30, 31).

Fig. 1.

seph mutant zebrafish exhibit defects in organ development. (A) Schematic illustrating the nature of the seph mutant. (B) Survival of WT and homozygous seph mutant larvae over time. n = 160 larvae. (C) Morphological assessment and fluorescent imaging (lateral and ventral views) of WT and seph mutant larvae on a Tg(ela3l:GFP;fabp10a:dsRed) background by confocal tomography at 5 dpf. Liver volume: WT, 3.09e⁶ μm³; seph, 1.69e⁶ μm³. Pancreas volume: WT, 2.79e⁶ μm³; seph, undetectable. (Scale bar: 100 μm.) (D) Quantitative analysis of fluorescent liver area in WT and seph mutant larvae at 5 dpf. n = 16. ****P < 0.0001. (E) Quantitative analysis of fluorescent pancreas area in WT and seph mutant larvae at 5 dpf. n = 16. ****P < 0.0001.

Fig. S1.

seph mutant Zebrafish exhibit defects in organ development. (A) Sequence of seph mutant reveals the viral insertion in the 3′ UTR that displaces the SECIS regulatory element that is required for selenoprotein synthesis. (B) WISH analysis of seph expression in WT and seph mutants at 3 dpf. (Scale bar: 200 μm.) (C) Fluorescent imaging of WT and seph mutant larvae on a Tg(gata6:GFP) background at 5 dpf. (Scale bar: 200 μm.) (D) Fluorescent imaging of WT and seph mutant larvae on a Tg(fabp2:dsRed) background at 7 dpf. (Scale bar: 200 μm.) (E) WISH analysis of fabp10a (liver), trypsin (pancreas), and fabp2 (intestine) expression in WT and seph morphants (2 ng, ATG morpholino) at 3 dpf. (Scale bar: 200 μm.) (F) WISH of fabp10a (liver), trypsin (pancreas), and fabp2 (intestine) expression in WT and seph mutants at 3 dpf. (Scale bar: 200 μm.) (G) Morphological assessment illustrating the rescue of the seph mutant phenotype by the injection of SelH-GFP mRNA (GFP-SelH^Sec38Cys and SelH^Sec38Cys-GFP constructs) at the one-cell stage. (H) Quantitative determination of the rescue of the seph mutant phenotype by the injection of SelH-GFP mRNA (GFP-SelH^Sec38Cys and SelH^Sec38Cys-GFP constructs) at the one-cell stage.

Developmental defects in homozygous seph mutants begin to manifest morphologically by 3 d postfertilization (dpf), and the mutants lose viability by 12–14 dpf (Fig. 1B). At 5 dpf, seph mutants exhibit craniofacial defects with smaller eyes (microphthalmia), impaired yolk absorption, and an uninflated swim bladder (Fig. 1C). To examine the effect of SepH deficiency on endodermal organ development, we imaged seph mutants on transgenic reporter fish, highlighting the liver and exocrine pancreas [Tg(ela3l:GFP;fabp10a:dsRed)] at 5 dpf, which revealed dramatically impaired liver and pancreas development (Fig. 1C). Quantification of liver and pancreas fluorescence revealed that the seph mutant liver was ∼40% smaller than WT liver, whereas the pancreas was almost absent (Fig. 1 D and E). Similarly, we assessed organ development in Tg(gata6:GFP), which highlights endodermal organs, and Tg(fabp2:dsRed), which illuminates the intestinal epithelium of larvae, and this confirmed that seph mutants exhibit defects in intestinal development (Fig. S1 C and D).

To confirm that the loss of seph gene function induced by disruption of the SECIS element is responsible for the developmental defects, we injected an antisense morpholino targeting seph into WT embryos at the one-cell stage, which resulted in a morphant phenotype that recapitulates the seph mutant (Fig. S1E). Whole-mount in situ hybridization (WISH) analysis for fabp10a, trypsin, and fabp2 expression in seph morphants and mutants compared with WT larvae at 72 hpf revealed that seph plays a critical role in liver, pancreas, and gut formation (Fig. S1 E and F). To verify that loss of seph is responsible for the mutant phenotype, we performed a rescue experiment injecting seph mutant embryos with mRNA encoding GFP-labeled murine selenoprotein h (selh). We found that expression of either N- or C-terminal SelH-GFP fusion constructs (GFP-SelH^Sec38Cys or SelH^Sec38Cys-GFP) (32, 33) was sufficient to rescue the seph mutant phenotype in the vast majority of injected embryos (Fig. S1 G and H). Taken together, these experiments demonstrate that seph is an essential gene that plays a key role in endodermal organ development.

Metabolomic Characterization of seph Mutant Larvae Reveals That SepH Modulates Redox Homeostasis.

Given the central role of many selenoproteins in oxidative metabolism, we aimed to characterize the metabolic status of seph mutant larvae. Polar metabolites were extracted from WT and homozygous seph mutant larvae at 5 dpf and analyzed by targeted LC-MS/MS via selected reaction monitoring (SRM) (34). Hierarchical clustering based on metabolite abundance showed significant changes in steady-state levels of a small fraction of the metabolites that were enriched (fold enrichment represents the normalized number of metabolites overrepresented from a predefined metabolic pathway) in the urea cycle, pyrimidine biosynthesis, and methionine (Met) metabolism (Fig. 2 A and B). No significant changes in the abundance of reduced or oxidized glutathione were observed (Fig. S2A). seph mutants had reduced NAD⁺:NADH and NADP⁺:NADPH ratios, due in most part to the large reductions in the abundance of NAD⁺ and NADP⁺, respectively (Fig. 2C and Fig. S2B). Interestingly, the seph mutants showed a reduction in Met levels and a concomitant increase in the abundance of Met sulfoxide (MetSO) (Fig. 2D). Consequently, the Met:MetSO redox status was substantially disrupted in the seph mutant larvae (Fig. 2E). Furthermore, seph mutants exhibited a dramatic reduction in the abundance of the antioxidant ascorbic acid (vitamin C) (Fig. 2F). Given the imbalance of the Met:MetSO redox state, we measured MetSO reductase (Msr) activity (both MsrA and MsrB) in larval lysates. These analyses showed no difference between WT and seph mutants (Fig. S2C), suggesting elevated Met oxidation in the mutant. Collectively, these studies illustrate that SepH plays an important role in maintaining specific aspects of redox homeostasis related to ascorbate and Met metabolism.

Fig. 2.

Metabolomics reveals that SepH deficiency modulates redox homeostasis. (A) Clustergram analysis of polar metabolite abundance in WT and seph mutant larvae at 5 dpf as determined by LC-MS/MS via SRM analysis. n = 3. P < 0.05. (B) Metabolite set enrichment of polar metabolites in WT and seph mutant larvae as determined by SRM analysis. (C) Steady-state ratio of redox-related metabolites NAD⁺:NADH, and NADP⁺:NADPH in WT and seph mutant larvae at 5 dpf. (D) Steady-state abundance of Met (reduced) and MetSO (oxidized) in WT and seph mutant larvae at 5 dpf. n = 3. *P < 0.05. (E) Met:MetSO ratio in WT and seph mutant larvae at 5 dpf. n = 3. *P < 0.05. (F) Steady-state abundance of ascorbic acid in WT and seph mutant larvae at 5 dpf. n = 3. *P < 0.05.

Fig. S2.

Metabolomics reveals that SepH deficiency modulates redox homeostasis. (A) Steady-state abundance of glutathione (reduced) and glutathione disulfide (oxidized) in WT and seph mutant larvae at 5 dpf. n = 3. (B) Steady-state abundance of NAD⁺ and NADP⁺ in WT and seph mutant larvae at 5 dpf. n = 3. (C) Specific activity of MsrA and MsrB in larval lysates of WT and seph mutants at 5 dpf. n = 4.

SepH-Deficient Larvae Are Prone to Oxidative Stress.

To further assess the role of SepH in regulating reactive oxygen species during development, we visualized H₂O₂ generation in vivo using the boronate-based H₂O₂ probe, PF2. PF2 fluorescence was increased in homozygous seph mutant larvae at 5 dpf (Fig. 3 A and B). Fluorescence intensity was heterogeneous in distribution, but most apparent in the endodermal and head regions. seph mutants were extremely sensitive to menadione-induced oxidative stress, resulting in axis curvature and global edema (Fig. 3 C and D). Taken together, these studies demonstrate that seph mutants have impaired antioxidant defense.

Fig. 3.

SepH deficient larvae are prone to oxidative stress. (A) Fluorescent detection of H₂O₂ (PF2 fluorescence) in WT and seph mutant larvae at 5 dpf. (Scale bar: 200 μm.) (B) Quantification of H₂O₂ in WT and seph mutant larvae at 5 dpf. n = 5. **P < 0.01. (C) Morphological assessment of WT and seph mutant larvae exposed to menadione (1 μM) from 3 to 5 dpf. (Scale bar: 200 μm.) (D) Quantification of phenotype (unaffected, moderate, or severe) observed following menadione (1 μM) exposure from 3 to 5 dpf. Moderately affected larvae include minor defects, such as edema and tail curling, whereas severely affected larvae include major defects, such as widespread tissue necrosis (loss of transparency).

Transcriptomic Profiling Reveals That SepH Deficiency Provokes an Inflammatory Response and Activates the p53 Pathway.

To determine whether SepH deficiency causes a transcriptional response that contributes to the developmental phenotype, we performed global RNAseq on WT and homozygous seph mutant larvae at 5 dpf. Transcriptomic profiling of differentially expressed genes revealed that SepH deficiency causes widespread changes in gene expression (Fig. 4A and Fig. S3A). Transcriptome profiling also further determined the extent of organ defects, including severe reductions in endoderm/hepatic progenitors (sox17, prox1) and hepatic (fabp10a), intestinal (fabp2), and pancreatic (trypsin) transcripts, with no changes in kidney (cdh17)- or vessel (kdrl)-related transcripts (Fig. S3B). Supporting the metabolic data indicating defects in Met metabolism, Gene Set Enrichment Analysis (GSEA) identified that seph mutants express a gene set associated with Met deprivation (Fig. S3C). Interestingly, GSEA also revealed that SepH deficiency enhances the expression of inflammatory response genes, including tnfa, il-1b, il-11a, socs3b, and lifrb (Fig. 4 B and C and Fig. S3D). seph mutants also demonstrated a strong induction of p53 target genes, including tp53, mdm2, ccng1, and rps27l (Fig. 4D and Fig. S3E). The results of our transcriptome analysis support the idea that loss of SepH provokes an inflammatory response and activates the p53 pathway.

Fig. 4.

Transcriptomic profiling reveals that SepH deficiency provokes an inflammatory response and activates the p53 pathway. (A) Heatmap of statistically significant differential gene expression as determined by RNAseq between WT and seph mutant larvae at 5 dpf. n = 4. P < 0.05. (B) GSEA showing that the SepH deficiency is highly enriched in genes associated with an inflammatory response signature. ES, 0.67; NES, 2.41. P < 0.05. (C) qPCR expression analysis of specific genes associated with an inflammatory response (tnfa, il11a, socs3b, and lifrb) in WT and seph mutant larvae at 5 dpf. n = 3. *P < 0.05; ***P < 0.001. (D) qPCR expression analysis of specific genes associated with p53 activation (mdm2, ccng1, tp53, and rps27l) in WT and seph mutant larvae at 5 dpf. n = 3. *P < 0.05; **P < 0.01; ***P < 0.001.

Fig. S3.

Transcriptomic profiling reveals that SepH deficiency provokes an inflammatory response that activates the p53 pathway. (A) Expression of seph mRNA in WT and seph mutants at 5 dpf. n = 4. ****P < 0.0001. (B) Expression of specific genes associated with organ development (foxa3, sox17, prox1, fabp10a, fabp2, trypsin, cdh17, kdrl, and fli1a) in WT and seph mutant larvae at 5 dpf. n = 4. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. (C) GSEA showing that the SepH deficiency is highly enriched in genes associated with Met deprivation. ES, 0.60; NES, 2.27. P < 0.05. (D) Expression of specific genes associated with an inflammatory response (il1b and il11a) in WT and seph mutant larvae at 5 dpf. n = 4. *P < 0.05; **P < 0.01; ****P < 0.0001. (E) Expression of specific genes associated with p53 activation (mdm2 and rps27l) in WT and seph mutant larvae at 5 dpf. n = 4. ***P < 0.001; ****P < 0.0001.

SepH-Deficient Larvae Are Sensitive to DNA Damage.

Having observed that SepH deficiency activates a transcriptional p53 response, we tested whether p53 activation contributes to the developmental phenotype. Immunoblot analysis demonstrated dramatically elevated p53 levels in seph mutant larvae (Fig. 5A). To examine whether the cell cycle is affected, we performed whole-mount immunohistochemistry probing bromo-deoxyuridine (BrdU) incorporation, and found that seph mutants incorporate lower levels of BrdU (Fig. S4A). Consistent with cell cycle defects, FACS analysis demonstrated that seph mutants exhibit an increased number of cells in the G0 phase and a decreased number of cells in the S or G2/M phase (Fig. S4B).

Fig. 5.

seph mutants are sensitive to DNA damage. (A) Immunoblot analysis of p53 expression in WT and seph mutant larvae at 5 dpf. (B) Survival of WT and seph mutant larvae 2 dpe to UV irradiation (200 J/m², 7 dpf). n = 7. ****P < 0.0001. (C) Survival of WT and seph mutant larvae 2 dpe to camptothecin (1 μM). n = 10. ****P < 0.0001. (D) Morphological and histological analysis of WT, seph^−/− and tp53^−/−;seph^−/− mutant larvae at 5 dpf. The yellow dashed region represents the liver. The region of histology showing the larval liver is shown in the zoomed images. [Scale bars: 200 μm (brightfield; BF) and 50 μm (histology; H+E).] (E) Quantitative analysis of liver, pancreas, and gut area in WT, seph^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. n > 8. *P < 0.05; ****P < 0.0001.

Fig. S4.

p53 activation and cell cycle arrest contribute to the SepH-deficient phenotype. (A) Whole-mount immunohistochemical analysis of BrdU incorporation in WT and seph mutants at 5 dpf. Arrows point to clusters of BrdU-positive cells. (Scale bar: 200 μm.) (B) FACS analysis of the cell cycle in WT (blue) and seph mutants (red) at 5 dpf as determined by Hoechst staining (VioFL1). (C) qPCR expression analysis of specific genes associated with p53 activation (rps27l and mdm2) and an inflammatory response (tnfa and il11a) in WT and tp53^−/−;seph^−/− mutant larvae at 5 dpf. n = 3. **P < 0.01. (D) WISH analysis of fabp10a (liver), trypsin (pancreas), and fabp2 (intestine) expression in WT, seph^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. (Scale bar: 200 μm.)

We next examined the response of seph mutants to DNA damage after exposure to UV irradiation (200 J/m²) and found that they were highly sensitized compared with WT larvae, with 50% mortality at 2 d postexposure (dpe) (Fig. 5B). Consistent with this notion, SepH-deficient larvae also were very sensitive to exposure to the DNA-damaging agent camptothecin (1 μM), with an 80% drop in survival at 2 dpe (Fig. 5C). Taken together, these studies reveal that seph mutant larvae exhibit cell cycle defects and are prone to DNA-damaging agents.

Given the involvement of p53 in the defects observed in seph mutant larvae, we tested whether the seph mutant phenotype persists in the absence of p53. Crossing seph mutants onto a tp53^M214K mutant background partially rescued the seph mutant phenotype. At the gene expression level, the loss of p53 in tp53;seph compound mutant larvae suppresses activation of p53 target genes rps27l and mdm2; however, we still observed activation of inflammatory genes, such as tnfa and il11a (Fig. S4C). At the morphological level, the craniofacial, eye, and endodermal organ defects were less severe in tp53;seph compound mutant larvae compared with seph mutants (Fig. 5D). Deeper examination by WISH analysis demonstrated that the loss of p53 rescued liver and, to a lesser effect, gut development in tp53;seph compound mutant larvae, but had no effect on exocrine pancreas development (Fig. 5E and Fig. S4D).

To examine the brain defects, we determined the expression of the neuron-specific gene elavl3 by WISH and quantitative PCR (qPCR) and observed a dramatic reduction in seph mutants compared with WT larvae, and this reduction was not altered in tp53;seph compound mutant larvae (Fig. S5 A and B). Minor defects in cartilage development also were apparent in both seph and tp53;seph compound mutant larvae at 5 dpf (Fig. S5A). Histological analysis revealed that seph mutants exhibit hepatocyte ballooning and signs of cell death, which are markedly reduced in tp53;seph compound mutant larvae at 5 dpf (Fig. 5D). Further immunohistochemical analysis of the seph mutants established that cell proliferation (PCNA) in the liver is decreased concomitant with an increase in apoptosis (cleaved caspase-3), and that these effects are partially rescued in the tp53;seph compound mutant larvae (Fig. S5 C and D). Taken together, these studies reveal that loss of tp53 partially mitigates the developmental defects observed in seph mutant larvae.

Fig. S5.

The seph mutant phenotype is partially mitigated by loss of p53. (A) WISH analysis of elavl3 (neurons) expression and Alcian blue staining in WT, seph^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. (Scale bar: 200 μm.) (B) qPCR expression analysis of the neuron-specific gene elavl3 in WT, tp53^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. n = 3. **P < 0.01. (C) Immunohistochemical detection of PCNA (proliferation) from transverse sections from WT, seph^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. (Scale bar: 50 μm.) (D) Immunohistochemical detection of cleaved caspase-3 (apoptosis) from transverse sections from WT, seph^−/−, and tp53^−/−;seph^−/− mutant larvae at 5 dpf. (Scale bar: 50 μm.)

seph Genetically Interacts with p53 Deficiency to Accelerate GI Tumor Formation.

Having shown that SepH deficiency disrupts redox homeostasis, provokes an inflammatory response, and activates p53 in development, we next examined whether SepH plays an important role in suppressing tumor development. We exposed progeny of tp53^−/−;seph^+/− fish to the carcinogen dimethylbenzanthracene (DMBA) at 3 wk postfertilization and followed tumor development in the fish over a period of 1 y (Fig. 6A). In our analysis, we focused on GI tumor development, which became readily apparent because GI tumor-bearing fish have distended abdomens and on dissection reveal tumors that can be confirmed histologically and segregated by genotype (Fig. 6B). We analyzed GI tumor-free survival in this cohort of fish and found that SepH deficiency (heterozygous mutant) significantly accelerated tumor onset (Fig. 6C). By the end of the 1-y investigation, 29 of 58 (50%) tp53^−/−;seph^+/− fish harbored tumors, compared with 5 of 23 (22%) p53^−/− fish (P = 0.0344). Histological analysis of the tumors that developed identified 52% of the tp53^−/−;seph^+/− tumors as being of hepatic origin and 28% as being of pancreatic origin (Fig. 6D). Most of the liver tumors were hepatocellular carcinomas (HCCs) (Fig. S6A), whereas the majority of the pancreatic tumors were pancreatic acinar cell carcinomas (PACCs) (Fig. 6E and Fig. S6B). Here 21% of the tumors in the tp53^−/−;seph^+/− fish and 20% of the tumors in the tp53^−/− fish were malignant spindle cell neoplasms, most likely representing either malignant mixed neoplasms of the intestine and/or malignant peripheral nerve sheath tumors (MPNSTs) (Fig. 6E and Fig. S6C). Taken together, these studies show that loss of seph synergizes with loss of tp53 and the carcinogen DMBA in promoting carcinogenesis.

Fig. 6.

seph genetically interacts with p53 deficiency to accelerate GI tumor formation. (A) Scheme illustrating the protocol used to study DMBA-induced tumorigenesis. (B) Example of a GI tumor in a tp53^−/−;seph^+/− fish exposed to DMBA. (Scale bar: 2 mm.) (C) Kaplan–Meier analysis of Tumor-free survival in tp53^−/− and tp53^−/−;seph^+/− fish exposed to DMBA. n > 25 fish. P = 0.0344, Mantel–Cox log-rank test. (D) The incidence of pancreatic cancer, liver cancer, intestinal cancer, and malignant spindle cell neoplasm in tp53^−/− and tp53^−/−;seph^+/− fish exposed to DMBA. (E) Histological evaluation of GI tumors identified in tp53^−/−;seph^+/− fish showing examples of PACC, HCC, and malignant spindle cell neoplasm (MSCN). (Scale bar: 100 μm.)

Fig. S6.

seph genetically interacts with p53 deficiency to accelerate GI tumor formation. (A) Histological example of PACC in a tp53^−/−;seph^+/− fish. (Scale bar: 100 μm.) (B) Histological example of HCC in a tp53^−/−;seph^+/− fish. (Scale bar: 100 μm.) (C) Histological example of a malignant spindle cell neoplasm in a tp53^−/−;seph^+/− fish. (Scale bar: 100 μm.)

Discussion

The micronutrient selenium plays an essential role in human health, and its effects are mediated by incorporation, in the form of the 21st amino acid Sec, into 25 proteins that compose the human selenoproteome. Despite the extensive functional information for some members of the selenoproteome, such as thioredoxin reductases, glutathione peroxidases, thyroid hormone deodinases, and MetSO reductases, relatively little is known about several more recently identified selenoproteins, which has spurred inquiry into their biological functions (2). SepH is one such protein of unknown function, which is conserved in vertebrates, and its functional homologs are present across metazoa. Because of this conservation, zebrafish represent a particularly attractive model for examining SepH functions. In this study, we found that seph mutants exhibited impaired organ development and failed to survive into adulthood. seph mutants were susceptible to oxidative stress and showed defects in maintaining the redox state of Met and ascorbate. seph mutant larvae exhibited a sustained inflammatory response and activation of p53, which contributed to the embryonic phenotype. seph-haploinsufficient adult fish were more prone to developing GI tumors. Collectively, these studies identify unique aspects of SepH function in regulating organ development and tumorigenesis by maintaining redox homeostasis and suppressing DNA damage (Fig. S7). In light of these studies, we hypothesize that SepH deficiency is an important factor contributing to human pathophysiology associated with selenium deficiency.

Fig. S7.

Model of SepH function in the context of development and cancer. Se deficiency has previously been shown to reduce the abundance of SepH. In this study, we show that SepH deficiency impairs redox homeostasis, increasing ROS, provoking an inflammatory response and causing DNA damage with sustained activation of p53. In the absence of p53, SepH deficiency leads to genomic instability that promotes tumorigenesis.

Biological Features of SepH.

SepH is a recently identified 14-kDa thioredoxin fold-like protein with a conserved CXXU motif (5). Initial biochemical studies have shown that SepH is a nucleolus-localized oxidoreductase with glutathione peroxidase activity and a DNA-binding AT hook domain (32, 33). In vitro studies have shown that selenium depletion significantly decreases seph mRNA abundance (35), whereas selenite exposure up-regulates seph mRNA abundance (36). Selenium status tightly regulates seph mRNA abundance in mice to a greater extent than most other selenoproteins (37); for example, a selenium-deficient diet was found to cause a 60% reduction in seph mRNA abundance in murine liver, kidney, intestine, and splenic leukocytes owing to nonsense-mediated decay (37–40). Recent elegant studies reported by the Hatfield and Howard laboratories used ribosome profiling to reveal that dietary selenium differentially regulates selenoprotein expression in the liver, with gpx1, sepw1, and seph being the most sensitive to dietary selenium (30). In vivo expression studies in zebrafish have shown that seph mRNA is localized to proliferative zones of the central nervous system and brachial arches over the first 2 dpf (41). Parallel studies examining the Drosophila homolog of seph, known as BthD, have shown that the protein is expressed in the salivary gland during embryogenesis and in the adult ovary (42). Taken together, these studies highlight the integral role of selenium in regulating SepH abundance.

No studies of genetic SepH deficiency in vertebrate models have been reported to date, and the majority of the functional studies examining the biological role of SepH have been performed in cell culture. Overexpression of SEPH in cultured cells up-regulates enzymes associated with de novo glutathione synthesis, providing resistance to glutathione depletion (33). In a similar manner, SEPH overexpression protects cells from ultraviolet b (UV-B) irradiation by suppressing p53 activation (43, 44). At the molecular level, up-regulation of SEPH triggers an AKT-PKA-CREB pathway that culminates in the activation of PGC1α and NRF1, which stimulates mitochondrial biogenesis, leading to enhanced oxygen consumption and respiration (44–46). Conversely, knockdown of SEPH expression renders cancer cells susceptible to H₂O₂ (32). Recent work by Wu et al. (47) showed that SEPH knockdown causes oxidative stress, which inhibits proliferation and induces senescence in fibroblasts. In that study, the authors found that H₂O₂ exposure in SEPH-deficient cells provoked a sustained DNA damage response and senescence, which was inhibited by loss of ATM or p53 function. In our present study, we have defined the mechanism of SepH function in vivo and discovered that it regulates redox homeostasis and integrates a DNA damage response involving p53, which culminates in organ defects during development and a susceptibility to tumorigenesis in adulthood.

The Nucleolus as a Stress Sensor.

Our findings demonstrate that deficiency of the nucleolar protein SepH provokes an inflammatory stress response and activates p53. Recent studies support the emerging concept that the nucleolus acts as a stress sensor facilitating p53 activation (48). Previous studies have proposed the thought-provoking hypothesis that the diverse stimuli known to activate p53 share the ability to disrupt nucleoli; these studies show that DNA damage is not sufficient to activate p53, but instead that p53 activation depends on nucleolar disruption (49, 50). A number of nucleolar proteins, including PICT (51), RPL5 (52), RPL6 (53), RPL11 (54–56), RPL23 (57), RPL26 (58, 59), RPS6 (60), RPS7 (61, 62), RPS27L (63), NPM (64–66), and NCL (58, 59), regulate the MDM2-p53 pathway. Recent studies have shown that the 5S ribonucleoprotein particle (RNP), comprising RPL5, RNP11, and 5S rRNA, regulates p53 on ribosomal stress (67–69). Elegant studies using rps27l mutant mice have provided evidence that RPS27L regulates p53-suppressing genomic instability and tumorigenesis (63). In the present study, we have demonstrated that SepH deficiency leads to the induction of rps27l, consistent with nucleoli disruption. Consequently, our work further illuminates previous studies by providing evidence that SepH acts as a redox sensor that integrates oxidative stress to the nucleolar stress response pathway.

Zebrafish Models of Ribosomal and Nucleolar Stress.

Zebrafish has proven to be a useful model in which to examine the effect of ribosomal biogenesis and nucleolar stress in vivo. Zebrafish have been used to model several ribosomopathies, including Diamond–Blackfan anemia (DBA), dyskeratosis congenital (DC), and Shwachman–Bodian–Diamond syndrome (SBDS). Studies have shown that loss of rps19 (70–74), rps24 (75), rps29 (76), rpl11 (77–79), and rpl22 (80) lead to hematopoietic defects reminiscent of DBA. In many cases, the DNA damage response contributes to p53 activation in zebrafish models of DBA (71). Defects in genes linked to DC, such as nop10, lead to a p53-dependent loss of hematopoietic stem cells (81). The gene responsible for SBDS, which regulates ribosomal biogenesis, plays an essential role in pancreas development (82). Furthermore, ribosomal proteins are often enriched in endodermal organs, and many are required for pancreas development (83). For example, the nucleolar protein Nom1 plays a critical role in ribosomal biogenesis and pancreas development (84). The ribosomal biogenesis factors Bms1 and Wdr43 cause tissue-specific defects in endodermal and neural crest development, respectively (85, 86). Heath et al. (87) recently reported that loss of a critical component of the small subunit processome, pw2h, causes defects in ribosome biogenesis, leading to impaired organ development and induction of autophagy as a survival response. Groundbreaking work by Amsterdam et al. (88) has revealed that many genes encoding components of the ribosome act as haploinsufficient tumor suppressors in zebrafish. Follow-up studies have revealed that the MPNSTs that form from a loss of ribosomal genes exhibit a loss of p53 expression and are highly aneuploid (89–91). Recent work by Provost et al. (92) showed that ribosomal gene rpl36 restrains Kras^G12V-induced pancreatic cancer. Our study provides a different angle on the field by establishing a nucleolus-localized selenoprotein, SepH, which plays a critical role in regulating the nucleolar stress response in development and cancer. Taken together, these studies highlight the advantages of zebrafish as a model system for studying ribosome and nucleolar biology in the context of development and cancer.

Selenoproteins Play Essential Roles in Tissue Homeostasis and Cancer.

Our findings provide evidence that SepH exhibits a tumor-suppressor function in the context of carcinogen-induced tumorigenesis. The tumor-suppressive activity of SepH is consistent with its role in regulating redox homeostasis, inflammation, and DNA damage during embryonic development. SepH deficiency collaborates with a loss of p53 function to accelerate GI tumorigenesis. Interestingly, we found that SepH-deficient fish exhibited induction of inflammatory genes, such as tnfa and il11a, even in the absence of p53. Given the recently reported tumor-promoting effects of tnfa (93, 94) and il11 (95, 96), we suspect that inflammation plays an important role in SepH-deficient tumors. The spectrum of tumors that we observed in the SepH-deficient fish included PACC, HCC, cholangiocarcinoma, intestinal cancer, and malignant spindle cell neoplasms, which resemble the MPNSTs that arise spontaneously in tp53^M214K mutant zebrafish (97).

Previous studies using Sec transfer RNA (tRNA) (trsp)-deficient mice have greatly increased our understanding of selenoprotein function. Germline disruption of trsp in mice leads to early embryonic lethality (98). Tissue-specific loss of trsp in endothelial cells, skin cells, osteochondroprogenitor cells, or neurons leads to a panoply of defects that share such features as growth retardation, degeneration, and premature death (99–103). Liver-specific loss of trsp disrupts selenoprotein synthesis and causes liver necrosis and death (104). Selenoprotein deficiency in the liver activates the hepatoprotective Nrf2 response and increases susceptibility to diethylnitrosamine (DEN)-induced tumorigenesis (101, 105, 106). Similarly, hematopoietic-specific loss of selenoproteins leads to oxidative stress, hemolytic anemia, and sustained activation of Nrf2 (107, 108). Prostate-specific trsp KO mice exhibit prostate neoplasia, demonstrating that selenoproteins function as tumor suppressors in the murine prostate (109, 110). In a comparable manner, mammary gland- specific loss of trsp renders mice susceptible to DMBA-induced tumorigenesis (111).

Gpx1/2 double-KO mice exhibit bacteria-induced inflammation (colitis) that spontaneously drives intestinal tumor formation (112, 113). Gpx2 appears to play a complex role in colon carcinogenesis (114), where it inhibits inflammation-driven tumorigenesis (115), yet promotes growth of xenografted tumors (116). Loss of GPX2 leads to dedifferentiation of cells to a progenitor-like state (117). Conversely, overexpression of GPX2 leads to cell differentiation, with increased proliferation and tumor-forming potential (117). Selenium status has a complex role in mouse models of cancer, as demonstrated by studies showing that both selenium deficiency and selenium supplementation can reduce the tumor incidence in different mouse models (118, 119). Taken together, these studies shed light on the complexity of the relationship between selenium status and tumorigenesis, while emphasizing the essential function of selenoproteins in maintaining tissue homeostasis and suppressing tumorigenesis.

In conclusion, we have demonstrated that SepH regulates redox homeostasis and plays an essential role in organ development and tumor suppression. Given the potency by which SepH is regulated by selenium intake, we propose that SepH deficiency contributes to the deleterious phenotypes associated with selenium deficiency.

Experimental Procedures

Zebrafish Husbandry.

Zebrafish were maintained according to Harvard Medical School Institutional Animal Care and Use Committee, protocol #04626. The following lines were used in this study: WT (AB), seph^hi2737Tg (seph mutant), tp53^zdf1 (p53^M214K, loss of function) Tg(ela3l:EGFP;fabp10a:dsRed)^gz15, Tg(gata6:GFP)^ae5, and Tg(fabp2:dsRed)^zf129, as described previously (29, 97, 120–123).

Chemical Exposure.

Zebrafish larvae were exposed to menadione (1 μM), camptothecin (1 μM), and DMBA (5 ppm), as described above. When necessary, chemicals were dissolved in DMSO. Unless indicated otherwise, all chemicals were obtained from Cayman Chemicals or Sigma-Aldrich.

Morpholino Injection.

Morpholinos (GeneTools; PhiloMath) designed against the ATG and site of SepH (5′- CGAGTCGCCATTGCAGCAGCAACAA-3′) or scrambled controls were injected into AB embryos at the one-cell stage.

mRNA Rescue Experiment.

SelH-GFP mRNA was synthesized using previously described SelH^Sec38Cys-GFP or GFP-SelH^Sec38Cys mammalian expression constructs (32, 33) as templates in conjunction with primers containing a T7 promoter (GFP-SelH^Sec38Cys: forward primer, GGCTAATACGACTCACTATAGGATGGTGAGCAAGGGCGAGGA; reverse primer, GCTCTTTATGAAAGGTACTTCTTC; SelH^Sec38Cys-GFP: forward primer, GGCTAATACGACTCACTATAGCATGGCCCCCCACGGAAGAAAG; reverse primer, GCTTTACTTGTACAGCTCGTC). SelH^Sec38Cys-GFP or GFP-SelH^Sec38Cys mRNA was synthesized using the mMESSAGE mMACHINE T7 Kit (Ambion). GFP mRNA was synthesized using pCS2-GFP as a template with the mMESSAGE mMACHINE SP6 Transcription Kit (Ambion). Poly(A) tails were added to mRNA using the Poly(A) Tailing Kit (Ambion) according to the manufacturer’s instructions. GFP, SelH^Sec38Cys-GFP, or GFP-SelH^Sec38Cys mRNA (100 ng/μL) was injected into seph mutant embryos (200 pg/egg) at the one-cell stage. GFP-positive embryos were sorted at 1 dpf, and larvae were imaged at 5 dpf. Individual larvae were subsequently genotyped using a three-primer multiplex assay (5′-GAGCAGTTTAACAGTTTAGCAGCTTAAC-3′, 5′-CCATTGTTCAGTTCTGCTGTCAC-3′, and 5′-CTGTTCCATCTGTTCCTGAC-3′), which gave a 172-bp band (WT) and a 240-bp band (seph transgenic).

Whole-mount In Situ Hybridization.

Paraformaldehyde (PFA)-fixed larvae were processed for in situ hybridization according to standard zebrafish protocols (www.zfin.org). The following RNA probes were used: seph, fabp10a, fabp2, trypsin, and elav3. Expression patterns represent the average of >50 larvae per treatment. Alternatively, the area of staining was analyzed using Fiji as described previously (124).

Fluorescence Microscopy.

Fluorescent liver and pancreas reporter [Tg(ela3l:EGFP;fabp10a:dsRed)^gz15], endoderm [Tg(gata6:GFP)^ae5], or intestinal reporter [Tg(fabp2:dsRed)^zf129] larvae were put under anesthesia with 0.04 mg/mL Tricaine-S, and microscopy was performed. Larvae were imaged using a Zeiss Discovery V8/AxioCam MRc with the Axiovision software suite. Lightsheet microscopy was performed using a Zeiss Lightsheet Z.1 at the Harvard Center for Biological Imaging core. Fluorescent images were analyzed using Fiji as described previously (124).

Steady-State Metabolomics Analysis.

WT and seph mutant larvae were isolated at 5 dpf, and methanol extraction was performed. Polar metabolites were isolated and enriched using the methodology outlined by Yuan et al. (34). Metabolite fractions were collected and analyzed by targeted LC-MS/MS via SRM with positive/negative ion polarity switching using a QTRAP (quadrupole-linear ion trap) 5500 hybrid triple quadrupole mass spectrometer (AB Sciex).

RNA Transcriptomic Analysis.

WT and seph mutant larvae were isolated at 5 dpf, and RNA was extracted with TRIzol (Life Technologies) according to the manufacturer’s instructions. RNA quality was checked using an Agilent 2100 Bioanalyzer. Sequencing was performed after library construction on an Illumina HiSeq. polyA sequence data were annotated on the ZV9 genomic assembly to identify differentially affected genes (125). Gene Ontology and GSEA of biological processes were determined by GAGE (Gene Ontology Consortium) (126).

qRT-PCR.

RNA was isolated from pooled zebrafish larvae using TRIzol. After DNase treatment, cDNA was synthesized using the SuperScript III First-Strand Synthesis Kit (Life Technologies). qRT-PCR was performed on biological triplicates using an iCycler with iQ SYBR Green (Bio-Rad). Gene expression was analyzed with ef1a as the reference gene (Table S1).

Table S1.

Primers used for qPCR

qPCR primer	Zebrafish gene	Forward primer	Reverse primer	Reference study
Control	ef1a	GCGTCATCAAGAGCGTTGAG	TTGGAACGGTGTGATTGAGG	(130)
p53 pathway	tp53	TGGAGAGGAGGTCGGCAAAATCAA	GACTGCGGGAACCTGAGCCTAAAT	(131)
p53 pathway	ccng1	GTGCGGAGACGTTTTCCTT	AAGACAGATGCTTGGGCTGA	(87)
p53 pathway	mdm2	TGACAACGAGAAACTGGTAAGA	AAACATAACCTCCTTCATGGT	(87)
p53 pathway	rps27l	GACTCACTGAGGGTTGCTCT	CCTGCCACACATCGCTCATA	This study
Inflammation	tnfa	AAGGAGAGTTGCCTTTACCGC	CGTGCAGATTGAGCGGATTG	(132)
Inflammation	il11a	CCGGTTCAAGTCTCTTCCAG	AGGTTTGCATGGAGCTGAGA	(133)
Inflammation	socs3b	CCAAGATTGAGTCGGATAACG	GAAATGATGTCTCGGTGGGTA	(133)
Inflammation	lifrb	TTCTGGCGCATCAGTATTTTT	GCTGAGGTCCCGTGTGATAC	(133)
Brain	elavl3	GTCAGAAAGACATGGAGCAGTTG	GAACCGAATGAAACCTACCCC	(134)

H₂O₂ Detection.

H₂O₂ generation was examined in 5 dpf WT and seph mutant larvae by exposure to 5 μM peroxyfluor-2 (PF2) (127) for 1 h at 28 °C. After incubation, PF2-loaded larvae were washed, and fluorescence was imaged.

MSR Activity Assay.

MsrA and MsrB activity was assayed from 5 dpf WT and seph mutant larval lysates (500 μg) as described previously (128). In brief, the reductions of dabsylated Met-R-SO and dabsylated Met-S-SO by lysates in the presence of NADPH were quantified by HPLC.

BrdU Incorporation Assay.

Proliferation was assessed in zebrafish larvae using whole-mount immunohistochemistry to examine the incorporation of BrdU. Larvae were immersed in 200 μg/mL BrdU (B-5002; Sigma-Aldrich) for 4 h before fixation. Larvae were processed for whole-mount immunohistochemistry, probed with anti-BrdU (Roche; clone 9318), and visualized using HRP-conjugated secondary coupled with a 3,3'-diaminobenzidine (DAB) substrate kit.

DNA Content Analysis.

The cell cycle was examined in disaggregated zebrafish larvae at 5 dpf by FACS analysis of DNA content. Larvae were disaggregated by mechanical disruption with a small pestle in a tube in 200 μL of PBS (10 larvae/tube). Cells were strained through a 35-μM nylon mesh, stained with 10 μg/mL Hoechst 33342, and incubated in the dark for 30 min before FACS analysis. DNA content (VioFL1) of individual cells defined the G0/G1 phase (n), the G2/M phase (2n), and the S phase (intermediate).

Alcian Blue Staining.

PFA-fixed 5 dpf larvae were bleached in H₂O₂, stained in Alcian blue solution [1% HCl, 70% (vol/vol) ethanol, 0.1% Alcian blue] overnight, and rinsed in acidic ethanol.

Histology.

PFA-fixed fish were paraffin-embedded, cut into serial sections, and stained with hematoxylin and eosin using standard techniques.

Immunohistochemistry.

Fixed tissue embedded in paraffin was serially sectioned before immunohistochemical analysis. Slides were deparaffinized and rehydrated before heat-induced antigen retrieval. Antigens were detected using primary antibodies, such as anti-PCNA (Anaspec; AS-55421) and anti-cleaved caspase-3 (Abcam; ab13847), in conjunction with an HRP/DAB (ABC) detection kit (Abcam; ab64264) according to the manufacturer’s instructions (R&D Systems).

Immunoblot Analysis.

Larval extracts were prepared from 5 dpf WT and seph mutant larvae. Lysates were resolved by SDS/PAGE and transferred electrophoretically onto nitrocellulose. Membranes were probed with anti-p53 (Abcam; ab77813) or anti–β-actin (Cell Signaling Technology; 4967) overnight and then detected with secondary antibody conjugated with HRP. Antibody complexes were visualized by enhanced chemiluminescence using X-ray film.

DMBA-Induced Carcinogenesis.

Here 3-wk-old p53^−/− and p53^−/−;SepH^+/− fry were exposed to DMBA dissolved in DMSO for 24 h, as described previously (129). The next day, the fry were rinsed several times in aquarium water before being returned to the aquarium tanks. Fish were monitored closely for gastrointestinal tumor development over the next 12 mo (excluding fish with ocular tumors). Fish with distended abdomens were dissected, and tumors were confirmed and diagnosed by histological analysis by two independent pathologists (K.J.E. and J.R.H.), who were blinded to the fish genotype.